#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCF7L2	6934	broad.mit.edu	37	10	114920448	114920448	+	Intron	SNP	C	C	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr10:114920448C>A	ENST00000355995.4	+	14	1949				TCF7L2_ENST00000369397.4_Intron|TCF7L2_ENST00000369389.1_Intron|TCF7L2_ENST00000352065.5_Intron|TCF7L2_ENST00000536810.1_Intron|TCF7L2_ENST00000545257.1_Nonsense_Mutation_p.C480*|TCF7L2_ENST00000355717.4_Intron|TCF7L2_ENST00000538897.1_Intron|TCF7L2_ENST00000543371.1_Nonsense_Mutation_p.C463*|TCF7L2_ENST00000369386.1_3'UTR|TCF7L2_ENST00000542695.1_Intron|TCF7L2_ENST00000466338.1_Intron			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)						blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.C463*(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GCAAACCGTGCAGGTATATTA	0.438			T	VTI1A	colorectal																																p.C440X			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1320A	10						.						65.0	54.0	57.0					10																	114920448		1568	3582	5150	114910438	SO:0001627	intron_variant	6934	exon12			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1442+697C>A	10.37:g.114920448C>A			114910438	NM_001198526	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Nonsense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	C	42	9.621729	0.99221	.	.	ENSG00000148737	ENST00000545257;ENST00000543371	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4669	0.94946	0.0:1.0:0.0:0.0	.	.	.	.	X	480;463	.	ENSP00000444972:C463X	C	+	3	2	TCF7L2	114910438	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.305000	0.78891	2.667000	0.90743	0.655000	0.94253	TGC		0.438	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
C10orf71	118461	broad.mit.edu	37	10	50532509	50532509	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr10:50532509G>A	ENST00000374144.3	+	3	2207	c.1919G>A	c.(1918-1920)cGc>cAc	p.R640H	C10orf71_ENST00000323868.4_Missense_Mutation_p.R640H			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	640								p.R640H(1)		endometrium(1)	1						AGGGAACACCGCCCCAGGAAA	0.567																																					p.R640H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1919A	10						.						22.0	25.0	24.0					10																	50532509		1927	4138	6065	50202515	SO:0001583	missense	118461	exon3			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.1919G>A	10.37:g.50532509G>A	ENSP00000363259:p.Arg640His		50202515	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177390	0.38413	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.14640	2.49;3.63	5.74	-8.43	0.00953	.	1.678220	0.03807	N	0.265309	T	0.05273	0.0140	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.30966	-0.9960	10	0.36615	T	0.2	.	3.2074	0.06671	0.4408:0.0739:0.1165:0.3688	.	640	Q711Q0-3	.	H	640	ENSP00000318713:R640H;ENSP00000363259:R640H	ENSP00000318713:R640H	R	+	2	0	C10orf71	50202515	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-0.430000	0.06973	-1.621000	0.01562	-1.057000	0.02308	CGC		0.567	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
ZCCHC24	219654	broad.mit.edu	37	10	81146152	81146152	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr10:81146152G>C	ENST00000372336.3	-	4	861	c.675C>G	c.(673-675)caC>caG	p.H225Q	ZCCHC24_ENST00000372333.3_Missense_Mutation_p.P166A|RP11-342M3.5_ENST00000438554.2_RNA	NM_153367.3	NP_699198.2	Q8N2G6	ZCH24_HUMAN	zinc finger, CCHC domain containing 24	225							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.H225Q(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)	9						TCTCGCAGAGGTGCTGCGGGT	0.692																																					p.H225Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C675G	10						.						49.0	43.0	45.0					10																	81146152		2203	4300	6503	80816158	SO:0001583	missense	219654	exon4			AK075279	CCDS7359.1	10q22.3	2014-02-20	2008-06-23	2008-06-23	ENSG00000165424	ENSG00000165424		"""Zinc fingers, CCHC domain containing"""	26911	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 8"""		"""chromosome 10 open reading frame 56"""	C10orf56		12477932	Standard	NM_153367		Approved	FLJ90798, Z3CXXC8	uc010qlr.2	Q8N2G6	OTTHUMG00000018561	ENST00000372336.3:c.675C>G	10.37:g.81146152G>C	ENSP00000361411:p.His225Gln		80816158	NM_153367	Q5U5T9|Q8TAG0	Missense_Mutation	SNP	ENST00000372336.3	37	CCDS7359.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.86|14.86	2.660923|2.660923	0.47572|0.47572	.|.	.|.	ENSG00000165424|ENSG00000165424	ENST00000372336|ENST00000372333	T|.	0.20598|.	2.06|.	5.63|5.63	1.76|1.76	0.24704|0.24704	.|.	0.164158|.	0.53938|.	D|.	0.000044|.	T|T	0.30198|0.30198	0.0757|0.0757	L|L	0.29908|0.29908	0.895|0.895	0.24162|0.24162	N|N	0.99566|0.99566	D|P	0.61697|0.47841	0.99|0.901	P|P	0.56343|0.45276	0.796|0.475	T|T	0.11941|0.11941	-1.0567|-1.0567	10|8	0.27785|0.87932	T|D	0.31|0	-14.8859|-14.8859	9.7651|9.7651	0.40557|0.40557	0.4056:0.0:0.5944:0.0|0.4056:0.0:0.5944:0.0	.|.	225|166	Q8N2G6|Q5W133	ZCH24_HUMAN|.	Q|A	225|166	ENSP00000361411:H225Q|.	ENSP00000361411:H225Q|ENSP00000361408:P166A	H|P	-|-	3|1	2|0	ZCCHC24|ZCCHC24	80816158|80816158	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.980000|0.980000	0.70556|0.70556	1.878000|1.878000	0.39608|0.39608	0.341000|0.341000	0.23771|0.23771	-0.136000|-0.136000	0.14681|0.14681	CAC|CCT		0.692	ZCCHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048947.1	NM_153367	
JAKMIP3	282973	broad.mit.edu	37	10	133931042	133931042	+	Silent	SNP	C	C	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr10:133931042C>A	ENST00000298622.4	+	2	735	c.597C>A	c.(595-597)cgC>cgA	p.R199R		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	199						Golgi apparatus (GO:0005794)		p.R199R(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		AGATCACCCGCATCAAGAAgg	0.687																																					p.R199R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C597A	10						.						17.0	20.0	19.0					10																	133931042		2062	4193	6255	133781032	SO:0001819	synonymous_variant	282973	exon2			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.597C>A	10.37:g.133931042C>A			133781032	NM_001105521	A6PW00|Q69YM6|Q6ZT29	Silent	SNP	ENST00000298622.4	37	CCDS44494.1																																																																																				0.687	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
OR4S2	219431	broad.mit.edu	37	11	55419161	55419161	+	Missense_Mutation	SNP	C	C	T	rs201389134	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr11:55419161C>T	ENST00000312422.2	+	1	782	c.782C>T	c.(781-783)aCg>aTg	p.T261M		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T261M(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				CGCCCTGATACGACCTTTTCA	0.453													c|||	2	0.000399361	0.0	0.0014	5008	,	,		14163	0.0		0.0	False		,,,				2504	0.001				p.T261M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C782T	11						.						157.0	136.0	144.0					11																	55419161		2180	4027	6207	55175737	SO:0001583	missense	219431	exon1			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.782C>T	11.37:g.55419161C>T	ENSP00000310337:p.Thr261Met		55175737	NM_001004059	Q6IF72	Missense_Mutation	SNP	ENST00000312422.2	37	CCDS31505.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.675	0.903752	0.17760	.	.	ENSG00000174982	ENST00000312422	T	0.00123	8.7	5.35	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	0.481200	0.19147	N	0.121552	T	0.00178	0.0005	M	0.87097	2.86	0.09310	N	1	P	0.46277	0.875	B	0.37422	0.249	T	0.41215	-0.9521	10	0.72032	D	0.01	.	1.9359	0.03337	0.1425:0.4551:0.2245:0.1779	.	261	Q8NH73	OR4S2_HUMAN	M	261	ENSP00000310337:T261M	ENSP00000310337:T261M	T	+	2	0	OR4S2	55175737	0.000000	0.05858	0.025000	0.17156	0.432000	0.31715	-2.405000	0.01045	0.633000	0.30452	0.542000	0.68232	ACG		0.453	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391503.1	NM_001004059	
MS4A7	58475	broad.mit.edu	37	11	60150732	60150732	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr11:60150732G>A	ENST00000300184.3	+	2	314	c.118G>A	c.(118-120)Ggg>Agg	p.G40R	MS4A7_ENST00000534016.1_Missense_Mutation_p.G40R|MS4A7_ENST00000358246.1_Missense_Mutation_p.G40R|MS4A7_ENST00000530234.2_Missense_Mutation_p.G40R|MS4A14_ENST00000531787.1_Intron	NM_021201.4|NM_206939.1	NP_067024.1|NP_996822.1	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member 7	40						integral component of membrane (GO:0016021)		p.G40R(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(8)|ovary(1)|skin(1)	20						CCTGCAGAACGGGCTGCCAAC	0.438																																					p.G40R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G118A	11						.						88.0	73.0	78.0					11																	60150732		2203	4300	6503	59907308	SO:0001583	missense	58475	exon2			AB026043	CCDS7985.1, CCDS7986.1	11q12	2008-03-25				ENSG00000166927			13378	protein-coding gene	gene with protein product		606502				11245982, 11401424	Standard	NM_021201		Approved	CD20L4, CFFM4, MS4A8	uc001npf.3	Q9GZW8		ENST00000300184.3:c.118G>A	11.37:g.60150732G>A	ENSP00000300184:p.Gly40Arg		59907308	NM_206938	A6NP53|Q6IAG8	Missense_Mutation	SNP	ENST00000300184.3	37	CCDS7985.1	.	.	.	.	.	.	.	.	.	.	G	5.724	0.317993	0.10845	.	.	ENSG00000166927	ENST00000300184;ENST00000358246;ENST00000534016;ENST00000530614;ENST00000530027;ENST00000530234;ENST00000528215	T;T;T;T;T;T;T	0.75589	3.23;2.26;2.26;2.35;2.75;0.92;-0.95	3.8	-1.81	0.07882	.	1.505000	0.04313	N	0.349316	T	0.58736	0.2143	L	0.32530	0.975	0.09310	N	1	B;B;B	0.24132	0.029;0.098;0.071	B;B;B	0.18871	0.005;0.023;0.011	T	0.32025	-0.9922	10	0.31617	T	0.26	-41.3672	2.6925	0.05125	0.3312:0.0:0.3239:0.345	.	40;40;40	E9PIV6;Q9GZW8-2;Q9GZW8	.;.;MS4A7_HUMAN	R	40;40;40;40;40;40;11	ENSP00000300184:G40R;ENSP00000350983:G40R;ENSP00000434637:G40R;ENSP00000433861:G40R;ENSP00000434819:G40R;ENSP00000433184:G40R;ENSP00000431408:G11R	ENSP00000300184:G40R	G	+	1	0	MS4A7	59907308	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.070000	0.11523	-0.348000	0.08286	-0.181000	0.13052	GGG		0.438	MS4A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394299.1		
SPTBN2	6712	broad.mit.edu	37	11	66461711	66461711	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr11:66461711C>T	ENST00000533211.1	-	22	4733	c.4402G>A	c.(4402-4404)Gag>Aag	p.E1468K	SPTBN2_ENST00000529997.1_Missense_Mutation_p.E1468K|SPTBN2_ENST00000309996.2_Missense_Mutation_p.E1468K			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1468					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)	p.E1468K(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTGAACTTCTCCTCCACGGCC	0.647											OREG0021113	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E1468K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4402A	11						.						66.0	62.0	63.0					11																	66461711		2200	4295	6495	66218287	SO:0001583	missense	6712	exon21			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.4402G>A	11.37:g.66461711C>T	ENSP00000432568:p.Glu1468Lys	1092	66218287	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	C	16.98	3.270901	0.59540	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.50813	0.73;0.73;0.73	4.63	4.63	0.57726	.	0.054711	0.64402	D	0.000001	T	0.33411	0.0862	N	0.20483	0.58	0.46542	D	0.999097	B	0.14012	0.009	B	0.14023	0.01	T	0.09729	-1.0661	10	0.18710	T	0.47	.	16.4261	0.83815	0.0:1.0:0.0:0.0	.	1468	O15020	SPTN2_HUMAN	K	1468	ENSP00000432568:E1468K;ENSP00000311489:E1468K;ENSP00000433593:E1468K	ENSP00000311489:E1468K	E	-	1	0	SPTBN2	66218287	1.000000	0.71417	1.000000	0.80357	0.358000	0.29455	1.718000	0.38001	2.397000	0.81536	0.563000	0.77884	GAG		0.647	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
C11orf65	160140	broad.mit.edu	37	11	108276210	108276210	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr11:108276210C>T	ENST00000529391.1	-	5	515	c.506G>A	c.(505-507)aGg>aAg	p.R169K	C11orf65_ENST00000525729.1_Missense_Mutation_p.R120K|C11orf65_ENST00000526725.1_5'UTR|C11orf65_ENST00000393084.1_Missense_Mutation_p.R169K			Q8NCR3	CK065_HUMAN	chromosome 11 open reading frame 65	169								p.R169K(1)		endometrium(1)|large_intestine(3)|lung(4)|ovary(2)	10		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		CAAATCTTGCCTTCTCTTCAG	0.333																																					p.R169K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G506A	11						.						136.0	131.0	132.0					11																	108276210		2201	4298	6499	107781420	SO:0001583	missense	160140	exon6			BC059411	CCDS8340.1	11q22.3	2012-05-30			ENSG00000166323	ENSG00000166323			28519	protein-coding gene	gene with protein product						12477932	Standard	NM_152587		Approved	MGC33948	uc001pkh.3	Q8NCR3	OTTHUMG00000166489	ENST00000529391.1:c.506G>A	11.37:g.108276210C>T	ENSP00000436400:p.Arg169Lys		107781420	NM_152587	B4DZU4|Q6PCA8	Missense_Mutation	SNP	ENST00000529391.1	37	CCDS8340.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.37|11.37	1.620021|1.620021	0.28801|0.28801	.|.	.|.	ENSG00000166323|ENSG00000166323	ENST00000524755|ENST00000525729;ENST00000529391;ENST00000393084;ENST00000533583	.|T;T;T;T	.|0.30714	.|1.52;1.52;1.52;1.52	5.18|5.18	0.924|0.924	0.19418|0.19418	.|.	.|0.202543	.|0.43747	.|N	.|0.000533	T|T	0.12305|0.12305	0.0299|0.0299	N|N	0.11698|0.11698	0.16|0.16	0.25878|0.25878	N|N	0.983624|0.983624	.|B;B	.|0.13594	.|0.008;0.008	.|B;B	.|0.17722	.|0.019;0.019	T|T	0.23691|0.23691	-1.0181|-1.0181	5|10	.|0.12766	.|T	.|0.61	-10.5936|-10.5936	4.6611|4.6611	0.12643|0.12643	0.1575:0.5666:0.0:0.276|0.1575:0.5666:0.0:0.276	.|.	.|120;169	.|B4DZU4;Q8NCR3	.|.;CK065_HUMAN	S|K	1|120;169;169;151	.|ENSP00000433395:R120K;ENSP00000436400:R169K;ENSP00000376799:R169K;ENSP00000434500:R151K	.|ENSP00000376799:R169K	G|R	-|-	1|2	0|0	C11orf65|C11orf65	107781420|107781420	0.977000|0.977000	0.34250|0.34250	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	0.032000|0.032000	0.13732|0.13732	0.662000|0.662000	0.31006|0.31006	0.563000|0.563000	0.77884|0.77884	GGC|AGG		0.333	C11orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390010.3	NM_152587	
STAB2	55576	broad.mit.edu	37	12	104126874	104126874	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr12:104126874G>T	ENST00000388887.2	+	51	5578	c.5374G>T	c.(5374-5376)Gct>Tct	p.A1792S		NM_017564.9	NP_060034.9			stabilin 2									p.A1792S(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TGCCCTACCTGCTGAACAACA	0.488																																					p.A1792S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5374T	12						.						234.0	192.0	206.0					12																	104126874		2203	4300	6503	102651004	SO:0001583	missense	55576	exon51			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5374G>T	12.37:g.104126874G>T	ENSP00000373539:p.Ala1792Ser		102651004	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	37	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	G	1.582	-0.531258	0.04112	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.90676	-2.71	5.11	-10.2	0.00374	FAS1 domain (5);	1.795730	0.02935	N	0.139688	T	0.79476	0.4452	L	0.28556	0.865	0.09310	N	1	B	0.21309	0.054	B	0.22386	0.039	T	0.65389	-0.6180	10	0.08599	T	0.76	.	4.8672	0.13615	0.3654:0.0898:0.409:0.1357	.	1792	Q8WWQ8	STAB2_HUMAN	S	1792;479	ENSP00000373539:A1792S	ENSP00000258495:A479S	A	+	1	0	STAB2	102651004	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.464000	0.06688	-4.342000	0.00055	-1.475000	0.01000	GCT		0.488	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
SLC2A13	114134	broad.mit.edu	37	12	40265611	40265611	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr12:40265611C>T	ENST00000280871.4	-	5	1237	c.1187G>A	c.(1186-1188)gGt>gAt	p.G396D		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	396					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.G377D(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TGCTAAACTACCAAAGGTAAG	0.383										HNSCC(50;0.14)																											p.G396D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1187A	12						.						56.0	55.0	55.0					12																	40265611		2203	4300	6503	38551878	SO:0001583	missense	114134	exon5			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1187G>A	12.37:g.40265611C>T	ENSP00000280871:p.Gly396Asp		38551878	NM_052885	Q17S07	Missense_Mutation	SNP	ENST00000280871.4	37	CCDS8736.2	.	.	.	.	.	.	.	.	.	.	C	17.95	3.514299	0.64522	.	.	ENSG00000151229	ENST00000280871	T	0.74315	-0.83	5.48	5.48	0.80851	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.85340	0.5674	M	0.78049	2.395	0.80722	D	1	D	0.54207	0.965	P	0.60886	0.88	D	0.83606	0.0131	10	0.36615	T	0.2	-13.8066	19.7151	0.96113	0.0:1.0:0.0:0.0	.	396	Q96QE2	MYCT_HUMAN	D	396	ENSP00000280871:G396D	ENSP00000280871:G396D	G	-	2	0	SLC2A13	38551878	0.998000	0.40836	0.998000	0.56505	0.986000	0.74619	3.624000	0.54231	2.742000	0.94016	0.650000	0.86243	GGT		0.383	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132849.2		
ANKRD33	341405	broad.mit.edu	37	12	52282866	52282866	+	Missense_Mutation	SNP	G	G	A	rs145080334		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr12:52282866G>A	ENST00000340970.4	+	3	378	c.7G>A	c.(7-9)Gca>Aca	p.A3T	ANKRD33_ENST00000301190.6_Missense_Mutation_p.A138T|ANKRD33_ENST00000538991.1_Intron|ANKRD33_ENST00000547119.1_3'UTR			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33	3					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.A138T(1)		endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		CCTCATGGTCGCATGCTACCA	0.602																																					p.A3T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7A	12						.	G	THR/ALA,THR/ALA	0,4406		0,0,2203	93.0	98.0	96.0		7,412	4.0	0.7	12	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ANKRD33	NM_001130015.1,NM_182608.3	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	3/273,138/453	52282866	1,13005	2203	4300	6503	50569133	SO:0001583	missense	341405	exon3				CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.7G>A	12.37:g.52282866G>A	ENSP00000344690:p.Ala3Thr		50569133	NM_001130015	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Missense_Mutation	SNP	ENST00000340970.4	37	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180550	0.57800	0.0	1.16E-4	ENSG00000167612	ENST00000301190;ENST00000340970	T;T	0.81163	-1.46;-1.46	3.98	3.98	0.46160	Ankyrin repeat-containing domain (3);	0.000000	0.64402	D	0.000001	D	0.91781	0.7400	H	0.94886	3.595	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	D	0.93610	0.6938	10	0.72032	D	0.01	-14.8396	13.417	0.60974	0.0:0.0:1.0:0.0	.	3;138	Q7Z3H0;Q7Z3H0-2	ANR33_HUMAN;.	T	138;3	ENSP00000301190:A138T;ENSP00000344690:A3T	ENSP00000301190:A138T	A	+	1	0	ANKRD33	50569133	1.000000	0.71417	0.702000	0.30337	0.065000	0.16274	8.232000	0.89796	2.211000	0.71520	0.462000	0.41574	GCA		0.602	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608	
