#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TRIOBP	11078	broad.mit.edu	37	22	38130772	38130773	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AF-3913-01	TCGA-AF-3913-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr22:38130772_38130773insG	ENST00000406386.3	+	9	4684_4685	c.4429_4430insG	c.(4429-4431)tggfs	p.W1477fs		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1477					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGAGGGAGCATGGGGGGGCACT	0.663																																					p.W1477fs												.	.	0			c.4429_4430insG	22						.			14,3234		0,14,1610						-2.3	0.0			11	12,7306		2,8,3649	no	frameshift	TRIOBP	NM_001039141.2		2,22,5259	A1A1,A1R,RR		0.164,0.431,0.2461				26,10540				36460719	SO:0001589	frameshift_variant	11078	exon9			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4436dupG	22.37:g.38130779_38130779dupG	ENSP00000384312:p.Trp1477fs		36460718	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Ins	INS	ENST00000406386.3	37	CCDS43015.1																																																																																				0.663	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
PRICKLE3	4007	broad.mit.edu	37	X	49034403	49034404	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AF-3913-01	TCGA-AF-3913-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chrX:49034403_49034404insT	ENST00000376317.3	-	7	987_988	c.893_894insA	c.(892-894)cacfs	p.H298fs	PRICKLE3_ENST00000540849.1_Frame_Shift_Ins_p.H230fs|PRICKLE3_ENST00000536904.1_Frame_Shift_Ins_p.H217fs|PRICKLE3_ENST00000538114.1_Intron	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	298	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)	p.H298fs*15(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						AGGCGCAGCAGTGGGGGCGGCT	0.624																																					p.H298fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.894_895insA	X						.																																			48921348	SO:0001589	frameshift_variant	4007	exon7			BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.894dupA	X.37:g.49034404_49034404dupT	ENSP00000365494:p.His298fs		48921347	NM_006150	B7Z8F2|O76007|Q53XR5	Frame_Shift_Ins	INS	ENST00000376317.3	37	CCDS14320.1																																																																																				0.624	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
SLC12A9	56996	broad.mit.edu	37	7	100456522	100456522	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:100456522T>C	ENST00000354161.3	+	6	948	c.823T>C	c.(823-825)Ttt>Ctt	p.F275L	SLC12A9_ENST00000428758.1_Missense_Mutation_p.F275L|SLC12A9_ENST00000540482.1_Missense_Mutation_p.F275L|SLC12A9_ENST00000415287.1_Missense_Mutation_p.F186L|SLC12A9_ENST00000275729.3_Missense_Mutation_p.F186L	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	275					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)	p.F275L(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGCTGTCCTCTTTAACGGCTG	0.597																																					p.F275L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T823C	7						.						94.0	73.0	80.0					7																	100456522		2203	4300	6503	100294458	SO:0001583	missense	56996	exon6			AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.823T>C	7.37:g.100456522T>C	ENSP00000275730:p.Phe275Leu		100294458	NM_020246	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Missense_Mutation	SNP	ENST00000354161.3	37	CCDS5707.1	.	.	.	.	.	.	.	.	.	.	T	31	5.066537	0.93898	.	.	ENSG00000146828	ENST00000540482;ENST00000418037;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000416675	D;D;D;D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12;-5.12;-5.12;-5.12	5.04	5.04	0.67666	Amino acid permease domain (1);	0.066872	0.64402	N	0.000014	D	0.99345	0.9770	H	0.95224	3.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98786	1.0734	10	0.87932	D	0	.	12.7139	0.57103	0.0:0.0:0.0:1.0	.	186;275	Q9BXP2-2;Q9BXP2	.;S12A9_HUMAN	L	275;11;275;186;186;275;83	ENSP00000443702:F275L;ENSP00000406560:F11L;ENSP00000408301:F275L;ENSP00000275729:F186L;ENSP00000413796:F186L;ENSP00000275730:F275L;ENSP00000410692:F83L	ENSP00000275729:F186L	F	+	1	0	SLC12A9	100294458	1.000000	0.71417	0.924000	0.36721	0.987000	0.75469	7.850000	0.86915	1.879000	0.54435	0.391000	0.25812	TTT		0.597	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	
DNAH11	8701	broad.mit.edu	37	7	21657267	21657267	+	Missense_Mutation	SNP	G	G	T	rs531283952		TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:21657267G>T	ENST00000409508.3	+	23	4157	c.4126G>T	c.(4126-4128)Gtc>Ttc	p.V1376F	DNAH11_ENST00000328843.6_Missense_Mutation_p.V1381F	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1381	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V1381F(1)|p.V1381I(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GGAAGTCCGCGTCTGGGATGC	0.483									Kartagener syndrome																												p.V1381F												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.G4141T	7						.						55.0	55.0	55.0					7																	21657267		1887	4106	5993	21623792	SO:0001583	missense	8701	exon23	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.4126G>T	7.37:g.21657267G>T	ENSP00000475939:p.Val1376Phe		21623792	NM_003777	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	G	5.455	0.268998	0.10349	.	.	ENSG00000105877	ENST00000328843	T	0.60920	0.15	5.48	2.44	0.29823	Dynein heavy chain, domain-2 (1);	0.624196	0.14824	N	0.296281	T	0.42063	0.1186	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.35226	-0.9797	9	0.59425	D	0.04	.	4.7959	0.13272	0.0847:0.1064:0.573:0.2359	.	1381	Q96DT5	DYH11_HUMAN	F	1381	ENSP00000330671:V1381F	ENSP00000330671:V1381F	V	+	1	0	DNAH11	21623792	0.000000	0.05858	0.055000	0.19348	0.034000	0.12701	0.206000	0.17375	0.705000	0.31890	-1.303000	0.01326	GTC		0.483	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
ABCA13	154664	broad.mit.edu	37	7	48313935	48313935	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:48313935G>T	ENST00000435803.1	+	17	4696	c.4672G>T	c.(4672-4674)Gta>Tta	p.V1558L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1558					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.V1558L(1)|p.V1503L(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCAGAAGCTTGTAAAAGGTAT	0.299																																					p.L1503F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4509T	7						.						56.0	58.0	58.0					7																	48313935		1800	4058	5858	48284481	SO:0001583	missense	154664	exon15			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4672G>T	7.37:g.48313935G>T	ENSP00000411096:p.Val1558Leu		48284481	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	5.252	0.231921	0.09969	.	.	ENSG00000179869	ENST00000435803	D	0.86164	-2.08	5.37	-7.45	0.01374	.	0.965332	0.08456	N	0.943227	T	0.69495	0.3117	N	0.24115	0.695	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.55724	-0.8096	9	.	.	.	.	1.9345	0.03333	0.3895:0.3089:0.1649:0.1367	.	1558	Q86UQ4	ABCAD_HUMAN	L	1558	ENSP00000411096:V1558L	.	V	+	1	0	ABCA13	48284481	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.310000	0.08135	-1.488000	0.01847	-0.253000	0.11424	GTA		0.299	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PCLO	27445	broad.mit.edu	37	7	82764531	82764531	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:82764531G>A	ENST00000333891.9	-	3	2672	c.2335C>T	c.(2335-2337)Cca>Tca	p.P779S	PCLO_ENST00000423517.2_Missense_Mutation_p.P779S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.P779S(2)|p.P725S(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTGGAGCTTGGAATATCAGGT	0.453																																					p.P779S												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C2335T	7						.						232.0	208.0	216.0					7																	82764531		1908	4134	6042	82602467	SO:0001583	missense	27445	exon3			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2335C>T	7.37:g.82764531G>A	ENSP00000334319:p.Pro779Ser		82602467	NM_033026		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	0.127	-1.118461	0.01785	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.14893	2.47;2.47	5.83	3.04	0.35103	.	.	.	.	.	T	0.10766	0.0263	N	0.24115	0.695	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.10450	0.001;0.005	T	0.31613	-0.9937	9	0.87932	D	0	.	3.4474	0.07486	0.1171:0.1258:0.5256:0.2314	.	779;779	Q9Y6V0-5;Q9Y6V0-6	.;.	S	725;779;779	ENSP00000334319:P779S;ENSP00000388393:P779S	ENSP00000334319:P779S	P	-	1	0	PCLO	82602467	0.000000	0.05858	0.000000	0.03702	0.160000	0.22226	0.436000	0.21526	0.370000	0.24538	-0.293000	0.09583	CCA		0.453	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
