#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C10orf71	118461	broad.mit.edu	37	10	50530877	50530877	+	Missense_Mutation	SNP	C	C	T	rs368058122		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr10:50530877C>T	ENST00000374144.3	+	3	575	c.287C>T	c.(286-288)gCg>gTg	p.A96V	C10orf71_ENST00000323868.4_Missense_Mutation_p.A96V			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	96								p.A96V(1)		endometrium(1)	1						TCGGGCTGGGCGGCCACCTTC	0.577																																					p.A96V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C287T	10						.	C	VAL/ALA,VAL/ALA	0,3916		0,0,1958	91.0	102.0	98.0		287,287	5.1	1.0	10		98	1,8285		0,1,4142	no	missense,missense	C10orf71	NM_001135196.1,NM_199459.3	64,64	0,1,6100	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging,probably-damaging	96/1436,96/720	50530877	1,12201	1958	4143	6101	50200883	SO:0001583	missense	118461	exon3			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.287C>T	10.37:g.50530877C>T	ENSP00000363259:p.Ala96Val		50200883	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	37	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418207	0.83449	0.0	1.21E-4	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.41400	1.0;2.13	5.07	5.07	0.68467	.	0.000000	0.47852	D	0.000220	T	0.64216	0.2578	M	0.68952	2.095	0.51767	D	0.999938	D	0.89917	1.0	D	0.91635	0.999	T	0.67711	-0.5600	10	0.72032	D	0.01	.	17.4432	0.87570	0.0:1.0:0.0:0.0	.	96	Q711Q0-3	.	V	96	ENSP00000318713:A96V;ENSP00000363259:A96V	ENSP00000318713:A96V	A	+	2	0	C10orf71	50200883	0.999000	0.42202	0.976000	0.42696	0.653000	0.38743	4.610000	0.61155	2.357000	0.79964	0.563000	0.77884	GCG		0.577	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
MMP7	4316	broad.mit.edu	37	11	102401427	102401427	+	Missense_Mutation	SNP	C	C	T	rs369414554		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:102401427C>T	ENST00000260227.4	-	1	57	c.5G>A	c.(4-6)cGa>cAa	p.R2Q		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	2					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R2Q(1)		large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	CACGGTGAGTCGCATAGCTGC	0.547																																					p.R2Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5A	11						.	C	GLN/ARG	0,4406		0,0,2203	64.0	55.0	58.0		5	-10.0	0.0	11		58	1,8597	1.2+/-3.3	0,1,4298	no	missense	MMP7	NM_002423.3	43	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	2/268	102401427	1,13003	2203	4299	6502	101906637	SO:0001583	missense	4316	exon1			Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.5G>A	11.37:g.102401427C>T	ENSP00000260227:p.Arg2Gln		101906637	NM_002423	Q9BTK9	Missense_Mutation	SNP	ENST00000260227.4	37	CCDS8317.1	.	.	.	.	.	.	.	.	.	.	C	4.980	0.181930	0.09495	0.0	1.16E-4	ENSG00000137673	ENST00000260227	T	0.22743	1.94	4.98	-9.96	0.00443	.	3.324910	0.00957	N	0.003047	T	0.06781	0.0173	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.12013	0.003;0.005;0.001	B;B;B	0.04013	0.0;0.001;0.0	T	0.17961	-1.0352	10	0.18710	T	0.47	-15.1091	6.0156	0.19601	0.0901:0.456:0.0913:0.3625	.	2;2;2	B4DDW4;Q53GF1;P09237	.;.;MMP7_HUMAN	Q	2	ENSP00000260227:R2Q	ENSP00000260227:R2Q	R	-	2	0	MMP7	101906637	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.227000	0.01210	-2.462000	0.00535	-1.105000	0.02106	CGA		0.547	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109633.2		
PHLDB1	23187	broad.mit.edu	37	11	118514642	118514642	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:118514642G>A	ENST00000361417.2	+	15	3413	c.3002G>A	c.(3001-3003)cGt>cAt	p.R1001H	PHLDB1_ENST00000527898.1_Missense_Mutation_p.R37H|PHLDB1_ENST00000524713.1_Missense_Mutation_p.R144H|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000356063.5_Missense_Mutation_p.R954H	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	1001								p.R1001H(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		ACCCTGGGGCGTAGCCCCTCC	0.687																																					p.R1001H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3002A	11						.						26.0	29.0	27.0					11																	118514642		2200	4294	6494	118019852	SO:0001583	missense	23187	exon14				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.3002G>A	11.37:g.118514642G>A	ENSP00000354498:p.Arg1001His		118019852	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	G	31	5.071250	0.93950	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063;ENST00000527898;ENST00000524713	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.3	5.3	0.74995	.	0.115244	0.64402	D	0.000017	T	0.66066	0.2752	L	0.56280	1.765	0.58432	D	0.999993	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.993;0.998;0.95;0.999;0.999;0.998;0.999	T	0.65944	-0.6045	10	0.51188	T	0.08	-14.5973	18.9495	0.92636	0.0:0.0:1.0:0.0	.	139;144;365;745;954;954;1001	B7Z2B9;B4DK17;B0YJ65;Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;.;.;.;PHLB1_HUMAN	H	1001;760;365;954;37;144	ENSP00000354498:R1001H;ENSP00000348359:R954H;ENSP00000435388:R37H;ENSP00000434905:R144H	ENSP00000348359:R954H	R	+	2	0	PHLDB1	118019852	1.000000	0.71417	0.967000	0.41034	0.996000	0.88848	6.006000	0.70724	2.478000	0.83669	0.655000	0.94253	CGT		0.687	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
OR56A4	120793	broad.mit.edu	37	11	6023919	6023919	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:6023919G>A	ENST00000330728.4	-	1	505	c.460C>T	c.(460-462)Ctc>Ttc	p.L154F		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L154F(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AACATCTGGAGGAAGCAGGCT	0.532																																					p.L154F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C460T	11						.						88.0	80.0	83.0					11																	6023919		2201	4296	6497	5980495	SO:0001583	missense	120793	exon1			BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.460C>T	11.37:g.6023919G>A	ENSP00000328215:p.Leu154Phe		5980495	NM_001005179	B9EH17	Missense_Mutation	SNP	ENST00000330728.4	37	CCDS31404.1	.	.	.	.	.	.	.	.	.	.	G	8.991	0.977752	0.18812	.	.	ENSG00000183389	ENST00000330728	T	0.01599	4.74	3.34	1.37	0.22104	GPCR, rhodopsin-like superfamily (1);	0.927592	0.08691	U	0.907976	T	0.01905	0.0060	L	0.33339	1.005	0.26826	N	0.968693	B	0.12013	0.005	B	0.20577	0.03	T	0.45891	-0.9230	10	0.72032	D	0.01	.	4.6978	0.12813	0.2205:0.285:0.4945:0.0	.	102	Q8NGH8	O56A4_HUMAN	F	154	ENSP00000328215:L154F	ENSP00000328215:L154F	L	-	1	0	OR56A4	5980495	0.000000	0.05858	0.998000	0.56505	0.871000	0.50021	-1.083000	0.03397	0.212000	0.20703	-0.263000	0.10527	CTC		0.532	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179	
COPB1	1315	broad.mit.edu	37	11	14490321	14490321	+	Missense_Mutation	SNP	C	C	T	rs373743844		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:14490321C>T	ENST00000249923.3	-	16	2351	c.2051G>A	c.(2050-2052)tGc>tAc	p.C684Y	COPB1_ENST00000439561.2_Missense_Mutation_p.C684Y	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	684					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.C684Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						ATCTTCCTTGCAGTTCATTTC	0.418																																					p.C684Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2051A	11						.						213.0	191.0	199.0					11																	14490321		2200	4294	6494	14446897	SO:0001583	missense	1315	exon16			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2051G>A	11.37:g.14490321C>T	ENSP00000249923:p.Cys684Tyr		14446897	NM_016451	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.678043	0.47886	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.41758	0.99;0.99	5.09	5.09	0.68999	Coatomer, beta subunit, C-terminal (1);	0.044661	0.85682	D	0.000000	T	0.22859	0.0552	N	0.03608	-0.345	0.48452	D	0.999652	B	0.06786	0.001	B	0.12156	0.007	T	0.07597	-1.0764	10	0.59425	D	0.04	.	13.2588	0.60093	0.0:0.7045:0.2955:0.0	.	684	P53618	COPB_HUMAN	Y	684	ENSP00000249923:C684Y;ENSP00000397873:C684Y	ENSP00000249923:C684Y	C	-	2	0	COPB1	14446897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.361000	0.52306	2.381000	0.81170	0.655000	0.94253	TGC		0.418	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
ELP4	26610	broad.mit.edu	37	11	31561279	31561279	+	Silent	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:31561279G>A	ENST00000350638.5	+	3	365	c.330G>A	c.(328-330)ggG>ggA	p.G110G	ELP4_ENST00000395934.2_Silent_p.G110G|ELP4_ENST00000379163.5_Silent_p.G110G	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	110					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)	p.G110G(2)		breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					TTGTCAATGGGCATACTTTGT	0.333																																					p.G110G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G330A	11						.						194.0	164.0	173.0					11																	31561279		1818	4082	5900	31517855	SO:0001819	synonymous_variant	26610	exon3			AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.330G>A	11.37:g.31561279G>A			31517855	NM_019040	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Silent	SNP	ENST00000350638.5	37	CCDS7875.2																																																																																				0.333	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040	
PPP6R3	55291	broad.mit.edu	37	11	68305208	68305208	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:68305208G>T	ENST00000393800.2	+	3	330	c.76G>T	c.(76-78)Gag>Tag	p.E26*	PPP6R3_ENST00000265636.5_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000534534.1_Intron|PPP6R3_ENST00000265637.4_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000393799.2_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000524904.1_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000393801.3_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000529710.1_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000527403.2_Nonsense_Mutation_p.E26*|PPP6R3_ENST00000524845.1_Nonsense_Mutation_p.E26*	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	26					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)	p.E26*(2)		breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						AACACTGAAGGAGTTAATGGA	0.368																																					p.E26X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G76T	11						.						98.0	90.0	93.0					11																	68305208		2200	4294	6494	68061784	SO:0001587	stop_gained	55291	exon4			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.76G>T	11.37:g.68305208G>T	ENSP00000377389:p.Glu26*		68061784	NM_001164164	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Nonsense_Mutation	SNP	ENST00000393800.2	37	CCDS53672.1	.	.	.	.	.	.	.	.	.	.	G	37	6.029711	0.97216	.	.	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000533127;ENST00000529344;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000531244	.	.	.	4.89	4.89	0.63831	.	0.051206	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2468	0.89989	0.0:0.0:1.0:0.0	.	.	.	.	X	26	.	.	E	+	1	0	PPP6R3	68061784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.538000	0.98072	2.548000	0.85928	0.557000	0.71058	GAG		0.368	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
TECTA	7007	broad.mit.edu	37	11	121038848	121038848	+	Missense_Mutation	SNP	C	C	T	rs200977539	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr11:121038848C>T	ENST00000392793.1	+	19	5943	c.5672C>T	c.(5671-5673)aCg>aTg	p.T1891M	TECTA_ENST00000264037.2_Missense_Mutation_p.T1891M			O75443	TECTA_HUMAN	tectorin alpha	1891	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.T1891M(2)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		AGGGACCGCACGATCAATGTG	0.473													C|||	3	0.000599042	0.0008	0.0	5008	,	,		21897	0.0		0.002	False		,,,				2504	0.0				p.T1891M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C5672T	11						.	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	274.0	239.0	251.0		5672	6.2	1.0	11		251	0,8598		0,0,4299	no	missense	TECTA	NM_005422.2	81	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	1891/2156	121038848	1,13003	2203	4299	6502	120544058	SO:0001583	missense	7007	exon18			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.5672C>T	11.37:g.121038848C>T	ENSP00000376543:p.Thr1891Met		120544058	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	17.72	3.459277	0.63401	2.27E-4	0.0	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.82344	-1.6;-1.6	6.17	6.17	0.99709	Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	N	0.20483	0.58	0.47441	D	0.999422	D	0.63880	0.993	P	0.49922	0.626	T	0.80937	-0.1159	10	0.45353	T	0.12	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1891	O75443	TECTA_HUMAN	M	1891	ENSP00000376543:T1891M;ENSP00000264037:T1891M	ENSP00000264037:T1891M	T	+	2	0	TECTA	120544058	1.000000	0.71417	0.989000	0.46669	0.963000	0.63663	5.713000	0.68415	2.941000	0.99782	0.655000	0.94253	ACG		0.473	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000556131.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0 	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