MYO1A	4640	broad.mit.edu	37	12	57423263	57423263	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr12:57423263C>T	ENST00000442789.2	-	27	3120	c.2833G>A	c.(2833-2835)Gtc>Atc	p.V945I	MYO1A_ENST00000544473.1_Missense_Mutation_p.V783I|TAC3_ENST00000415231.1_5'Flank|MYO1A_ENST00000300119.3_Missense_Mutation_p.V945I	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	945	Myosin tail. {ECO:0000255}.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.V945I(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						AGGCTGGTGACTGACACCCCA	0.542																																					p.V945I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2833A	12						.						107.0	102.0	103.0					12																	57423263		2203	4300	6503	55709530	SO:0001583	missense	4640	exon26			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.2833G>A	12.37:g.57423263C>T	ENSP00000393392:p.Val945Ile		55709530	NM_005379	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	37	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	C	18.17	3.563482	0.65651	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.38722	1.12;1.12;1.12	4.48	3.6	0.41247	Myosin tail 2 (1);	0.000000	0.85682	D	0.000000	T	0.63082	0.2481	M	0.85542	2.76	0.39867	D	0.973457	D	0.57899	0.981	D	0.71870	0.975	T	0.66952	-0.5793	10	0.62326	D	0.03	.	8.1979	0.31407	0.0:0.8916:0.0:0.1084	.	945	Q9UBC5	MYO1A_HUMAN	I	945;945;783	ENSP00000300119:V945I;ENSP00000393392:V945I;ENSP00000440514:V783I	ENSP00000300119:V945I	V	-	1	0	MYO1A	55709530	1.000000	0.71417	0.998000	0.56505	0.501000	0.33797	5.667000	0.68067	1.119000	0.41883	0.460000	0.39030	GTC		0.542	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379	
TMEM132D	121256	broad.mit.edu	37	12	129822265	129822265	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr12:129822265A>G	ENST00000422113.2	-	4	1539	c.1213T>C	c.(1213-1215)Tac>Cac	p.Y405H		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	405					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.Y405H(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCTCCGGGGTACTCGACCTGC	0.587																																					p.Y405H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1213C	12						.						154.0	134.0	141.0					12																	129822265		2203	4300	6503	128388218	SO:0001583	missense	121256	exon4			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1213T>C	12.37:g.129822265A>G	ENSP00000408581:p.Tyr405His		128388218	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002511	0.74932	.	.	ENSG00000151952	ENST00000422113	T	0.22134	1.97	5.31	5.31	0.75309	.	0.338722	0.25078	N	0.033320	T	0.51652	0.1687	M	0.87180	2.865	0.33671	D	0.610882	D	0.76494	0.999	D	0.85130	0.997	T	0.70092	-0.4967	9	.	.	.	-12.3022	13.8833	0.63693	1.0:0.0:0.0:0.0	.	405	Q14C87	T132D_HUMAN	H	405	ENSP00000408581:Y405H	.	Y	-	1	0	TMEM132D	128388218	1.000000	0.71417	0.744000	0.31058	0.676000	0.39594	6.120000	0.71596	2.006000	0.58801	0.529000	0.55759	TAC		0.587	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
FREM2	341640	broad.mit.edu	37	13	39454540	39454540	+	Missense_Mutation	SNP	G	G	T	rs368021911		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr13:39454540G>T	ENST00000280481.7	+	24	9342	c.9126G>T	c.(9124-9126)aaG>aaT	p.K3042N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	3042					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K3042N(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTCAAGGAAAGCCCCAATCCA	0.478																																					p.K3042N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9126T	13						.						106.0	100.0	102.0					13																	39454540		2203	4300	6503	38352540	SO:0001583	missense	341640	exon24			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.9126G>T	13.37:g.39454540G>T	ENSP00000280481:p.Lys3042Asn		38352540	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	4.823	0.152965	0.09185	.	.	ENSG00000150893	ENST00000280481	T	0.19394	2.15	5.95	0.471	0.16752	.	0.778125	0.12606	N	0.454282	T	0.08670	0.0215	N	0.16478	0.41	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33904	-0.9850	10	0.16896	T	0.51	.	0.2601	0.00217	0.237:0.1827:0.2604:0.3199	.	3042	Q5SZK8	FREM2_HUMAN	N	3042	ENSP00000280481:K3042N	ENSP00000280481:K3042N	K	+	3	2	FREM2	38352540	0.000000	0.05858	0.092000	0.20876	0.557000	0.35523	0.089000	0.15002	0.370000	0.24538	0.563000	0.77884	AAG		0.478	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
KLHL1	57626	broad.mit.edu	37	13	70535456	70535456	+	Silent	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr13:70535456G>C	ENST00000377844.4	-	3	1560	c.801C>G	c.(799-801)gtC>gtG	p.V267V	KLHL1_ENST00000545028.1_Silent_p.V74V	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	267	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)	p.V267V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ATGCAAATTGGACAAGGTCCC	0.373																																					p.V267V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C801G	13						.						141.0	126.0	131.0					13																	70535456		2203	4300	6503	69433457	SO:0001819	synonymous_variant	57626	exon3			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.801C>G	13.37:g.70535456G>C			69433457	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	37	CCDS9445.1																																																																																				0.373	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
SYNE2	23224	broad.mit.edu	37	14	64586324	64586324	+	Silent	SNP	T	T	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr14:64586324T>C	ENST00000344113.4	+	67	13232	c.13020T>C	c.(13018-13020)gaT>gaC	p.D4340D	SYNE2_ENST00000555002.1_Silent_p.D974D|SYNE2_ENST00000358025.3_Silent_p.D4340D|SYNE2_ENST00000357395.3_Silent_p.D725D|SYNE2_ENST00000553455.1_Silent_p.D59D|SYNE2_ENST00000554584.1_Silent_p.D4355D|SYNE2_ENST00000394768.2_Silent_p.D725D|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4340					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.D4340D(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACAGTGAAGATCAGGTAAAAA	0.428																																					p.D4340D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T13020C	14						.						58.0	53.0	55.0					14																	64586324		2203	4300	6503	63656077	SO:0001819	synonymous_variant	23224	exon67			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13020T>C	14.37:g.64586324T>C			63656077	NM_015180	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																				0.428	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
HCN4	10021	broad.mit.edu	37	15	73635946	73635946	+	Missense_Mutation	SNP	G	G	A	rs370442588		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr15:73635946G>A	ENST00000261917.3	-	2	1982	c.989C>T	c.(988-990)cCg>cTg	p.P330L	RP11-272D12.1_ENST00000558742.1_RNA|RP11-272D12.1_ENST00000557981.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	330					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.P330L(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		AATCCGCTGCGGGTCCAGGAT	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		21961	0.001		0.0	False		,,,				2504	0.0				p.P330L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C989T	15						.	G	LEU/PRO	0,4396		0,0,2198	95.0	80.0	85.0		989	5.3	1.0	15		85	1,8593	1.2+/-3.3	0,1,4296	no	missense	HCN4	NM_005477.2	98	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	330/1204	73635946	1,12989	2198	4297	6495	71422999	SO:0001583	missense	10021	exon2			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.989C>T	15.37:g.73635946G>A	ENSP00000261917:p.Pro330Leu		71422999	NM_005477	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240049	0.79912	0.0	1.16E-4	ENSG00000138622	ENST00000261917	D	0.95103	-3.61	5.34	5.34	0.76211	Ion transport (1);	.	.	.	.	D	0.97164	0.9073	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97445	1.0024	9	0.72032	D	0.01	.	19.4036	0.94640	0.0:0.0:1.0:0.0	.	330	Q9Y3Q4	HCN4_HUMAN	L	330	ENSP00000261917:P330L	ENSP00000261917:P330L	P	-	2	0	HCN4	71422999	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	9.678000	0.98647	2.657000	0.90304	0.655000	0.94253	CCG		0.493	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
FBXO22	26263	broad.mit.edu	37	15	76225330	76225330	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr15:76225330C>T	ENST00000308275.3	+	7	1204	c.1099C>T	c.(1099-1101)Cgg>Tgg	p.R367W	FBXO22_ENST00000540507.1_Missense_Mutation_p.R263W	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	367					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)	p.R367W(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TGGATGTGATCGGATAGTCAC	0.383																																					p.R367W												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C1099T	15						.						164.0	166.0	165.0					15																	76225330		2197	4294	6491	74012385	SO:0001583	missense	26263	exon7			AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.1099C>T	15.37:g.76225330C>T	ENSP00000307833:p.Arg367Trp		74012385	NM_147188	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Missense_Mutation	SNP	ENST00000308275.3	37	CCDS10287.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.583421	0.86748	.	.	ENSG00000167196	ENST00000308275;ENST00000540507	.	.	.	5.82	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.47303	0.1438	L	0.36672	1.1	0.80722	D	1	B	0.29955	0.263	B	0.20767	0.031	T	0.49762	-0.8905	9	0.87932	D	0	-16.6146	14.195	0.65664	0.0:0.9284:0.0:0.0716	.	367	Q8NEZ5	FBX22_HUMAN	W	367;263	.	ENSP00000307833:R367W	R	+	1	2	FBXO22	74012385	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	7.219000	0.78000	1.464000	0.47987	0.655000	0.94253	CGG		0.383	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286477.2	NM_147188	
IL32	9235	broad.mit.edu	37	16	3119162	3119162	+	Missense_Mutation	SNP	G	G	A	rs538977484		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr16:3119162G>A	ENST00000534507.1	+	6	722	c.511G>A	c.(511-513)Ggg>Agg	p.G171R	IL32_ENST00000528163.2_Missense_Mutation_p.G125R|IL32_ENST00000526464.2_Missense_Mutation_p.G125R|IL32_ENST00000008180.9_Missense_Mutation_p.G105R|IL32_ENST00000529550.1_Missense_Mutation_p.G125R|IL32_ENST00000551513.1_Missense_Mutation_p.G162R|IL32_ENST00000382213.3_Missense_Mutation_p.G116R|IL32_ENST00000551122.1_Intron|IL32_ENST00000444393.3_Missense_Mutation_p.G125R|IL32_ENST00000530538.2_Missense_Mutation_p.G125R|IL32_ENST00000525643.2_Missense_Mutation_p.G125R|IL32_ENST00000552664.1_Missense_Mutation_p.G125R|IL32_ENST00000325568.5_Missense_Mutation_p.G125R|IL32_ENST00000552936.1_Missense_Mutation_p.G149R|IL32_ENST00000440815.3_Missense_Mutation_p.G125R|IL32_ENST00000552356.1_Missense_Mutation_p.G105R|IL32_ENST00000548246.1_Missense_Mutation_p.G85R|IL32_ENST00000396890.2_Missense_Mutation_p.G171R|IL32_ENST00000533097.2_Missense_Mutation_p.G125R|IL32_ENST00000549213.1_Intron|IL32_ENST00000531965.1_Missense_Mutation_p.G115R|IL32_ENST00000548652.1_Missense_Mutation_p.G116R|IL32_ENST00000530890.1_Missense_Mutation_p.G105R|IL32_ENST00000529699.1_Missense_Mutation_p.G105R|IL32_ENST00000548476.1_Missense_Mutation_p.G171R|IL32_ENST00000396887.3_Intron|RNU1-125P_ENST00000516752.1_RNA			P24001	IL32_HUMAN	interleukin 32	171					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)		p.G125R(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CTGGTGGCACGGGGTTCTGGC	0.597																																					p.G125R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G373A	16						.						19.0	23.0	22.0					16																	3119162		2192	4275	6467	3059163	SO:0001583	missense	9235	exon7			M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.511G>A	16.37:g.3119162G>A	ENSP00000431775:p.Gly171Arg		3059163	NM_004221	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Missense_Mutation	SNP	ENST00000534507.1	37		.	.	.	.	.	.	.	.	.	.	G	3.626	-0.076578	0.07184	.	.	ENSG00000008517	ENST00000325568;ENST00000534507;ENST00000531965;ENST00000529699;ENST00000526464;ENST00000440815;ENST00000529550;ENST00000525643;ENST00000548807;ENST00000528163;ENST00000530890;ENST00000444393;ENST00000533097;ENST00000008180;ENST00000396890;ENST00000525228;ENST00000548652;ENST00000530538;ENST00000552936;ENST00000548476;ENST00000552664;ENST00000552356;ENST00000551513;ENST00000382213;ENST00000548246	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.73575	-0.76;0.78;0.78;-0.06;-0.76;-0.76;-0.76;-0.76;0.78;-0.76;0.78;-0.76;-0.76;0.78;0.78;-0.76;-0.76;-0.76;0.78;0.78;-0.76;0.78;0.78;-0.76;0.78	1.89	-3.78	0.04333	.	.	.	.	.	T	0.45276	0.1334	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001;0.001	T	0.10268	-1.0637	9	0.32370	T	0.25	.	1.3663	0.02202	0.366:0.142:0.3492:0.1428	.	85;105;116;105;171;125	B8Q191;C6GKH1;A6NNM0;A8MPX0;P24001;P24001-2	.;.;.;.;IL32_HUMAN;.	R	125;171;115;105;125;125;125;125;171;125;105;125;125;105;171;96;116;125;149;171;125;105;162;116;85	ENSP00000324742:G125R;ENSP00000431775:G171R;ENSP00000433177:G115R;ENSP00000436937:G105R;ENSP00000450364:G125R;ENSP00000405063:G125R;ENSP00000437020:G125R;ENSP00000432218:G125R;ENSP00000448354:G171R;ENSP00000432850:G125R;ENSP00000433747:G105R;ENSP00000411958:G125R;ENSP00000432917:G125R;ENSP00000008180:G105R;ENSP00000380099:G171R;ENSP00000431740:G96R;ENSP00000446624:G116R;ENSP00000436929:G125R;ENSP00000447033:G149R;ENSP00000449483:G171R;ENSP00000448683:G125R;ENSP00000446978:G105R;ENSP00000449147:G162R;ENSP00000371648:G116R;ENSP00000447979:G85R	ENSP00000008180:G105R	G	+	1	0	IL32	3059163	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.036000	0.03560	-2.265000	0.00688	-1.690000	0.00728	GGG		0.597	IL32-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000394812.2	NM_004221	
KIAA0556	23247	broad.mit.edu	37	16	27689071	27689071	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr16:27689071C>T	ENST00000261588.4	+	7	581	c.562C>T	c.(562-564)Ctt>Ttt	p.L188F	KIAA0556_ENST00000567894.1_3'UTR|CTD-2049O4.1_ENST00000564893.1_RNA	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	188						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L188F(2)		breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AAGCCTGGAACTTAGTGTAAA	0.413																																					p.L188F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C562T	16						.						44.0	40.0	41.0					16																	27689071		2197	4300	6497	27596572	SO:0001583	missense	23247	exon7			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.562C>T	16.37:g.27689071C>T	ENSP00000261588:p.Leu188Phe		27596572	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155937	0.57259	.	.	ENSG00000047578	ENST00000261588;ENST00000327217	T	0.49432	0.78	5.48	4.53	0.55603	.	0.178230	0.39615	N	0.001309	T	0.44767	0.1309	M	0.67953	2.075	0.32560	N	0.531194	B;B	0.24186	0.099;0.019	B;B	0.22753	0.041;0.022	T	0.54715	-0.8252	10	0.40728	T	0.16	.	10.0823	0.42397	0.0:0.9075:0.0:0.0925	.	96;188	Q8N803;O60303	.;K0556_HUMAN	F	188;95	ENSP00000261588:L188F	ENSP00000261588:L188F	L	+	1	0	KIAA0556	27596572	0.591000	0.26824	0.660000	0.29694	0.810000	0.45777	0.855000	0.27805	1.311000	0.45024	0.655000	0.94253	CTT		0.413	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
IRX6	79190	broad.mit.edu	37	16	55361233	55361233	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr16:55361233C>T	ENST00000290552.7	+	3	1661	c.329C>T	c.(328-330)gCt>gTt	p.A110V	IRX6_ENST00000558315.1_3'UTR|RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	110					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.A110V(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TTTAAGGAGGCTGCAGGGAGT	0.517																																					p.A110V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C329T	16						.						71.0	71.0	71.0					16																	55361233		2198	4300	6498	53918734	SO:0001583	missense	79190	exon3			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.329C>T	16.37:g.55361233C>T	ENSP00000290552:p.Ala110Val		53918734	NM_024335	B2RN06|Q7Z2K0	Missense_Mutation	SNP	ENST00000290552.7	37	CCDS32449.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.317195	0.60524	.	.	ENSG00000159387	ENST00000290552	D	0.90004	-2.6	5.55	4.6	0.57074	.	0.481161	0.24001	N	0.042479	D	0.83073	0.5175	L	0.50333	1.59	0.09310	N	0.999999	B;P	0.44734	0.02;0.842	B;B	0.35114	0.017;0.196	T	0.77948	-0.2396	10	0.62326	D	0.03	-2.6163	9.798	0.40746	0.1289:0.6009:0.2701:0.0	.	110;9	P78412;Q9BZI2	IRX6_HUMAN;.	V	110	ENSP00000290552:A110V	ENSP00000290552:A110V	A	+	2	0	IRX6	53918734	0.979000	0.34478	0.253000	0.24343	0.950000	0.60333	2.431000	0.44775	1.582000	0.49881	0.655000	0.94253	GCT		0.517	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417445.4	NM_024335	
NIP7	51388	broad.mit.edu	37	16	69373742	69373742	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr16:69373742T>G	ENST00000254940.5	+	1	410	c.10T>G	c.(10-12)Ttg>Gtg	p.L4V	COG8_ENST00000306875.4_5'Flank|NIP7_ENST00000254941.6_Missense_Mutation_p.L4V|RP11-343C2.7_ENST00000564737.1_Intron|NIP7_ENST00000569637.2_Missense_Mutation_p.L4V|RP11-343C2.9_ENST00000563634.1_Intron|COG8_ENST00000562081.1_5'Flank	NM_016101.4	NP_057185.1	Q9Y221	NIP7_HUMAN	NIP7, nucleolar pre-rRNA processing protein	4	N-terminal domain.				ribosome assembly (GO:0042255)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.L4V(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Ovarian(137;0.101)				AATGCGGCCTTTGACTGAAGA	0.602											OREG0023907	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L4V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T10G	16						.						133.0	153.0	147.0					16																	69373742		2198	4300	6498	67931243	SO:0001583	missense	51388	exon1			AB112439	CCDS10877.1, CCDS56003.1	16q22.1	2013-03-04	2013-03-04		ENSG00000132603	ENSG00000132603			24328	protein-coding gene	gene with protein product			"""nuclear import 7 homolog (S. cerevisiae)"""			14660641, 22195017	Standard	NM_016101		Approved	CGI-37, FLJ10296, HSPC031, KD93	uc002exa.3	Q9Y221	OTTHUMG00000137568	ENST00000254940.5:c.10T>G	16.37:g.69373742T>G	ENSP00000254940:p.Leu4Val	1114	67931243	NM_016101	B2RD04|Q9NZZ0	Missense_Mutation	SNP	ENST00000254940.5	37	CCDS10877.1	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444825	0.43429	.	.	ENSG00000132603	ENST00000254940;ENST00000254941	.	.	.	5.58	-1.45	0.08828	.	0.000000	0.64402	D	0.000001	D	0.83220	0.5207	H	0.94847	3.59	0.58432	D	0.999998	D;D	0.76494	0.999;0.993	D;D	0.71414	0.973;0.941	D	0.85039	0.0922	9	0.87932	D	0	-0.6882	12.0393	0.53444	0.0:0.7105:0.0:0.2895	.	4;4	Q9Y221-2;Q9Y221	.;NIP7_HUMAN	V	4	.	ENSP00000254940:L4V	L	+	1	2	NIP7	67931243	0.004000	0.15560	0.981000	0.43875	0.955000	0.61496	-0.054000	0.11826	-0.206000	0.10203	0.374000	0.22700	TTG		0.602	NIP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268947.2	NM_016101	
SLC7A5	8140	broad.mit.edu	37	16	87866620	87866620	+	Missense_Mutation	SNP	C	C	T	rs200265403		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr16:87866620C>T	ENST00000261622.4	-	10	1545	c.1480G>A	c.(1480-1482)Gtc>Atc	p.V494I	SLC7A5_ENST00000565644.1_Missense_Mutation_p.V228I	NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	494					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.V494I(1)		endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	TGACACAGGACGGTCGTGGAG	0.642																																					p.V494I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1480A	16						.	C	ILE/VAL	2,4394	4.2+/-10.8	0,2,2196	144.0	150.0	148.0		1480	5.2	0.0	16		148	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SLC7A5	NM_003486.5	29	0,3,6495	TT,TC,CC		0.0116,0.0455,0.0231	benign	494/508	87866620	3,12993	2198	4300	6498	86424121	SO:0001583	missense	8140	exon10			AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.1480G>A	16.37:g.87866620C>T	ENSP00000261622:p.Val494Ile		86424121	NM_003486	Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Missense_Mutation	SNP	ENST00000261622.4	37	CCDS10964.1	.	.	.	.	.	.	.	.	.	.	C	6.231	0.410820	0.11812	4.55E-4	1.16E-4	ENSG00000103257	ENST00000261622	D	0.90900	-2.75	5.2	5.2	0.72013	.	0.201135	0.40385	N	0.001116	T	0.81307	0.4795	N	0.10874	0.06	0.09310	N	0.999997	B	0.16603	0.018	B	0.08055	0.003	T	0.65117	-0.6246	10	0.22109	T	0.4	.	15.8928	0.79312	0.0:1.0:0.0:0.0	.	494	Q01650	LAT1_HUMAN	I	494	ENSP00000261622:V494I	ENSP00000261622:V494I	V	-	1	0	SLC7A5	86424121	0.997000	0.39634	0.023000	0.16930	0.020000	0.10135	3.679000	0.54634	2.434000	0.82447	0.462000	0.41574	GTC		0.642	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269110.2	NM_003486	