CALCR	799	broad.mit.edu	37	7	93116298	93116298	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:93116298G>C	ENST00000394441.1	-	0	311				CALCR_ENST00000421592.1_De_novo_Start_OutOfFrame|CALCR_ENST00000426151.1_De_novo_Start_OutOfFrame|CALCR_ENST00000359558.2_Nonsense_Mutation_p.S17*|MIR489_ENST00000384923.1_RNA|CALCR_ENST00000360249.4_De_novo_Start_OutOfFrame	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.S17*(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	CCTCATTTTTGATTTTTGAAG	0.299																																					p.S17X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C50G	7						.						82.0	88.0	86.0					7																	93116298		2202	4299	6501	92954234			799	exon4			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.-5C>G	7.37:g.93116298G>C			92954234	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Nonsense_Mutation	SNP	ENST00000394441.1	37	CCDS5631.1	.	.	.	.	.	.	.	.	.	.	G	37	6.614848	0.97705	.	.	ENSG00000004948	ENST00000359558	.	.	.	3.64	3.64	0.41730	.	.	.	.	.	.	.	.	.	.	.	0.44424	D	0.997342	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	11.1083	0.48216	0.0:0.0:1.0:0.0	.	.	.	.	X	17	.	ENSP00000352561:S17X	S	-	2	0	CALCR	92954234	0.298000	0.24417	0.067000	0.19924	0.113000	0.19764	2.548000	0.45794	2.315000	0.78130	0.650000	0.86243	TCA		0.299	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
SMURF1	57154	broad.mit.edu	37	7	98634740	98634740	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:98634740C>T	ENST00000361125.1	-	16	2156	c.1837G>A	c.(1837-1839)Gag>Aag	p.E613K	AC004893.11_ENST00000360902.1_RNA|SMURF1_ENST00000361368.2_Missense_Mutation_p.E587K|AC004893.11_ENST00000468960.2_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	613	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)	p.E613K(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			GGGATGAGCTCATTGAACCCC	0.517											OREG0018188	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E613K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1837A	7						.						141.0	127.0	131.0					7																	98634740		2203	4300	6503	98472676	SO:0001583	missense	57154	exon16			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.1837G>A	7.37:g.98634740C>T	ENSP00000354621:p.Glu613Lys	1337	98472676	NM_020429	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	ENST00000361125.1	37	CCDS34690.1	.	.	.	.	.	.	.	.	.	.	C	36	5.701949	0.96812	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.59502	0.26;0.26	5.43	5.43	0.79202	HECT (4);	0.000000	0.85682	D	0.000000	T	0.75700	0.3885	M	0.67625	2.065	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.74023	0.977;0.975;0.982	T	0.77327	-0.2629	10	0.87932	D	0	.	19.5914	0.95514	0.0:1.0:0.0:0.0	.	587;613;587	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	K	587;613	ENSP00000355326:E587K;ENSP00000354621:E613K	ENSP00000354621:E613K	E	-	1	0	SMURF1	98472676	1.000000	0.71417	0.255000	0.24374	0.966000	0.64601	7.701000	0.84566	2.720000	0.93068	0.591000	0.81541	GAG		0.517	SMURF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335001.2	NM_020429	
MKLN1	4289	broad.mit.edu	37	7	131151088	131151088	+	Silent	SNP	A	A	G			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr7:131151088A>G	ENST00000352689.6	+	15	1882	c.1842A>G	c.(1840-1842)agA>agG	p.R614R	MKLN1_ENST00000421797.2_Silent_p.R522R|MKLN1_ENST00000498778.1_3'UTR	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	614					signal transduction (GO:0007165)	cytoplasm (GO:0005737)		p.R614R(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					CAAAGATGAGATTAGATGACT	0.343																																					p.R614R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1842G	7						.						142.0	143.0	143.0					7																	131151088		2203	4300	6503	130801628	SO:0001819	synonymous_variant	4289	exon15			AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.1842A>G	7.37:g.131151088A>G			130801628	NM_013255	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Silent	SNP	ENST00000352689.6	37	CCDS34754.1																																																																																				0.343	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255	
MATN4	8785	broad.mit.edu	37	20	43933297	43933297	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr20:43933297G>A	ENST00000372754.1	-	2	222	c.214C>T	c.(214-216)Cgc>Tgc	p.R72C	MATN4_ENST00000342716.4_Missense_Mutation_p.R72C|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000353917.5_Missense_Mutation_p.R72C|MATN4_ENST00000537548.1_Missense_Mutation_p.R72C|MATN4_ENST00000360607.6_Missense_Mutation_p.R72C|MATN4_ENST00000372751.4_Intron|RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000372756.1_Missense_Mutation_p.R72C|RBPJL_ENST00000372741.3_5'Flank			O95460	MATN4_HUMAN	matrilin 4	72	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.R72C(1)|p.N69fs*3(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				ACGCCAACGCGCGTGGCGTTG	0.647																																					p.R72C												.	.	2	Substitution - Missense(1)|Deletion - Frameshift(1)	large_intestine(1)|skin(1)	c.C214T	20						.						36.0	34.0	34.0					20																	43933297		2202	4299	6501	43366711	SO:0001583	missense	8785	exon3			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.214C>T	20.37:g.43933297G>A	ENSP00000361840:p.Arg72Cys		43366711	NM_003833	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	37		.	.	.	.	.	.	.	.	.	.	G	17.67	3.447297	0.63178	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	4.2	4.2	0.49525	.	0.000000	0.42964	D	0.000631	D	0.95172	0.8435	H	0.96916	3.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.95750	0.8791	10	0.87932	D	0	.	11.0291	0.47761	0.0:0.0:0.8142:0.1858	.	72;72;72	A6NNA4;O95460-4;O95460-2	.;.;.	C	72	ENSP00000361840:R72C;ENSP00000361842:R72C;ENSP00000243983:R72C;ENSP00000353819:R72C;ENSP00000343164:R72C;ENSP00000440328:R72C	ENSP00000255132:R72C	R	-	1	0	MATN4	43366711	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	3.380000	0.52448	2.161000	0.67846	0.462000	0.41574	CGC		0.647	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
ADNP	23394	broad.mit.edu	37	20	49507985	49507985	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr20:49507985T>C	ENST00000396029.3	-	5	3833	c.3266A>G	c.(3265-3267)cAt>cGt	p.H1089R	ADNP_ENST00000371602.4_Missense_Mutation_p.H1089R|ADNP_ENST00000396032.3_Missense_Mutation_p.H1089R|ADNP_ENST00000349014.3_Missense_Mutation_p.H1089R	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	1089					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H1089R(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						TAAGCTGCCATGCATGGGCTC	0.522																																					p.H1089R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3266G	20						.						106.0	81.0	90.0					20																	49507985		2203	4300	6503	48941392	SO:0001583	missense	23394	exon5			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.3266A>G	20.37:g.49507985T>C	ENSP00000379346:p.His1089Arg		48941392	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	ENST00000396029.3	37	CCDS13433.1	.	.	.	.	.	.	.	.	.	.	T	9.795	1.179095	0.21787	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.87	5.87	0.94306	.	0.088722	0.49305	D	0.000156	T	0.31918	0.0812	N	0.08118	0	0.36542	D	0.871351	B	0.02656	0.0	B	0.04013	0.001	T	0.31392	-0.9945	9	0.39692	T	0.17	-2.0144	10.5936	0.45325	0.0:0.0714:0.0:0.9286	.	1089	Q9H2P0	ADNP_HUMAN	R	1089	.	ENSP00000342905:H1089R	H	-	2	0	ADNP	48941392	0.991000	0.36638	0.979000	0.43373	0.992000	0.81027	2.287000	0.43505	2.248000	0.74166	0.533000	0.62120	CAT		0.522	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