ITGA7	3679	broad.mit.edu	37	12	56096855	56096855	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr12:56096855C>T	ENST00000555728.1	-	2	342	c.314G>A	c.(313-315)aGa>aAa	p.R105K	ITGA7_ENST00000347027.6_Missense_Mutation_p.R105K|ITGA7_ENST00000257879.6_Missense_Mutation_p.R105K|ITGA7_ENST00000257880.7_Missense_Mutation_p.R105K|ITGA7_ENST00000553804.1_Missense_Mutation_p.R105K|ITGA7_ENST00000394230.2_Missense_Mutation_p.R105K|ITGA7_ENST00000394229.2_Missense_Mutation_p.R105K|ITGA7_ENST00000452168.2_Intron			Q13683	ITA7_HUMAN	integrin, alpha 7	105					blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)	p.R105K(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						GATGTCCACTCTGTAGCAGTC	0.632																																					p.R105K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G314A	12						.						113.0	103.0	107.0					12																	56096855		2203	4300	6503	54383122	SO:0001583	missense	3679	exon2				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.314G>A	12.37:g.56096855C>T	ENSP00000452387:p.Arg105Lys		54383122	NM_001144996	B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	ENST00000555728.1	37		.	.	.	.	.	.	.	.	.	.	C	26.8	4.769676	0.90020	.	.	ENSG00000135424	ENST00000553804;ENST00000257879;ENST00000347027;ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000555728	D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	4.35	4.35	0.52113	.	0.068974	0.56097	D	0.000037	D	0.91253	0.7243	M	0.86178	2.8	0.53688	D	0.999977	P;D	0.54772	0.942;0.968	P;B	0.58013	0.831;0.329	D	0.92561	0.6058	10	0.66056	D	0.02	.	14.7775	0.69740	0.0:1.0:0.0:0.0	.	105;168	Q13683-3;Q4LE35	.;.	K	105	ENSP00000452120:R105K;ENSP00000257879:R105K;ENSP00000343009:R105K;ENSP00000257880:R105K;ENSP00000377777:R105K;ENSP00000377776:R105K;ENSP00000452387:R105K	ENSP00000257879:R105K	R	-	2	0	ITGA7	54383122	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.533000	0.67160	2.430000	0.82344	0.491000	0.48974	AGA		0.632	ITGA7-014	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000410138.1	NM_002206	
GLS2	27165	broad.mit.edu	37	12	56868451	56868451	+	Silent	SNP	G	G	A	rs145926460	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr12:56868451G>A	ENST00000311966.4	-	12	1379	c.1101C>T	c.(1099-1101)ctC>ctT	p.L367L	GLS2_ENST00000476991.1_5'UTR	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	367					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)	p.L367L(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CACCGTTGGCGAGGGTGGCTG	0.537													G|||	3	0.000599042	0.0	0.0014	5008	,	,		21239	0.0		0.002	False		,,,				2504	0.0				p.L367L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1101T	12						.	G		3,4403	6.2+/-15.9	0,3,2200	123.0	113.0	116.0		1101	-11.1	0.8	12	dbSNP_134	116	17,8583	13.3+/-46.6	1,15,4284	no	coding-synonymous	GLS2	NM_013267.2		1,18,6484	AA,AG,GG		0.1977,0.0681,0.1538		367/603	56868451	20,12986	2203	4300	6503	55154718	SO:0001819	synonymous_variant	27165	exon12				CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.1101C>T	12.37:g.56868451G>A			55154718	NM_013267	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Silent	SNP	ENST00000311966.4	37	CCDS8921.1																																																																																				0.537	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277113.1	NM_013267	
UTP20	27340	broad.mit.edu	37	12	101731909	101731909	+	Missense_Mutation	SNP	C	C	T	rs140749743	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr12:101731909C>T	ENST00000261637.4	+	30	3896	c.3722C>T	c.(3721-3723)gCg>gTg	p.A1241V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1241					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.A1241V(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						ATTCTCTCAGCGAAGAATCTT	0.408													C|||	2	0.000399361	0.0	0.0	5008	,	,		17022	0.0		0.002	False		,,,				2504	0.0				p.A1241V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3722T	12						.	C	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	131.0	130.0	130.0		3722	5.6	1.0	12	dbSNP_134	130	9,8591	7.1+/-27.0	0,9,4291	yes	missense	UTP20	NM_014503.2	64	0,10,6493	TT,TC,CC		0.1047,0.0227,0.0769	possibly-damaging	1241/2786	101731909	10,12996	2203	4300	6503	100256040	SO:0001583	missense	27340	exon30			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.3722C>T	12.37:g.101731909C>T	ENSP00000261637:p.Ala1241Val		100256040	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	25.2	4.615748	0.87359	2.27E-4	0.001047	ENSG00000120800	ENST00000261637	T	0.18174	2.23	5.63	5.63	0.86233	Armadillo-type fold (1);	0.105406	0.64402	D	0.000004	T	0.19005	0.0456	L	0.47716	1.5	0.58432	D	0.999999	D	0.54964	0.969	B	0.42282	0.382	T	0.03717	-1.1010	10	0.16896	T	0.51	-16.5951	19.7096	0.96089	0.0:1.0:0.0:0.0	.	1241	O75691	UTP20_HUMAN	V	1241	ENSP00000261637:A1241V	ENSP00000261637:A1241V	A	+	2	0	UTP20	100256040	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	7.469000	0.80959	2.652000	0.90054	0.655000	0.94253	GCG		0.408	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
L2HGDH	79944	broad.mit.edu	37	14	50735993	50735993	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr14:50735993C>T	ENST00000267436.4	-	7	1191	c.794G>A	c.(793-795)cGt>cAt	p.R265H	L2HGDH_ENST00000421284.3_Missense_Mutation_p.R265H|L2HGDH_ENST00000261699.4_Missense_Mutation_p.R265H			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	265					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)	p.R265H(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					CTCTGAAATACGGTCTGAGTA	0.403																																					p.R265H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	14						.						130.0	125.0	127.0					14																	50735993		2203	4300	6503	49805743	SO:0001583	missense	79944	exon7				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.794G>A	14.37:g.50735993C>T	ENSP00000267436:p.Arg265His		49805743	NM_024884	Q9BRR1	Missense_Mutation	SNP	ENST00000267436.4	37	CCDS9698.1	.	.	.	.	.	.	.	.	.	.	C	36	5.626098	0.96671	.	.	ENSG00000087299	ENST00000261699;ENST00000267436;ENST00000421284	D;D;D	0.81996	-1.56;-1.56;-1.56	5.57	5.57	0.84162	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.93631	0.7966	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.94432	0.7650	10	0.87932	D	0	-6.6394	19.9253	0.97100	0.0:1.0:0.0:0.0	.	265;265	C9JVN9;Q9H9P8	.;L2HDH_HUMAN	H	265	ENSP00000261699:R265H;ENSP00000267436:R265H;ENSP00000405559:R265H	ENSP00000261699:R265H	R	-	2	0	L2HGDH	49805743	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	5.816000	0.69222	2.793000	0.96121	0.643000	0.83706	CGT		0.403	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884	
KCNH5	27133	broad.mit.edu	37	14	63175035	63175035	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr14:63175035G>A	ENST00000322893.7	-	11	2426	c.2158C>T	c.(2158-2160)Cgg>Tgg	p.R720W	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	720					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R720W(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CCCTGATTCCGCAGCTCCTTC	0.582																																					p.R720W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2158T	14						.						112.0	110.0	111.0					14																	63175035		2203	4300	6503	62244788	SO:0001583	missense	27133	exon11			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2158C>T	14.37:g.63175035G>A	ENSP00000321427:p.Arg720Trp		62244788	NM_139318	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687024	0.48097	.	.	ENSG00000140015	ENST00000322893	T	0.18960	2.18	5.52	3.43	0.39272	.	0.068061	0.64402	D	0.000018	T	0.36908	0.0984	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	P	0.55260	0.772	T	0.38564	-0.9655	10	0.66056	D	0.02	.	14.6848	0.69042	0.0:0.0:0.624:0.376	.	720	Q8NCM2	KCNH5_HUMAN	W	720	ENSP00000321427:R720W	ENSP00000321427:R720W	R	-	1	2	KCNH5	62244788	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	3.177000	0.50871	1.279000	0.44446	0.655000	0.94253	CGG		0.582	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
ARHGAP11A	9824	broad.mit.edu	37	15	32921003	32921003	+	Splice_Site	SNP	G	G	C			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr15:32921003G>C	ENST00000361627.3	+	7	1659	c.937G>C	c.(937-939)Gcc>Ccc	p.A313P	ARHGAP11A_ENST00000543522.1_Splice_Site_p.A124P|ARHGAP11A_ENST00000565905.1_Splice_Site_p.A124P|ARHGAP11A_ENST00000563864.1_Splice_Site_p.A313P|ARHGAP11A_ENST00000567348.1_Splice_Site_p.A313P	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	313					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.A313P(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		AGAAAGAATTGGTAGGTATTT	0.244																																					p.A313P	Colon(45;757 1134 30003 36652)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937C	15						.						34.0	37.0	36.0					15																	32921003		2197	4279	6476	30708295	SO:0001630	splice_region_variant	9824	exon7			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.937+1G>C	15.37:g.32921003G>C			30708295	NM_199357	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	37	CCDS10028.1	.	.	.	.	.	.	.	.	.	.	.	11.69	1.712414	0.30322	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	D;D	0.93019	-3.15;-3.15	4.9	1.89	0.25635	.	0.464152	0.20093	N	0.099408	D	0.93851	0.8033	M	0.63428	1.95	0.43050	D	0.994656	P;D	0.57571	0.944;0.98	P;P	0.58331	0.528;0.837	D	0.91042	0.4872	10	0.39692	T	0.17	.	9.2544	0.37575	0.2453:0.0:0.7547:0.0	.	313;124	Q6P4F7;B4DZN9	RHGBA_HUMAN;.	P	313;124	ENSP00000355090:A313P;ENSP00000440073:A124P	ENSP00000355090:A313P	A	+	1	0	ARHGAP11A	30708295	1.000000	0.71417	0.473000	0.27253	0.451000	0.32288	3.720000	0.54933	0.312000	0.23038	0.467000	0.42956	GCC		0.244	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	Missense_Mutation
TEFM	79736	broad.mit.edu	37	17	29231133	29231133	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr17:29231133C>T	ENST00000581216.1	-	2	1067	c.446G>A	c.(445-447)cGg>cAg	p.R149Q	TEFM_ENST00000580840.1_Missense_Mutation_p.R149Q	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial	149					DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)	p.R149Q(1)									TCTCAGGAACCGGTTTTCCGG	0.383																																					p.R149Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G446A	17						.						61.0	58.0	59.0					17																	29231133		1815	4077	5892	26255259	SO:0001583	missense	79736	exon2				CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.446G>A	17.37:g.29231133C>T	ENSP00000462963:p.Arg149Gln		26255259	NM_024683	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	Missense_Mutation	SNP	ENST00000581216.1	37	CCDS42291.1	.	.	.	.	.	.	.	.	.	.	C	6.918	0.538966	0.13250	.	.	ENSG00000172171	ENST00000306049;ENST00000541382	.	.	.	5.54	-0.335	0.12662	.	0.765885	0.12778	N	0.439875	T	0.30039	0.0752	L	0.60455	1.87	0.09310	N	1	B;B;B	0.27971	0.123;0.196;0.059	B;B;B	0.17722	0.005;0.019;0.005	T	0.18555	-1.0333	9	0.19590	T	0.45	-17.8015	5.2395	0.15464	0.1308:0.5554:0.0:0.3137	.	149;149;149	B4DPU1;Q96QE5-4;Q96QE5	.;.;TEFM_HUMAN	Q	149	.	ENSP00000306574:R149Q	R	-	2	0	C17orf42	26255259	0.000000	0.05858	0.028000	0.17463	0.055000	0.15305	0.519000	0.22862	0.085000	0.17107	0.655000	0.94253	CGG		0.383	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444498.1	NM_024683	
AOC2	314	broad.mit.edu	37	17	40997947	40997947	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr17:40997947G>A	ENST00000253799.3	+	1	1331	c.1304G>A	c.(1303-1305)cGa>cAa	p.R435Q	AOC2_ENST00000452774.2_Missense_Mutation_p.R435Q	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	435					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.R435Q(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CTGCCCCTTCGAAGGCACCAC	0.517																																					p.R435Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1304A	17						.						94.0	87.0	90.0					17																	40997947		2203	4300	6503	38251473	SO:0001583	missense	314	exon1			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1304G>A	17.37:g.40997947G>A	ENSP00000253799:p.Arg435Gln		38251473	NM_001158	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	37	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.790575	0.50102	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.03982	3.74;3.74	5.68	4.72	0.59763	Copper amine oxidase, C-terminal (3);	0.000000	0.64402	D	0.000001	T	0.23926	0.0579	M	0.91090	3.175	0.58432	D	0.999991	D;D	0.76494	0.999;0.997	D;P	0.64506	0.926;0.866	T	0.30707	-0.9969	10	0.20046	T	0.44	-6.6011	14.4888	0.67637	0.0708:0.0:0.9292:0.0	.	435;435	O75106;O75106-2	AOC2_HUMAN;.	Q	435	ENSP00000253799:R435Q;ENSP00000406134:R435Q	ENSP00000253799:R435Q	R	+	2	0	AOC2	38251473	1.000000	0.71417	0.010000	0.14722	0.052000	0.14988	6.573000	0.74009	1.395000	0.46643	0.591000	0.81541	CGA		0.517	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