MYH2	4620	broad.mit.edu	37	17	10441055	10441055	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr17:10441055T>G	ENST00000245503.5	-	15	1898	c.1514A>C	c.(1513-1515)aAg>aCg	p.K505T	MYH2_ENST00000397183.2_Missense_Mutation_p.K505T|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|MYH2_ENST00000532183.2_Missense_Mutation_p.K505T|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	505	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.K505T(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GCCTTCCTTCTTGTACTCCTC	0.493																																					p.K505T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1514C	17						.						197.0	165.0	176.0					17																	10441055		2203	4300	6503	10381780	SO:0001583	missense	4620	exon15				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1514A>C	17.37:g.10441055T>G	ENSP00000245503:p.Lys505Thr		10381780	NM_001100112	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.4|28.4	4.913225|4.913225	0.92178|0.92178	.|.	.|.	ENSG00000125414|ENSG00000214970	ENST00000532183;ENST00000245503;ENST00000397183|ENST00000399342	D;D;D|.	0.87809|.	-2.3;-2.3;-2.3|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Myosin head, motor domain (2);|.	0.000000|.	0.41097|.	U|.	0.000958|.	T|T	0.75686|0.75686	0.3883|0.3883	M|M	0.75884|0.75884	2.315|2.315	0.58432|0.58432	D|D	0.999995|0.999995	D;P|.	0.63046|.	0.992;0.864|.	D;D|.	0.85130|.	0.997;0.947|.	T|T	0.79120|0.79120	-0.1934|-0.1934	10|6	0.87932|0.87932	D|D	0|0	.|.	14.8155|14.8155	0.70031|0.70031	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	505;505|.	Q567P6;Q9UKX2|.	.;MYH2_HUMAN|.	T|V	505|43	ENSP00000433944:K505T;ENSP00000245503:K505T;ENSP00000380367:K505T|.	ENSP00000245503:K505T|ENSP00000382280:L43V	K|L	-|+	2|1	0|2	MYH2|AC005323.1	10381780|10381780	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.970000|7.970000	0.88000|0.88000	2.105000|2.105000	0.64084|0.64084	0.533000|0.533000	0.62120|0.62120	AAG|TTG		0.493	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
MYH3	4621	broad.mit.edu	37	17	10541369	10541369	+	Silent	SNP	C	C	T	rs377201866		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr17:10541369C>T	ENST00000583535.1	-	27	3807	c.3720G>A	c.(3718-3720)tcG>tcA	p.S1240S	MYH3_ENST00000226209.7_Silent_p.S1240S	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1240					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.S1240S(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CCTTAGATTTCGACACACTCT	0.547													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18150	0.0		0.0	False		,,,				2504	0.0				p.S1240S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3720A	17						.	A		1,4405		0,1,2202	90.0	88.0	88.0		3720	-10.7	0.4	17		88	0,8600		0,0,4300	no	coding-synonymous	MYH3	NM_002470.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1240/1941	10541369	1,13005	2203	4300	6503	10482094	SO:0001819	synonymous_variant	4621	exon26				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3720G>A	17.37:g.10541369C>T			10482094	NM_002470	Q15492	Silent	SNP	ENST00000583535.1	37	CCDS11157.1																																																																																				0.547	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
ZNF286A	57335	broad.mit.edu	37	17	15619398	15619398	+	Silent	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr17:15619398G>A	ENST00000464847.2	+	5	913	c.360G>A	c.(358-360)aaG>aaA	p.K120K	ZNF286A_ENST00000580259.1_3'UTR|ZNF286A_ENST00000581529.1_3'UTR|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000583566.1_Silent_p.K120K|ZNF286A_ENST00000413242.2_Silent_p.K120K|ZNF286A_ENST00000593105.1_Silent_p.K110K|ZNF286A_ENST00000395894.2_3'UTR|ZNF286A_ENST00000472486.1_3'UTR|ZNF286A_ENST00000421016.1_Silent_p.K120K			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K120K(1)		central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		CACAGAGCAAGGATTCAACTT	0.393																																					p.K120K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G360A	17						.						76.0	72.0	73.0					17																	15619398		2203	4299	6502	15560123	SO:0001819	synonymous_variant	57335	exon6			AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.360G>A	17.37:g.15619398G>A			15560123	NM_001130842	B4DKF9|Q96JF3	Silent	SNP	ENST00000464847.2	37	CCDS11172.1																																																																																				0.393	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652	
KRTAP1-3	81850	broad.mit.edu	37	17	39190779	39190779	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr17:39190779T>C	ENST00000344363.5	-	1	328	c.295A>G	c.(295-297)Agt>Ggt	p.S99G		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	109						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)	p.S99G(2)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ACAGCTCCACTGCTGCCCTCC	0.652																																					p.S99G												.	.	2	Substitution - Missense(2)	lung(1)|kidney(1)	c.A295G	17						.						17.0	22.0	21.0					17																	39190779		2007	4147	6154	36444305	SO:0001583	missense	81850	exon1			AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.295A>G	17.37:g.39190779T>C	ENSP00000344420:p.Ser99Gly		36444305	NM_030966	Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	ENST00000344363.5	37	CCDS42323.1	.	.	.	.	.	.	.	.	.	.	T	12.64	1.997470	0.35226	.	.	ENSG00000221880	ENST00000344363	T	0.38077	1.16	4.93	-9.87	0.00470	.	.	.	.	.	T	0.25754	0.0627	.	.	.	0.09310	N	0.999999	B	0.29253	0.239	B	0.34038	0.174	T	0.43956	-0.9359	8	0.59425	D	0.04	.	10.9204	0.47161	0.1862:0.0:0.0722:0.7416	.	109	Q8IUG1	KRA13_HUMAN	G	99	ENSP00000344420:S99G	ENSP00000344420:S99G	S	-	1	0	KRTAP1-3	36444305	0.028000	0.19301	0.006000	0.13384	0.225000	0.24961	0.193000	0.17116	-1.956000	0.01022	-0.302000	0.09304	AGT		0.652	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257687.1		
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0 	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CDC27	996	broad.mit.edu	37	17	45219311	45219311	+	Missense_Mutation	SNP	T	T	C	rs140737545		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr17:45219311T>C	ENST00000066544.3	-	12	1552	c.1459A>G	c.(1459-1461)Att>Gtt	p.I487V	CDC27_ENST00000446365.2_Missense_Mutation_p.I426V|CDC27_ENST00000531206.1_Missense_Mutation_p.I493V|CDC27_ENST00000527547.1_Missense_Mutation_p.I486V	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	487					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TGGCTCAAAATATTTATAGCT	0.383																																					p.I493V												.	.	0			c.A1477G	17						.						112.0	118.0	116.0					17																	45219311		2203	4299	6502	42574310	SO:0001583	missense	996	exon12			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1459A>G	17.37:g.45219311T>C	ENSP00000066544:p.Ile487Val		42574310	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	4.731	0.135890	0.09032	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.92	3.6	0.41247	.	0.089833	0.85682	D	0.000000	T	0.53384	0.1793	L	0.31476	0.935	0.49798	D	0.999821	B;B;B;B	0.23316	0.05;0.083;0.083;0.024	B;B;B;B	0.17098	0.008;0.017;0.017;0.005	T	0.44590	-0.9318	10	0.02654	T	1	-23.2923	6.9274	0.24422	0.0:0.0792:0.1504:0.7704	.	426;486;493;487	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	V	487;493;426;486	ENSP00000066544:I487V;ENSP00000434614:I493V;ENSP00000392802:I426V;ENSP00000437339:I486V	ENSP00000066544:I487V	I	-	1	0	CDC27	42574310	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.907000	0.63300	1.072000	0.40860	0.528000	0.53228	ATT		0.383	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
RNF152	220441	broad.mit.edu	37	18	59483681	59483681	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr18:59483681delG	ENST00000312828.3	-	2	1115	c.16delC	c.(16-18)cagfs	p.Q6fs		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	6					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q6fs*37(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				AGAGAGTCCTGGGACAGCGTC	0.587																																					p.Q6fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.16delC	18						.						72.0	73.0	72.0					18																	59483681		2203	4300	6503	57634661	SO:0001589	frameshift_variant	220441	exon2			AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.16delC	18.37:g.59483681delG	ENSP00000316628:p.Gln6fs		57634661	NM_173557	B3KV99|Q52LA4	Frame_Shift_Del	DEL	ENST00000312828.3	37	CCDS11978.1																																																																																				0.587	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	NM_173557	
UNC13A	23025	broad.mit.edu	37	19	17753746	17753746	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr19:17753746C>T	ENST00000519716.2	-	20	2379	c.2380G>A	c.(2380-2382)Gtg>Atg	p.V794M	UNC13A_ENST00000552293.1_Missense_Mutation_p.V794M|UNC13A_ENST00000550896.1_Missense_Mutation_p.V792M|UNC13A_ENST00000551649.1_Missense_Mutation_p.V794M|UNC13A_ENST00000252773.7_Missense_Mutation_p.V794M|UNC13A_ENST00000428389.2_Missense_Mutation_p.V882M	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	794					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.V794M(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GCACCCGACACGGCAGATTTG	0.512																																					p.V794M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2380A	19						.						46.0	47.0	47.0					19																	17753746		1968	4142	6110	17614746	SO:0001583	missense	23025	exon19			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2380G>A	19.37:g.17753746C>T	ENSP00000429562:p.Val794Met		17614746	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	37	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024125	0.54683	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67;-0.67;-0.67	3.46	2.41	0.29592	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000004	T	0.82098	0.4963	M	0.82630	2.6	0.45427	D	0.998407	D	0.89917	1.0	D	0.80764	0.994	T	0.81675	-0.0825	10	0.87932	D	0	-17.8307	8.6969	0.34301	0.0:0.8802:0.0:0.1198	.	794	Q9UPW8	UN13A_HUMAN	M	794;882;794;794;794;792	ENSP00000429562:V794M;ENSP00000400409:V882M;ENSP00000252773:V794M;ENSP00000447236:V794M;ENSP00000447572:V794M;ENSP00000446831:V792M	ENSP00000252773:V794M	V	-	1	0	UNC13A	17614746	1.000000	0.71417	0.012000	0.15200	0.632000	0.37999	7.545000	0.82128	0.573000	0.29400	0.313000	0.20887	GTG		0.512	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
FAM187B	148109	broad.mit.edu	37	19	35718939	35718939	+	Silent	SNP	G	G	A	rs13382163		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr19:35718939G>A	ENST00000324675.3	-	1	693	c.645C>T	c.(643-645)taC>taT	p.Y215Y		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	215						integral component of membrane (GO:0016021)		p.Y215Y(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						CAAAAATGACGTAATCCACCC	0.537																																					p.Y215Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C645T	19						.						99.0	82.0	88.0					19																	35718939		2203	4300	6503	40410779	SO:0001819	synonymous_variant	148109	exon1			AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.645C>T	19.37:g.35718939G>A			40410779	NM_152481	Q8N7G6	Silent	SNP	ENST00000324675.3	37	CCDS12448.1																																																																																				0.537	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378854.1	NM_152481	
MARK4	57787	broad.mit.edu	37	19	45774884	45774884	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr19:45774884C>T	ENST00000262891.4	+	8	1035	c.704C>T	c.(703-705)cCg>cTg	p.P235L	MARK4_ENST00000300843.4_Missense_Mutation_p.P235L	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	235	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)	p.P235L(1)		NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TACGACGGGCCGGAGGTGGAC	0.637																																					p.P235L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C704T	19						.						63.0	66.0	65.0					19																	45774884		2203	4300	6503	50466724	SO:0001583	missense	57787	exon8			AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.704C>T	19.37:g.45774884C>T	ENSP00000262891:p.Pro235Leu		50466724	NM_001199867	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803328	0.90623	.	.	ENSG00000007047	ENST00000262893;ENST00000262891;ENST00000300843	T;T	0.65364	-0.15;-0.15	4.37	4.37	0.52481	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71307	0.3324	L	0.39245	1.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;1.0;1.0	T	0.74771	-0.3552	10	0.87932	D	0	.	14.4482	0.67367	0.0:1.0:0.0:0.0	.	101;235;235	Q8N2N5;Q96L34;Q96L34-2	.;MARK4_HUMAN;.	L	265;235;235	ENSP00000262891:P235L;ENSP00000300843:P235L	ENSP00000262891:P235L	P	+	2	0	MARK4	50466724	1.000000	0.71417	0.990000	0.47175	0.959000	0.62525	7.601000	0.82783	2.273000	0.75805	0.561000	0.74099	CCG		0.637	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
SLC17A7	57030	broad.mit.edu	37	19	49933893	49933893	+	Silent	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr19:49933893G>A	ENST00000221485.3	-	12	1737	c.1566C>T	c.(1564-1566)agC>agT	p.S522S	SLC17A7_ENST00000543531.1_Silent_p.S510S|SLC17A7_ENST00000600601.1_Silent_p.S455S	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	522					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)	p.S522S(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CCTCCATTTCGCTGTCGTCAC	0.657																																					p.S522S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1566T	19						.						44.0	38.0	40.0					19																	49933893		2201	4299	6500	54625705	SO:0001819	synonymous_variant	57030	exon12			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.1566C>T	19.37:g.49933893G>A			54625705	NM_020309	B4DFR9|B4DG46|Q6PCD0	Silent	SNP	ENST00000221485.3	37	CCDS12764.1																																																																																				0.657	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2		
OR7G3	390883	broad.mit.edu	37	19	9237177	9237177	+	Silent	SNP	G	G	A	rs529517536		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr19:9237177G>A	ENST00000305444.2	-	1	449	c.450C>T	c.(448-450)atC>atT	p.I150I		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I150I(1)		NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						GGACACTAACGATGAAGGACA	0.493													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22123	0.0		0.0	False		,,,				2504	0.0				p.I150I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C450T	19						.						75.0	71.0	72.0					19																	9237177		2203	4300	6503	9098177	SO:0001819	synonymous_variant	390883	exon1				CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.450C>T	19.37:g.9237177G>A			9098177	NM_001001958	Q6IFJ6|Q96R99	Silent	SNP	ENST00000305444.2	37	CCDS32899.1																																																																																				0.493	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1		
MYH14	79784	broad.mit.edu	37	19	50794219	50794219	+	Missense_Mutation	SNP	G	G	A	rs556548077	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr19:50794219G>A	ENST00000596571.1	+	33	4918	c.4918G>A	c.(4918-4920)Gag>Aag	p.E1640K	MYH14_ENST00000598205.1_Missense_Mutation_p.E1648K|MYH14_ENST00000376970.2_Missense_Mutation_p.E1673K|MYH14_ENST00000440075.2_Missense_Mutation_p.E1681K|MYH14_ENST00000262269.8_Missense_Mutation_p.E1681K|MYH14_ENST00000425460.1_Missense_Mutation_p.E1648K|MYH14_ENST00000601313.1_Missense_Mutation_p.E1681K			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1640					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E1681K(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CAAGAAGCTGGAGGGAGAGCT	0.652													G|||	6	0.00119808	0.0	0.0	5008	,	,		18912	0.0		0.0	False		,,,				2504	0.0061				p.E1648K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4942A	19						.						21.0	29.0	26.0					19																	50794219		2060	4202	6262	55486031	SO:0001583	missense	79784	exon35			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4918G>A	19.37:g.50794219G>A	ENSP00000472819:p.Glu1640Lys		55486031	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150568	0.78001	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	4.42	4.42	0.53409	Myosin tail (1);	.	.	.	.	D	0.91418	0.7292	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.92724	0.6194	9	0.87932	D	0	.	14.8871	0.70579	0.0:0.0:1.0:0.0	.	1681;1640;1648	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	K	1681;1673;1648;1424;1681	ENSP00000406273:E1681K;ENSP00000366169:E1673K;ENSP00000407879:E1648K;ENSP00000262269:E1681K	ENSP00000262269:E1681K	E	+	1	0	MYH14	55486031	1.000000	0.71417	0.998000	0.56505	0.303000	0.27691	9.300000	0.96151	2.447000	0.82792	0.491000	0.48974	GAG		0.652	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
CD101	9398	broad.mit.edu	37	1	117559854	117559854	+	Silent	SNP	C	C	T	rs139644223		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:117559854C>T	ENST00000256652.4	+	5	1429	c.1371C>T	c.(1369-1371)ccC>ccT	p.P457P	CD101_ENST00000369470.1_Silent_p.P457P	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	457	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.P457P(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGACACAGCCCGAGTTTGTGG	0.577																																					p.P457P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1371T	1						.	C		0,4406		0,0,2203	78.0	69.0	72.0		1371	-4.7	0.0	1	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CD101	NM_004258.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		457/1022	117559854	1,13005	2203	4300	6503	117361377	SO:0001819	synonymous_variant	9398	exon5			Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1371C>T	1.37:g.117559854C>T			117361377	NM_004258	Q15856	Silent	SNP	ENST00000256652.4	37	CCDS891.1																																																																																				0.577	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
THEM5	284486	broad.mit.edu	37	1	151823573	151823573	+	Silent	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:151823573C>T	ENST00000368817.5	-	3	551	c.420G>A	c.(418-420)tcG>tcA	p.S140S	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	140					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)	p.S140S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAGACAGACCGACTTCTTCT	0.567																																					p.S140S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G420A	1						.						96.0	84.0	88.0					1																	151823573		2203	4300	6503	150090197	SO:0001819	synonymous_variant	284486	exon3			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.420G>A	1.37:g.151823573C>T			150090197	NM_182578	Q5T1C3	Silent	SNP	ENST00000368817.5	37	CCDS1005.1	.	.	.	.	.	.	.	.	.	.	C	0.579	-0.837710	0.02692	.	.	ENSG00000196407	ENST00000453881	.	.	.	5.91	-11.8	0.00035	.	.	.	.	.	T	0.13030	0.0316	.	.	.	0.36872	D	0.888955	.	.	.	.	.	.	T	0.52260	-0.8599	4	.	.	.	-2.4985	3.0193	0.06070	0.5055:0.1225:0.0741:0.2978	.	.	.	.	Q	87	.	.	R	-	2	0	THEM5	150090197	0.000000	0.05858	0.002000	0.10522	0.228000	0.25075	-3.710000	0.00387	-4.767000	0.00033	-1.959000	0.00480	CGG		0.567	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036678.2	NM_182578	