NFATC2	4773	broad.mit.edu	37	20	50139944	50139944	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr20:50139944G>T	ENST00000396009.3	-	2	1055	c.836C>A	c.(835-837)cCc>cAc	p.P279H	NFATC2_ENST00000609507.1_Missense_Mutation_p.P60H|NFATC2_ENST00000609943.1_Missense_Mutation_p.P259H|NFATC2_ENST00000371564.3_Missense_Mutation_p.P279H|NFATC2_ENST00000414705.1_Missense_Mutation_p.P259H|NFATC2_ENST00000610033.1_Missense_Mutation_p.P60H	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	279	3 X approximate SP repeats.				B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P279H(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GTGAGATGAGGGCTGCGGCGA	0.711																																					p.P279H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C836A	20						.						9.0	12.0	11.0					20																	50139944		2170	4223	6393	49573351	SO:0001583	missense	4773	exon2			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.836C>A	20.37:g.50139944G>T	ENSP00000379330:p.Pro279His		49573351	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130792	0.37630	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.79033	-1.23;-1.23;-1.23	5.22	4.27	0.50696	.	0.373507	0.30285	N	0.009980	T	0.66509	0.2796	L	0.28344	0.845	0.27851	N	0.940733	P;P;D;P	0.56521	0.855;0.85;0.976;0.947	B;B;P;P	0.46975	0.359;0.258;0.533;0.533	T	0.58301	-0.7660	10	0.16420	T	0.52	-19.4848	9.8161	0.40853	0.157:0.0:0.843:0.0	.	259;259;279;279	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	H	279;279;60;259	ENSP00000360619:P279H;ENSP00000379330:P279H;ENSP00000396471:P259H	ENSP00000360619:P279H	P	-	2	0	NFATC2	49573351	1.000000	0.71417	0.987000	0.45799	0.712000	0.41017	8.585000	0.90802	1.190000	0.43042	0.313000	0.20887	CCC		0.711	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
PCK1	5105	broad.mit.edu	37	20	56140577	56140577	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr20:56140577G>T	ENST00000319441.4	+	10	1750	c.1586G>T	c.(1585-1587)gGc>gTc	p.G529V	PCK1_ENST00000543666.1_Missense_Mutation_p.G212V	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	529					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)	p.G529V(1)		endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CTCTGGCCAGGCTTTGGAGAG	0.557																																					p.G529V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1586T	20						.						76.0	75.0	75.0					20																	56140577		2203	4300	6503	55573983	SO:0001583	missense	5105	exon10				CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1586G>T	20.37:g.56140577G>T	ENSP00000319814:p.Gly529Val		55573983	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	37	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866552	0.91511	.	.	ENSG00000124253	ENST00000540165;ENST00000319441;ENST00000543666	T;T	0.07444	3.19;3.19	5.69	5.69	0.88448	Phosphoenolpyruvate carboxykinase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49609	0.1567	H	0.98333	4.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70324	-0.4903	10	0.87932	D	0	-43.4742	19.8045	0.96525	0.0:0.0:1.0:0.0	.	212;529	B4DT64;P35558	.;PCKGC_HUMAN	V	211;529;212	ENSP00000319814:G529V;ENSP00000445767:G212V	ENSP00000319814:G529V	G	+	2	0	PCK1	55573983	1.000000	0.71417	0.908000	0.35775	0.987000	0.75469	9.731000	0.98807	2.676000	0.91093	0.655000	0.94253	GGC		0.557	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
FOXG1	2290	broad.mit.edu	37	14	29237487	29237488	+	Nonsense_Mutation	DNP	CC	CC	AG	rs531378284		TCGA-AF-3913-01	TCGA-AF-3913-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr14:29237487_29237488CC>AG	ENST00000313071.4	+	1	1201_1202	c.1002_1003CC>AG	c.(1000-1005)taCCcc>taAGcc	p.334_335YP>*A	FOXG1_ENST00000382535.3_Nonsense_Mutation_p.334_335YP>*A	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	334					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y334>?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CGTCGGCCTACCCCAGCCACCC	0.658																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1002_1003AG	14						.																																			28307239	SO:0001587	stop_gained	2290	exon1				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	Exception_encountered	14.37:g.29237487_29237488delinsAG	ENSP00000339004:p.Y334_P335delins*A		28307238	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Nonsense_Mutation	DNP	ENST00000313071.4	37	CCDS9636.1																																																																																				0.658	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
SNW1	22938	broad.mit.edu	37	14	78205352	78205352	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr14:78205352T>C	ENST00000261531.7	-	4	445	c.383A>G	c.(382-384)gAt>gGt	p.D128G	SNW1_ENST00000555761.1_Missense_Mutation_p.D128G|SNW1_ENST00000554775.1_Intron|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	128					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)	p.D128G(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GTCTGGATCATCTGCATTCAT	0.378																																					p.D128G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A383G	14						.						278.0	292.0	287.0					14																	78205352		2203	4300	6503	77275105	SO:0001583	missense	22938	exon4			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.383A>G	14.37:g.78205352T>C	ENSP00000261531:p.Asp128Gly		77275105	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	ENST00000261531.7	37	CCDS9867.1	.	.	.	.	.	.	.	.	.	.	T	12.69	2.012927	0.35511	.	.	ENSG00000100603	ENST00000261531;ENST00000555761;ENST00000416259;ENST00000554324	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.48874	0.1524	L	0.31065	0.9	0.80722	D	1	B;B	0.14012	0.009;0.001	B;B	0.19666	0.026;0.003	T	0.44757	-0.9307	9	0.07175	T	0.84	.	15.8367	0.78805	0.0:0.0:0.0:1.0	.	128;128	G3V3A4;Q13573	.;SNW1_HUMAN	G	128	.	ENSP00000261531:D128G	D	-	2	0	SNW1	77275105	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.655000	0.83696	2.146000	0.66826	0.377000	0.23210	GAT		0.378	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
AHNAK2	113146	broad.mit.edu	37	14	105419482	105419482	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr14:105419482G>T	ENST00000333244.5	-	7	2425	c.2306C>A	c.(2305-2307)cCc>cAc	p.P769H	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	769						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.P769H(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCCACTTTGGGCATCTTCAA	0.617																																					p.P769H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2306A	14						.						116.0	128.0	124.0					14																	105419482		1873	4100	5973	104490527	SO:0001583	missense	113146	exon7			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2306C>A	14.37:g.105419482G>T	ENSP00000353114:p.Pro769His		104490527	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	g	14.03	2.414075	0.42817	.	.	ENSG00000185567	ENST00000333244	T	0.02837	4.14	3.28	3.28	0.37604	.	.	.	.	.	T	0.18299	0.0439	M	0.92122	3.275	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.03933	-1.0991	9	0.72032	D	0.01	-7.189	8.3859	0.32499	0.1153:0.0:0.8847:0.0	.	769	Q8IVF2	AHNK2_HUMAN	H	769	ENSP00000353114:P769H	ENSP00000353114:P769H	P	-	2	0	AHNAK2	104490527	0.943000	0.32029	0.003000	0.11579	0.060000	0.15804	0.918000	0.28678	1.374000	0.46228	0.485000	0.47835	CCC		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
GAL3ST1	9514	broad.mit.edu	37	22	30953352	30953352	+	Nonsense_Mutation	SNP	C	C	A	rs138460948	byFrequency	TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr22:30953352C>A	ENST00000402321.1	-	2	345	c.28G>T	c.(28-30)Gag>Tag	p.E10*	GAL3ST1_ENST00000401975.1_Nonsense_Mutation_p.E10*|GAL3ST1_ENST00000406955.1_Nonsense_Mutation_p.E10*|GAL3ST1_ENST00000402369.1_Nonsense_Mutation_p.E10*|GAL3ST1_ENST00000406361.1_Nonsense_Mutation_p.E10*|GAL3ST1_ENST00000443111.2_Nonsense_Mutation_p.E10*|GAL3ST1_ENST00000338911.5_Nonsense_Mutation_p.E10*			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	10					galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)	p.E10*(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						GCCATGGACTCCCAGGGCTTC	0.652																																					p.E10X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G28T	22						.						77.0	82.0	80.0					22																	30953352		2203	4300	6503	29283352	SO:0001587	stop_gained	9514	exon3			D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.28G>T	22.37:g.30953352C>A	ENSP00000385735:p.Glu10*		29283352	NM_004861	Q96C63	Nonsense_Mutation	SNP	ENST00000402321.1	37	CCDS13879.1	.	.	.	.	.	.	.	.	.	.	C	37	6.086896	0.97271	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111;ENST00000441967;ENST00000431313;ENST00000452827;ENST00000437282;ENST00000416358;ENST00000427899;ENST00000423299;ENST00000443136;ENST00000423371;ENST00000428682;ENST00000453479;ENST00000426220;ENST00000447224;ENST00000411821;ENST00000445645;ENST00000448604	.	.	.	5.84	1.11	0.20524	.	0.380754	0.27518	N	0.019020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-28.7184	6.9258	0.24414	0.0:0.306:0.442:0.252	.	.	.	.	X	10	.	ENSP00000343234:E10X	E	-	1	0	GAL3ST1	29283352	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	0.428000	0.21395	0.358000	0.24211	0.655000	0.94253	GAG		0.652	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321745.1	NM_004861	