FGF11	2256	broad.mit.edu	37	17	7345133	7345133	+	Missense_Mutation	SNP	A	A	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr17:7345133A>T	ENST00000293829.4	+	3	937	c.343A>T	c.(343-345)Acc>Tcc	p.T115S	RP11-104H15.8_ENST00000576615.1_RNA|RP11-104H15.10_ENST00000575331.1_RNA|FGF11_ENST00000575082.1_5'UTR|FGF11_ENST00000575398.1_5'UTR|FGF11_ENST00000575235.1_5'UTR|RP11-104H15.7_ENST00000575310.1_RNA|FGF11_ENST00000572907.1_5'UTR	NM_004112.2	NP_004103.1	Q92914	FGF11_HUMAN	fibroblast growth factor 11	115					cell-cell signaling (GO:0007267)|nervous system development (GO:0007399)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	growth factor activity (GO:0008083)	p.T115S(1)		central_nervous_system(1)|large_intestine(3)|ovary(1)|prostate(1)	6		Prostate(122;0.157)				CCGTGTGGTCACCATCCAGAG	0.587																																					p.T115S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A343T	17						.						102.0	82.0	88.0					17																	7345133		2203	4300	6503	7285857	SO:0001583	missense	2256	exon3				CCDS11105.1	17p13.1	2008-07-18			ENSG00000161958	ENSG00000161958			3667	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 3"""	601514				8790420	Standard	NM_004112		Approved	FHF3, FLJ16061, MGC45269, MGC102953	uc002ggz.3	Q92914	OTTHUMG00000108136	ENST00000293829.4:c.343A>T	17.37:g.7345133A>T	ENSP00000293829:p.Thr115Ser		7285857	NM_004112	Q2YDX8	Missense_Mutation	SNP	ENST00000293829.4	37	CCDS11105.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.136577	0.56936	.	.	ENSG00000161958	ENST00000293829	T	0.65916	-0.18	5.13	4.06	0.47325	.	0.218806	0.48286	D	0.000195	T	0.23846	0.0577	N	0.00569	-1.365	0.80722	D	1	B;B	0.15141	0.007;0.012	B;B	0.24006	0.028;0.05	T	0.08472	-1.0720	10	0.08381	T	0.77	.	6.492	0.22121	0.8153:0.0:0.1847:0.0	.	56;115	B7Z1C3;Q92914	.;FGF11_HUMAN	S	115	ENSP00000293829:T115S	ENSP00000293829:T115S	T	+	1	0	FGF11	7285857	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.716000	0.74702	0.986000	0.38683	0.454000	0.30748	ACC		0.587	FGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226939.3	NM_004112	
UNK	85451	broad.mit.edu	37	17	73805871	73805871	+	Nonsense_Mutation	SNP	C	C	A	rs535960934	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr17:73805871C>A	ENST00000589666.1	+	2	245	c.135C>A	c.(133-135)tgC>tgA	p.C45*	UNK_ENST00000293218.3_Nonsense_Mutation_p.C121*	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	45							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.C45*(1)		cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGAGCAGTGCCCACTCTTTG	0.612																																					p.C121X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C363A	17						.						23.0	27.0	26.0					17																	73805871		2160	4281	6441	71317466	SO:0001587	stop_gained	85451	exon3			AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.135C>A	17.37:g.73805871C>A	ENSP00000464893:p.Cys45*		71317466	NM_001080419		Nonsense_Mutation	SNP	ENST00000589666.1	37	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501393	0.85176	.	.	ENSG00000132478	ENST00000293218	.	.	.	5.22	2.0	0.26442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0272	8.2522	0.31732	0.0:0.6736:0.0:0.3264	.	.	.	.	X	121	.	ENSP00000293218:C121X	C	+	3	2	UNK	71317466	0.995000	0.38212	1.000000	0.80357	0.971000	0.66376	0.518000	0.22847	0.532000	0.28657	-0.258000	0.10820	TGC		0.612	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
ZNF14	7561	broad.mit.edu	37	19	19822926	19822926	+	Missense_Mutation	SNP	C	C	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr19:19822926C>A	ENST00000344099.3	-	4	1302	c.1164G>T	c.(1162-1164)gaG>gaT	p.E388D		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	388					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E388D(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				CATAAGGTTTCTCTCCAGTAT	0.378																																					p.E388D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1164T	19						.						94.0	95.0	95.0					19																	19822926		2203	4300	6503	19683926	SO:0001583	missense	7561	exon4			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.1164G>T	19.37:g.19822926C>A	ENSP00000340514:p.Glu388Asp		19683926	NM_021030	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	37	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069628	0.55539	.	.	ENSG00000105708	ENST00000344099	T	0.26810	1.71	1.68	1.68	0.24146	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20700	0.0498	L	0.37750	1.13	0.26257	N	0.978638	B	0.15719	0.014	B	0.19946	0.027	T	0.25187	-1.0139	9	0.72032	D	0.01	.	8.892	0.35439	0.0:1.0:0.0:0.0	.	388	P17017	ZNF14_HUMAN	D	388	ENSP00000340514:E388D	ENSP00000340514:E388D	E	-	3	2	ZNF14	19683926	0.990000	0.36364	0.367000	0.25926	0.953000	0.61014	0.352000	0.20113	0.907000	0.36646	0.467000	0.42956	GAG		0.378	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
PSG8	440533	broad.mit.edu	37	19	43259170	43259170	+	Missense_Mutation	SNP	G	G	A	rs200167716		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr19:43259170G>A	ENST00000306511.4	-	4	1055	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	PSG8_ENST00000406636.3_Missense_Mutation_p.R198C|PSG8_ENST00000404209.4_Missense_Mutation_p.R320C|PSG8_ENST00000600709.1_Intron|PSG8_ENST00000401467.2_Missense_Mutation_p.R227C	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	320	Ig-like C2-type 2.					extracellular region (GO:0005576)		p.R320C(2)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GGGTAACTGCGGATGCCACCA	0.483																																					p.R198C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C592T	19						.	G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	185.0	185.0	185.0		958,592,958	-2.0	0.0	19		185	1,8597		0,1,4298	no	missense,missense,missense	PSG8	NM_001130167.1,NM_001130168.1,NM_182707.2	180,180,180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	320/420,198/298,320/427	43259170	1,13003	2203	4299	6502	47951010	SO:0001583	missense	440533	exon3			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.958C>T	19.37:g.43259170G>A	ENSP00000305005:p.Arg320Cys		47951010	NM_001130168	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	N	4.888	0.164951	0.09287	0.0	1.16E-4	ENSG00000124467	ENST00000404209;ENST00000406636;ENST00000401467;ENST00000426252;ENST00000407488;ENST00000306511	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	1.38	-1.99	0.07457	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.25494	0.0620	M	0.78285	2.405	0.09310	N	1	D;P;B;B;B;B	0.69078	0.997;0.594;0.02;0.005;0.005;0.006	P;B;B;B;B;B	0.61397	0.888;0.284;0.009;0.07;0.005;0.009	T	0.13737	-1.0498	9	0.51188	T	0.08	.	2.0334	0.03534	0.2288:0.0:0.475:0.2962	.	198;227;320;227;320;320	Q9UQ74-2;B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;.;PSG8_HUMAN;.;.;.	C	320;198;227;132;227;320	ENSP00000385869:R320C;ENSP00000385081:R198C;ENSP00000386090:R227C;ENSP00000305005:R320C	ENSP00000305005:R320C	R	-	1	0	PSG8	47951010	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.436000	0.02421	-0.117000	0.11872	-1.261000	0.01458	CGC		0.483	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
MUC16	94025	broad.mit.edu	37	19	8982158	8982158	+	Splice_Site	SNP	G	G	A	rs575816174		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr19:8982158G>A	ENST00000397910.4	-	70	42320	c.42117C>T	c.(42115-42117)aaC>aaT	p.N14039N	MUC16_ENST00000380951.5_Splice_Site_p.N680N	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14064	SEA 13. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.N14039N(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCTGCTCACCGTTAAGGTAGA	0.607													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15070	0.0		0.0	False		,,,				2504	0.0				p.N14039N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C42117T	19						.						32.0	34.0	33.0					19																	8982158		1941	4115	6056	8843158	SO:0001630	splice_region_variant	94025	exon70			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42118+1C>T	19.37:g.8982158G>A			8843158	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	G	0.757	-0.770630	0.02974	.	.	ENSG00000181143	ENST00000542240	.	.	.	3.89	-0.991	0.10235	.	.	.	.	.	T	0.37679	0.1012	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46119	-0.9214	3	.	.	.	.	7.4371	0.27162	0.5573:0.0:0.4427:0.0	.	.	.	.	M	879	.	.	T	-	2	0	MUC16	8843158	0.490000	0.26012	0.978000	0.43139	0.098000	0.18820	-0.552000	0.06020	-0.234000	0.09782	-0.438000	0.05819	ACG		0.607	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	Silent
CCDC155	147872	broad.mit.edu	37	19	49900955	49900955	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr19:49900955G>A	ENST00000447857.3	+	6	653	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	150						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.E150K(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						CTTCGGAGGCGAAGACCCCAG	0.627																																					p.E150K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G448A	19						.						102.0	118.0	113.0					19																	49900955		1998	4155	6153	54592767	SO:0001583	missense	147872	exon6				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.448G>A	19.37:g.49900955G>A	ENSP00000404220:p.Glu150Lys		54592767	NM_144688	Q96MC3	Missense_Mutation	SNP	ENST00000447857.3	37	CCDS46140.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.320810	0.60634	.	.	ENSG00000161609	ENST00000447857	T	0.41400	1.0	4.76	3.71	0.42584	.	0.075553	0.49305	N	0.000151	T	0.56485	0.1988	M	0.76574	2.34	0.30877	N	0.73188	P;P;D	0.76494	0.74;0.74;0.999	B;B;P	0.61201	0.127;0.127;0.885	T	0.60811	-0.7189	10	0.46703	T	0.11	-13.2715	8.9222	0.35619	0.1026:0.0:0.8974:0.0	.	150;150;230	C9JGW3;Q8N6L0;Q6ZRK4	.;CC155_HUMAN;.	K	150	ENSP00000404220:E150K	ENSP00000404220:E150K	E	+	1	0	CCDC155	54592767	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	3.001000	0.49488	1.351000	0.45789	0.561000	0.74099	GAA		0.627	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688	
AMIGO1	57463	broad.mit.edu	37	1	110050860	110050860	+	Silent	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:110050860G>A	ENST00000369864.4	-	2	1024	c.675C>T	c.(673-675)tgC>tgT	p.C225C	AMIGO1_ENST00000369862.1_Silent_p.C225C					adhesion molecule with Ig-like domain 1									p.C225C(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		GCTCACAGTCGCAGTTCAGGG	0.512																																					p.C225C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C675T	1						.						83.0	78.0	80.0					1																	110050860		2203	4300	6503	109852383	SO:0001819	synonymous_variant	57463	exon2				CCDS30795.1	1p13.3	2013-01-11			ENSG00000181754	ENSG00000181754		"""Immunoglobulin superfamily / V-set domain containing"""	20824	protein-coding gene	gene with protein product	"""amphoterin-induced gene and open reading frame"""	615689				12629050	Standard	NM_020703		Approved	AMIGO, KIAA1163	uc001dxx.4	Q86WK6	OTTHUMG00000011653	ENST00000369864.4:c.675C>T	1.37:g.110050860G>A			109852383	NM_020703		Silent	SNP	ENST00000369864.4	37	CCDS30795.1																																																																																				0.512	AMIGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032247.1	NM_020703	