NPR1	4881	broad.mit.edu	37	1	153657471	153657471	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:153657471G>T	ENST00000368680.3	+	8	1988	c.1516G>T	c.(1516-1518)Gag>Tag	p.E506*		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	506					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)	p.E506*(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	ACTGGCCTCGGAGCTGTGGCG	0.657																																					p.E506X	Pancreas(141;1349 1870 15144 15830 40702)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1516T	1						.						71.0	69.0	69.0					1																	153657471		2203	4300	6503	151924095	SO:0001587	stop_gained	4881	exon8			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1516G>T	1.37:g.153657471G>T	ENSP00000357669:p.Glu506*		151924095	NM_000906	B0ZBF0|Q5SR08|Q6P4Q3	Nonsense_Mutation	SNP	ENST00000368680.3	37	CCDS1051.1	.	.	.	.	.	.	.	.	.	.	G	42	9.585668	0.99211	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	.	.	.	4.86	4.86	0.63082	.	0.078262	0.52532	D	0.000074	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	15.5406	0.76043	0.0:0.0:1.0:0.0	.	.	.	.	X	506;11	.	ENSP00000357669:E506X	E	+	1	0	NPR1	151924095	0.909000	0.30893	0.999000	0.59377	0.993000	0.82548	1.495000	0.35627	2.525000	0.85131	0.655000	0.94253	GAG		0.657	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090034.1	NM_000906	
TBX19	9095	broad.mit.edu	37	1	168282170	168282170	+	Missense_Mutation	SNP	C	C	T	rs148791684		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:168282170C>T	ENST00000367821.3	+	8	1328	c.1277C>T	c.(1276-1278)tCg>tTg	p.S426L	TBX19_ENST00000465440.1_3'UTR	NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	426					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S426L(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					GCAGTGGCCTCGCATCCCTTC	0.627													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20046	0.0		0.0	False		,,,				2504	0.0				p.S426L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1277T	1						.	C	LEU/SER	2,4404	4.2+/-10.8	0,2,2201	47.0	46.0	46.0		1277	5.5	1.0	1	dbSNP_134	46	0,8600		0,0,4300	no	missense	TBX19	NM_005149.2	145	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	426/449	168282170	2,13004	2203	4300	6503	166548794	SO:0001583	missense	9095	exon8			AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.1277C>T	1.37:g.168282170C>T	ENSP00000356795:p.Ser426Leu		166548794	NM_005149	Q52M53	Missense_Mutation	SNP	ENST00000367821.3	37	CCDS1272.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	22.3	4.274820	0.80580	4.54E-4	0.0	ENSG00000143178	ENST00000367821;ENST00000367828	D	0.94650	-3.48	5.53	5.53	0.82687	.	0.706038	0.13453	N	0.386794	D	0.89336	0.6686	L	0.44542	1.39	0.39534	D	0.968718	D;D	0.57899	0.981;0.981	P;P	0.46685	0.524;0.524	D	0.86309	0.1685	9	0.08837	T	0.75	.	16.3922	0.83543	0.0:1.0:0.0:0.0	.	426;294	O60806;B3KRD9	TBX19_HUMAN;.	L	426;303	ENSP00000356795:S426L	ENSP00000356795:S426L	S	+	2	0	TBX19	166548794	0.984000	0.35163	0.964000	0.40570	0.623000	0.37688	2.872000	0.48467	2.597000	0.87782	0.563000	0.77884	TCG		0.627	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
DNM3	26052	broad.mit.edu	37	1	171890938	171890938	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:171890938T>G	ENST00000355305.5	+	2	369	c.212T>G	c.(211-213)cTg>cGg	p.L71R	DNM3_ENST00000358155.4_Missense_Mutation_p.L71R|DNM3_ENST00000367733.2_Missense_Mutation_p.L71R|DNM3_ENST00000520906.1_Missense_Mutation_p.L71R|DNM3_ENST00000367731.1_Missense_Mutation_p.L71R			Q9UQ16	DYN3_HUMAN	dynamin 3	71	Dynamin-type G.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.L71R(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CCTCTTGTGCTGCAGCTTGTT	0.448																																					p.L71R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T212G	1						.						118.0	111.0	113.0					1																	171890938		1911	4121	6032	170157561	SO:0001583	missense	26052	exon2			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.212T>G	1.37:g.171890938T>G	ENSP00000347457:p.Leu71Arg		170157561	NM_015569	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	37		.	.	.	.	.	.	.	.	.	.	T	21.6	4.173852	0.78452	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906	D;D;D;D;D	0.98120	-4.73;-4.73;-4.73;-4.73;-4.73	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000002	D	0.99184	0.9717	H	0.98089	4.145	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.995;0.999;0.999;0.993	D	0.99069	1.0833	10	0.87932	D	0	.	12.5617	0.56286	0.0:0.0:0.0:1.0	.	71;71;71;71	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	R	71	ENSP00000350876:L71R;ENSP00000356707:L71R;ENSP00000347457:L71R;ENSP00000356705:L71R;ENSP00000429701:L71R	ENSP00000347457:L71R	L	+	2	0	DNM3	170157561	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	4.662000	0.61525	2.217000	0.71921	0.533000	0.62120	CTG		0.448	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
SLC9C2	284525	broad.mit.edu	37	1	173569288	173569288	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:173569288C>T	ENST00000367714.3	-	3	618	c.196G>A	c.(196-198)Gtg>Atg	p.V66M	SLC9C2_ENST00000536496.1_Intron|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	66					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.V66M(1)									TGTCCTATCACGAATCCTGAT	0.343																																					p.V66M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G196A	1						.						92.0	84.0	87.0					1																	173569288		2203	4300	6503	171835911	SO:0001583	missense	284525	exon3			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.196G>A	1.37:g.173569288C>T	ENSP00000356687:p.Val66Met		171835911	NM_178527	Q86UF3	Missense_Mutation	SNP	ENST00000367714.3	37	CCDS1308.1	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494475	0.44352	.	.	ENSG00000162753	ENST00000367714	T	0.17691	2.26	5.27	0.182	0.15077	Cation/H+ exchanger (1);	1.189460	0.06003	N	0.648051	T	0.03136	0.0092	N	0.22421	0.69	0.09310	N	0.999999	P	0.42973	0.796	B	0.38106	0.265	T	0.32561	-0.9902	10	0.33141	T	0.24	-0.8498	3.5232	0.07750	0.1839:0.4456:0.0:0.3704	.	66	Q5TAH2	S9A11_HUMAN	M	66	ENSP00000356687:V66M	ENSP00000356687:V66M	V	-	1	0	SLC9A11	171835911	0.003000	0.15002	0.065000	0.19835	0.040000	0.13550	-0.613000	0.05610	0.135000	0.18707	0.596000	0.82720	GTG		0.343	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084205.1	NM_178527	
RLF	6018	broad.mit.edu	37	1	40705591	40705591	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:40705591delA	ENST00000372771.4	+	8	5244	c.5217delA	c.(5215-5217)gtafs	p.V1739fs		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1739					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			AAAACACTGTAAAAAATCCAA	0.398																																					p.V1739fs												.	.	0			c.5217delA	1						.						47.0	48.0	48.0					1																	40705591		2201	4286	6487	40478178	SO:0001589	frameshift_variant	6018	exon8				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.5217delA	1.37:g.40705591delA	ENSP00000361857:p.Val1739fs		40478178	NM_012421	Q14CQ1|Q9NU60	Frame_Shift_Del	DEL	ENST00000372771.4	37	CCDS448.1																																																																																				0.398	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015767.1	NM_012421	
C8B	732	broad.mit.edu	37	1	57399156	57399156	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:57399156C>A	ENST00000371237.4	-	10	1470	c.1404G>T	c.(1402-1404)gaG>gaT	p.E468D	C8B_ENST00000543257.1_Missense_Mutation_p.E416D|C8B_ENST00000535057.1_Missense_Mutation_p.E406D	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	468	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.E468D(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						CATACAGAGGCTCCACCTGGA	0.423																																					p.E468D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1404T	1						.						68.0	63.0	65.0					1																	57399156		2203	4300	6503	57171744	SO:0001583	missense	732	exon10			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.1404G>T	1.37:g.57399156C>A	ENSP00000360281:p.Glu468Asp		57171744	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	37	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809484	0.31961	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	D;D;D	0.84660	-1.88;-1.88;-1.88	5.08	3.09	0.35607	Membrane attack complex component/perforin (MACPF) domain (3);	0.908483	0.09782	N	0.756565	T	0.79986	0.4541	M	0.65975	2.015	0.35890	D	0.82959	P;P;P	0.39717	0.634;0.634;0.684	B;B;B	0.34536	0.116;0.116;0.185	T	0.76926	-0.2778	10	0.22109	T	0.4	-10.1874	6.8741	0.24137	0.2218:0.6317:0.0:0.1465	.	416;406;468	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	D	468;416;406	ENSP00000360281:E468D;ENSP00000442548:E416D;ENSP00000440113:E406D	ENSP00000360281:E468D	E	-	3	2	C8B	57171744	0.065000	0.20965	0.995000	0.50966	0.875000	0.50365	0.270000	0.18607	1.521000	0.48983	0.655000	0.94253	GAG		0.423	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
BRDT	676	broad.mit.edu	37	1	92430238	92430238	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:92430238T>G	ENST00000362005.3	+	4	665	c.247T>G	c.(247-249)Ttg>Gtg	p.L83V	BRDT_ENST00000402388.1_Missense_Mutation_p.L83V|BRDT_ENST00000394530.3_Intron|BRDT_ENST00000370389.2_Missense_Mutation_p.L10V|BRDT_ENST00000399546.2_Missense_Mutation_p.L83V	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	83	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)	p.L83V(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		TAAGAAGCGCTTGGAGAATAA	0.274																																					p.L83V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T247G	1						.						28.0	31.0	30.0					1																	92430238		2185	4273	6458	92202826	SO:0001583	missense	676	exon3			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.247T>G	1.37:g.92430238T>G	ENSP00000354568:p.Leu83Val		92202826	NM_207189	A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	ENST00000362005.3	37	CCDS735.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103397	0.76983	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000539070;ENST00000423434;ENST00000440509;ENST00000427104;ENST00000448194;ENST00000426141;ENST00000450792;ENST00000548992;ENST00000552654;ENST00000402388	T;T;T;T;T;T;T;T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18;1.18	5.67	4.52	0.55395	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.53938	D	0.000044	T	0.46014	0.1371	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.97110	1.0;0.994	T	0.53078	-0.8489	10	0.87932	D	0	-7.324	6.8852	0.24195	0.0:0.279:0.0:0.721	.	83;83	B7Z890;Q58F21	.;BRDT_HUMAN	V	83;10;83;83;83;83;83;83;83;83;83;10;83	ENSP00000354568:L83V;ENSP00000359416:L10V;ENSP00000387822:L83V;ENSP00000396351:L83V;ENSP00000416714:L83V;ENSP00000400002:L83V;ENSP00000410587:L83V;ENSP00000404969:L83V;ENSP00000414349:L83V;ENSP00000447394:L83V;ENSP00000446599:L10V;ENSP00000384051:L83V	ENSP00000354568:L83V	L	+	1	2	BRDT	92202826	0.905000	0.30787	1.000000	0.80357	0.998000	0.95712	1.580000	0.36547	0.946000	0.37632	0.529000	0.55759	TTG		0.274	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027980.2	NM_207189	
SNAP47	116841	broad.mit.edu	37	1	227935621	227935621	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr1:227935621C>T	ENST00000366759.4	+	2	733	c.319C>T	c.(319-321)Cat>Tat	p.H107Y	SNAP47-AS1_ENST00000413347.2_RNA|SNAP47_ENST00000315781.5_Missense_Mutation_p.H107Y|SNAP47_ENST00000366760.1_Intron	NM_053052.3	NP_444280.2	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	107					long-term synaptic potentiation (GO:0060291)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.H107Y(1)		endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GGAGGCTTCACATTTTATCTT	0.517																																					p.H107Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319T	1						.						74.0	73.0	73.0					1																	227935621		2203	4300	6503	226002244	SO:0001583	missense	116841	exon2			AY090635	CCDS1562.1	1q42.13	2013-10-11	2008-10-27	2008-10-27	ENSG00000143740	ENSG00000143740			30669	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 142"""	C1orf142		16621800	Standard	NM_053052		Approved	SVAP1, SNAP-47	uc001hrf.2	Q5SQN1	OTTHUMG00000037697	ENST00000366759.4:c.319C>T	1.37:g.227935621C>T	ENSP00000355721:p.His107Tyr		226002244	NM_053052	B6EDE0|Q5HYB5|Q5TBZ3|Q8N558|Q8TB31|Q8TCW8|Q8WV46|Q96CQ3|Q96FE1|Q96I66|Q96NU3|Q9BT10|Q9BVB2	Missense_Mutation	SNP	ENST00000366759.4	37	CCDS1562.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.323|8.323	0.824695|0.824695	0.16678|0.16678	.|.	.|.	ENSG00000143740|ENSG00000143740	ENST00000366759;ENST00000315781|ENST00000426344	T;T|.	0.15603|.	2.41;2.41|.	4.08|4.08	4.08|4.08	0.47627|0.47627	.|.	0.160507|.	0.53938|.	D|.	0.000055|.	T|T	0.48892|0.48892	0.1525|0.1525	M|M	0.65975|0.65975	2.015|2.015	0.09310|0.09310	N|N	1|1	D;D|.	0.58620|.	0.983;0.983|.	P;P|.	0.51453|.	0.536;0.67|.	T|T	0.39375|0.39375	-0.9617|-0.9617	10|5	0.02654|.	T|.	1|.	-12.506|-12.506	9.1105|9.1105	0.36725|0.36725	0.2182:0.7818:0.0:0.0|0.2182:0.7818:0.0:0.0	.|.	107;107|.	Q5SQN1;Q5SQN1-2|.	SNP47_HUMAN;.|.	Y|I	107|98	ENSP00000355721:H107Y;ENSP00000314157:H107Y|.	ENSP00000314157:H107Y|.	H|T	+|+	1|2	0|0	SNAP47|SNAP47	226002244|226002244	0.993000|0.993000	0.37304|0.37304	0.005000|0.005000	0.12908|0.12908	0.012000|0.012000	0.07955|0.07955	3.094000|3.094000	0.50227|0.50227	2.111000|2.111000	0.64477|0.64477	0.591000|0.591000	0.81541|0.81541	CAT|ACA		0.517	SNAP47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091961.1	NM_053052	
JAG1	182	broad.mit.edu	37	20	10620429	10620429	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr20:10620429G>T	ENST00000254958.5	-	26	3889	c.3374C>A	c.(3373-3375)cCc>cAc	p.P1125H	JAG1_ENST00000423891.2_Missense_Mutation_p.P966H	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	1125					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)	p.P1125H(2)		biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TTTCTCAATGGGGTTTTTGAT	0.512									Alagille Syndrome																												p.P1125H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3374A	20						.						126.0	120.0	122.0					20																	10620429		2203	4300	6503	10568429	SO:0001583	missense	182	exon26	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.3374C>A	20.37:g.10620429G>T	ENSP00000254958:p.Pro1125His		10568429	NM_000214	A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	ENST00000254958.5	37	CCDS13112.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.269475	0.40095	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.86694	-2.16;-2.16	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.82623	0.5077	N	0.24115	0.695	0.80722	D	1	B	0.26775	0.159	B	0.30105	0.111	T	0.78730	-0.2090	10	0.52906	T	0.07	.	20.0887	0.97806	0.0:0.0:1.0:0.0	.	1125	P78504	JAG1_HUMAN	H	1125;966	ENSP00000254958:P1125H;ENSP00000389519:P966H	ENSP00000254958:P1125H	P	-	2	0	JAG1	10568429	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.447000	0.80620	2.825000	0.97269	0.655000	0.94253	CCC		0.512	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_000214	
JPH2	57158	broad.mit.edu	37	20	42788606	42788606	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr20:42788606T>G	ENST00000372980.3	-	2	1693	c.821A>C	c.(820-822)gAc>gCc	p.D274A		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	274					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.D274A(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TGCGGCCTCGTCGGCGCCCTC	0.687																																					p.D274A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A821C	20						.						26.0	25.0	26.0					20																	42788606		2201	4298	6499	42222020	SO:0001583	missense	57158	exon2			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.821A>C	20.37:g.42788606T>G	ENSP00000362071:p.Asp274Ala		42222020	NM_020433	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	ENST00000372980.3	37	CCDS13325.1	.	.	.	.	.	.	.	.	.	.	t	12.44	1.937460	0.34189	.	.	ENSG00000149596	ENST00000372980	T	0.61274	0.12	3.03	3.03	0.35002	.	0.496685	0.19947	U	0.102520	T	0.52885	0.1762	L	0.55481	1.735	0.80722	D	1	P	0.52463	0.953	P	0.47744	0.556	T	0.51411	-0.8709	10	0.08381	T	0.77	.	11.3688	0.49687	0.0:0.0:0.0:1.0	.	274	Q9BR39	JPH2_HUMAN	A	274	ENSP00000362071:D274A	ENSP00000362071:D274A	D	-	2	0	JPH2	42222020	1.000000	0.71417	0.658000	0.29665	0.337000	0.28794	4.963000	0.63694	1.259000	0.44117	0.248000	0.18094	GAC		0.687	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1		
SLC12A5	57468	broad.mit.edu	37	20	44664102	44664102	+	Silent	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr20:44664102C>T	ENST00000454036.2	+	3	325	c.276C>T	c.(274-276)acC>acT	p.T92T	SLC12A5_ENST00000243964.3_Silent_p.T69T|SLC12A5_ENST00000372315.1_Silent_p.T69T|SLC12A5_ENST00000608944.1_Silent_p.T18T	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	92					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)	p.T69T(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCAACTACACCAACCTGCCCC	0.577																																					p.T69T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C207T	20						.						94.0	101.0	98.0					20																	44664102		2203	4300	6503	44097509	SO:0001819	synonymous_variant	57468	exon3			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.276C>T	20.37:g.44664102C>T			44097509	NM_020708	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	ENST00000454036.2	37	CCDS46610.1																																																																																				0.577	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
RUNX1	861	broad.mit.edu	37	21	36231783	36231783	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr21:36231783G>C	ENST00000344691.4	-	3	2097	c.520C>G	c.(520-522)Cga>Gga	p.R174G	RUNX1_ENST00000358356.5_Missense_Mutation_p.R174G|RUNX1_ENST00000437180.1_Missense_Mutation_p.R201G|RUNX1_ENST00000300305.3_Missense_Mutation_p.R201G|RUNX1_ENST00000325074.5_Missense_Mutation_p.R189G|RUNX1_ENST00000486278.2_Missense_Mutation_p.R177G|RUNX1_ENST00000399240.1_Missense_Mutation_p.R174G	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	174	Interaction with DNA.|Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.		R -> Q (in FPDMM; impaired phosphorylation). {ECO:0000269|PubMed:10508512, ECO:0000269|PubMed:18695000}.		behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R201*(5)|p.R201G(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						CGAGGTTCTCGGGGCCCATCC	0.552			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																p.R201G			Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	RUNX1,haematopoietic_and_lymphoid_tissue,NS,Substitution - Nonsense,0 	.	6	Substitution - Nonsense(5)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(5)|large_intestine(1)	c.C601G	21	GRCh37	CM992141	RUNX1	M		.						274.0	240.0	251.0					21																	36231783		2203	4300	6503	35153653	SO:0001583	missense	861	exon6			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.520C>G	21.37:g.36231783G>C	ENSP00000340690:p.Arg174Gly		35153653	NM_001754	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Missense_Mutation	SNP	ENST00000344691.4	37	CCDS42922.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037142	0.75617	.	.	ENSG00000159216	ENST00000344691;ENST00000300305;ENST00000437180;ENST00000325074;ENST00000399240;ENST00000399245;ENST00000358356;ENST00000399237;ENST00000486278	D;D;D;D;D;D;D;D	0.99711	-6.49;-6.49;-6.49;-6.49;-6.49;-6.49;-6.49;-6.49	5.12	4.21	0.49690	Acute myeloid leukemia 1 (AML 1)/Runt (2);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	M	0.91090	3.175	0.80722	D	1	D;D;D;P;D;D;D	0.89917	0.999;1.0;0.98;0.946;0.994;0.996;0.997	D;D;D;P;D;D;D	0.87578	0.994;0.998;0.973;0.824;0.971;0.937;0.994	D	0.97740	1.0208	10	0.87932	D	0	-10.7194	12.147	0.54028	0.0:0.0:0.8085:0.1914	.	201;174;174;177;201;189;174	Q2TAM6;Q01196-5;Q01196-3;C9JK12;Q01196-8;Q01196-10;Q01196	.;.;.;.;.;.;RUNX1_HUMAN	G	174;201;201;189;174;177;174;189;177	ENSP00000340690:R174G;ENSP00000300305:R201G;ENSP00000409227:R201G;ENSP00000319459:R189G;ENSP00000382184:R174G;ENSP00000351123:R174G;ENSP00000382182:R189G;ENSP00000438019:R177G	ENSP00000300305:R201G	R	-	1	2	RUNX1	35153653	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.798000	0.47884	1.088000	0.41272	0.655000	0.94253	CGA		0.552	RUNX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194230.1		