GCAT	23464	broad.mit.edu	37	22	38212575	38212575	+	Splice_Site	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr22:38212575C>T	ENST00000248924.6	+	9	1166	c.1110C>T	c.(1108-1110)ggC>ggT	p.G370G	GCAT_ENST00000323205.6_Splice_Site_p.G396G	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	370					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)	p.G370G(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	CCCTCCCAGGCATCTTTGTCA	0.602																																					p.G370G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1110T	22						.						81.0	75.0	77.0					22																	38212575		2203	4300	6503	36542521	SO:0001630	splice_region_variant	23464	exon9			AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.1109-1C>T	22.37:g.38212575C>T			36542521	NM_014291	E2QC23|Q6ZWF1|Q96CA9	Silent	SNP	ENST00000248924.6	37	CCDS13957.1																																																																																				0.602	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2	Silent
ATF4	468	broad.mit.edu	37	22	39918282	39918282	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr22:39918282G>T	ENST00000337304.2	+	2	1613	c.731G>T	c.(730-732)aGg>aTg	p.R244M	ATF4_ENST00000404241.2_Missense_Mutation_p.R244M|ATF4_ENST00000396680.1_Missense_Mutation_p.R244M	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	244					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R244M(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TCTCCAAATAGGAGCCTCCCA	0.532																																					p.R244M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G731T	22						.						18.0	19.0	19.0					22																	39918282		2203	4297	6500	38248228	SO:0001583	missense	468	exon2			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.731G>T	22.37:g.39918282G>T	ENSP00000336790:p.Arg244Met		38248228	NM_001675	Q9UH31	Missense_Mutation	SNP	ENST00000337304.2	37	CCDS13996.1	.	.	.	.	.	.	.	.	.	.	G	3.871	-0.027951	0.07589	.	.	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	T;T;T	0.24908	1.83;1.83;1.83	3.64	-0.328	0.12690	.	2.266840	0.01429	N	0.014664	T	0.23886	0.0578	L	0.44542	1.39	0.09310	N	1	P	0.35600	0.511	B	0.32393	0.145	T	0.37174	-0.9717	10	0.87932	D	0	-9.0666	8.422	0.32707	0.501:0.0:0.499:0.0	.	244	P18848	ATF4_HUMAN	M	244	ENSP00000384587:R244M;ENSP00000336790:R244M;ENSP00000379912:R244M	ENSP00000336790:R244M	R	+	2	0	ATF4	38248228	0.000000	0.05858	0.001000	0.08648	0.309000	0.27889	0.688000	0.25422	0.076000	0.16826	0.313000	0.20887	AGG		0.532	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321305.1	NM_001675	
ZNF91	7644	broad.mit.edu	37	19	23543701	23543701	+	Missense_Mutation	SNP	T	T	C	rs78293839		TCGA-AF-3913-01	TCGA-AF-3913-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr19:23543701T>C	ENST00000300619.7	-	4	2285	c.2080A>G	c.(2080-2082)Act>Gct	p.T694A	ZNF91_ENST00000397082.2_Missense_Mutation_p.T662A|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	694					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T694A(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CGCTTAAAAGTTTTGTCACAT	0.343																																					p.T694A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2080G	19						.						93.0	97.0	96.0					19																	23543701		2070	4250	6320	23335541	SO:0001583	missense	7644	exon4			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2080A>G	19.37:g.23543701T>C	ENSP00000300619:p.Thr694Ala		23335541	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.096730	0.00034	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.03745	3.82;3.82	1.71	-3.43	0.04810	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01695	0.0054	N	0.17674	0.51	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.11329	0.0;0.006	T	0.47699	-0.9097	9	0.02654	T	1	.	1.6096	0.02691	0.3397:0.3682:0.1678:0.1243	.	662;694	Q05481-2;Q05481	.;ZNF91_HUMAN	A	694;662	ENSP00000300619:T694A;ENSP00000380272:T662A	ENSP00000300619:T694A	T	-	1	0	ZNF91	23335541	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.129000	0.03244	-2.440000	0.00550	-3.411000	0.00038	ACT		0.343	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
KIRREL2	84063	broad.mit.edu	37	19	36348303	36348303	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr19:36348303G>T	ENST00000360202.5	+	2	316	c.118G>T	c.(118-120)Gaa>Taa	p.E40*	KIRREL2_ENST00000592409.1_Nonsense_Mutation_p.E40*|KIRREL2_ENST00000347900.6_Intron|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000262625.7_Nonsense_Mutation_p.E40*	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	40	Ig-like C2-type 1.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)		p.E40*(2)		breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTGGGGGAGGAAGCCCGGCT	0.647																																					p.E40X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G118T	19						.						48.0	57.0	54.0					19																	36348303		2199	4297	6496	41040143	SO:0001587	stop_gained	84063	exon2			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.118G>T	19.37:g.36348303G>T	ENSP00000353331:p.Glu40*		41040143	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Nonsense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	G	38	6.838210	0.97877	.	.	ENSG00000126259	ENST00000262625;ENST00000360202;ENST00000341658	.	.	.	5.04	5.04	0.67666	.	0.000000	0.48767	D	0.000170	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-19.7951	14.3154	0.66446	0.0:0.0:1.0:0.0	.	.	.	.	X	40	.	ENSP00000262625:E40X	E	+	1	0	KIRREL2	41040143	0.568000	0.26635	0.992000	0.48379	0.997000	0.91878	1.180000	0.32005	2.525000	0.85131	0.650000	0.86243	GAA		0.647	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
TBC1D17	79735	broad.mit.edu	37	19	50388006	50388006	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr19:50388006G>A	ENST00000221543.5	+	13	1734	c.1435G>A	c.(1435-1437)Gac>Aac	p.D479N	TBC1D17_ENST00000535102.2_Missense_Mutation_p.D446N	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	479	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)	p.D479N(1)		NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		CCTGCTCTGCGACTTCCTGGG	0.602																																					p.D446N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1336A	19						.						40.0	39.0	39.0					19																	50388006		2203	4300	6503	55079818	SO:0001583	missense	79735	exon12			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.1435G>A	19.37:g.50388006G>A	ENSP00000221543:p.Asp479Asn		55079818	NM_001168222	B4DT12|B9A6L8|F5H1W7	Missense_Mutation	SNP	ENST00000221543.5	37	CCDS12785.1	.	.	.	.	.	.	.	.	.	.	G	9.855	1.194820	0.22037	.	.	ENSG00000104946	ENST00000221543;ENST00000535102	T;T	0.10860	2.83;2.83	4.23	4.23	0.50019	Rab-GAP/TBC domain (5);	0.124686	0.52532	D	0.000080	T	0.04048	0.0113	N	0.01761	-0.735	0.80722	D	1	B;B	0.24533	0.105;0.003	B;B	0.22386	0.039;0.013	T	0.40739	-0.9547	10	0.08837	T	0.75	-33.4833	14.5005	0.67719	0.0:0.0:1.0:0.0	.	446;479	F5H1W7;Q9HA65	.;TBC17_HUMAN	N	479;446	ENSP00000221543:D479N;ENSP00000446323:D446N	ENSP00000221543:D479N	D	+	1	0	TBC1D17	55079818	1.000000	0.71417	0.995000	0.50966	0.250000	0.25880	3.801000	0.55545	2.343000	0.79666	0.655000	0.94253	GAC		0.602	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466404.1	NM_024682	