KCNA3	3738	broad.mit.edu	37	1	111216188	111216188	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:111216188G>A	ENST00000369769.2	-	1	1467	c.1244C>T	c.(1243-1245)gCg>gTg	p.A415V		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	415					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)	p.A415V(2)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AAAGTAGACCGCGCTGGAGAA	0.572																																					p.A415V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1244T	1						.						55.0	52.0	53.0					1																	111216188		2203	4300	6503	111017711	SO:0001583	missense	3738	exon1			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1244C>T	1.37:g.111216188G>A	ENSP00000358784:p.Ala415Val		111017711	NM_002232	Q5VWN2	Missense_Mutation	SNP	ENST00000369769.2	37	CCDS828.2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.613619	0.87359	.	.	ENSG00000177272	ENST00000369769	D	0.98455	-4.94	5.91	5.91	0.95273	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.98188	0.9401	L	0.38649	1.16	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.99837	1.1058	10	0.87932	D	0	.	20.2896	0.98541	0.0:0.0:1.0:0.0	.	415	P22001	KCNA3_HUMAN	V	415	ENSP00000358784:A415V	ENSP00000358784:A415V	A	-	2	0	KCNA3	111017711	1.000000	0.71417	0.970000	0.41538	0.993000	0.82548	9.864000	0.99589	2.794000	0.96219	0.655000	0.94253	GCG		0.572	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
TDRD10	126668	broad.mit.edu	37	1	154515221	154515221	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:154515221G>A	ENST00000368480.3	+	8	512	c.427G>A	c.(427-429)Gct>Act	p.A143T	TDRD10_ENST00000479937.1_3'UTR|TDRD10_ENST00000368482.4_Missense_Mutation_p.A143T			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	143							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.A143T(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TATACAGCTCGCTCCTAAAGC	0.512																																					p.A143T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G427A	1						.						104.0	93.0	97.0					1																	154515221		2203	4300	6503	152781845	SO:0001583	missense	126668	exon8			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.427G>A	1.37:g.154515221G>A	ENSP00000357465:p.Ala143Thr		152781845	NM_182499	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	37	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	G	0.024	-1.391933	0.01185	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.21543	2.02;2.0	3.32	-0.632	0.11523	.	.	.	.	.	T	0.01558	0.0050	N	0.01576	-0.805	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.04013	0.001;0.001	T	0.47971	-0.9075	9	0.15499	T	0.54	-0.0969	6.0416	0.19738	0.5875:0.0:0.4125:0.0	.	143;143	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	T	143	ENSP00000357467:A143T;ENSP00000357465:A143T	ENSP00000357465:A143T	A	+	1	0	TDRD10	152781845	0.000000	0.05858	0.004000	0.12327	0.016000	0.09150	-0.178000	0.09782	-0.343000	0.08351	-0.403000	0.06358	GCT		0.512	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
ADAR	103	broad.mit.edu	37	1	154574859	154574859	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:154574859G>A	ENST00000368474.4	-	2	458	c.259C>T	c.(259-261)Caa>Taa	p.Q87*	ADAR_ENST00000292205.5_Nonsense_Mutation_p.Q130*|ADAR_ENST00000471068.1_5'UTR|ADAR_ENST00000368471.3_5'UTR	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	87					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.Q87*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATGTCCACTTGCCTGCCTCTG	0.602																																					p.Q87X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C259T	1						.						84.0	80.0	81.0					1																	154574859		2203	4300	6503	152841483	SO:0001587	stop_gained	103	exon2			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.259C>T	1.37:g.154574859G>A	ENSP00000357459:p.Gln87*		152841483	NM_015841	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Nonsense_Mutation	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	G	6.397	0.441356	0.12164	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000529168	.	.	.	4.56	1.61	0.23674	.	1.473130	0.03638	N	0.239035	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	0.9284	5.0041	0.14279	0.081:0.1544:0.6191:0.1454	.	.	.	.	X	130;87;82	.	ENSP00000292205:Q130X	Q	-	1	0	ADAR	152841483	0.059000	0.20769	0.001000	0.08648	0.011000	0.07611	1.412000	0.34714	0.244000	0.21351	-0.268000	0.10319	CAA		0.602	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
OR6K3	391114	broad.mit.edu	37	1	158687491	158687491	+	Missense_Mutation	SNP	G	G	A	rs550637792		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:158687491G>A	ENST00000368146.1	-	1	462	c.463C>T	c.(463-465)Cgg>Tgg	p.R155W	OR6K3_ENST00000368145.1_Missense_Mutation_p.R139W			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R155R(1)|p.R155W(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GCACAGAGCCGGGGGGTCATG	0.517																																					p.R139W												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C415T	1						.						86.0	93.0	91.0					1																	158687491		2203	4300	6503	156954115	SO:0001583	missense	391114	exon1			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.463C>T	1.37:g.158687491G>A	ENSP00000357128:p.Arg155Trp		156954115	NM_001005327	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	ENST00000368146.1	37		.	.	.	.	.	.	.	.	.	.	G	12.42	1.933544	0.34096	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.01629	4.72;4.72	4.04	-4.12	0.03916	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02119	0.0066	M	0.63843	1.955	0.09310	N	1	D	0.89917	1.0	D	0.67725	0.953	T	0.28902	-1.0029	9	0.59425	D	0.04	.	6.8375	0.23945	0.176:0.0:0.1793:0.6447	.	155	Q8NGY3	OR6K3_HUMAN	W	139;155	ENSP00000357127:R139W;ENSP00000357128:R155W	ENSP00000357127:R139W	R	-	1	2	OR6K3	156954115	.	.	0.001000	0.08648	0.222000	0.24845	.	.	-0.530000	0.06349	0.411000	0.27672	CGG		0.517	OR6K3-201	KNOWN	basic	protein_coding	protein_coding			
ADCK3	56997	broad.mit.edu	37	1	227172627	227172627	+	Silent	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:227172627C>T	ENST00000366779.1	+	18	4328	c.1557C>T	c.(1555-1557)acC>acT	p.T519T	ADCK3_ENST00000366777.3_Silent_p.T519T|ADCK3_ENST00000433743.2_Silent_p.T193T|ADCK3_ENST00000478406.1_3'UTR|ADCK3_ENST00000366778.1_Silent_p.T467T|ADCK3_ENST00000458507.2_Silent_p.T240T			Q8NI60	ADCK3_HUMAN	aarF domain containing kinase 3	519					cell death (GO:0008219)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T519T(1)|p.T240T(1)		endometrium(1)|kidney(2)|large_intestine(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	9						GATCCTTCACCGACCTCTACA	0.572																																					p.T519T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1557T	1						.						64.0	62.0	62.0					1																	227172627		2203	4300	6503	225239250	SO:0001819	synonymous_variant	56997	exon13			AJ278126	CCDS1557.1	1q42.11	2011-05-03	2010-10-01	2010-10-01	ENSG00000163050	ENSG00000163050			16812	protein-coding gene	gene with protein product	"""coenzyme Q8 homolog (yeast)"""	606980	"""chaperone-ABC1 (activity of bc1 complex, S.pombe)-like"", ""chaperone, ABC1 activity of bc1 complex like (S. pombe)"", ""chaperone, ABC1 activity of bc1 complex homolog (S. pombe)"""	CABC1			Standard	NM_020247		Approved	COQ8, SCAR9	uc001hqn.1	Q8NI60	OTTHUMG00000037621	ENST00000366779.1:c.1557C>T	1.37:g.227172627C>T			225239250	NM_020247	Q5T7A5|Q63HK0|Q8NCJ6|Q9HBQ1|Q9NQ67	Silent	SNP	ENST00000366779.1	37	CCDS1557.1																																																																																				0.572	ADCK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091712.1	NM_020247	
GIPC2	54810	broad.mit.edu	37	1	78585159	78585159	+	Silent	SNP	A	A	G			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:78585159A>G	ENST00000370759.3	+	4	883	c.690A>G	c.(688-690)aaA>aaG	p.K230K		NM_017655.4	NP_060125.4	Q8TF65	GIPC2_HUMAN	GIPC PDZ domain containing family, member 2	230						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.K230K(1)		endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)	20						TGAGATCAAAAGGTCCTGCCA	0.393																																					p.K230K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A690G	1						.						150.0	146.0	147.0					1																	78585159		2203	4300	6503	78357747	SO:0001819	synonymous_variant	54810	exon4			AB073737	CCDS685.1	1p31.1	2010-05-28			ENSG00000137960	ENSG00000137960			18177	protein-coding gene	gene with protein product	"""semaphorin cytoplasmic domain associated protein 2"""					11836570	Standard	NM_017655		Approved	FLJ20075, SEMCAP-2	uc001dik.3	Q8TF65	OTTHUMG00000041145	ENST00000370759.3:c.690A>G	1.37:g.78585159A>G			78357747	NM_017655	Q8IYD3|Q9NXS7	Silent	SNP	ENST00000370759.3	37	CCDS685.1																																																																																				0.393	GIPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098629.1	NM_017655	
OR2G2	81470	broad.mit.edu	37	1	247752053	247752053	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr1:247752053G>A	ENST00000320065.1	+	1	392	c.392G>A	c.(391-393)cGt>cAt	p.R131H	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R131H(1)		endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GCTGTCTGCCGTCCTCTCCAT	0.552																																					p.R131H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G392A	1						.						288.0	236.0	253.0					1																	247752053		2203	4300	6503	245818676	SO:0001583	missense	81470	exon1			BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.392G>A	1.37:g.247752053G>A	ENSP00000326349:p.Arg131His		245818676	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	37	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409306	0.25378	.	.	ENSG00000177489	ENST00000320065	T	0.00554	6.64	4.29	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	0.250332	0.21722	U	0.070115	T	0.00412	0.0013	L	0.28694	0.88	0.09310	N	1	B	0.21821	0.061	B	0.15870	0.014	T	0.48433	-0.9036	10	0.59425	D	0.04	.	4.8711	0.13633	0.2013:0.1753:0.6234:0.0	.	131	Q8NGZ5	OR2G2_HUMAN	H	131	ENSP00000326349:R131H	ENSP00000326349:R131H	R	+	2	0	OR2G2	245818676	0.000000	0.05858	0.153000	0.22517	0.699000	0.40488	-0.025000	0.12413	1.006000	0.39211	0.591000	0.81541	CGT		0.552	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
TGM6	343641	broad.mit.edu	37	20	2413184	2413184	+	Silent	SNP	C	C	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr20:2413184C>A	ENST00000202625.2	+	13	2077	c.2016C>A	c.(2014-2016)atC>atA	p.I672I	TGM6_ENST00000381423.1_3'UTR	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	672					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.I672I(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	AGTTTGACATCACCCCCTCCA	0.592																																					p.I672I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2016A	20						.						124.0	102.0	109.0					20																	2413184		2203	4300	6503	2361184	SO:0001819	synonymous_variant	343641	exon13			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.2016C>A	20.37:g.2413184C>A			2361184	NM_198994	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	ENST00000202625.2	37	CCDS13025.1																																																																																				0.592	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
SLC13A3	64849	broad.mit.edu	37	20	45188677	45188677	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr20:45188677G>A	ENST00000279027.4	-	13	1811	c.1793C>T	c.(1792-1794)aCa>aTa	p.T598I	SLC13A3_ENST00000435032.1_Missense_Mutation_p.T183I|SLC13A3_ENST00000396360.1_Missense_Mutation_p.T516I|SLC13A3_ENST00000472148.1_Missense_Mutation_p.T516I|SLC13A3_ENST00000413164.2_Missense_Mutation_p.T548I|SLC13A3_ENST00000495082.1_Missense_Mutation_p.T551I|SLC13A3_ENST00000290317.5_Missense_Mutation_p.T551I	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	598					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.T598I(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GGTCCGAAATGTGTCATTGGC	0.557																																					p.T548I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1643T	20						.						110.0	95.0	100.0					20																	45188677		2203	4300	6503	44622084	SO:0001583	missense	64849	exon12			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1793C>T	20.37:g.45188677G>A	ENSP00000279027:p.Thr598Ile		44622084	NM_001193339	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	ENST00000279027.4	37	CCDS13400.1	.	.	.	.	.	.	.	.	.	.	G	9.308	1.054801	0.19907	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000435032;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082	T;T;T;T;T;T;T	0.35236	3.77;3.77;1.32;4.03;3.77;3.52;3.77	4.78	3.83	0.44106	.	0.815443	0.10949	N	0.616267	T	0.33933	0.0880	L	0.46157	1.445	0.80722	D	1	B;B;B;B;B;B	0.26577	0.153;0.022;0.069;0.069;0.041;0.041	B;B;B;B;B;B	0.25759	0.043;0.03;0.063;0.063;0.028;0.028	T	0.15954	-1.0419	10	0.87932	D	0	-10.8931	10.7581	0.46249	0.0881:0.0:0.9119:0.0	.	548;183;516;551;500;598	B4DIR8;B4E181;Q8WWT9-3;F6WI18;B4DF27;Q8WWT9	.;.;.;.;.;S13A3_HUMAN	I	551;516;183;598;516;548;551	ENSP00000290317:T551I;ENSP00000379648:T516I;ENSP00000403394:T183I;ENSP00000279027:T598I;ENSP00000420177:T516I;ENSP00000415852:T548I;ENSP00000419621:T551I	ENSP00000279027:T598I	T	-	2	0	SLC13A3	44622084	1.000000	0.71417	0.019000	0.16419	0.062000	0.15995	4.460000	0.60108	1.207000	0.43291	0.655000	0.94253	ACA		0.557	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