MORC3	23515	broad.mit.edu	37	21	37717265	37717265	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr21:37717265G>A	ENST00000400485.1	+	8	1017	c.941G>A	c.(940-942)gGg>gAg	p.G314E	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	314					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)	p.G314E(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						GATCATTATGGGATAATGATG	0.294																																					p.G314E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G941A	21						.						85.0	87.0	87.0					21																	37717265		1811	4074	5885	36639135	SO:0001583	missense	23515	exon8			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.941G>A	21.37:g.37717265G>A	ENSP00000383333:p.Gly314Glu		36639135	NM_015358	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	37	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537437	0.85917	.	.	ENSG00000159256	ENST00000400485	D	0.85411	-1.98	5.63	4.75	0.60458	.	0.000000	0.85682	D	0.000000	D	0.93654	0.7973	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94859	0.8020	10	0.87932	D	0	-15.0223	14.646	0.68762	0.0701:0.0:0.9299:0.0	.	314	Q14149	MORC3_HUMAN	E	314	ENSP00000383333:G314E	ENSP00000383333:G314E	G	+	2	0	MORC3	36639135	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.751000	0.98889	1.379000	0.46325	0.655000	0.94253	GGG		0.294	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
XBP1	7494	broad.mit.edu	37	22	29191393	29191393	+	3'UTR	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr22:29191393C>T	ENST00000216037.6	-	0	999				XBP1_ENST00000405219.3_3'UTR|XBP1_ENST00000344347.5_Missense_Mutation_p.V301M|XBP1_ENST00000403532.3_3'UTR	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V301M(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						TCTTCCTTCACTGAGACAATG	0.498																																					p.V301M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G901A	22						.						69.0	74.0	72.0					22																	29191393		1216	2244	3460	27521393	SO:0001624	3_prime_UTR_variant	7494	exon6			M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.*141G>A	22.37:g.29191393C>T			27521393	NM_001079539	Q8WYK6|Q969P1|Q96BD7	Missense_Mutation	SNP	ENST00000216037.6	37	CCDS13847.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128738	0.77549	.	.	ENSG00000100219	ENST00000344347	.	.	.	5.87	5.87	0.94306	.	0.065928	0.64402	D	0.000012	D	0.83617	0.5293	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84644	0.0697	8	0.72032	D	0.01	.	19.1969	0.93693	0.0:1.0:0.0:0.0	.	301	P17861-2	.	M	301	.	ENSP00000343155:V301M	V	-	1	0	XBP1	27521393	1.000000	0.71417	0.990000	0.47175	0.999000	0.98932	5.509000	0.67012	2.791000	0.96007	0.655000	0.94253	GTG		0.498	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321274.1	NM_005080	
CDC42EP1	11135	broad.mit.edu	37	22	37964409	37964429	+	In_Frame_Del	DEL	CAGCGCCTGCTGCAAACCCCT	CAGCGCCTGCTGCAAACCCCT	-	rs13056859|rs13055845|rs77417880|rs62235033|rs62235034|rs187761157|rs66468174|rs200195385	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	CAGCGCCTGCTGCAAACCCCT	CAGCGCCTGCTGCAAACCCCT					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr22:37964409_37964429delCAGCGCCTGCTGCAAACCCCT	ENST00000249014.4	+	3	1178_1198	c.758_778delCAGCGCCTGCTGCAAACCCCT	c.(757-780)ccagcgcctgctgcaaacccctca>cca	p.APAANPS254del		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	254	8 X 7 AA tandem repeats of [PT]-[AT]-A- [ENT]-[PT]-[PTS]-[AG].				positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.N258_A264delNPSAPAA(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GCAAACCCCCCAGCGCCTGCTGCAAACCCCTCAGCACCTGC	0.665																																					p.253_260del												.	.	3	Deletion - In frame(3)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)	c.758_778del	22						.			868,3338		98,672,1333						1.5	0.0		dbSNP_130	10	4310,3696		1298,1714,991	no	coding	CDC42EP1	NM_152243.2		1396,2386,2324	A1A1,A1R,RR		46.1654,20.6372,42.4009				5178,7034				36294375	SO:0001651	inframe_deletion	11135	exon3			M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.758_778delCAGCGCCTGCTGCAAACCCCT	22.37:g.37964409_37964429delCAGCGCCTGCTGCAAACCCCT	ENSP00000249014:p.Ala254_Ser260del		36294355	NM_152243	A8K825|Q96GN1	In_Frame_Del	DEL	ENST00000249014.4	37	CCDS13949.1																																																																																				0.665	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318993.1	NM_152243	
TNRC6B	23112	broad.mit.edu	37	22	40661744	40661744	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr22:40661744T>C	ENST00000454349.2	+	5	1721	c.1510T>C	c.(1510-1512)Tct>Cct	p.S504P	TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.S504P|TNRC6B_ENST00000402203.1_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	504	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S518P(1)		breast(1)	1						CAAAATGACATCTGGGGTCTC	0.493																																					p.S504P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1510C	22						.						49.0	48.0	48.0					22																	40661744		1862	4093	5955	38991690	SO:0001583	missense	23112	exon5			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.1510T>C	22.37:g.40661744T>C	ENSP00000401946:p.Ser504Pro		38991690	NM_015088	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416485	0.42918	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	T;T	0.56275	0.47;0.47	5.96	5.96	0.96718	.	0.112528	0.64402	D	0.000008	T	0.55909	0.1950	N	0.22421	0.69	0.33771	D	0.623111	D;P;P	0.60160	0.987;0.652;0.531	D;B;B	0.68483	0.958;0.188;0.346	T	0.63453	-0.6634	10	0.27082	T	0.32	-5.0571	12.3032	0.54887	0.0:0.0:0.1411:0.8589	.	504;504;504	Q9UPQ9;A8MYY3;Q9UPQ9-1	TNR6B_HUMAN;.;.	P	504	ENSP00000401946:S504P;ENSP00000338371:S504P	ENSP00000338371:S504P	S	+	1	0	TNRC6B	38991690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.174000	0.50847	2.285000	0.76669	0.528000	0.53228	TCT		0.493	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
CATIP	375307	broad.mit.edu	37	2	219232578	219232579	+	Frame_Shift_Ins	INS	-	-	C	rs144442656	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:219232578_219232579insC	ENST00000289388.3	+	10	1084_1085	c.1055_1056insC	c.(1054-1059)ggccccfs	p.GP352fs	C2orf62_ENST00000481940.1_3'UTR|AC021016.6_ENST00000441749.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		352					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.F354fs*>35(1)		endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGTTCTTCGGCCCCTTCGACC	0.718																																					p.G352fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1055_1056insC	2						.																																			218940823	SO:0001589	frameshift_variant	375307	exon10																														ENST00000289388.3:c.1059dupC	2.37:g.219232582_219232582dupC	ENSP00000289388:p.Gly352fs		218940822	NM_198559		Frame_Shift_Ins	INS	ENST00000289388.3	37	CCDS2414.1																																																																																				0.718	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
CHST10	9486	broad.mit.edu	37	2	101010093	101010093	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:101010093G>A	ENST00000264249.3	-	7	1070	c.685C>T	c.(685-687)Cgg>Tgg	p.R229W	CHST10_ENST00000542617.1_Missense_Mutation_p.R277W|CHST10_ENST00000409701.1_Missense_Mutation_p.R229W	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	229					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)	p.R229W(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						GTCTCTGTCCGGTTCCTCCTG	0.488																																					p.R229W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C685T	2						.						170.0	168.0	168.0					2																	101010093		2203	4300	6503	100376525	SO:0001583	missense	9486	exon7			BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.685C>T	2.37:g.101010093G>A	ENSP00000264249:p.Arg229Trp		100376525	NM_004854	Q53T18	Missense_Mutation	SNP	ENST00000264249.3	37	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316371	0.95655	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701	T;T;T	0.73897	-0.79;-0.79;-0.79	6.06	6.06	0.98353	.	0.264147	0.44688	D	0.000428	T	0.82199	0.4985	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.63033	0.91	T	0.81812	-0.0761	10	0.62326	D	0.03	-31.4427	20.6208	0.99490	0.0:0.0:1.0:0.0	.	229	O43529	CHSTA_HUMAN	W	229;277;229	ENSP00000264249:R229W;ENSP00000438869:R277W;ENSP00000387309:R229W	ENSP00000264249:R229W	R	-	1	2	CHST10	100376525	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.624000	0.98398	2.882000	0.98803	0.655000	0.94253	CGG		0.488	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
LRP2	4036	broad.mit.edu	37	2	170002343	170002343	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:170002343C>T	ENST00000263816.3	-	70	13187	c.12902G>A	c.(12901-12903)gGg>gAg	p.G4301E		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4301					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.G4301E(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTTTCCTTGCCCAAATTTATT	0.403																																					p.G4301E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G12902A	2						.						99.0	91.0	94.0					2																	170002343		2203	4300	6503	169710589	SO:0001583	missense	4036	exon70				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12902G>A	2.37:g.170002343C>T	ENSP00000263816:p.Gly4301Glu		169710589	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.660830	0.88154	.	.	ENSG00000081479	ENST00000263816	D	0.91464	-2.85	5.38	5.38	0.77491	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.94185	0.8134	M	0.70842	2.15	0.80722	D	1	D	0.63880	0.993	P	0.60117	0.869	D	0.94570	0.7770	10	0.87932	D	0	.	17.6905	0.88268	0.0:1.0:0.0:0.0	.	4301	P98164	LRP2_HUMAN	E	4301	ENSP00000263816:G4301E	ENSP00000263816:G4301E	G	-	2	0	LRP2	169710589	1.000000	0.71417	0.966000	0.40874	0.812000	0.45895	6.024000	0.70857	2.690000	0.91761	0.655000	0.94253	GGG		0.403	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
PUM2	23369	broad.mit.edu	37	2	20512167	20512167	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:20512167G>A	ENST00000361078.2	-	3	200	c.178C>T	c.(178-180)Cct>Tct	p.P60S	PUM2_ENST00000403432.1_Missense_Mutation_p.P60S|PUM2_ENST00000338086.5_Missense_Mutation_p.P60S|PUM2_ENST00000536417.1_Missense_Mutation_p.P4S|PUM2_ENST00000420234.1_5'UTR|PUM2_ENST00000319801.5_Missense_Mutation_p.P60S			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	60	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.P60S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCATAATAGGCTGGGACATT	0.353																																					p.P60S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C178T	2						.						70.0	65.0	67.0					2																	20512167		2203	4300	6503	20375648	SO:0001583	missense	23369	exon3			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.178C>T	2.37:g.20512167G>A	ENSP00000354370:p.Pro60Ser		20375648	NM_015317	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	ENST00000361078.2	37		.	.	.	.	.	.	.	.	.	.	G	17.96	3.515732	0.64634	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T	0.59638	1.44;1.66;1.63;1.44;0.25	6.07	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.70090	0.3184	L	0.56280	1.765	0.80722	D	1	B;D	0.89917	0.272;1.0	B;D	0.91635	0.167;0.999	T	0.70022	-0.4986	10	0.51188	T	0.08	-10.9635	12.7688	0.57408	0.1311:0.0:0.8689:0.0	.	60;60	B7ZL34;Q8TB72-3	.;.	S	60;60;60;60;4;60	ENSP00000338173:P60S;ENSP00000354370:P60S;ENSP00000326746:P60S;ENSP00000385992:P60S;ENSP00000440093:P4S	ENSP00000326746:P60S	P	-	1	0	PUM2	20375648	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	9.869000	0.99810	0.915000	0.36847	-0.136000	0.14681	CCT		0.353	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015317	
TTN	7273	broad.mit.edu	37	2	179482764	179482764	+	Silent	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:179482764G>T	ENST00000591111.1	-	203	42615	c.42391C>A	c.(42391-42393)Cga>Aga	p.R14131R	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.R6899R|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000342992.6_Silent_p.R13204R|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000359218.5_Silent_p.R6832R|TTN_ENST00000460472.2_Silent_p.R6707R|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.R15772R|TTN-AS1_ENST00000589907.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14131	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> Q. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R13204R(1)|p.R6707R(1)|p.R6832R(1)|p.R6899R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACCAAATCGATTCACATCA	0.433																																					p.R6707R												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C20119A	2						.						78.0	75.0	76.0					2																	179482764		1952	4145	6097	179191009	SO:0001819	synonymous_variant	7273	exon81			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.42391C>A	2.37:g.179482764G>T			179191009	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NAGK	55577	broad.mit.edu	37	2	71302769	71302769	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:71302769G>A	ENST00000244204.6	+	7	726	c.664G>A	c.(664-666)Gaa>Aaa	p.E222K	NAGK_ENST00000443872.2_Missense_Mutation_p.E74K|NAGK_ENST00000455662.2_Missense_Mutation_p.E268K|NAGK_ENST00000443938.2_Missense_Mutation_p.E222K|NAGK_ENST00000418807.3_Missense_Mutation_p.E171K			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	222					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)	p.E222K(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	GAAAATTGCAGAAGGTACTGG	0.493																																					p.E268K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G802A	2						.						79.0	73.0	75.0					2																	71302769		2203	4300	6503	71156277	SO:0001583	missense	55577	exon7			AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.664G>A	2.37:g.71302769G>A	ENSP00000244204:p.Glu222Lys		71156277	NM_017567	B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	ENST00000244204.6	37		.	.	.	.	.	.	.	.	.	.	G	19.87	3.907640	0.72868	.	.	ENSG00000124357	ENST00000244204;ENST00000455662;ENST00000531934;ENST00000418807	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.02	5.02	0.67125	ATPase, BadF/BadG/BcrA/BcrD type (1);	0.112252	0.64402	D	0.000014	T	0.36496	0.0969	L	0.39467	1.215	0.80722	D	1	D	0.57257	0.979	P	0.53401	0.725	T	0.02625	-1.1132	10	0.18276	T	0.48	-22.1172	16.2286	0.82318	0.0:0.0:1.0:0.0	.	222	Q9UJ70	NAGK_HUMAN	K	222;268;74;171	ENSP00000244204:E222K;ENSP00000389087:E268K;ENSP00000436326:E74K;ENSP00000396070:E171K	ENSP00000244204:E222K	E	+	1	0	NAGK	71156277	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.593000	0.90832	2.495000	0.84180	0.655000	0.94253	GAA		0.493	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1		
TSGA10	80705	broad.mit.edu	37	2	99636781	99636781	+	Missense_Mutation	SNP	C	C	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:99636781C>G	ENST00000393483.3	-	18	2623	c.1779G>C	c.(1777-1779)caG>caC	p.Q593H	TSGA10_ENST00000539964.1_Missense_Mutation_p.Q593H|TSGA10_ENST00000355053.4_Missense_Mutation_p.Q593H|TSGA10_ENST00000410001.1_Missense_Mutation_p.Q593H	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	593	Interaction with HIF1A. {ECO:0000250}.				cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.Q593H(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CTTTAAGAAGCTGAATTTCAG	0.333																																					p.Q593H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1779C	2						.						78.0	77.0	77.0					2																	99636781		2203	4300	6503	99003213	SO:0001583	missense	80705	exon18			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1779G>C	2.37:g.99636781C>G	ENSP00000377123:p.Gln593His		99003213	NM_025244	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	ENST00000393483.3	37	CCDS2037.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548912	0.65311	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	T;T;T;T;T;T	0.78003	2.46;2.46;2.46;2.46;-1.14;2.46	5.3	4.42	0.53409	.	0.080006	0.51477	D	0.000089	D	0.84129	0.5404	L	0.57536	1.79	0.80722	D	1	D	0.69078	0.997	D	0.65684	0.937	D	0.85496	0.1188	10	0.66056	D	0.02	-11.1893	13.0238	0.58804	0.0:0.9226:0.0:0.0774	.	593	Q9BZW7	TSG10_HUMAN	H	593;593;593;593;523;593	ENSP00000377123:Q593H;ENSP00000386956:Q593H;ENSP00000347161:Q593H;ENSP00000444419:Q593H;ENSP00000386508:Q523H;ENSP00000377122:Q593H	ENSP00000347161:Q593H	Q	-	3	2	TSGA10	99003213	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.583000	0.23849	1.459000	0.47892	0.650000	0.86243	CAG		0.333	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
DYTN	391475	broad.mit.edu	37	2	207570550	207570550	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr2:207570550A>G	ENST00000452335.2	-	4	460	c.344T>C	c.(343-345)aTa>aCa	p.I115T	DYTN_ENST00000477734.1_5'Flank	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	115						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.I115T(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TGAGAGGGTTATTAGGGCAGC	0.507																																					p.I115T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T344C	2						.						54.0	52.0	53.0					2																	207570550		1890	4111	6001	207278795	SO:0001583	missense	391475	exon4			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.344T>C	2.37:g.207570550A>G	ENSP00000396593:p.Ile115Thr		207278795	NM_001093730		Missense_Mutation	SNP	ENST00000452335.2	37	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	A	10.23	1.294287	0.23564	.	.	ENSG00000232125	ENST00000452335	T	0.64803	-0.12	5.03	1.13	0.20643	EF-hand domain, type 1 (1);	.	.	.	.	T	0.45836	0.1362	N	0.24115	0.695	0.20074	N	0.999938	B	0.33940	0.433	B	0.38921	0.285	T	0.34153	-0.9840	9	0.33141	T	0.24	-3.4465	5.3391	0.15974	0.7211:0.0:0.1486:0.1303	.	115	A2CJ06	DYTN_HUMAN	T	115	ENSP00000396593:I115T	ENSP00000396593:I115T	I	-	2	0	DYTN	207278795	1.000000	0.71417	0.571000	0.28486	0.065000	0.16274	2.460000	0.45031	0.481000	0.27557	-0.254000	0.11334	ATA		0.507	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		