SPAG1	6674	broad.mit.edu	37	8	101196231	101196231	+	Missense_Mutation	SNP	A	A	C			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:101196231A>C	ENST00000388798.2	+	6	727	c.536A>C	c.(535-537)gAa>gCa	p.E179A	SPAG1_ENST00000520643.1_Missense_Mutation_p.E179A|SPAG1_ENST00000520508.1_Missense_Mutation_p.E179A|Y_RNA_ENST00000362797.1_RNA|SPAG1_ENST00000251809.3_Missense_Mutation_p.E179A	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	179					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.E179A(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		GATTACAAAGAAAAGACGGTA	0.279																																					p.E179A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A536C	8						.						53.0	55.0	55.0					8																	101196231		2203	4287	6490	101265407	SO:0001583	missense	6674	exon6			AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.536A>C	8.37:g.101196231A>C	ENSP00000373450:p.Glu179Ala		101265407	NM_003114	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	37	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.259556	0.59321	.	.	ENSG00000104450	ENST00000520643;ENST00000251809;ENST00000520508;ENST00000388798	T;T;T;T	0.13307	2.6;2.6;2.6;2.6	5.66	4.5	0.54988	.	1.696240	0.02577	N	0.098466	T	0.20618	0.0496	M	0.69823	2.125	0.33453	D	0.583984	B;B	0.26318	0.146;0.138	B;B	0.23150	0.039;0.044	T	0.24693	-1.0153	10	0.45353	T	0.12	-14.6961	6.8595	0.24060	0.7713:0.1511:0.0776:0.0	.	179;179	Q07617;G3XAM3	SPAG1_HUMAN;.	A	179	ENSP00000427716:E179A;ENSP00000251809:E179A;ENSP00000428070:E179A;ENSP00000373450:E179A	ENSP00000251809:E179A	E	+	2	0	SPAG1	101265407	1.000000	0.71417	0.975000	0.42487	0.794000	0.44872	2.097000	0.41748	0.982000	0.38575	0.459000	0.35465	GAA		0.279	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218	
NUDCD1	84955	broad.mit.edu	37	8	110293397	110293397	+	Silent	SNP	A	A	C			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:110293397A>C	ENST00000239690.4	-	6	1202	c.828T>G	c.(826-828)ccT>ccG	p.P276P	NUDCD1_ENST00000427660.2_Silent_p.P247P	NM_032869.3	NP_116258.2			NudC domain containing 1									p.P276P(1)		breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			AGTAATACAGAGGTTCTATTG	0.338																																					p.P276P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T828G	8						.						87.0	80.0	82.0					8																	110293397		2203	4300	6503	110362573	SO:0001819	synonymous_variant	84955	exon6			AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.828T>G	8.37:g.110293397A>C			110362573	NM_032869		Silent	SNP	ENST00000239690.4	37	CCDS6312.1																																																																																				0.338	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380996.1	NM_032869	
AGPAT6	137964	broad.mit.edu	37	8	41470394	41470394	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:41470394G>T	ENST00000396987.3	+	8	1753	c.826G>T	c.(826-828)Gtg>Ttg	p.V276L	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	276					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.V276L(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			ACTCATGGGTGTGATTCAGAG	0.547											OREG0018739	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V276L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G826T	8						.						120.0	85.0	97.0					8																	41470394		2203	4300	6503	41589551	SO:0001583	missense	137964	exon8			AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.826G>T	8.37:g.41470394G>T	ENSP00000380184:p.Val276Leu	901	41589551	NM_178819	Q86V89	Missense_Mutation	SNP	ENST00000396987.3	37	CCDS6117.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971851	0.74246	.	.	ENSG00000158669	ENST00000396987	D	0.92397	-3.03	5.3	5.3	0.74995	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.85579	0.5729	N	0.13043	0.29	0.80722	D	1	B	0.09022	0.002	B	0.15484	0.013	T	0.79550	-0.1757	10	0.27082	T	0.32	.	18.1301	0.89598	0.0:0.0:1.0:0.0	.	276	Q86UL3	GPAT4_HUMAN	L	276	ENSP00000380184:V276L	ENSP00000380184:V276L	V	+	1	0	AGPAT6	41589551	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	3.911000	0.56378	2.769000	0.95229	0.655000	0.94253	GTG		0.547	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
ANK1	286	broad.mit.edu	37	8	41530174	41530174	+	Silent	SNP	G	G	A	rs61753678		TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:41530174G>A	ENST00000347528.4	-	38	4877	c.4794C>T	c.(4792-4794)caC>caT	p.H1598H	ANK1_ENST00000379758.2_Silent_p.H1598H|ANK1_ENST00000396942.1_Silent_p.H1598H|ANK1_ENST00000352337.4_Silent_p.H1598H|ANK1_ENST00000289734.7_Silent_p.H1598H|ANK1_ENST00000396945.1_Silent_p.H1598H|ANK1_ENST00000265709.8_Silent_p.H1639H	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1598	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.H1598H(1)		breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			ACTTCCACTCGTGACCTGTGG	0.597																																					p.H1598H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4794T	8						.						88.0	89.0	89.0					8																	41530174		2203	4300	6503	41649331	SO:0001819	synonymous_variant	286	exon38			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4794C>T	8.37:g.41530174G>A			41649331	NM_020475	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	37	CCDS6119.1																																																																																				0.597	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
PRKDC	5591	broad.mit.edu	37	8	48855841	48855841	+	Silent	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:48855841T>C	ENST00000314191.2	-	10	950	c.894A>G	c.(892-894)ttA>ttG	p.L298L	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.L298L	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	298					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.L298L(2)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CACACCACTTTAACAAGACTT	0.433								Non-homologous end-joining																													p.L298L	Esophageal Squamous(79;1091 1253 12329 31680 40677)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A894G	8						.						71.0	69.0	70.0					8																	48855841		1900	4117	6017	49018394	SO:0001819	synonymous_variant	5591	exon10				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.894A>G	8.37:g.48855841T>C			49018394	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	ENST00000314191.2	37																																																																																					0.433	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
ST18	9705	broad.mit.edu	37	8	53028937	53028937	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:53028937C>T	ENST00000276480.7	-	25	3584	c.2901G>A	c.(2899-2901)gaG>gaA	p.E967E		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	967					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.E967E(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGAGTTTGTTCTCCTCCTCTA	0.428																																					p.E967E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2901A	8						.						239.0	171.0	194.0					8																	53028937		2203	4300	6503	53191490	SO:0001819	synonymous_variant	9705	exon25			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2901G>A	8.37:g.53028937C>T			53191490	NM_014682	Q17RY1	Silent	SNP	ENST00000276480.7	37	CCDS6149.1																																																																																				0.428	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
OSGIN2	734	broad.mit.edu	37	8	90936738	90936738	+	Missense_Mutation	SNP	A	A	G			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:90936738A>G	ENST00000297438.2	+	6	851	c.496A>G	c.(496-498)Aaa>Gaa	p.K166E	OSGIN2_ENST00000451899.2_Missense_Mutation_p.K210E	NM_004337.2	NP_004328.1	Q9Y236	OSGI2_HUMAN	oxidative stress induced growth inhibitor family member 2	166					meiotic nuclear division (GO:0007126)			p.K166E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(1)	17			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TAGGAGCCTAAAAGGGGATCG	0.328																																					p.K166E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A496G	8						.						55.0	62.0	59.0					8																	90936738		2182	4291	6473	91005913	SO:0001583	missense	734	exon6			AF061326	CCDS6248.1, CCDS47888.1	8q21	2006-10-05	2006-10-05	2006-10-05	ENSG00000164823	ENSG00000164823			1355	protein-coding gene	gene with protein product		604598	"""chromosome 8 open reading frame 1"""	C8orf1		9933573	Standard	NM_004337		Approved	hT41	uc003yeh.3	Q9Y236	OTTHUMG00000163811	ENST00000297438.2:c.496A>G	8.37:g.90936738A>G	ENSP00000297438:p.Lys166Glu		91005913	NM_004337		Missense_Mutation	SNP	ENST00000297438.2	37	CCDS6248.1	.	.	.	.	.	.	.	.	.	.	A	12.90	2.077494	0.36662	.	.	ENSG00000164823	ENST00000297438;ENST00000451899	T;T	0.25250	1.81;1.81	4.93	4.93	0.64822	.	0.099261	0.64402	D	0.000002	T	0.27731	0.0682	L	0.44542	1.39	0.80722	D	1	P;P	0.49090	0.919;0.855	P;P	0.47015	0.501;0.534	T	0.02345	-1.1173	10	0.19590	T	0.45	-19.184	14.872	0.70465	1.0:0.0:0.0:0.0	.	210;166	Q9Y236-2;Q9Y236	.;OSGI2_HUMAN	E	166;210	ENSP00000297438:K166E;ENSP00000396445:K210E	ENSP00000297438:K166E	K	+	1	0	OSGIN2	91005913	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	4.919000	0.63383	1.992000	0.58205	0.454000	0.30748	AAA		0.328	OSGIN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375691.1	NM_004337	