PAK7	57144	broad.mit.edu	37	20	9561251	9561251	+	Silent	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr20:9561251G>A	ENST00000378429.3	-	5	1077	c.531C>T	c.(529-531)caC>caT	p.H177H	PAK7_ENST00000353224.5_Silent_p.H177H|RP5-986I17.2_ENST00000428769.1_RNA|PAK7_ENST00000378423.1_Silent_p.H177H	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	177	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.H177H(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			AGGCCTCCCCGTGCTTCATTT	0.458																																					p.H177H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C531T	20						.						141.0	136.0	137.0					20																	9561251		2203	4300	6503	9509251	SO:0001819	synonymous_variant	57144	exon4			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.531C>T	20.37:g.9561251G>A			9509251	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Silent	SNP	ENST00000378429.3	37	CCDS13107.1																																																																																				0.458	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
PTGIS	5740	broad.mit.edu	37	20	48124486	48124486	+	Missense_Mutation	SNP	C	C	T	rs200895888		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr20:48124486C>T	ENST00000244043.4	-	10	1503	c.1474G>A	c.(1474-1476)Gtg>Atg	p.V492M	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	492					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.V492M(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	CGGACGGGCACGTCGTGTTCC	0.632																																					p.V492M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1474A	20						.						99.0	68.0	78.0					20																	48124486		2203	4300	6503	47557893	SO:0001583	missense	5740	exon10				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.1474G>A	20.37:g.48124486C>T	ENSP00000244043:p.Val492Met		47557893	NM_000961	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	ENST00000244043.4	37	CCDS13419.1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.424824	0.43020	.	.	ENSG00000124212	ENST00000244043	T	0.01347	4.99	4.76	3.58	0.41010	.	0.467170	0.20696	N	0.087372	T	0.05410	0.0143	M	0.72479	2.2	0.29043	N	0.884963	D	0.89917	1.0	P	0.61477	0.889	T	0.01998	-1.1232	10	0.59425	D	0.04	-14.3407	9.3585	0.38182	0.0:0.8092:0.0:0.1907	.	492	Q16647	PTGIS_HUMAN	M	492	ENSP00000244043:V492M	ENSP00000244043:V492M	V	-	1	0	PTGIS	47557893	0.059000	0.20769	0.696000	0.30242	0.150000	0.21749	0.130000	0.15850	2.208000	0.71279	0.462000	0.41574	GTG		0.632	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2		
ITSN1	6453	broad.mit.edu	37	21	35254658	35254658	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr21:35254658G>A	ENST00000381318.3	+	35	4741	c.4453G>A	c.(4453-4455)Gac>Aac	p.D1485N	ITSN1_ENST00000399367.3_Missense_Mutation_p.D1480N|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Missense_Mutation_p.D1424N|ITSN1_ENST00000381285.4_Missense_Mutation_p.D1485N|ITSN1_ENST00000399326.3_3'UTR	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	1485	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D1485N(1)		breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CCTTTTCAACGACTTCCTCCT	0.483																																					p.D1485N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4453A	21						.						75.0	71.0	72.0					21																	35254658		2203	4300	6503	34176528	SO:0001583	missense	6453	exon35			AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.4453G>A	21.37:g.35254658G>A	ENSP00000370719:p.Asp1485Asn		34176528	NM_003024	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	37	CCDS33545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.524036|5.524036	0.96431|0.96431	.|.	.|.	ENSG00000205726|ENSG00000205726	ENST00000381318;ENST00000381285;ENST00000381288;ENST00000399367;ENST00000437442|ENST00000381284	T;T;T;T|.	0.49720|.	0.77;0.77;0.77;0.77|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.81588|0.81588	0.4854|0.4854	M|M	0.79123|0.79123	2.44|2.44	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	T|T	0.80627|0.80627	-0.1298|-0.1298	10|5	0.87932|.	D|.	0|.	.|.	20.0545|20.0545	0.97645|0.97645	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1424;1480;1485|.	A8CTY3;A8CTX8;Q15811|.	.;.;ITSN1_HUMAN|.	N|Q	1485;1485;1414;1480;1424|164	ENSP00000370719:D1485N;ENSP00000370685:D1485N;ENSP00000382301:D1480N;ENSP00000387377:D1424N|.	ENSP00000370685:D1485N|.	D|R	+|+	1|2	0|0	ITSN1|ITSN1	34176528|34176528	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	9.437000|9.437000	0.97535|0.97535	2.748000|2.748000	0.94277|0.94277	0.655000|0.655000	0.94253|0.94253	GAC|CGA		0.483	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
TRAPPC10	7109	broad.mit.edu	37	21	45502758	45502758	+	Missense_Mutation	SNP	G	G	T	rs367993178		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr21:45502758G>T	ENST00000291574.4	+	14	1988	c.1813G>T	c.(1813-1815)Gtt>Ttt	p.V605F		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	605					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)	p.V605F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CGTGGGCGGCGTTTTGTGCGT	0.483																																					p.V605F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1813T	21						.						194.0	163.0	173.0					21																	45502758		2203	4300	6503	44327186	SO:0001583	missense	7109	exon14			U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1813G>T	21.37:g.45502758G>T	ENSP00000291574:p.Val605Phe		44327186	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	37	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	G	9.486	1.099484	0.20552	.	.	ENSG00000160218	ENST00000291574	T	0.46451	0.87	5.58	-2.99	0.05497	.	0.845087	0.10694	N	0.644857	T	0.17577	0.0422	N	0.19112	0.55	0.09310	N	1	P	0.41159	0.74	B	0.31390	0.129	T	0.27971	-1.0058	10	0.10111	T	0.7	.	8.3648	0.32380	0.6995:0.0:0.1746:0.1259	.	605	P48553	TPC10_HUMAN	F	605	ENSP00000291574:V605F	ENSP00000291574:V605F	V	+	1	0	TRAPPC10	44327186	0.001000	0.12720	0.000000	0.03702	0.031000	0.12232	1.285000	0.33261	-0.457000	0.07033	-0.768000	0.03414	GTT		0.483	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
SEZ6L	23544	broad.mit.edu	37	22	26688853	26688853	+	Silent	SNP	G	G	A	rs368342681		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr22:26688853G>A	ENST00000248933.6	+	2	671	c.576G>A	c.(574-576)gcG>gcA	p.A192A	SEZ6L_ENST00000529632.2_Silent_p.A192A|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000343706.4_Silent_p.A192A|SEZ6L_ENST00000404234.3_Silent_p.A192A|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000360929.3_Silent_p.A192A			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	192					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)		p.A192A(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						AGGAGAGTGCGGTCCCTACAA	0.672																																					p.A192A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G576A	22						.	G	,,,,,	0,4406		0,0,2203	55.0	57.0	57.0		576,576,576,576,576,576	-8.2	0.0	22		57	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEZ6L	NM_001184773.1,NM_001184774.1,NM_001184775.1,NM_001184776.1,NM_001184777.1,NM_021115.4	,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,	192/1024,192/1014,192/1012,192/950,192/949,192/1025	26688853	1,13005	2203	4300	6503	25018853	SO:0001819	synonymous_variant	23544	exon2			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.576G>A	22.37:g.26688853G>A			25018853	NM_001184776	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	ENST00000248933.6	37	CCDS13833.1																																																																																				0.672	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
MOV10L1	54456	broad.mit.edu	37	22	50553670	50553670	+	Silent	SNP	C	C	T	rs144338444		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr22:50553670C>T	ENST00000262794.5	+	8	1337	c.1254C>T	c.(1252-1254)gaC>gaT	p.D418D	MOV10L1_ENST00000395843.1_5'UTR|MOV10L1_ENST00000540615.1_Silent_p.D398D|MOV10L1_ENST00000545383.1_Silent_p.D418D|MOV10L1_ENST00000395858.3_Silent_p.D418D	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	418					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)	p.D418D(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TCATCTGTGACGGAAAGTAAG	0.502																																					p.D418D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254T	22						.	C	,,	0,4406		0,0,2203	94.0	106.0	102.0		1254,1194,1254	-11.1	0.0	22	dbSNP_134	102	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	MOV10L1	NM_001164104.1,NM_001164105.1,NM_018995.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	418/1166,398/1166,418/1212	50553670	1,13005	2203	4300	6503	48895797	SO:0001819	synonymous_variant	54456	exon8			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1254C>T	22.37:g.50553670C>T			48895797	NM_001164104	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	CCDS14084.1																																																																																				0.502	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
KCNS3	3790	broad.mit.edu	37	2	18112824	18112824	+	Silent	SNP	C	C	T	rs201603883		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr2:18112824C>T	ENST00000403915.1	+	3	1000	c.549C>T	c.(547-549)tcC>tcT	p.S183S	KCNS3_ENST00000465292.1_Intron|KCNS3_ENST00000304101.4_Silent_p.S183S	NM_001282428.1	NP_001269357.1	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3	183					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)	p.S183S(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(11)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ACTGCCTGTCCGCTAAGCTTA	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		21342	0.001		0.0	False		,,,				2504	0.0				p.S183S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C549T	2						.						69.0	71.0	70.0					2																	18112824		2203	4300	6503	17976305	SO:0001819	synonymous_variant	3790	exon3			AF043472	CCDS1692.1	2p24	2011-07-05			ENSG00000170745	ENSG00000170745		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6302	protein-coding gene	gene with protein product		603888				10484328, 16382104	Standard	NM_002252		Approved	Kv9.3	uc002rcw.3	Q9BQ31	OTTHUMG00000044150	ENST00000403915.1:c.549C>T	2.37:g.18112824C>T			17976305	NM_002252	D6W520|O43651|Q4ZFY1|Q96B56	Silent	SNP	ENST00000403915.1	37	CCDS1692.1																																																																																				0.512	KCNS3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323808.1	NM_002252	
PTH2R	5746	broad.mit.edu	37	2	209357999	209357999	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr2:209357999A>G	ENST00000272847.2	+	13	1481	c.1268A>G	c.(1267-1269)gAg>gGg	p.E423G	PTH2R_ENST00000413482.1_3'UTR|AC019185.4_ENST00000424628.1_RNA	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	423					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)	p.E423G(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	GTTCAGGCAGAGGTGAAGAAG	0.527																																					p.E423G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1268G	2						.						70.0	69.0	70.0					2																	209357999		2203	4300	6503	209066244	SO:0001583	missense	5746	exon13			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1268A>G	2.37:g.209357999A>G	ENSP00000272847:p.Glu423Gly		209066244	NM_005048	Q8N429	Missense_Mutation	SNP	ENST00000272847.2	37	CCDS2383.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.734729	0.89482	.	.	ENSG00000144407	ENST00000272847	T	0.73897	-0.79	5.65	5.65	0.86999	.	0.000000	0.48286	D	0.000192	D	0.87783	0.6264	M	0.88031	2.925	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89524	0.3780	9	.	.	.	.	13.8102	0.63260	1.0:0.0:0.0:0.0	.	312;423	B4DFN8;P49190	.;PTH2R_HUMAN	G	423	ENSP00000272847:E423G	.	E	+	2	0	PTH2R	209066244	1.000000	0.71417	0.998000	0.56505	0.949000	0.60115	8.293000	0.89932	2.149000	0.67028	0.482000	0.46254	GAG		0.527	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