WNT7A	7476	broad.mit.edu	37	3	13860614	13860614	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr3:13860614C>T	ENST00000285018.4	-	4	1181	c.877G>A	c.(877-879)Gcc>Acc	p.A293T		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	293					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)	p.A293T(1)		NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						TTGTTGCAGGCGCGGCCCTGG	0.657																																					p.A293T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G877A	3						.						74.0	72.0	72.0					3																	13860614		2203	4299	6502	13835615	SO:0001583	missense	7476	exon4			D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.877G>A	3.37:g.13860614C>T	ENSP00000285018:p.Ala293Thr		13835615	NM_004625	Q96H90|Q9Y560	Missense_Mutation	SNP	ENST00000285018.4	37	CCDS2616.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297577	0.23650	.	.	ENSG00000154764	ENST00000285018	T	0.75704	-0.96	4.18	0.78	0.18556	.	0.736111	0.13340	N	0.395211	T	0.40815	0.1132	N	0.02192	-0.645	0.20489	N	0.999893	B	0.06786	0.001	B	0.01281	0.0	T	0.25847	-1.0120	10	0.13853	T	0.58	.	3.4922	0.07642	0.0:0.3033:0.2096:0.4871	.	293	O00755	WNT7A_HUMAN	T	293	ENSP00000285018:A293T	ENSP00000285018:A293T	A	-	1	0	WNT7A	13835615	0.034000	0.19679	0.880000	0.34516	0.901000	0.52897	0.326000	0.19646	0.338000	0.23692	0.563000	0.77884	GCC		0.657	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
CTDSPL	10217	broad.mit.edu	37	3	38022264	38022264	+	Missense_Mutation	SNP	C	C	T	rs115508245	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr3:38022264C>T	ENST00000273179.5	+	8	763	c.737C>T	c.(736-738)aCg>aTg	p.T246M	CTDSPL_ENST00000310189.3_3'UTR|CTDSPL_ENST00000443503.2_Missense_Mutation_p.T235M	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	246	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.T246M(1)		breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		GATGACATGACGGACACGGAG	0.602													C|||	5	0.000998403	0.0	0.0	5008	,	,		19214	0.005		0.0	False		,,,				2504	0.0				p.T235M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C704T	3						.	C	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	142.0	101.0	115.0		737,704	4.4	1.0	3	dbSNP_132	115	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	CTDSPL	NM_001008392.1,NM_005808.2	81,81	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging,probably-damaging	246/277,235/266	38022264	4,13002	2203	4300	6503	37997268	SO:0001583	missense	10217	exon7			D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.737C>T	3.37:g.38022264C>T	ENSP00000273179:p.Thr246Met		37997268	NM_005808	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	ENST00000273179.5	37	CCDS33734.1	5|5	0.0022893772893772895|0.0022893772893772895	0|0	0.0|0.0	0|0	0.0|0.0	5|5	0.008741258741258742|0.008741258741258742	0|0	0.0|0.0	C|C	22.2|22.2	4.252210|4.252210	0.80135|0.80135	2.27E-4|2.27E-4	3.49E-4|3.49E-4	ENSG00000144677|ENSG00000144677	ENST00000436654|ENST00000443503;ENST00000273179;ENST00000447745	.|T;T;T	.|0.18174	.|2.23;2.23;2.23	5.33|5.33	4.41|4.41	0.53225|0.53225	.|NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	.|0.148220	.|0.64402	.|D	.|0.000014	T|T	0.27559|0.27559	0.0677|0.0677	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;D	.|0.60160	.|0.984;0.987	.|P;P	.|0.60886	.|0.81;0.88	T|T	0.03394|0.03394	-1.1041|-1.1041	5|10	.|0.66056	.|D	.|0.02	-8.9083|-8.9083	16.7029|16.7029	0.85364|0.85364	0.0:0.8708:0.1291:0.0|0.0:0.8708:0.1291:0.0	.|.	.|235;246	.|O15194-2;O15194	.|.;CTDSL_HUMAN	W|M	52|235;246;135	.|ENSP00000398288:T235M;ENSP00000273179:T246M;ENSP00000407443:T135M	.|ENSP00000273179:T246M	R|T	+|+	1|2	2|0	CTDSPL|CTDSPL	37997268|37997268	0.979000|0.979000	0.34478|0.34478	0.991000|0.991000	0.47740|0.47740	0.997000|0.997000	0.91878|0.91878	2.544000|2.544000	0.45761|0.45761	2.664000|2.664000	0.90586|0.90586	0.655000|0.655000	0.94253|0.94253	CGG|ACG		0.602	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342392.1	NM_005808	
FLNB	2317	broad.mit.edu	37	3	58133989	58133989	+	Missense_Mutation	SNP	G	G	T	rs146685642	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr3:58133989G>T	ENST00000295956.4	+	35	5950	c.5785G>T	c.(5785-5787)Gac>Tac	p.D1929Y	FLNB_ENST00000429972.2_Missense_Mutation_p.D1918Y|FLNB_ENST00000419752.2_Missense_Mutation_p.D1749Y|FLNB_ENST00000490882.1_Missense_Mutation_p.D1960Y|FLNB_ENST00000493452.1_Missense_Mutation_p.D1736Y|FLNB_ENST00000358537.3_Missense_Mutation_p.D1905Y|FLNB_ENST00000357272.4_Missense_Mutation_p.D1929Y|FLNB_ENST00000348383.5_Missense_Mutation_p.D1929Y	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1929	Interaction with the cytoplasmic tail of GP1BA.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.D1929Y(1)		NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		CTTCCTGCTCGACATCAGTGA	0.582																																					p.D1960Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5878T	3						.						65.0	53.0	57.0					3																	58133989		2203	4300	6503	58109029	SO:0001583	missense	2317	exon36			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.5785G>T	3.37:g.58133989G>T	ENSP00000295956:p.Asp1929Tyr		58109029	NM_001164317	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875063	0.91664	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.86956	-2.13;-2.17;-2.13;-2.13;-2.19;-2.16;-1.89;-1.88	6.17	6.17	0.99709	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92880	0.7735	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.998;1.0;0.996;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.93;0.999;0.959;0.999;0.999	D	0.92069	0.5663	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1905;1960;1736;1749;1918;1929	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	Y	1929;1960;1905;1918;1929;1929;1736;1749	ENSP00000295956:D1929Y;ENSP00000420213:D1960Y;ENSP00000351339:D1905Y;ENSP00000415599:D1918Y;ENSP00000232447:D1929Y;ENSP00000349819:D1929Y;ENSP00000418510:D1736Y;ENSP00000414532:D1749Y	ENSP00000295956:D1929Y	D	+	1	0	FLNB	58109029	1.000000	0.71417	0.974000	0.42286	0.988000	0.76386	6.640000	0.74319	2.941000	0.99782	0.655000	0.94253	GAC		0.582	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
FRMD4B	23150	broad.mit.edu	37	3	69351555	69351555	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr3:69351555G>A	ENST00000398540.3	-	4	438	c.355C>T	c.(355-357)Cga>Tga	p.R119*	FRMD4B_ENST00000542259.1_Nonsense_Mutation_p.R65*	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	119	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)		p.R65*(1)		NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TCAAGAACTCGGTGATCTAAC	0.448																																					p.R119X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C355T	3						.						104.0	103.0	104.0					3																	69351555		1934	4126	6060	69434245	SO:0001587	stop_gained	23150	exon4			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.355C>T	3.37:g.69351555G>A	ENSP00000381549:p.Arg119*		69434245	NM_015123	Q8TAI3	Nonsense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	G	36	5.711795	0.96830	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000473029;ENST00000460709;ENST00000459638	.	.	.	5.65	2.73	0.32206	.	0.245622	0.35151	N	0.003414	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6008	10.2235	0.43212	0.0:0.1213:0.4838:0.3948	.	.	.	.	X	119;65;65;65;65	.	ENSP00000381549:R119X	R	-	1	2	FRMD4B	69434245	1.000000	0.71417	0.998000	0.56505	0.028000	0.11728	1.590000	0.36654	0.348000	0.23949	-0.188000	0.12872	CGA		0.448	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
CEP70	80321	broad.mit.edu	37	3	138219389	138219389	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr3:138219389A>T	ENST00000264982.3	-	15	1655	c.1389T>A	c.(1387-1389)ttT>ttA	p.F463L	CEP70_ENST00000484888.1_Missense_Mutation_p.F463L|CEP70_ENST00000542237.1_Missense_Mutation_p.F443L|CEP70_ENST00000489254.1_Missense_Mutation_p.F311L|CEP70_ENST00000481834.1_Missense_Mutation_p.F463L	NM_024491.2	NP_077817.2	Q8NHQ1	CEP70_HUMAN	centrosomal protein 70kDa	463					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)		p.F463L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	24						GCAAAGTTTGAAAGTGTGGCA	0.318																																					p.F463L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1389A	3						.						178.0	207.0	197.0					3																	138219389		2202	4300	6502	139702079	SO:0001583	missense	80321	exon15			AF202146	CCDS3102.1, CCDS75022.1, CCDS75023.1, CCDS75024.1	3q22.3	2014-02-20			ENSG00000114107	ENSG00000114107			29972	protein-coding gene	gene with protein product		614310				14654843	Standard	XM_005247802		Approved	BITE, FLJ13036	uc003esl.3	Q8NHQ1	OTTHUMG00000159891	ENST00000264982.3:c.1389T>A	3.37:g.138219389A>T	ENSP00000264982:p.Phe463Leu		139702079	NM_024491	B7Z5I8|B7Z7E8|D3DNE9|F5GZX8|Q96B31|Q9H2C3|Q9H2Z1|Q9H940	Missense_Mutation	SNP	ENST00000264982.3	37	CCDS3102.1	.	.	.	.	.	.	.	.	.	.	A	6.176	0.400620	0.11696	.	.	ENSG00000114107	ENST00000264982;ENST00000542237;ENST00000489254;ENST00000484888;ENST00000474781;ENST00000481834	T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13	4.76	0.901	0.19284	.	0.810365	0.11554	N	0.552471	T	0.05731	0.0150	N	0.02539	-0.55	0.19300	N	0.999974	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.002	T	0.39099	-0.9630	10	0.09590	T	0.72	-1.6995	1.4518	0.02376	0.5447:0.1727:0.0966:0.1859	.	311;443;463;463	B7Z2D2;F5GZX8;Q8NHQ1-2;Q8NHQ1	.;.;.;CEP70_HUMAN	L	463;443;311;463;445;463	ENSP00000264982:F463L;ENSP00000444128:F443L;ENSP00000417821:F311L;ENSP00000419231:F463L;ENSP00000419833:F445L;ENSP00000417465:F463L	ENSP00000264982:F463L	F	-	3	2	CEP70	139702079	0.996000	0.38824	0.979000	0.43373	0.271000	0.26615	0.484000	0.22308	0.007000	0.14760	0.533000	0.62120	TTT		0.318	CEP70-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000358001.1	NM_024491	
ANK2	287	broad.mit.edu	37	4	114280447	114280447	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr4:114280447A>T	ENST00000357077.4	+	38	10726	c.10673A>T	c.(10672-10674)cAt>cTt	p.H3558L	ANK2_ENST00000509550.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.H3525L|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3558					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.H3558L(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGCCATGACCATGCTGAAGGT	0.423																																					p.H3558L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A10673T	4						.						61.0	61.0	61.0					4																	114280447		2203	4299	6502	114499896	SO:0001583	missense	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.10673A>T	4.37:g.114280447A>T	ENSP00000349588:p.His3558Leu		114499896	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	10.37	1.330760	0.24167	.	.	ENSG00000145362	ENST00000357077;ENST00000264366;ENST00000505342	T;T;D	0.95885	-0.2;-0.21;-3.84	5.64	-2.84	0.05751	DEATH-like (1);	0.249449	0.28021	N	0.016903	D	0.83566	0.5282	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.63994	-0.6511	10	0.28530	T	0.3	.	2.8971	0.05693	0.4471:0.113:0.3302:0.1096	.	3525;3558	Q01484;Q01484-4	ANK2_HUMAN;.	L	3558;3525;568	ENSP00000349588:H3558L;ENSP00000264366:H3525L;ENSP00000422498:H568L	ENSP00000264366:H3525L	H	+	2	0	ANK2	114499896	0.467000	0.25831	0.931000	0.37212	0.995000	0.86356	-0.172000	0.09868	-0.369000	0.08028	0.528000	0.53228	CAT		0.423	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
CCNA2	890	broad.mit.edu	37	4	122741871	122741871	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr4:122741871G>C	ENST00000274026.5	-	4	923	c.620C>G	c.(619-621)aCt>aGt	p.T207S		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	207					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.T207S(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						CATACTGTTAGTGATGTCTGG	0.348																																					p.T207S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C620G	4						.						138.0	140.0	139.0					4																	122741871		2203	4300	6503	122961321	SO:0001583	missense	890	exon4				CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.620C>G	4.37:g.122741871G>C	ENSP00000274026:p.Thr207Ser		122961321	NM_001237	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	ENST00000274026.5	37	CCDS3723.1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679397	0.68042	.	.	ENSG00000145386	ENST00000274026	T	0.11385	2.78	5.99	5.14	0.70334	Cyclin, N-terminal (1);Cyclin-like (2);	0.044527	0.85682	D	0.000000	T	0.13415	0.0325	L	0.44542	1.39	0.53005	D	0.999966	B	0.15473	0.013	B	0.24541	0.054	T	0.02526	-1.1146	10	0.46703	T	0.11	.	16.614	0.84902	0.0:0.0:0.8688:0.1312	.	207	P20248	CCNA2_HUMAN	S	207	ENSP00000274026:T207S	ENSP00000274026:T207S	T	-	2	0	CCNA2	122961321	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	7.859000	0.86982	1.508000	0.48769	0.655000	0.94253	ACT		0.348	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256712.2	NM_001237	
DCHS2	54798	broad.mit.edu	37	4	155237075	155237075	+	Silent	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr4:155237075C>T	ENST00000357232.4	-	15	3719	c.3720G>A	c.(3718-3720)ctG>ctA	p.L1240L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1240	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L1240L(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CATCCAGTGCCAGAACAGTCA	0.398																																					p.L1240L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3720A	4						.						129.0	123.0	125.0					4																	155237075		2203	4300	6503	155456525	SO:0001819	synonymous_variant	54798	exon15			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3720G>A	4.37:g.155237075C>T			155456525	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																				0.398	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
UNC5C	8633	broad.mit.edu	37	4	96140415	96140415	+	Missense_Mutation	SNP	T	T	G			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr4:96140415T>G	ENST00000453304.1	-	9	1698	c.1350A>C	c.(1348-1350)agA>agC	p.R450S	UNC5C_ENST00000506749.1_Missense_Mutation_p.R469S	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	450					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.R450S(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		AGACAGGTCCTCTGTACATGG	0.488																																					p.R450S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1350C	4						.						259.0	254.0	256.0					4																	96140415		2203	4300	6503	96359438	SO:0001583	missense	8633	exon9			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1350A>C	4.37:g.96140415T>G	ENSP00000406022:p.Arg450Ser		96359438	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	T	13.75	2.329012	0.41197	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.56611	0.78;0.45;0.49	5.21	-5.49	0.02584	.	0.000000	0.85682	D	0.000000	T	0.50000	0.1590	L	0.55990	1.75	0.80722	D	1	D;P;P	0.56287	0.975;0.919;0.651	P;B;B	0.55161	0.77;0.214;0.115	T	0.58769	-0.7578	10	0.20046	T	0.44	.	10.6601	0.45698	0.0:0.5507:0.1015:0.3478	.	450;469;450	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	S	450;409;469;469	ENSP00000406022:R450S;ENSP00000426924:R469S;ENSP00000426153:R469S	ENSP00000328673:R409S	R	-	3	2	UNC5C	96359438	0.178000	0.23122	0.966000	0.40874	0.973000	0.67179	-0.524000	0.06222	-0.917000	0.03813	-0.256000	0.11100	AGA		0.488	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
TRIML1	339976	broad.mit.edu	37	4	189068102	189068102	+	Missense_Mutation	SNP	C	C	T	rs147254109		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr4:189068102C>T	ENST00000332517.3	+	6	1123	c.983C>T	c.(982-984)gCg>gTg	p.A328V	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	328	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A328V(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GACCAGTCTGCGACTGTGCTG	0.537													c|||	1	0.000199681	0.0008	0.0	5008	,	,		17404	0.0		0.0	False		,,,				2504	0.0				p.A328V	Melanoma(31;213 1036 16579 23968 32372)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C983T	4						.	C	VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	98.0	92.0	94.0		983	4.9	1.0	4	dbSNP_134	94	0,8600		0,0,4300	no	missense	TRIML1	NM_178556.3	64	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	328/469	189068102	2,13004	2203	4300	6503	189305096	SO:0001583	missense	339976	exon6			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.983C>T	4.37:g.189068102C>T	ENSP00000327738:p.Ala328Val		189305096	NM_178556	Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	37	CCDS3851.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	c	12.92	2.081718	0.36758	4.54E-4	0.0	ENSG00000184108	ENST00000332517	T	0.12147	2.71	4.92	4.92	0.64577	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.53938	D	0.000060	T	0.11707	0.0285	L	0.42008	1.315	0.32138	N	0.585837	P	0.48834	0.916	B	0.42422	0.387	T	0.04041	-1.0982	10	0.17369	T	0.5	-22.406	9.4112	0.38494	0.0:0.9057:0.0:0.0943	.	328	Q8N9V2	TRIML_HUMAN	V	328	ENSP00000327738:A328V	ENSP00000327738:A328V	A	+	2	0	TRIML1	189305096	0.000000	0.05858	0.970000	0.41538	0.418000	0.31294	0.050000	0.14120	2.749000	0.94314	0.550000	0.68814	GCG		0.537	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	