EXT1	2131	broad.mit.edu	37	8	119122509	119122509	+	Silent	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr8:119122509G>A	ENST00000378204.2	-	1	1583	c.777C>T	c.(775-777)ctC>ctT	p.L259L		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	259					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.L259L(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TGTACTTCCTGAGAGGAGGGA	0.498			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.L259L		yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C777T	8						.						193.0	155.0	168.0					8																	119122509		2203	4300	6503	119191690	SO:0001819	synonymous_variant	2131	exon1	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.777C>T	8.37:g.119122509G>A			119191690	NM_000127	B2R7V2|Q9BVI9	Silent	SNP	ENST00000378204.2	37	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	G	4.140	0.024308	0.08054	.	.	ENSG00000182197	ENST00000436216	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.1406	15.0861	0.72155	0.0:0.1413:0.8587:0.0	.	.	.	.	X	49	.	.	Q	-	1	0	EXT1	119191690	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.948000	0.49066	2.616000	0.88540	0.462000	0.41574	CAG		0.498	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
EXTL2	2135	broad.mit.edu	37	1	101343241	101343241	+	Missense_Mutation	SNP	C	C	G	rs200323785		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:101343241C>G	ENST00000370114.3	-	3	1660	c.224G>C	c.(223-225)aGa>aCa	p.R75T	EXTL2_ENST00000535414.1_Missense_Mutation_p.R62T|EXTL2_ENST00000370113.3_Missense_Mutation_p.R75T	NM_001033025.2|NM_001261440.1	NP_001028197.1|NP_001248369.1	Q9UBQ6	EXTL2_HUMAN	exostosin-like glycosyltransferase 2	75					heparan sulfate proteoglycan biosynthetic process (GO:0015012)|N-acetylglucosamine metabolic process (GO:0006044)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	alpha-1,4-N-acetylgalactosaminyltransferase activity (GO:0035248)|glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)	p.R75T(1)|p.R83T(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	14		all_epithelial(167;2.48e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0425)|all cancers(265;0.0628)|COAD - Colon adenocarcinoma(174;0.148)|Colorectal(144;0.167)|Lung(183;0.195)		GAGATCTGTTCTGTTGTACGT	0.398																																					p.R75T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G224C	1						.						131.0	130.0	130.0					1																	101343241		2203	4300	6503	101115829	SO:0001583	missense	2135	exon3			U76189	CCDS775.1, CCDS72831.1	1p21	2013-03-01	2013-03-01		ENSG00000162694	ENSG00000162694	2.4.1.223	"""Exostosin glycosyltransferase family"""	3516	protein-coding gene	gene with protein product	"""alpha-1,4-N-acteylhexosaminyltransferase"""	602411	"""exostoses (multiple)-like 2"""			9450183, 15831490	Standard	NM_001439		Approved		uc001dtk.2	Q9UBQ6	OTTHUMG00000011814	ENST00000370114.3:c.224G>C	1.37:g.101343241C>G	ENSP00000359132:p.Arg75Thr		101115829	NM_001033025	B2R795|D3DT60	Missense_Mutation	SNP	ENST00000370114.3	37	CCDS775.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908908	0.92107	.	.	ENSG00000162694	ENST00000370114;ENST00000370113;ENST00000535414;ENST00000450240;ENST00000416479	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	5.61	5.61	0.85477	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.91713	0.7380	M	0.91872	3.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.92562	0.6059	10	0.87932	D	0	-27.9273	20.0018	0.97417	0.0:1.0:0.0:0.0	.	75;75	Q8N8F1;Q9UBQ6	.;EXTL2_HUMAN	T	75;75;62;83;62	ENSP00000359132:R75T;ENSP00000359131:R75T;ENSP00000444385:R62T;ENSP00000403363:R83T;ENSP00000392255:R62T	ENSP00000359131:R75T	R	-	2	0	EXTL2	101115829	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.445000	0.80570	2.793000	0.96121	0.655000	0.94253	AGA		0.398	EXTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032705.1	NM_001439	
NRAS	4893	broad.mit.edu	37	1	115256528	115256528	+	Missense_Mutation	SNP	T	T	G	rs121913255		TCGA-AF-3913-01	TCGA-AF-3913-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:115256528T>G	ENST00000369535.4	-	3	436	c.183A>C	c.(181-183)caA>caC	p.Q61H		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61H(100)|p.Q61Q(3)|p.Q61L(3)|p.Q61R(2)|p.Q61K(1)|p.Q61_E62>HK(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTACTCTTCTTGTCCAGCTG	0.463	Q61H(ME1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61H(RD_SOFT_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61H			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-2	.	110	Substitution - Missense(106)|Substitution - coding silent(3)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(48)|skin(43)|soft_tissue(8)|thyroid(6)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|NS(1)	c.A183C	1						.						180.0	156.0	164.0					1																	115256528		2203	4300	6503	115058051	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.183A>C	1.37:g.115256528T>G	ENSP00000358548:p.Gln61His		115058051	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.585934	0.66105	.	.	ENSG00000213281	ENST00000369535	D	0.84146	-1.81	5.08	3.93	0.45458	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.87026	0.6075	H	0.94385	3.53	0.80722	D	1	B	0.30763	0.294	B	0.42087	0.375	D	0.89247	0.3588	10	0.72032	D	0.01	.	5.8174	0.18500	0.0:0.1721:0.0:0.8279	.	61	P01111	RASN_HUMAN	H	61	ENSP00000358548:Q61H	ENSP00000358548:Q61H	Q	-	3	2	NRAS	115058051	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.898000	0.28404	2.120000	0.65058	0.533000	0.62120	CAA		0.463	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
SPAG17	200162	broad.mit.edu	37	1	118558619	118558619	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:118558619G>T	ENST00000336338.5	-	29	4321	c.4256C>A	c.(4255-4257)tCc>tAc	p.S1419Y		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1419						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.S1419Y(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GGCCTGAAAGGATAACAATGG	0.413																																					p.S1419Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4256A	1						.						153.0	162.0	159.0					1																	118558619		2203	4300	6503	118360142	SO:0001583	missense	200162	exon29				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4256C>A	1.37:g.118558619G>T	ENSP00000337804:p.Ser1419Tyr		118360142	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	7.908	0.735938	0.15574	.	.	ENSG00000155761	ENST00000336338	T	0.20069	2.1	4.98	2.04	0.26737	.	0.457000	0.24511	N	0.037884	T	0.08492	0.0211	L	0.56769	1.78	0.22156	N	0.999327	P	0.44044	0.825	B	0.39935	0.314	T	0.10823	-1.0613	10	0.56958	D	0.05	.	7.6275	0.28220	0.2821:0.0:0.7179:0.0	.	1419	Q6Q759	SPG17_HUMAN	Y	1419	ENSP00000337804:S1419Y	ENSP00000337804:S1419Y	S	-	2	0	SPAG17	118360142	1.000000	0.71417	0.313000	0.25210	0.331000	0.28603	1.873000	0.39558	0.140000	0.18849	0.460000	0.39030	TCC		0.413	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