ABCA12	26154	broad.mit.edu	37	2	215845310	215845310	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr2:215845310C>T	ENST00000272895.7	-	31	4856	c.4637G>A	c.(4636-4638)cGc>cAc	p.R1546H	ABCA12_ENST00000389661.4_Missense_Mutation_p.R1228H	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1546	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> C (in dbSNP:rs13401480).		cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.R1546H(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GAAGGCGATGCGGTCACTCAG	0.512																																					p.R1546H	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4637A	2						.						131.0	118.0	122.0					2																	215845310		2203	4300	6503	215553555	SO:0001583	missense	26154	exon31			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4637G>A	2.37:g.215845310C>T	ENSP00000272895:p.Arg1546His		215553555	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	35	5.529593	0.96446	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.79247	-1.25;-1.25	5.95	5.95	0.96441	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.64402	D	0.000004	D	0.88647	0.6493	M	0.73430	2.235	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.91635	0.999;0.761	D	0.87648	0.2526	10	0.52906	T	0.07	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	1546;1228	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	H	1546;1228	ENSP00000272895:R1546H;ENSP00000374312:R1228H	ENSP00000272895:R1546H	R	-	2	0	ABCA12	215553555	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.827000	0.97445	0.650000	0.86243	CGC		0.512	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
COL6A3	1293	broad.mit.edu	37	2	238270391	238270391	+	Silent	SNP	G	G	A	rs536959688		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr2:238270391G>A	ENST00000295550.4	-	15	6599	c.6147C>T	c.(6145-6147)atC>atT	p.I2049I	COL6A3_ENST00000347401.3_Silent_p.I1848I|COL6A3_ENST00000409809.1_Silent_p.I1843I|COL6A3_ENST00000346358.4_Silent_p.I1849I|COL6A3_ENST00000353578.4_Silent_p.I1843I|COL6A3_ENST00000472056.1_Silent_p.I1442I	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2049	Collagen-like 1.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.I2049I(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CCTTTGGCCCGATGCTGCCGA	0.562													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17355	0.0		0.0	False		,,,				2504	0.0				p.I1442I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4326T	2						.						71.0	75.0	73.0					2																	238270391		2203	4300	6503	237935130	SO:0001819	synonymous_variant	1293	exon12			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.6147C>T	2.37:g.238270391G>A			237935130	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	ENST00000295550.4	37	CCDS33412.1																																																																																				0.562	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
BOC	91653	broad.mit.edu	37	3	112989693	112989693	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr3:112989693C>T	ENST00000495514.1	+	6	1273	c.569C>T	c.(568-570)gCc>gTc	p.A190V	BOC_ENST00000355385.3_Missense_Mutation_p.A190V|BOC_ENST00000273395.4_Missense_Mutation_p.A190V			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	190	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)		p.A190V(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			ATTGTGAATGCCAGCCAGGAG	0.572																																					p.A190V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C569T	3						.						139.0	130.0	133.0					3																	112989693		2203	4300	6503	114472383	SO:0001583	missense	91653	exon6			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.569C>T	3.37:g.112989693C>T	ENSP00000418663:p.Ala190Val		114472383	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.834720	0.32421	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.09630	2.96;2.96;2.96	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.05090	0.0136	N	0.00996	-1.065	0.80722	D	1	B;B	0.31625	0.332;0.088	B;B	0.38194	0.226;0.267	T	0.35724	-0.9777	10	0.02654	T	1	.	20.063	0.97692	0.0:1.0:0.0:0.0	.	190;190	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	V	190	ENSP00000418663:A190V;ENSP00000273395:A190V;ENSP00000347546:A190V	ENSP00000273395:A190V	A	+	2	0	BOC	114472383	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.770000	0.68873	2.735000	0.93741	0.655000	0.94253	GCC		0.572	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
SIDT1	54847	broad.mit.edu	37	3	113342523	113342523	+	Silent	SNP	C	C	T	rs142301843	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr3:113342523C>T	ENST00000264852.4	+	23	2976	c.2250C>T	c.(2248-2250)acC>acT	p.T750T	SIDT1_ENST00000393830.3_Silent_p.T755T|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	750					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.T750T(2)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TCGTGGCCACCGCTGTGATGT	0.572																																					p.T750T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2250T	3						.	C		0,4406		0,0,2203	102.0	104.0	103.0		2250	-9.4	0.7	3	dbSNP_134	103	3,8597	3.7+/-12.6	0,3,4297	no	coding-synonymous	SIDT1	NM_017699.2		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		750/828	113342523	3,13003	2203	4300	6503	114825213	SO:0001819	synonymous_variant	54847	exon23			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.2250C>T	3.37:g.113342523C>T			114825213	NM_017699	Q17RR4	Silent	SNP	ENST00000264852.4	37	CCDS2974.1																																																																																				0.572	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317564.1	NM_017699	
DSPP	1834	broad.mit.edu	37	4	88537413	88537413	+	Missense_Mutation	SNP	A	A	G			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr4:88537413A>G	ENST00000282478.7	+	4	3632	c.3599A>G	c.(3598-3600)gAc>gGc	p.D1200G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1200G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1200	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.D1200G(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gatagcagcgacagcagcgat	0.557																																					p.D1200G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3599G	4						.						47.0	65.0	59.0					4																	88537413		1627	2923	4550	88756437	SO:0001583	missense	1834	exon5			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3599A>G	4.37:g.88537413A>G	ENSP00000282478:p.Asp1200Gly		88756437	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	1.359	-0.589332	0.03799	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.90197	-2.63;-2.63	3.25	3.25	0.37280	.	0.490245	0.15116	U	0.279684	D	0.89698	0.6790	L	0.38175	1.15	0.19775	N	0.999952	D	0.71674	0.998	D	0.63957	0.92	T	0.79374	-0.1830	10	0.14252	T	0.57	-2.0457	8.1676	0.31237	1.0:0.0:0.0:0.0	.	1200	Q9NZW4	DSPP_HUMAN	G	1200	ENSP00000382213:D1200G;ENSP00000282478:D1200G	ENSP00000282478:D1200G	D	+	2	0	DSPP	88756437	0.658000	0.27402	0.515000	0.27774	0.004000	0.04260	1.604000	0.36804	1.494000	0.48533	0.248000	0.18094	GAC		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT4	79633	broad.mit.edu	37	4	126372145	126372145	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr4:126372145G>A	ENST00000394329.3	+	9	9987	c.9974G>A	c.(9973-9975)cGt>cAt	p.R3325H	FAT4_ENST00000335110.5_Missense_Mutation_p.R1623H	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3325	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R3325H(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCTAGCGACCGTGATTTGGGC	0.388																																					p.R3325H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9974A	4						.						103.0	103.0	103.0					4																	126372145		2203	4300	6503	126591595	SO:0001583	missense	79633	exon9			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9974G>A	4.37:g.126372145G>A	ENSP00000377862:p.Arg3325His		126591595	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227448	0.79576	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.52754	0.65;0.65	5.42	5.42	0.78866	Cadherin (4);Cadherin-like (1);	0.000000	0.31519	U	0.007508	T	0.69513	0.3119	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	T	0.69774	-0.5054	10	0.49607	T	0.09	.	19.2521	0.93929	0.0:0.0:1.0:0.0	.	1623;3325;3325	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	H	3325;1623	ENSP00000377862:R3325H;ENSP00000335169:R1623H	ENSP00000335169:R1623H	R	+	2	0	FAT4	126591595	1.000000	0.71417	0.993000	0.49108	0.799000	0.45148	9.666000	0.98612	2.542000	0.85734	0.655000	0.94253	CGT		0.388	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
UGT3A2	167127	broad.mit.edu	37	5	36036005	36036005	+	Missense_Mutation	SNP	A	A	C	rs201308652		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr5:36036005A>C	ENST00000282507.3	-	7	1468	c.1367T>G	c.(1366-1368)gTg>gGg	p.V456G	UGT3A2_ENST00000513300.1_Missense_Mutation_p.V422G|UGT3A2_ENST00000545528.1_Missense_Mutation_p.V154G	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	456					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)	p.V456G(1)		NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AATCCAGCCCACCAGCCGCTG	0.607																																					p.V422G												.	.	1	Substitution - Missense(1)	endometrium(1)	c.T1265G	5						.						31.0	31.0	31.0					5																	36036005		2203	4300	6503	36071762	SO:0001583	missense	167127	exon6				CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.1367T>G	5.37:g.36036005A>C	ENSP00000282507:p.Val456Gly		36071762	NM_001168316	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	ENST00000282507.3	37	CCDS3914.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.328112	0.24080	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	T;T;T	0.71341	-0.56;-0.56;-0.56	2.74	0.117	0.14652	.	0.518222	0.16281	U	0.221352	T	0.81927	0.4926	M	0.93594	3.435	0.50632	D	0.999888	P;D	0.67145	0.736;0.996	P;D	0.64144	0.596;0.922	T	0.76745	-0.2846	10	0.87932	D	0	.	1.4496	0.02372	0.5371:0.1804:0.1077:0.1748	.	422;456	E9PFK7;Q3SY77	.;UD3A2_HUMAN	G	456;422;154	ENSP00000282507:V456G;ENSP00000427404:V422G;ENSP00000445367:V154G	ENSP00000282507:V456G	V	-	2	0	UGT3A2	36071762	1.000000	0.71417	0.948000	0.38648	0.064000	0.16182	1.465000	0.35299	0.019000	0.15079	-0.364000	0.07487	GTG		0.607	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253771.2	NM_174914	
APC	324	broad.mit.edu	37	5	112174161	112174162	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	AG	AG	AG	AG	AG	AG	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr5:112174161_112174162delAG	ENST00000457016.1	+	16	3250_3251	c.2870_2871delAG	c.(2869-2871)aagfs	p.K957fs	APC_ENST00000257430.4_Frame_Shift_Del_p.K957fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.K957fs			P25054	APC_HUMAN	adenomatous polyposis coli	957	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTAGAATACAAGAGATCTTCAA	0.351		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.939_939del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	1	Unknown(1)	skin(1)	c.2816_2817del	5						.																																			112202061	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2870_2871delAG	5.37:g.112174163_112174164delAG	ENSP00000413133:p.Lys957fs		112202060	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.351	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FOXI1	2299	broad.mit.edu	37	5	169535277	169535277	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr5:169535277C>T	ENST00000306268.6	+	2	860	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	267					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R267W(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCAGAGAAGCGGCCCTCCCC	0.647									Pendred syndrome																												p.R267W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C799T	5						.						48.0	56.0	53.0					5																	169535277		2203	4300	6503	169467855	SO:0001583	missense	2299	exon2	Familial Cancer Database	Goiter-Deafness syndrome	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.799C>T	5.37:g.169535277C>T	ENSP00000304286:p.Arg267Trp		169467855	NM_012188	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	7.740	0.701146	0.15172	.	.	ENSG00000168269	ENST00000306268	D	0.94376	-3.41	5.01	2.01	0.26516	.	0.457825	0.22817	N	0.055268	D	0.90614	0.7057	M	0.63428	1.95	0.26741	N	0.970384	D	0.62365	0.991	B	0.43623	0.425	D	0.84442	0.0583	10	0.66056	D	0.02	.	8.4908	0.33100	0.4306:0.303:0.2664:0.0	.	267	Q12951	FOXI1_HUMAN	W	267	ENSP00000304286:R267W	ENSP00000304286:R267W	R	+	1	2	FOXI1	169467855	0.236000	0.23804	0.484000	0.27391	0.028000	0.11728	0.880000	0.28159	0.480000	0.27534	0.455000	0.32223	CGG		0.647	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