APC	324	broad.mit.edu	37	5	112174631	112174631	+	Nonsense_Mutation	SNP	C	C	T	rs121913331		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:112174631C>T	ENST00000457016.1	+	16	3720	c.3340C>T	c.(3340-3342)Cga>Tga	p.R1114*	APC_ENST00000508376.2_Nonsense_Mutation_p.R1114*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.R1114*			P25054	APC_HUMAN	adenomatous polyposis coli	1114	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1114*(30)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAACAAATCGAGTGGGTTC	0.403	R1114*(LOVO_LARGE_INTESTINE)|R1114*(SW948_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1096X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0 	.	31	Substitution - Nonsense(30)|Unknown(1)	large_intestine(29)|ovary(1)|skin(1)	c.C3286T	5	GRCh37	CM920048	APC	M	rs121913331	.						90.0	82.0	85.0					5																	112174631		2202	4300	6502	112202530	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3340C>T	5.37:g.112174631C>T	ENSP00000413133:p.Arg1114*		112202530	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	6.950292	0.97956	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.76	4.88	0.63580	.	0.190581	0.42172	D	0.000759	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.7869	14.0911	0.64990	0.3279:0.6721:0.0:0.0	.	.	.	.	X	1114;1096;1114;1114;1114	.	ENSP00000257430:R1114X	R	+	1	2	APC	112202530	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.208000	0.42797	1.423000	0.47198	0.655000	0.94253	CGA		0.403	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PSD2	84249	broad.mit.edu	37	5	139221938	139221938	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:139221938G>A	ENST00000274710.3	+	15	2400	c.2195G>A	c.(2194-2196)cGg>cAg	p.R732Q		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	732					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.R732Q(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTGAGGCCCGGCTGGCCACT	0.542																																					p.R732Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2195A	5						.						62.0	62.0	62.0					5																	139221938		2203	4300	6503	139202122	SO:0001583	missense	84249	exon15			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.2195G>A	5.37:g.139221938G>A	ENSP00000274710:p.Arg732Gln		139202122	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	G	14.45	2.540256	0.45176	.	.	ENSG00000146005	ENST00000274710	T	0.11063	2.81	5.91	5.91	0.95273	.	2.058620	0.02013	N	0.047193	T	0.09555	0.0235	N	0.17082	0.46	0.27562	N	0.950156	D	0.53312	0.959	B	0.41088	0.347	T	0.19778	-1.0295	10	0.11182	T	0.66	.	12.7402	0.57249	0.0747:0.0:0.9253:0.0	.	732	Q9BQI7	PSD2_HUMAN	Q	732	ENSP00000274710:R732Q	ENSP00000274710:R732Q	R	+	2	0	PSD2	139202122	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.997000	0.63921	2.793000	0.96121	0.655000	0.94253	CGG		0.542	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHA3	56145	broad.mit.edu	37	5	140181080	140181080	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:140181080G>A	ENST00000522353.2	+	1	298	c.298G>A	c.(298-300)Gcg>Acg	p.A100T	PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.A100T	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A100T(2)		NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCGGAGCGCGGAGTGCAG	0.547																																					p.A100T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G298A	5						.						128.0	142.0	137.0					5																	140181080		2203	4300	6503	140161264	SO:0001583	missense	56145	exon1			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.298G>A	5.37:g.140181080G>A	ENSP00000429808:p.Ala100Thr		140161264	NM_031497	O75286	Missense_Mutation	SNP	ENST00000522353.2	37	CCDS54915.1	.	.	.	.	.	.	.	.	.	.	N	0.144	-1.099328	0.01843	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.27104	1.69;1.69	4.35	-4.24	0.03777	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	1.871880	0.04948	U	0.459684	T	0.16171	0.0389	L	0.35854	1.095	0.09310	N	1	B;B	0.30033	0.266;0.081	B;B	0.26614	0.071;0.036	T	0.19582	-1.0301	10	0.46703	T	0.11	.	2.7254	0.05212	0.1866:0.3332:0.3163:0.1639	.	100;100	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	T	100	ENSP00000429808:A100T;ENSP00000434086:A100T	ENSP00000429808:A100T	A	+	1	0	PCDHA3	140161264	0.000000	0.05858	0.044000	0.18714	0.017000	0.09413	-3.000000	0.00653	-0.937000	0.03719	-2.769000	0.00120	GCG		0.547	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PCDHA7	56141	broad.mit.edu	37	5	140215967	140215967	+	Missense_Mutation	SNP	G	G	T	rs377524749		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:140215967G>T	ENST00000525929.1	+	1	1999	c.1999G>T	c.(1999-2001)Gtg>Ttg	p.V667L	PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.V667L|PCDHA5_ENST00000529859.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	667	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V667L(2)		NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCGTGCTGGTGTCGCTGGT	0.652																																					p.V667L	NSCLC(160;258 2013 5070 22440 28951)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1999T	5						.						69.0	71.0	70.0					5																	140215967		2203	4299	6502	140196151	SO:0001583	missense	56141	exon1			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1999G>T	5.37:g.140215967G>T	ENSP00000436426:p.Val667Leu		140196151	NM_018910	O75282	Missense_Mutation	SNP	ENST00000525929.1	37	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	3.585	-0.084754	0.07097	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.53857	0.6;0.6	3.57	-2.97	0.05530	Cadherin (4);Cadherin-like (1);	1.190300	0.06945	N	0.813508	T	0.53465	0.1798	L	0.55017	1.72	0.09310	N	1	B;B	0.25312	0.123;0.026	B;B	0.41374	0.355;0.052	T	0.57057	-0.7876	10	0.19147	T	0.46	.	11.2323	0.48920	0.1765:0.1673:0.6562:0.0	.	667;667	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	L	667	ENSP00000436426:V667L;ENSP00000367365:V667L	ENSP00000367365:V667L	V	+	1	0	PCDHA7	140196151	0.000000	0.05858	0.987000	0.45799	0.158000	0.22134	-0.835000	0.04386	-0.364000	0.08088	-0.502000	0.04539	GTG		0.652	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHB7	56129	broad.mit.edu	37	5	140553366	140553366	+	Missense_Mutation	SNP	T	T	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:140553366T>C	ENST00000231137.3	+	1	1124	c.950T>C	c.(949-951)tTa>tCa	p.L317S		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	317	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L317S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTTACACATTAACTATTCAG	0.428																																					p.L317S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T950C	5						.						68.0	72.0	71.0					5																	140553366		2203	4300	6503	140533550	SO:0001583	missense	56129	exon1			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.950T>C	5.37:g.140553366T>C	ENSP00000231137:p.Leu317Ser		140533550	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	T	17.16	3.319750	0.60524	.	.	ENSG00000113212	ENST00000231137;ENST00000543636	T	0.68025	-0.3	4.61	4.61	0.57282	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.82742	0.5103	M	0.94021	3.485	0.34263	D	0.680107	D	0.53151	0.958	P	0.55455	0.776	D	0.91295	0.5062	9	0.87932	D	0	.	13.9717	0.64245	0.0:0.0:0.0:1.0	.	317	Q9Y5E2	PCDB7_HUMAN	S	317;100	ENSP00000231137:L317S	ENSP00000231137:L317S	L	+	2	0	PCDHB7	140533550	0.983000	0.35010	0.978000	0.43139	0.497000	0.33675	7.993000	0.88291	1.823000	0.53134	0.533000	0.62120	TTA		0.428	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
HTR4	3360	broad.mit.edu	37	5	147830828	147830828	+	Missense_Mutation	SNP	C	C	T	rs201201172		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:147830828C>T	ENST00000521530.1	-	6	1089	c.1084G>A	c.(1084-1086)Gtt>Att	p.V362I	HTR4_ENST00000521735.1_3'UTR|HTR4_ENST00000314512.6_3'UTR|HTR4_ENST00000354217.2_Missense_Mutation_p.V362I	NM_001040169.2	NP_001035259.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	362					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.V362I(1)		endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	CTGTGCAGAACGGTGTACCTA	0.483																																					p.V362I	GBM(120;370 1604 14007 17804 41573)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1084A	5						.	C	ILE/VAL,	1,4405	2.1+/-5.4	0,1,2202	321.0	284.0	297.0		1084,	4.4	1.0	5		297	0,8600		0,0,4300	no	missense,utr-3	HTR4	NM_001040169.2,NM_199453.3	29,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	362/388,	147830828	1,13005	2203	4300	6503	147811021	SO:0001583	missense	3360	exon6			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000521530.1:c.1084G>A	5.37:g.147830828C>T	ENSP00000428320:p.Val362Ile		147811021	NM_001040169	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	ENST00000521530.1	37	CCDS34270.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.955586	0.34471	2.27E-4	0.0	ENSG00000164270	ENST00000521530;ENST00000354217	T;T	0.71222	-0.55;-0.55	5.25	4.39	0.52855	.	.	.	.	.	T	0.55065	0.1897	.	.	.	0.80722	D	1	B	0.17268	0.021	B	0.13407	0.009	T	0.48163	-0.9059	8	0.20046	T	0.44	.	9.5818	0.39493	0.0:0.906:0.0:0.094	.	362	Q13639-2	.	I	362	ENSP00000428320:V362I;ENSP00000346156:V362I	ENSP00000346156:V362I	V	-	1	0	HTR4	147811021	1.000000	0.71417	1.000000	0.80357	0.509000	0.34042	3.204000	0.51082	1.439000	0.47511	0.650000	0.86243	GTT		0.483	HTR4-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374174.3	NM_000870	
FASTKD3	79072	broad.mit.edu	37	5	7867378	7867378	+	Missense_Mutation	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:7867378G>C	ENST00000264669.5	-	2	955	c.819C>G	c.(817-819)caC>caG	p.H273Q	MTRR_ENST00000264668.2_5'Flank|MTRR_ENST00000341013.6_5'Flank|FASTKD3_ENST00000513658.1_Intron|MTRR_ENST00000502509.1_Intron|MTRR_ENST00000440940.2_5'Flank	NM_024091.3	NP_076996.2	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	273					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)	p.H273Q(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AAAATGTTTGGTGTTCATCCA	0.373																																					p.H273Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C819G	5						.						84.0	95.0	91.0					5																	7867378		2202	4300	6502	7920378	SO:0001583	missense	79072	exon2			AK026927	CCDS3873.1	5p15.31	2008-02-05			ENSG00000124279	ENSG00000124279			28758	protein-coding gene	gene with protein product						12477932	Standard	NM_024091		Approved	MGC5297, FLJ23274	uc003jeb.3	Q14CZ7	OTTHUMG00000131029	ENST00000264669.5:c.819C>G	5.37:g.7867378G>C	ENSP00000264669:p.His273Gln		7920378	NM_024091	Q9BVD3	Missense_Mutation	SNP	ENST00000264669.5	37	CCDS3873.1	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475566	0.26511	.	.	ENSG00000124279	ENST00000264669	T	0.13778	2.56	4.85	1.96	0.26148	.	0.452145	0.26680	N	0.023041	T	0.10337	0.0253	L	0.41027	1.25	0.35810	D	0.82381	B	0.18863	0.031	B	0.12156	0.007	T	0.16335	-1.0406	10	0.28530	T	0.3	-2.1259	8.7069	0.34360	0.1423:0.124:0.7336:0.0	.	273	Q14CZ7	FAKD3_HUMAN	Q	273	ENSP00000264669:H273Q	ENSP00000264669:H273Q	H	-	3	2	FASTKD3	7920378	1.000000	0.71417	0.066000	0.19879	0.521000	0.34408	1.584000	0.36589	0.600000	0.29862	0.650000	0.86243	CAC		0.373	FASTKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253673.1	NM_024091	
SGCD	6444	broad.mit.edu	37	5	156186373	156186373	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr5:156186373G>T	ENST00000435422.3	+	8	1329	c.842G>T	c.(841-843)tGt>tTt	p.C281F	SGCD_ENST00000337851.4_Missense_Mutation_p.C282F	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	281					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.C282F(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GGGTCCACTTGTCAGATAAAC	0.502																																					p.C282F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G845T	5						.						124.0	118.0	120.0					5																	156186373		1942	4154	6096	156118951	SO:0001583	missense	6444	exon9			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.842G>T	5.37:g.156186373G>T	ENSP00000403003:p.Cys281Phe		156118951	NM_000337	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	ENST00000435422.3	37	CCDS47327.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528235	0.85706	.	.	ENSG00000170624	ENST00000435422;ENST00000337851	D;D	0.96200	-3.94;-3.94	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.97617	0.9219	M	0.77616	2.38	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.81914	0.995;0.991	D	0.98406	1.0570	10	0.87932	D	0	-2.0736	18.5207	0.90951	0.0:0.0:1.0:0.0	.	281;282	Q92629;Q92629-2	SGCD_HUMAN;.	F	281;282	ENSP00000403003:C281F;ENSP00000338343:C282F	ENSP00000338343:C282F	C	+	2	0	SGCD	156118951	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.282000	0.95840	2.447000	0.82792	0.655000	0.94253	TGT		0.502	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3		
HIST1H2BF	8343	broad.mit.edu	37	6	26199888	26199888	+	Silent	SNP	C	C	T	rs368844614		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr6:26199888C>T	ENST00000359985.1	+	1	141	c.102C>T	c.(100-102)cgC>cgT	p.R34R	HIST1H3D_ENST00000377831.5_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	34					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R34R(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				AGCGTAGCCGCAAGGAGAGCT	0.552																																					p.R34R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102T	6						.						199.0	182.0	188.0					6																	26199888		2203	4300	6503	26307867	SO:0001819	synonymous_variant	8343	exon1			Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.102C>T	6.37:g.26199888C>T			26307867	NM_003522	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000359985.1	37	CCDS4592.1																																																																																				0.552	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040108.1	NM_003522	
PKHD1	5314	broad.mit.edu	37	6	51890747	51890747	+	Silent	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr6:51890747C>T	ENST00000371117.3	-	32	4136	c.3861G>A	c.(3859-3861)gtG>gtA	p.V1287V	PKHD1_ENST00000340994.4_Silent_p.V1287V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1287	IPT/TIG 7.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.V1287V(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGCCTTTCCCCACCAAGCTTG	0.587																																					p.V1287V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3861A	6						.						87.0	78.0	81.0					6																	51890747		2203	4300	6503	51998706	SO:0001819	synonymous_variant	5314	exon32			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3861G>A	6.37:g.51890747C>T			51998706	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	37	CCDS4935.1																																																																																				0.587	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
SLC22A16	85413	broad.mit.edu	37	6	110768160	110768160	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr6:110768160G>T	ENST00000368919.3	-	3	633	c.567C>A	c.(565-567)agC>agA	p.S189R	SLC22A16_ENST00000439654.1_Missense_Mutation_p.S189R|SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000330550.4_Missense_Mutation_p.S155R	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	189					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.S189R(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	ACATGCTACTGCTTGTGGCCC	0.448																																					p.S189R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C567A	6						.						75.0	69.0	71.0					6																	110768160		2203	4300	6503	110874853	SO:0001583	missense	85413	exon3				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.567C>A	6.37:g.110768160G>T	ENSP00000357915:p.Ser189Arg		110874853	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	ENST00000368919.3	37	CCDS5084.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393413	0.42410	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378;ENST00000424139	T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.14	4.28	0.50868	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.040736	0.85682	D	0.000000	T	0.66733	0.2819	M	0.81239	2.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.988	T	0.71087	-0.4694	10	0.56958	D	0.05	.	9.6886	0.40114	0.1705:0.0:0.8295:0.0	.	189;155	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	R	189;106;155;189;19;146;146	ENSP00000357915:S189R;ENSP00000395642:S106R;ENSP00000328583:S155R;ENSP00000408799:S189R;ENSP00000409306:S19R;ENSP00000416310:S146R;ENSP00000401007:S146R	ENSP00000328583:S155R	S	-	3	2	SLC22A16	110874853	1.000000	0.71417	0.844000	0.33320	0.088000	0.18126	4.494000	0.60347	1.171000	0.42768	0.561000	0.74099	AGC		0.448	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
SNX13	23161	broad.mit.edu	37	7	17915406	17915406	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr7:17915406C>A	ENST00000409389.1	-	6	620	c.448G>T	c.(448-450)Gaa>Taa	p.E150*	SNX13_ENST00000428135.3_Nonsense_Mutation_p.E150*			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	150	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.E150*(1)		breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					CAGTCTATTTCTTTTGACCTT	0.294																																					p.E150X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G448T	7						.						90.0	78.0	81.0					7																	17915406		1812	4069	5881	17881931	SO:0001587	stop_gained	23161	exon6			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.448G>T	7.37:g.17915406C>A	ENSP00000386705:p.Glu150*		17881931	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Nonsense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	C	38	6.743683	0.97805	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-17.3541	19.0612	0.93093	0.0:1.0:0.0:0.0	.	.	.	.	X	150;150;198	.	ENSP00000242044:E198X	E	-	1	0	SNX13	17881931	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.085000	0.76875	2.488000	0.83962	0.655000	0.94253	GAA		0.294	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
WBSCR17	64409	broad.mit.edu	37	7	71130575	71130575	+	Silent	SNP	G	G	A	rs575395276		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr7:71130575G>A	ENST00000333538.5	+	7	1894	c.1260G>A	c.(1258-1260)ccG>ccA	p.P420P	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	420					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.P420P(2)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGAACCTGCCGCTGGAGGTAG	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		17651	0.0		0.0	False		,,,				2504	0.001				p.P420P												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G1260A	7						.						72.0	59.0	64.0					7																	71130575		2203	4300	6503	70768511	SO:0001819	synonymous_variant	64409	exon7			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1260G>A	7.37:g.71130575G>A			70768511	NM_022479	Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	37	CCDS5540.1																																																																																				0.478	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
PCLO	27445	broad.mit.edu	37	7	82579559	82579559	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr7:82579559C>T	ENST00000333891.9	-	6	10682	c.10345G>A	c.(10345-10347)Gac>Aac	p.D3449N	PCLO_ENST00000423517.2_Missense_Mutation_p.D3449N|PCLO_ENST00000437081.1_Missense_Mutation_p.D169N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.D3449N(1)|p.D3380N(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCATCTTCGTCATCCGTTTGT	0.438																																					p.D3449N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G10345A	7						.						126.0	117.0	120.0					7																	82579559		1952	4153	6105	82417495	SO:0001583	missense	27445	exon6			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10345G>A	7.37:g.82579559C>T	ENSP00000334319:p.Asp3449Asn		82417495	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653297	0.67472	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.35421	1.41;1.42;1.31	5.73	5.73	0.89815	.	.	.	.	.	T	0.62527	0.2435	M	0.71036	2.16	0.49687	D	0.999813	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77004	0.922;0.982;0.989	T	0.63945	-0.6522	9	0.87932	D	0	.	19.8991	0.96978	0.0:1.0:0.0:0.0	.	3380;3449;3449	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	N	3380;3449;3449;169	ENSP00000334319:D3449N;ENSP00000388393:D3449N;ENSP00000393760:D169N	ENSP00000334319:D3449N	D	-	1	0	PCLO	82417495	1.000000	0.71417	0.923000	0.36655	0.857000	0.48899	7.640000	0.83355	2.708000	0.92522	0.655000	0.94253	GAC		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
IKBKB	3551	broad.mit.edu	37	8	42174366	42174366	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr8:42174366G>T	ENST00000520810.1	+	11	1255	c.1069G>T	c.(1069-1071)Gcg>Tcg	p.A357S	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000379708.3_Missense_Mutation_p.A134S|IKBKB_ENST00000520835.1_Missense_Mutation_p.A355S|IKBKB_ENST00000416505.2_Missense_Mutation_p.A298S	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	357					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)	p.A357S(1)		breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	GCTGCAGGAAGCGGGCCTGGC	0.577																																					p.A357S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1069T	8						.						84.0	77.0	80.0					8																	42174366		2203	4300	6503	42293523	SO:0001583	missense	3551	exon11			AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.1069G>T	8.37:g.42174366G>T	ENSP00000430684:p.Ala357Ser		42293523	NM_001190722	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036448	0.35893	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.46	5.46	0.80206	Ubiquitin supergroup (1);	0.050505	0.85682	D	0.000000	T	0.27798	0.0684	L	0.28556	0.865	0.46222	D	0.998936	B;B;B;B;B;B	0.27498	0.18;0.013;0.064;0.004;0.007;0.007	B;B;B;B;B;B	0.20577	0.03;0.02;0.025;0.004;0.009;0.005	T	0.06752	-1.0809	10	0.07175	T	0.84	.	14.1495	0.65373	0.0:0.0:0.8499:0.1501	.	298;355;134;308;357;357	B4E0U4;O14920-2;B3KRB7;Q59GL9;O14920;Q32ND9	.;.;.;.;IKKB_HUMAN;.	S	357;298;355;134	ENSP00000430684:A357S;ENSP00000404920:A298S;ENSP00000430868:A355S;ENSP00000369030:A134S	ENSP00000369030:A134S	A	+	1	0	IKBKB	42293523	1.000000	0.71417	0.845000	0.33349	0.837000	0.47467	3.412000	0.52679	2.719000	0.93026	0.650000	0.86243	GCG		0.577	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