FLG2	388698	broad.mit.edu	37	1	152328756	152328756	+	Silent	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:152328756G>T	ENST00000388718.5	-	3	1578	c.1506C>A	c.(1504-1506)tcC>tcA	p.S502S	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	502	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S502S(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAAAGCCAGAGGACTGACCTG	0.522																																					p.S502S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1506A	1						.						232.0	231.0	232.0					1																	152328756		2203	4300	6503	150595380	SO:0001819	synonymous_variant	388698	exon3			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1506C>A	1.37:g.152328756G>T			150595380	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																				0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
LCE3D	84648	broad.mit.edu	37	1	152552262	152552262	+	Missense_Mutation	SNP	C	C	T	rs145962377	byFrequency	TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:152552262C>T	ENST00000368787.3	-	2	207	c.151G>A	c.(151-153)Ggc>Agc	p.G51S		NM_032563.1	NP_115952.1	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	51					keratinization (GO:0031424)			p.G51S(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|skin(1)|stomach(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)		AGGAAGCAGCCGCCCTCGGAG	0.672													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15382	0.001		0.0	False		,,,				2504	0.0				p.G51S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G151A	1						.	C	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	46.0	55.0	52.0		151	1.7	0.4	1	dbSNP_134	52	5,8587	3.7+/-12.6	0,5,4291	no	missense	LCE3D	NM_032563.1	56	0,6,6493	TT,TC,CC		0.0582,0.0227,0.0462	benign	51/93	152552262	6,12992	2203	4296	6499	150818886	SO:0001583	missense	84648	exon2			BI670519	CCDS1014.1	1q21	2008-02-05	2004-05-21	2004-10-15	ENSG00000163202	ENSG00000163202		"""Late cornified envelopes"""	16615	protein-coding gene	gene with protein product		612616	"""small proline rich-like (epidermal differentiation complex) 6B"""	SPRL6B, SPRL6A		11698679	Standard	NM_032563		Approved	LEP16	uc001fab.3	Q9BYE3	OTTHUMG00000012384	ENST00000368787.3:c.151G>A	1.37:g.152552262C>T	ENSP00000357776:p.Gly51Ser		150818886	NM_032563	Q3MIL1	Missense_Mutation	SNP	ENST00000368787.3	37	CCDS1014.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	11.02	1.516689	0.27123	2.27E-4	5.82E-4	ENSG00000163202	ENST00000368787	T	0.04603	3.59	3.6	1.68	0.24146	.	.	.	.	.	T	0.01189	0.0039	.	.	.	0.23978	N	0.996284	B	0.31968	0.349	B	0.21708	0.036	T	0.46898	-0.9158	8	0.87932	D	0	.	5.89	0.18904	0.0:0.7473:0.0:0.2527	.	51	Q9BYE3	LCE3D_HUMAN	S	51	ENSP00000357776:G51S	ENSP00000357776:G51S	G	-	1	0	LCE3D	150818886	0.235000	0.23794	0.421000	0.26609	0.937000	0.57800	0.305000	0.19254	0.326000	0.23384	0.655000	0.94253	GGC		0.672	LCE3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034504.1	NM_032563	
UBAP2L	9898	broad.mit.edu	37	1	154224110	154224110	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:154224110C>A	ENST00000361546.2	+	13	1687	c.1645C>A	c.(1645-1647)Ctg>Atg	p.L549M	UBAP2L_ENST00000271877.7_Missense_Mutation_p.L560M|AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000343815.6_Missense_Mutation_p.L549M|UBAP2L_ENST00000428931.1_Missense_Mutation_p.L549M			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	549					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.L549M(1)|p.L45M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCAAGTAGCCTGTATACCAG	0.483																																					p.L549M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1645A	1						.						77.0	79.0	78.0					1																	154224110		2203	4300	6503	152490734	SO:0001583	missense	9898	exon14			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1645C>A	1.37:g.154224110C>A	ENSP00000355343:p.Leu549Met		152490734	NM_014847	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101774	0.76983	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.16073	2.39;2.4;2.37;2.4	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.32224	0.0822	L	0.57536	1.79	0.58432	D	0.999999	D;D;D;D;D	0.76494	0.998;0.999;0.999;0.999;0.998	D;D;D;D;D	0.85130	0.99;0.997;0.996;0.996;0.994	T	0.02868	-1.1100	10	0.87932	D	0	-1.6432	17.817	0.88638	0.0:1.0:0.0:0.0	.	463;560;542;549;549	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	M	549;549;45;45;560;549	ENSP00000345308:L549M;ENSP00000389445:L549M;ENSP00000271877:L560M;ENSP00000355343:L549M	ENSP00000271877:L560M	L	+	1	2	UBAP2L	152490734	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.137000	0.77295	2.755000	0.94549	0.650000	0.86243	CTG		0.483	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
CTRC	11330	broad.mit.edu	37	1	15768968	15768968	+	Missense_Mutation	SNP	G	G	A	rs367979183		TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:15768968G>A	ENST00000375949.4	+	4	282	c.256G>A	c.(256-258)Gtg>Atg	p.V86M	CTRC_ENST00000483406.1_3'UTR|CTRC_ENST00000375943.2_Silent_p.P22P	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	86	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.V86M(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCGTGTGGCCGTGGGAAAGAA	0.617																																					p.V86M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G256A	1						.	G	MET/VAL	0,4406		0,0,2203	132.0	87.0	102.0		256	2.5	1.0	1		102	1,8599		0,1,4299	no	missense	CTRC	NM_007272.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	86/269	15768968	1,13005	2203	4300	6503	15641555	SO:0001583	missense	11330	exon4			BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.256G>A	1.37:g.15768968G>A	ENSP00000365116:p.Val86Met		15641555	NM_007272	A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	ENST00000375949.4	37	CCDS156.1	.	.	.	.	.	.	.	.	.	.	.	6.056	0.378699	0.11466	0.0	1.16E-4	ENSG00000162438	ENST00000375949	D	0.89552	-2.53	4.39	2.52	0.30459	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.239260	0.35436	N	0.003206	D	0.83142	0.5190	L	0.53729	1.69	0.80722	D	1	B;B	0.29612	0.251;0.039	B;B	0.23018	0.043;0.017	T	0.81104	-0.1084	10	0.59425	D	0.04	-11.4298	7.8498	0.29448	0.0:0.5931:0.3171:0.0898	.	86;86	A8MTQ9;Q99895	.;CTRC_HUMAN	M	86	ENSP00000365116:V86M	ENSP00000365116:V86M	V	+	1	0	CTRC	15641555	0.004000	0.15560	0.999000	0.59377	0.017000	0.09413	-0.006000	0.12833	1.204000	0.43247	-0.234000	0.12200	GTG		0.617	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006435.1	NM_007272	
RAB25	57111	broad.mit.edu	37	1	156035800	156035800	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:156035800G>C	ENST00000361084.5	+	2	383	c.142G>C	c.(142-144)Gag>Cag	p.E48Q	RAB25_ENST00000487325.1_Intron	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	48					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)	p.E52Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					CATCGGGGTTGAGTTCTCCAC	0.607																																					p.E48Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G142C	1						.						63.0	68.0	67.0					1																	156035800		2157	4274	6431	154302424	SO:0001583	missense	57111	exon2			AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.142G>C	1.37:g.156035800G>C	ENSP00000354376:p.Glu48Gln		154302424	NM_020387	Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Missense_Mutation	SNP	ENST00000361084.5	37	CCDS41413.1	.	.	.	.	.	.	.	.	.	.	G	35	5.424759	0.96111	.	.	ENSG00000132698	ENST00000361084	T	0.80994	-1.44	5.44	5.44	0.79542	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.87993	0.6318	M	0.71920	2.185	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.88360	0.2987	10	0.87932	D	0	.	18.0139	0.89232	0.0:0.0:1.0:0.0	.	48	P57735	RAB25_HUMAN	Q	48	ENSP00000354376:E48Q	ENSP00000354376:E48Q	E	+	1	0	RAB25	154302424	1.000000	0.71417	0.973000	0.42090	0.981000	0.71138	9.525000	0.98039	2.828000	0.97474	0.655000	0.94253	GAG		0.607	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046185.1		