KCNQ5	56479	broad.mit.edu	37	6	73332245	73332246	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr6:73332245_73332246insG	ENST00000370398.1	+	1	437_438	c.328_329insG	c.(328-330)cggfs	p.R110fs	KCNQ5_ENST00000414165.2_Frame_Shift_Ins_p.R110fs|KCNQ5_ENST00000370392.1_Frame_Shift_Ins_p.R110fs|KCNQ5_ENST00000342056.2_Frame_Shift_Ins_p.R110fs|KCNQ5_ENST00000403813.2_Frame_Shift_Ins_p.R110fs|KCNQ5_ENST00000402622.2_Frame_Shift_Ins_p.R110fs|KCNQ5_ENST00000355635.3_Frame_Shift_Ins_p.R110fs|KCNQ5_ENST00000355194.4_Frame_Shift_Ins_p.R110fs	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	110					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)	p.V111fs*41(1)		breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CAAGTACCGGCGGGTGCAGAAC	0.663																																					p.R110fs	GBM(142;1375 1859 14391 23261 44706)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.328_329insG	6						.																																			73388967	SO:0001589	frameshift_variant	56479	exon1			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.331dupG	6.37:g.73332248_73332248dupG	ENSP00000359425:p.Arg110fs		73388966	NM_019842	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Frame_Shift_Ins	INS	ENST00000370398.1	37	CCDS4976.1																																																																																				0.663	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041198.3	NM_019842	
DST	667	broad.mit.edu	37	6	56498939	56498939	+	Silent	SNP	A	A	G			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr6:56498939A>G	ENST00000361203.3	-	23	2986	c.2979T>C	c.(2977-2979)aaT>aaC	p.N993N	DST_ENST00000370769.4_Silent_p.N993N|DST_ENST00000446842.2_Silent_p.N667N|DST_ENST00000370754.5_Silent_p.N1171N|DST_ENST00000370788.2_Silent_p.N993N|DST_ENST00000421834.2_Silent_p.N993N|DST_ENST00000312431.6_Silent_p.N993N|DST_ENST00000370765.6_Silent_p.N667N|DST_ENST00000244364.6_Silent_p.N667N|DST_ENST00000518935.1_Silent_p.N667N			Q03001	DYST_HUMAN	dystonin	993					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.N667N(3)|p.N993N(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTGAAGCCACATTGCTAGCTC	0.368																																					p.N667N												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.T2001C	6						.						190.0	171.0	177.0					6																	56498939		2203	4300	6503	56606898	SO:0001819	synonymous_variant	667	exon13			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2979T>C	6.37:g.56498939A>G			56606898	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																					0.368	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
UBE2J1	51465	broad.mit.edu	37	6	90039425	90039425	+	Silent	SNP	G	G	A	rs3822871	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr6:90039425G>A	ENST00000435041.2	-	8	1208	c.930C>T	c.(928-930)aaC>aaT	p.N310N		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	310					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)	p.N310N(2)		NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		ATATGTATTCGTTTGCCAGAT	0.383													A|||	19	0.00379393	0.0	0.0	5008	,	,		18713	0.0169		0.001	False		,,,				2504	0.001				p.N310N												.	.	2	Substitution - coding silent(2)	large_intestine(1)|stomach(1)	c.C930T	6						.	A		0,4406		0,0,2203	78.0	74.0	75.0		930	3.7	1.0	6	dbSNP_107	75	2,8598	819.0+/-406.8	0,2,4298	no	coding-synonymous	UBE2J1	NM_016021.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		310/319	90039425	2,13004	2203	4300	6503	90096144	SO:0001819	synonymous_variant	51465	exon8			AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.930C>T	6.37:g.90039425G>A			90096144	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Silent	SNP	ENST00000435041.2	37	CCDS5021.1																																																																																				0.383	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
WBSCR17	64409	broad.mit.edu	37	7	70880967	70880967	+	Missense_Mutation	SNP	C	C	T	rs144185040		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr7:70880967C>T	ENST00000333538.5	+	4	1316	c.682C>T	c.(682-684)Cgc>Tgc	p.R228C	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	228	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.R228C(3)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				AGGCCTGATCCGCGCTCGCAT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		16785	0.0		0.001	False		,,,				2504	0.0				p.R228C												.	.	3	Substitution - Missense(3)	large_intestine(2)|skin(1)	c.C682T	7						.						92.0	79.0	83.0					7																	70880967		2203	4300	6503	70518903	SO:0001583	missense	64409	exon4			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.682C>T	7.37:g.70880967C>T	ENSP00000329654:p.Arg228Cys		70518903	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	32	5.114447	0.94339	.	.	ENSG00000185274	ENST00000333538	T	0.62498	0.02	5.04	5.04	0.67666	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.85492	0.5709	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.90175	0.4238	10	0.87932	D	0	.	17.3775	0.87396	0.0:1.0:0.0:0.0	.	228	Q6IS24	GLTL3_HUMAN	C	228	ENSP00000329654:R228C	ENSP00000329654:R228C	R	+	1	0	WBSCR17	70518903	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.470000	0.60175	2.351000	0.79841	0.462000	0.41574	CGC		0.567	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
ANKIB1	54467	broad.mit.edu	37	7	92015835	92015836	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr7:92015835_92015836delTT	ENST00000265742.3	+	12	2006_2007	c.1630_1631delTT	c.(1630-1632)tttfs	p.F544fs		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	544							zinc ion binding (GO:0008270)	p.F544fs*6(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CAAGTATGACTTTTGCTGGATT	0.366																																					p.544_544del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1630_1631del	7						.																																			91853772	SO:0001589	frameshift_variant	54467	exon12			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.1630_1631delTT	7.37:g.92015837_92015838delTT	ENSP00000265742:p.Phe544fs		91853771	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Frame_Shift_Del	DEL	ENST00000265742.3	37	CCDS47639.1																																																																																				0.366	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
ZFAT	57623	broad.mit.edu	37	8	135669910	135669910	+	Silent	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:135669910G>A	ENST00000377838.3	-	2	264	c.90C>T	c.(88-90)caC>caT	p.H30H	ZFAT_ENST00000520727.1_Silent_p.H18H|ZFAT_ENST00000429442.2_Silent_p.H18H|ZFAT_ENST00000520214.1_Silent_p.H18H|ZFAT_ENST00000520356.1_Silent_p.H18H|ZFAT_ENST00000523399.1_Silent_p.H30H	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	30					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.H18H(2)|p.H30H(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TCTCTGAAACGTGGGAGAGGA	0.418																																					p.H30H												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C90T	8						.						107.0	102.0	104.0					8																	135669910		1884	4114	5998	135739092	SO:0001819	synonymous_variant	57623	exon2			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.90C>T	8.37:g.135669910G>A			135739092	NM_001174157	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Silent	SNP	ENST00000377838.3	37	CCDS47924.1																																																																																				0.418	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
DLGAP2	9228	broad.mit.edu	37	8	1575018	1575018	+	Missense_Mutation	SNP	G	G	A	rs371441823		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:1575018G>A	ENST00000421627.2	+	4	1449	c.1315G>A	c.(1315-1317)Gtc>Atc	p.V439I		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	518					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)		p.V461I(1)		breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CATGAGGGCCGTCAGCACCCT	0.662																																					p.V439I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1315A	8						.	G	ILE/VAL	1,3947		0,1,1973	30.0	34.0	33.0		1315	5.2	1.0	8		33	0,8334		0,0,4167	no	missense	DLGAP2	NM_004745.3	29	0,1,6140	AA,AG,GG		0.0,0.0253,0.0081	probably-damaging	439/976	1575018	1,12281	1974	4167	6141	1562425	SO:0001583	missense	9228	exon4			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1315G>A	8.37:g.1575018G>A	ENSP00000400258:p.Val439Ile		1562425	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	37	CCDS47760.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260423	0.80246	2.53E-4	0.0	ENSG00000198010	ENST00000356067;ENST00000421627	T	0.21543	2.0	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.30008	0.0751	M	0.79123	2.44	0.41089	D	0.985582	D;D	0.61697	0.961;0.99	B;B	0.42827	0.399;0.225	T	0.25745	-1.0123	10	0.22109	T	0.4	-19.4894	18.6392	0.91389	0.0:0.0:1.0:0.0	.	518;518	Q9P1A6-2;Q9P1A6	.;DLGP2_HUMAN	I	484;439	ENSP00000400258:V439I	ENSP00000348366:V484I	V	+	1	0	DLGAP2	1562425	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	6.228000	0.72288	2.375000	0.81037	0.655000	0.94253	GTC		0.662	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
CSMD1	64478	broad.mit.edu	37	8	3141811	3141811	+	Silent	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:3141811G>A	ENST00000520002.1	-	27	4566	c.4011C>T	c.(4009-4011)gaC>gaT	p.D1337D	CSMD1_ENST00000602723.1_Silent_p.D1337D|CSMD1_ENST00000400186.3_Silent_p.D1337D|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000542608.1_Silent_p.D1336D|CSMD1_ENST00000602557.1_Silent_p.D1337D|CSMD1_ENST00000537824.1_Silent_p.D1336D|CSMD1_ENST00000539096.1_Silent_p.D1336D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1337	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.D1065D(1)|p.D1336D(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCACCGGCCCGTCCCAGACCT	0.572											OREG0018505	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R1337W												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4009T	8						.						92.0	96.0	95.0					8																	3141811		2129	4240	6369	3129218	SO:0001819	synonymous_variant	64478	exon26					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4011C>T	8.37:g.3141811G>A		608	3129218	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	G	7.779	0.709131	0.15239	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.12	-6.57	0.01842	.	.	.	.	.	T	0.65091	0.2658	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67995	-0.5526	4	.	.	.	.	17.0738	0.86581	0.7848:0.0:0.2152:0.0	.	.	.	.	W	817	.	.	R	-	1	2	CSMD1	3129218	0.703000	0.27826	0.291000	0.24904	0.758000	0.43043	0.019000	0.13444	-1.443000	0.01953	-1.008000	0.02478	CGG		0.572	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
TEX15	56154	broad.mit.edu	37	8	30705183	30705183	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:30705183C>T	ENST00000256246.2	-	1	1425	c.1351G>A	c.(1351-1353)Ggt>Agt	p.G451S	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	451					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.G451S(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TGATCCTGACCCCTATCTTCA	0.333																																					p.G451S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1351A	8						.						179.0	178.0	178.0					8																	30705183		2203	4299	6502	30824725	SO:0001583	missense	56154	exon1			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.1351G>A	8.37:g.30705183C>T	ENSP00000256246:p.Gly451Ser		30824725	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	6.690	0.495939	0.12762	.	.	ENSG00000133863	ENST00000256246	T	0.09255	3.0	5.51	-0.724	0.11177	.	1.174520	0.06137	N	0.671728	T	0.06416	0.0165	N	0.14661	0.345	0.09310	N	1	B	0.16396	0.017	B	0.14578	0.011	T	0.41716	-0.9493	10	0.87932	D	0	.	3.69	0.08343	0.381:0.3216:0.0:0.2974	.	451	Q9BXT5	TEX15_HUMAN	S	451	ENSP00000256246:G451S	ENSP00000256246:G451S	G	-	1	0	TEX15	30824725	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.198000	0.09505	-0.367000	0.08052	-0.145000	0.13849	GGT		0.333	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