ZFHX4	79776	broad.mit.edu	37	8	77775880	77775880	+	Silent	SNP	G	G	T	rs374859191		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr8:77775880G>T	ENST00000521891.2	+	11	10378	c.9930G>T	c.(9928-9930)ctG>ctT	p.L3310L	ZFHX4_ENST00000455469.2_Silent_p.L3265L|ZFHX4_ENST00000518282.1_Silent_p.L3284L|ZFHX4_ENST00000050961.6_Silent_p.L3261L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.L3294L(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGGCAGGTCTGTCCCCAGGTG	0.552										HNSCC(33;0.089)																											p.L3310L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9930T	8						.	G		1,3897		0,1,1948	28.0	30.0	29.0		9930	4.2	1.0	8		29	0,8296		0,0,4148	no	coding-synonymous	ZFHX4	NM_024721.4		0,1,6096	TT,TG,GG		0.0,0.0257,0.0082		3310/3617	77775880	1,12193	1949	4148	6097	77938435	SO:0001819	synonymous_variant	79776	exon11				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9930G>T	8.37:g.77775880G>T			77938435	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				0.552	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
KCNV2	169522	broad.mit.edu	37	9	2717857	2717857	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:2717857C>T	ENST00000382082.3	+	1	356	c.118C>T	c.(118-120)Cag>Tag	p.Q40*		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	40					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.Q40*(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		TTCCGGCTCCCAGGCCAGCAT	0.617																																					p.Q40X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C118T	9						.						105.0	99.0	101.0					9																	2717857		2203	4300	6503	2707857	SO:0001587	stop_gained	169522	exon1			AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.118C>T	9.37:g.2717857C>T	ENSP00000371514:p.Gln40*		2707857	NM_133497	Q5T6X0	Nonsense_Mutation	SNP	ENST00000382082.3	37	CCDS6447.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816430	0.90790	.	.	ENSG00000168263	ENST00000423608;ENST00000382082	.	.	.	4.92	4.92	0.64577	.	2.309250	0.01690	N	0.026631	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	10.0213	0.42044	0.1537:0.6977:0.1486:0.0	.	.	.	.	X	40	.	ENSP00000371514:Q40X	Q	+	1	0	KCNV2	2707857	0.847000	0.29606	1.000000	0.80357	0.318000	0.28184	1.486000	0.35530	2.546000	0.85860	0.467000	0.42956	CAG		0.617	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
ADAMTSL1	92949	broad.mit.edu	37	9	18684799	18684799	+	Splice_Site	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:18684799G>C	ENST00000380548.4	+	13	1913		c.e13+1		ADAMTSL1_ENST00000276935.6_Splice_Site|ADAMTSL1_ENST00000327883.7_Silent_p.S525S	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1							proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AGGAGCCCTCGTAAGTTGTAA	0.433																																					p.S525S												.	.	2	Unknown(2)	large_intestine(2)	c.G1575C	9						.						71.0	72.0	72.0					9																	18684799		2203	4300	6503	18674799	SO:0001630	splice_region_variant	92949	exon13			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.1574+1G>C	9.37:g.18684799G>C			18674799	NM_052866	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Splice_Site	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468463	0.84533	.	.	ENSG00000178031	ENST00000380548;ENST00000276935	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0256	0.92931	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTSL1	18674799	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	8.802000	0.91910	2.516000	0.84829	0.563000	0.77884	.		0.433	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		Intron
DNAJB5	25822	broad.mit.edu	37	9	34993435	34993435	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:34993435G>A	ENST00000541010.1	+	1	3217	c.205G>A	c.(205-207)Gag>Aag	p.E69K	DNAJB5_ENST00000545841.1_Missense_Mutation_p.E69K|DNAJB5_ENST00000454002.2_Missense_Mutation_p.E141K|DNAJB5_ENST00000312316.5_Missense_Mutation_p.E69K|DNAJB5_ENST00000453597.3_Missense_Mutation_p.E183K|DNAJB5_ENST00000335998.3_Missense_Mutation_p.E103K			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	69					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)	p.E69K(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			CCAGTATGGGGAGGAAGGTAA	0.562																																					p.E141K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G421A	9						.						80.0	83.0	82.0					9																	34993435		2203	4300	6503	34983435	SO:0001583	missense	25822	exon2			AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.205G>A	9.37:g.34993435G>A	ENSP00000443151:p.Glu69Lys		34983435	NM_001135005	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	37	CCDS35007.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935377	0.73442	.	.	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841;ENST00000539059;ENST00000443266	T;T;T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	5.31	5.31	0.75309	Heat shock protein DnaJ, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.80105	0.4562	M	0.80616	2.505	0.80722	D	1	P;P	0.45672	0.864;0.721	P;P	0.49332	0.607;0.555	T	0.82504	-0.0424	10	0.62326	D	0.03	.	18.1394	0.89634	0.0:0.0:1.0:0.0	.	141;69	B4DSA6;O75953	.;DNJB5_HUMAN	K	183;103;69;69;69;141;69;105;69	ENSP00000404079:E183K;ENSP00000337626:E103K;ENSP00000312517:E69K;ENSP00000443151:E69K;ENSP00000413684:E141K;ENSP00000441999:E69K;ENSP00000445536:E105K;ENSP00000396332:E69K	ENSP00000312517:E69K	E	+	1	0	DNAJB5	34983435	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.218000	0.95166	2.768000	0.95171	0.561000	0.74099	GAG		0.562	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1		
CEP78	84131	broad.mit.edu	37	9	80866877	80866877	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:80866877G>A	ENST00000424347.2	+	9	1412	c.1123G>A	c.(1123-1125)Gaa>Aaa	p.E375K	CEP78_ENST00000277082.5_Missense_Mutation_p.E375K|CEP78_ENST00000415759.2_Missense_Mutation_p.E376K|CEP78_ENST00000376597.4_Missense_Mutation_p.E376K|CEP78_ENST00000376598.2_Missense_Mutation_p.E375K			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	375					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)		p.E375K(1)|p.E375*(1)		breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						CCTTGGTAAAGAATATTATGC	0.433																																					p.E376K												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(2)	c.G1126A	9						.						49.0	50.0	50.0					9																	80866877		1876	4122	5998	80056697	SO:0001583	missense	84131	exon9			BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.1123G>A	9.37:g.80866877G>A	ENSP00000411284:p.Glu375Lys		80056697	NM_001098802	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Missense_Mutation	SNP	ENST00000424347.2	37		.	.	.	.	.	.	.	.	.	.	G	15.70	2.912017	0.52439	.	.	ENSG00000148019	ENST00000424347;ENST00000415085;ENST00000415759;ENST00000376597;ENST00000277082;ENST00000376598	T;T;T;T;T	0.26660	1.73;1.92;1.72;1.73;1.72	5.86	4.94	0.65067	.	0.670270	0.14998	N	0.286264	T	0.30135	0.0755	L	0.50333	1.59	0.31027	N	0.717859	P;P;P	0.42692	0.682;0.787;0.561	B;B;B	0.41510	0.197;0.359;0.109	T	0.26503	-1.0101	10	0.54805	T	0.06	-0.7423	15.9581	0.79902	0.0:0.1351:0.8649:0.0	.	376;376;375	E9PHX5;Q5JTW2-2;Q5JTW2	.;.;CEP78_HUMAN	K	375;375;376;376;375;375	ENSP00000411284:E375K;ENSP00000399286:E376K;ENSP00000365782:E376K;ENSP00000277082:E375K;ENSP00000365783:E375K	ENSP00000277082:E375K	E	+	1	0	CEP78	80056697	1.000000	0.71417	0.873000	0.34254	0.429000	0.31625	6.269000	0.72558	1.446000	0.47643	0.655000	0.94253	GAA		0.433	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991	
SHC3	53358	broad.mit.edu	37	9	91652926	91652926	+	Silent	SNP	G	G	C			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:91652926G>C	ENST00000375835.4	-	11	1944	c.1638C>G	c.(1636-1638)ctC>ctG	p.L546L	SHC3_ENST00000375831.1_Silent_p.L94L|SHC3_ENST00000375830.1_Silent_p.L94L	NM_016848.5	NP_058544.3	Q92529	SHC3_HUMAN	SHC (Src homology 2 domain containing) transforming protein 3	546	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|insulin receptor signaling pathway (GO:0008286)|learning or memory (GO:0007611)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Ras protein signal transduction (GO:0007265)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	signal transducer activity (GO:0004871)	p.L546L(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|skin(3)	28						CTGGGTCCACGAGCAGCAGGT	0.612																																					p.L546L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1638G	9						.						65.0	68.0	67.0					9																	91652926		2203	4300	6503	90842746	SO:0001819	synonymous_variant	53358	exon11			D84361	CCDS6681.1	9q22.1	2013-02-14	2005-05-24		ENSG00000148082	ENSG00000148082		"""SH2 domain containing"""	18181	protein-coding gene	gene with protein product		605263	"""src homology 2 domain containing transforming protein C3"""			8808684	Standard	NM_016848		Approved	N-Shc, NSHC, SHCC	uc004aqf.2	Q92529	OTTHUMG00000020179	ENST00000375835.4:c.1638C>G	9.37:g.91652926G>C			90842746	NM_016848	Q5T7I7|Q8TAP2|Q9UCX5	Silent	SNP	ENST00000375835.4	37	CCDS6681.1																																																																																				0.612	SHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052986.1	NM_016848	
TSTD2	158427	broad.mit.edu	37	9	100364981	100364981	+	Missense_Mutation	SNP	C	C	T	rs370389075		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:100364981C>T	ENST00000341170.4	-	10	1703	c.1321G>A	c.(1321-1323)Gtt>Att	p.V441I		NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	441								p.V441I(1)		large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						CAGGTCAAAACGAGCTGGCGG	0.522																																					p.V441I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1321A	9						.						140.0	125.0	130.0					9																	100364981		2203	4300	6503	99404802	SO:0001583	missense	158427	exon10			AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.1321G>A	9.37:g.100364981C>T	ENSP00000342499:p.Val441Ile		99404802	NM_139246	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	37	CCDS6727.2	.	.	.	.	.	.	.	.	.	.	C	9.425	1.084026	0.20309	.	.	ENSG00000136925	ENST00000375173;ENST00000341170	T;T	0.23147	1.92;1.92	5.63	3.81	0.43845	.	0.125316	0.53938	N	0.000058	T	0.19765	0.0475	L	0.42008	1.315	0.80722	D	1	B	0.18166	0.026	B	0.09377	0.004	T	0.04413	-1.0953	10	0.11182	T	0.66	-11.4735	12.3491	0.55139	0.0:0.8614:0.0:0.1386	.	441	Q5T7W7	TSTD2_HUMAN	I	37;441	ENSP00000364316:V37I;ENSP00000342499:V441I	ENSP00000342499:V441I	V	-	1	0	TSTD2	99404802	0.957000	0.32711	0.142000	0.22268	0.528000	0.34623	1.876000	0.39588	0.871000	0.35750	-0.137000	0.14449	GTT		0.522	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246	
TNC	3371	broad.mit.edu	37	9	117853061	117853061	+	Silent	SNP	C	C	T	rs149512169		TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chr9:117853061C>T	ENST00000350763.4	-	2	648	c.237G>A	c.(235-237)ccG>ccA	p.P79P	TNC_ENST00000542877.1_Silent_p.P79P|TNC_ENST00000535648.1_Silent_p.P79P|TNC_ENST00000537320.1_Silent_p.P79P|TNC_ENST00000345230.3_Silent_p.P79P|TNC_ENST00000341037.4_Silent_p.P79P|TNC_ENST00000346706.3_Silent_p.P79P|TNC_ENST00000340094.3_Silent_p.P79P|TNC_ENST00000423613.2_Silent_p.P79P	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	79					bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.P79P(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GCTCTGAAGGCGGTGCCAGGT	0.562																																					p.P79P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G237A	9						.	C		1,4405	2.1+/-5.4	0,1,2202	164.0	158.0	160.0		237	-11.9	0.0	9	dbSNP_134	160	0,8600		0,0,4300	no	coding-synonymous	TNC	NM_002160.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		79/2202	117853061	1,13005	2203	4300	6503	116892882	SO:0001819	synonymous_variant	3371	exon2				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.237G>A	9.37:g.117853061C>T			116892882	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	ENST00000350763.4	37	CCDS6811.1																																																																																				0.562	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
KAL1	3730	broad.mit.edu	37	X	8538695	8538695	+	Missense_Mutation	SNP	C	C	T	rs144634904	byFrequency	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chrX:8538695C>T	ENST00000262648.3	-	7	1056	c.907G>A	c.(907-909)Gtc>Atc	p.V303I		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	303	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.V303I(2)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						TCACTGTTGACGGTGGAGTTG	0.522																																					p.V303I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G907A	X						.	C	ILE/VAL	0,3835		0,0,0,1632,571	57.0	46.0	50.0		907	-7.1	0.0	X	dbSNP_134	50	1,6727		0,0,1,2428,1871	no	missense	KAL1	NM_000216.2	29	0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	benign	303/681	8538695	1,10562	2203	4300	6503	8498695	SO:0001583	missense	3730	exon7				CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.907G>A	X.37:g.8538695C>T	ENSP00000262648:p.Val303Ile		8498695	NM_000216	B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	37	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.118920	0.00346	0.0	1.49E-4	ENSG00000011201	ENST00000262648	T	0.59502	0.26	4.11	-7.11	0.01542	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.246520	0.05408	N	0.541834	T	0.44477	0.1295	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.38156	-0.9674	10	0.13470	T	0.59	-1.0617	14.1879	0.65617	0.0:0.4689:0.0:0.5311	.	303	P23352	KALM_HUMAN	I	303	ENSP00000262648:V303I	ENSP00000262648:V303I	V	-	1	0	KAL1	8498695	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.370000	0.07523	-1.977000	0.00994	-0.507000	0.04495	GTC		0.522	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
DMD	1756	broad.mit.edu	37	X	32381047	32381047	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chrX:32381047C>T	ENST00000357033.4	-	37	5389	c.5183G>A	c.(5182-5184)cGc>cAc	p.R1728H	DMD_ENST00000378677.2_Missense_Mutation_p.R1724H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1728	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.R1723H(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CACCTTTGGGCGTATGTCATT	0.443																																					p.R387H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1160A	X						.						152.0	117.0	129.0					X																	32381047		2202	4300	6502	32290968	SO:0001583	missense	1756	exon9			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5183G>A	X.37:g.32381047C>T	ENSP00000354923:p.Arg1728His		32290968	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.505751	0.44558	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.52057	0.68;0.68	5.24	5.24	0.73138	.	0.214218	0.22803	U	0.055451	T	0.33847	0.0877	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B	0.18863	0.022;0.031;0.027;0.027;0.027	B;B;B;B;B	0.15484	0.007;0.012;0.013;0.013;0.013	T	0.15636	-1.0430	10	0.39692	T	0.17	.	8.4949	0.33121	0.0:0.8134:0.0:0.1866	.	1720;1728;1724;387;384	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	H	1720;387;384;1724;1728;1728;1605	ENSP00000367948:R1724H;ENSP00000354923:R1728H	ENSP00000354923:R1728H	R	-	2	0	DMD	32290968	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	1.189000	0.32114	2.164000	0.68074	0.538000	0.68166	CGC		0.443	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CPXCR1	53336	broad.mit.edu	37	X	88008648	88008648	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chrX:88008648A>T	ENST00000276127.4	+	3	492	c.233A>T	c.(232-234)aAa>aTa	p.K78I	CPXCR1_ENST00000373111.1_Missense_Mutation_p.K78I	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	78							metal ion binding (GO:0046872)	p.K78I(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						GAGATCCAAAAAGATCAACGA	0.448																																					p.K78I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A233T	X						.						40.0	37.0	38.0					X																	88008648		2203	4300	6503	87895304	SO:0001583	missense	53336	exon3			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.233A>T	X.37:g.88008648A>T	ENSP00000276127:p.Lys78Ile		87895304	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	A	12.01	1.809897	0.31961	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.26067	1.76;1.76	3.57	3.57	0.40892	.	0.699813	0.11938	N	0.514997	T	0.28001	0.0690	N	0.24115	0.695	0.09310	N	1	D	0.55385	0.971	P	0.57548	0.823	T	0.07366	-1.0776	9	.	.	.	-6.1023	7.7566	0.28927	1.0:0.0:0.0:0.0	.	78	Q8N123	CPXCR_HUMAN	I	78	ENSP00000276127:K78I;ENSP00000362203:K78I	.	K	+	2	0	CPXCR1	87895304	0.145000	0.22656	0.004000	0.12327	0.028000	0.11728	2.016000	0.40971	1.646000	0.50622	0.481000	0.45027	AAA		0.448	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
MAGEC3	139081	broad.mit.edu	37	X	140985314	140985314	+	Intron	SNP	A	A	T			TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01T-01A-21W-A096-10	TCGA-AA-A01T-11A-11W-A096-10	g.chrX:140985314A>T	ENST00000298296.1	+	7	1728				MAGEC3_ENST00000544766.1_Missense_Mutation_p.R292S|MAGEC3_ENST00000536088.1_Missense_Mutation_p.R292S|MAGEC3_ENST00000409007.1_Missense_Mutation_p.R292S|MAGEC3_ENST00000443323.2_Missense_Mutation_p.R212S	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3									p.R292S(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					GGGATCCCAGAAAGCTGCTCA	0.522																																					p.R292S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A876T	X						.						75.0	75.0	75.0					X																	140985314		2203	4300	6503	140812980	SO:0001627	intron_variant	139081	exon5			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1728+42A>T	X.37:g.140985314A>T			140812980	NM_177456	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	ENST00000298296.1	37	CCDS14676.1	.	.	.	.	.	.	.	.	.	.	a	11.18	1.561458	0.27915	.	.	ENSG00000165509	ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	T;T;T;T	0.05319	3.46;3.46;3.46;3.46	1.25	0.0372	0.14195	.	.	.	.	.	T	0.23289	0.0563	M	0.91872	3.25	0.09310	N	1	D	0.56287	0.975	D	0.65323	0.934	T	0.07309	-1.0779	8	.	.	.	.	3.5236	0.07751	0.3013:0.0:0.6987:0.0	.	292	Q3SYA7	.	S	292;212;292;292	ENSP00000441107:R292S;ENSP00000438254:R212S;ENSP00000440444:R292S;ENSP00000386566:R292S	.	R	+	3	2	MAGEC3	140812980	0.003000	0.15002	0.014000	0.15608	0.003000	0.03518	-0.029000	0.12329	0.012000	0.14892	-0.816000	0.03127	AGA		0.522	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058606.1	NM_138702	