SNTG1	54212	broad.mit.edu	37	8	51617199	51617199	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:51617199G>A	ENST00000522124.1	+	16	1739	c.1078G>A	c.(1078-1080)Gtg>Atg	p.V360M	SNTG1_ENST00000517473.1_Missense_Mutation_p.V360M|SNTG1_ENST00000518864.1_Missense_Mutation_p.V360M|SNTG1_ENST00000276467.5_Missense_Mutation_p.V360M	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	360	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)	p.V360M(1)		NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GTGCTTCACCGTGCAGTCTGA	0.542																																					p.V360M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1078A	8						.						148.0	122.0	130.0					8																	51617199		2203	4300	6503	51779752	SO:0001583	missense	54212	exon16			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1078G>A	8.37:g.51617199G>A	ENSP00000429842:p.Val360Met		51779752	NM_018967	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580653	0.65992	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.19	5.19	0.71726	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.052186	0.85682	N	0.000000	T	0.36303	0.0962	L	0.41492	1.28	0.80722	D	1	P;B	0.36587	0.559;0.174	B;B	0.38954	0.286;0.013	T	0.16129	-1.0413	10	0.48119	T	0.1	-8.3196	18.0775	0.89432	0.0:0.0:1.0:0.0	.	360;360	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	M	360	ENSP00000429276:V360M;ENSP00000429842:V360M;ENSP00000431123:V360M;ENSP00000276467:V360M	ENSP00000276467:V360M	V	+	1	0	SNTG1	51779752	1.000000	0.71417	0.977000	0.42913	0.940000	0.58332	5.862000	0.69560	2.577000	0.86979	0.643000	0.83706	GTG		0.542	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377964.1		
CDH17	1015	broad.mit.edu	37	8	95183098	95183098	+	Missense_Mutation	SNP	C	C	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:95183098C>T	ENST00000027335.3	-	8	1023	c.899G>A	c.(898-900)cGa>cAa	p.R300Q	CDH17_ENST00000441892.2_Intron|CDH17_ENST00000450165.2_Missense_Mutation_p.R300Q	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	300	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.R300Q(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CTTTTCTTCTCGGTCCAAGGG	0.428																																					p.R300Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G899A	8						.						154.0	154.0	154.0					8																	95183098		2203	4300	6503	95252274	SO:0001583	missense	1015	exon8			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.899G>A	8.37:g.95183098C>T	ENSP00000027335:p.Arg300Gln		95252274	NM_001144663	Q15336|Q2M2E0	Missense_Mutation	SNP	ENST00000027335.3	37	CCDS6260.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416226	0.83449	.	.	ENSG00000079112	ENST00000027335;ENST00000450165	T;T	0.59364	0.27;0.27	5.95	4.16	0.48862	Cadherin (4);Cadherin-like (1);	0.333720	0.21690	N	0.070589	D	0.82282	0.5003	H	0.97186	3.955	0.49130	D	0.999751	D	0.89917	1.0	D	0.91635	0.999	D	0.84447	0.0586	10	0.56958	D	0.05	-3.4131	10.6326	0.45545	0.0:0.8439:0.0:0.1561	.	300	Q12864	CAD17_HUMAN	Q	300	ENSP00000027335:R300Q;ENSP00000401468:R300Q	ENSP00000027335:R300Q	R	-	2	0	CDH17	95252274	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	2.598000	0.46223	0.835000	0.34877	0.650000	0.86243	CGA		0.428	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
C8orf31	286122	broad.mit.edu	37	8	144130634	144130634	+	Silent	SNP	C	C	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr8:144130634C>A	ENST00000395172.1	+	5	716	c.364C>A	c.(364-366)Cgg>Agg	p.R122R	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	122								p.R122R(1)		breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					aggattctctcggcaccacgg	0.512																																					p.R122R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C364A	8						.						169.0	135.0	146.0					8																	144130634		2203	4300	6503	144202009	SO:0001819	synonymous_variant	286122	exon5				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.364C>A	8.37:g.144130634C>A			144202009	NM_173687	Q6GMU7	Silent	SNP	ENST00000395172.1	37	CCDS6395.1																																																																																				0.512	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380167.1	NM_173687	
MPDZ	8777	broad.mit.edu	37	9	13219695	13219695	+	Missense_Mutation	SNP	G	G	T			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr9:13219695G>T	ENST00000319217.7	-	8	1196	c.949C>A	c.(949-951)Caa>Aaa	p.Q317K	MPDZ_ENST00000381015.4_Missense_Mutation_p.Q317K|MPDZ_ENST00000546205.1_Missense_Mutation_p.Q317K|MPDZ_ENST00000447879.1_Missense_Mutation_p.Q317K|MPDZ_ENST00000536827.1_Missense_Mutation_p.Q317K|MPDZ_ENST00000541718.1_Missense_Mutation_p.Q317K|MPDZ_ENST00000381022.2_Missense_Mutation_p.Q317K	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	317	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.Q317K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TGTGCTACTTGCTCACTGCTC	0.428																																					p.Q317K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C949A	9						.						164.0	159.0	160.0					9																	13219695		2033	4210	6243	13209695	SO:0001583	missense	8777	exon7			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.949C>A	9.37:g.13219695G>T	ENSP00000320006:p.Gln317Lys		13209695	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	G	34	5.342709	0.95783	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03	6.17	6.17	0.99709	.	0.000000	0.45126	D	0.000387	T	0.67664	0.2917	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.996	D;D;D	0.83275	0.995;0.996;0.992	T	0.63180	-0.6695	10	0.44086	T	0.13	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	317;317;317	B7ZMI4;O75970-3;O75970-2	.;.;.	K	317	ENSP00000320006:Q317K;ENSP00000439807:Q317K;ENSP00000370410:Q317K;ENSP00000444151:Q317K;ENSP00000415208:Q317K;ENSP00000370403:Q317K;ENSP00000446358:Q317K	ENSP00000320006:Q317K	Q	-	1	0	MPDZ	13209695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.274000	0.78538	2.941000	0.99782	0.655000	0.94253	CAA		0.428	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
LMX1B	4010	broad.mit.edu	37	9	129458674	129458674	+	Missense_Mutation	SNP	G	G	A			TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr9:129458674G>A	ENST00000373474.4	+	8	1160	c.1153G>A	c.(1153-1155)Gtg>Atg	p.V385M	LMX1B_ENST00000561065.1_Missense_Mutation_p.V366M|LMX1B_ENST00000526117.1_Missense_Mutation_p.V378M|LMX1B_ENST00000425646.2_Missense_Mutation_p.V355M|LMX1B_ENST00000355497.5_Missense_Mutation_p.V389M			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	385					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.V355M(1)		endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						GCAGGCCCGCGTGGGGAACCC	0.647									Nail-Patella Syndrome																												p.V378M	Pancreas(110;1796 2278 18357 20466)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1132A	9						.						101.0	107.0	105.0					9																	129458674		2203	4300	6503	128498495	SO:0001583	missense	4010	exon8	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.1153G>A	9.37:g.129458674G>A	ENSP00000362573:p.Val385Met		128498495	NM_002316	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236705	0.79800	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.85062	0.5611	M	0.61703	1.905	0.80722	D	1	D;D;D	0.76494	0.993;0.998;0.999	P;D;D	0.68765	0.84;0.912;0.96	T	0.82110	-0.0619	10	0.21014	T	0.42	.	17.2947	0.87167	0.0:0.0:1.0:0.0	.	366;362;378	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	M	378;385;389;355	ENSP00000436930:V378M;ENSP00000362573:V385M;ENSP00000347684:V389M;ENSP00000390923:V355M	ENSP00000347684:V389M	V	+	1	0	LMX1B	128498495	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.605000	0.82844	2.317000	0.78254	0.561000	0.74099	GTG		0.647	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
DMRT3	58524	broad.mit.edu	37	9	990717	990717	+	Silent	SNP	G	G	A	rs560657467	byFrequency	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr9:990717G>A	ENST00000190165.2	+	2	1169	c.1131G>A	c.(1129-1131)gcG>gcA	p.A377A		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	377					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A377A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		ATACTTTGGCGAGAAGCCAGT	0.592													G|||	3	0.000599042	0.0	0.0	5008	,	,		17862	0.003		0.0	False		,,,				2504	0.0				p.A377A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1131A	9						.						44.0	42.0	43.0					9																	990717		2203	4300	6503	980717	SO:0001819	synonymous_variant	58524	exon2			AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.1131G>A	9.37:g.990717G>A			980717	NM_021240	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Silent	SNP	ENST00000190165.2	37	CCDS6443.1																																																																																				0.592	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051490.1	NM_021240	
LAMC3	10319	broad.mit.edu	37	9	133954657	133954657	+	Missense_Mutation	SNP	C	C	T	rs142459109		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chr9:133954657C>T	ENST00000361069.4	+	23	4032	c.3899C>T	c.(3898-3900)aCg>aTg	p.T1300M	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1300	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)	p.T1300M(2)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GCCCAGGCGACGCTACGGCAA	0.612																																					p.T1300M												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C3899T	9						.	C	MET/THR	1,4405		0,1,2202	50.0	43.0	46.0		3899	-8.1	0.0	9	dbSNP_134	46	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMC3	NM_006059.3	81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign	1300/1576	133954657	2,13004	2203	4300	6503	132944478	SO:0001583	missense	10319	exon23			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3899C>T	9.37:g.133954657C>T	ENSP00000354360:p.Thr1300Met		132944478	NM_006059	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	ENST00000361069.4	37	CCDS6938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.26|10.26	1.300656|1.300656	0.23650|0.23650	2.27E-4|2.27E-4	1.16E-4|1.16E-4	ENSG00000050555|ENSG00000050555	ENST00000355452|ENST00000361069;ENST00000355048	.|T	.|0.27557	.|1.66	4.24|4.24	-8.11|-8.11	0.01082|0.01082	.|.	.|0.972225	.|0.08457	.|N	.|0.943028	T|T	0.09512|0.09512	0.0234|0.0234	N|N	0.02011|0.02011	-0.69|-0.69	0.09310|0.09310	N|N	1|1	.|B;B	.|0.21225	.|0.014;0.053	.|B;B	.|0.15052	.|0.004;0.012	T|T	0.38607|0.38607	-0.9653|-0.9653	5|10	.|0.49607	.|T	.|0.09	.|.	8.3533|8.3533	0.32316|0.32316	0.2233:0.661:0.0:0.1157|0.2233:0.661:0.0:0.1157	.|.	.|9;1300	.|Q9UF61;Q9Y6N6	.|.;LAMC3_HUMAN	C|M	10|1300	.|ENSP00000354360:T1300M	.|ENSP00000347156:T1300M	R|T	+|+	1|2	0|0	LAMC3|LAMC3	132944478|132944478	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-1.254000|-1.254000	0.02874|0.02874	-1.290000|-1.290000	0.02372|0.02372	-0.459000|-0.459000	0.05422|0.05422	CGC|ACG		0.612	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054717.3	NM_006059	
CPXCR1	53336	broad.mit.edu	37	X	88009032	88009032	+	Missense_Mutation	SNP	G	G	A	rs144908642		TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AA-A01X-01A-21W-A096-10	TCGA-AA-A01X-11A-11W-A096-10	g.chrX:88009032G>A	ENST00000276127.4	+	3	876	c.617G>A	c.(616-618)cGt>cAt	p.R206H	CPXCR1_ENST00000373111.1_Missense_Mutation_p.R206H	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	206							metal ion binding (GO:0046872)	p.R206H(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CACTACTACCGTCCCCTCACT	0.423																																					p.R206H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G617A	X						.	G	HIS/ARG,HIS/ARG	0,3835		0,0,0,1632,571	76.0	61.0	66.0		617,617	-3.9	0.0	X	dbSNP_134	66	2,6726		0,1,1,2427,1871	yes	missense,missense	CPXCR1	NM_001184771.1,NM_033048.5	29,29	0,1,1,4059,2442	AA,AG,A,GG,G		0.0297,0.0,0.0189	probably-damaging,probably-damaging	206/302,206/302	88009032	2,10561	2203	4300	6503	87895688	SO:0001583	missense	53336	exon3			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.617G>A	X.37:g.88009032G>A	ENSP00000276127:p.Arg206His		87895688	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	G	8.235	0.805427	0.16467	0.0	2.97E-4	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.23348	1.91;1.91	2.85	-3.86	0.04230	.	1.440130	0.04976	N	0.464830	T	0.10423	0.0255	N	0.04880	-0.145	0.09310	N	1	B	0.15141	0.012	B	0.06405	0.002	T	0.24368	-1.0162	9	.	.	.	0.1407	5.1186	0.14849	0.619:0.0:0.2163:0.1648	.	206	Q8N123	CPXCR_HUMAN	H	206	ENSP00000276127:R206H;ENSP00000362203:R206H	.	R	+	2	0	CPXCR1	87895688	0.000000	0.05858	0.000000	0.03702	0.110000	0.19582	-2.327000	0.01113	-1.405000	0.02048	-0.198000	0.12761	CGT		0.423	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