CACNA1E	777	broad.mit.edu	37	1	181764147	181764147	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:181764147C>T	ENST00000367573.2	+	46	6175	c.6175C>T	c.(6175-6177)Cgg>Tgg	p.R2059W	CACNA1E_ENST00000367570.1_Missense_Mutation_p.R2016W|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R2040W|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R1948W|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1623W|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R1997W|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R2010W	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2059					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R2016W(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTCCTCCTTGCGGCTGTCAGC	0.542																																					p.R2016W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6046T	1						.						56.0	60.0	59.0					1																	181764147		1929	4130	6059	180030770	SO:0001583	missense	777	exon45			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6175C>T	1.37:g.181764147C>T	ENSP00000356545:p.Arg2059Trp		180030770	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	37	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729196	0.69074	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97138	-4.18;-4.17;-4.09;-4.17;-4.26;-4.08;-4.09	5.91	1.32	0.21799	.	0.562824	0.19394	N	0.115332	D	0.93432	0.7905	N	0.24115	0.695	0.46203	D	0.998923	D;D	0.56287	0.975;0.962	B;P	0.45428	0.436;0.48	D	0.90329	0.4350	10	0.87932	D	0	.	11.272	0.49144	0.6122:0.324:0.0:0.0638	.	1997;2016	Q15878-2;Q15878-3	.;.	W	2016;1997;2010;1948;1623;2040;2059	ENSP00000356542:R2016W;ENSP00000434814:R1997W;ENSP00000350183:R2010W;ENSP00000351101:R1948W;ENSP00000356539:R1623W;ENSP00000353222:R2040W;ENSP00000356545:R2059W	ENSP00000350183:R2010W	R	+	1	2	CACNA1E	180030770	0.998000	0.40836	0.997000	0.53966	0.986000	0.74619	0.444000	0.21661	-0.062000	0.13088	0.655000	0.94253	CGG		0.542	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
CYB5R1	51706	broad.mit.edu	37	1	202935700	202935700	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:202935700C>T	ENST00000367249.4	-	3	268	c.194G>A	c.(193-195)cGc>cAc	p.R65H	CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	65	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)	p.R65H(1)		breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	CAGGGCAAAGCGGAACCTCTT	0.607																																					p.R65H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G194A	1						.						111.0	89.0	96.0					1																	202935700		2203	4300	6503	201202323	SO:0001583	missense	51706	exon3			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.194G>A	1.37:g.202935700C>T	ENSP00000356218:p.Arg65His		201202323	NM_016243	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	Missense_Mutation	SNP	ENST00000367249.4	37	CCDS1431.1	.	.	.	.	.	.	.	.	.	.	C	37	6.325784	0.97476	.	.	ENSG00000159348	ENST00000367249	D	0.85702	-2.02	5.95	5.95	0.96441	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);	0.134163	0.49916	D	0.000122	D	0.94108	0.8111	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.94735	0.7913	10	0.87932	D	0	-0.0195	17.887	0.88858	0.0:1.0:0.0:0.0	.	65	Q9UHQ9	NB5R1_HUMAN	H	65	ENSP00000356218:R65H	ENSP00000356218:R65H	R	-	2	0	CYB5R1	201202323	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.707000	0.74654	2.824000	0.97209	0.655000	0.94253	CGC		0.607	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099155.1	NM_016243	
GJA4	2701	broad.mit.edu	37	1	35260477	35260477	+	Silent	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:35260477G>A	ENST00000342280.4	+	2	751	c.663G>A	c.(661-663)ctG>ctA	p.L221L		NM_002060.2	NP_002051.2	P35212	CXA4_HUMAN	gap junction protein, alpha 4, 37kDa	221					blood vessel development (GO:0001568)|calcium ion transport (GO:0006816)|cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|endothelium development (GO:0003158)|response to pain (GO:0048265)|transport (GO:0006810)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)		p.L221L(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(4)|stomach(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TCATCTCCCTGGTGCTTAACC	0.617																																					p.L221L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G663A	1						.						93.0	87.0	89.0					1																	35260477		2203	4300	6503	35033064	SO:0001819	synonymous_variant	2701	exon2			M96789	CCDS30669.1	1p35.1	2008-02-05	2007-01-16		ENSG00000187513	ENSG00000187513		"""Ion channels / Gap junction proteins (connexins)"""	4278	protein-coding gene	gene with protein product	"""connexin 37"""	121012	"""gap junction protein, alpha 4, 37kD (connexin 37)"", ""gap junction protein, alpha 4, 37kDa (connexin 37)"""			9843209, 7680674	Standard	XM_005270750		Approved	CX37	uc001bya.3	P35212	OTTHUMG00000004050	ENST00000342280.4:c.663G>A	1.37:g.35260477G>A			35033064	NM_002060	A8K698|D3DPR4|Q9P106|Q9UBL1|Q9UNA9|Q9UNB0|Q9UNB1|Q9Y5N7	Silent	SNP	ENST00000342280.4	37	CCDS30669.1																																																																																				0.617	GJA4-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011556.1	NM_002060	
RIMS3	9783	broad.mit.edu	37	1	41101660	41101660	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:41101660C>T	ENST00000372684.3	-	4	756	c.287G>A	c.(286-288)cGg>cAg	p.R96Q	RIMS3_ENST00000372683.1_Missense_Mutation_p.R96Q	NM_014747.2	NP_055562.2	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3	96					calcium ion-dependent exocytosis (GO:0017156)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)		p.R96Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			GACCCGGCTCCGCATCTCCAC	0.682																																					p.R96Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G287A	1						.						72.0	64.0	66.0					1																	41101660		2203	4300	6503	40874247	SO:0001583	missense	9783	exon4			BC003103	CCDS30687.1	1p34.2	2013-09-19			ENSG00000117016	ENSG00000117016			21292	protein-coding gene	gene with protein product		611600				12620390, 10748113	Standard	NM_014747		Approved	RIM3, NIM3	uc001cfu.1	Q9UJD0	OTTHUMG00000007453	ENST00000372684.3:c.287G>A	1.37:g.41101660C>T	ENSP00000361769:p.Arg96Gln		40874247	NM_014747	D3DPV8|Q92511|X5D7U7	Missense_Mutation	SNP	ENST00000372684.3	37	CCDS30687.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.329311	0.81690	.	.	ENSG00000117016	ENST00000372684;ENST00000372683	T;T	0.37411	1.2;1.2	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	P	0.53593	0.73	T	0.24333	-1.0163	10	0.51188	T	0.08	-24.1876	15.9164	0.79521	0.0:1.0:0.0:0.0	.	96	Q9UJD0	RIMS3_HUMAN	Q	96	ENSP00000361769:R96Q;ENSP00000361768:R96Q	ENSP00000361768:R96Q	R	-	2	0	RIMS3	40874247	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.575000	0.82447	2.626000	0.88956	0.650000	0.86243	CGG		0.682	RIMS3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019585.1	NM_014747	
FPGT	8790	broad.mit.edu	37	1	74670203	74670203	+	Missense_Mutation	SNP	A	A	C			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:74670203A>C	ENST00000609362.1	+	4	509	c.472A>C	c.(472-474)Atg>Ctg	p.M158L	FPGT_ENST00000370898.3_Missense_Mutation_p.M171L|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT_ENST00000467578.2_3'UTR|FPGT_ENST00000524915.1_Intron|FPGT_ENST00000370894.5_Intron|FPGT_ENST00000534056.1_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000370893.1_Intron	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	158					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)	p.M158L(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						CCCCTTAAATATGAATCCTGG	0.353																																					p.M158L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A472C	1						.						109.0	112.0	111.0					1																	74670203		2203	4300	6503	74442791	SO:0001583	missense	8790	exon4			AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.472A>C	1.37:g.74670203A>C	ENSP00000476680:p.Met158Leu		74442791	NM_003838	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	CCDS663.1	.	.	.	.	.	.	.	.	.	.	A	19.21	3.784334	0.70222	.	.	ENSG00000254685	ENST00000370898;ENST00000472069	T;T	0.31510	1.49;1.49	5.57	4.45	0.53987	L-fucokinase (1);	.	.	.	.	T	0.24812	0.0602	M	0.65975	2.015	0.80722	D	1	P	0.40681	0.727	P	0.48840	0.592	T	0.05305	-1.0893	9	0.13853	T	0.58	.	10.9181	0.47148	0.9269:0.0:0.0731:0.0	.	158	O14772	FPGT_HUMAN	L	158;156	ENSP00000359935:M158L;ENSP00000433499:M156L	ENSP00000359935:M158L	M	+	1	0	TNNI3K	74442791	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.175000	0.77632	2.116000	0.64780	0.482000	0.46254	ATG		0.353	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
OPN3	23596	broad.mit.edu	37	1	241767754	241767754	+	Silent	SNP	C	C	T	rs370046789		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:241767754C>T	ENST00000366554.2	-	2	607	c.501G>A	c.(499-501)gcG>gcA	p.A167A	OPN3_ENST00000469376.1_5'UTR|OPN3_ENST00000331838.5_Intron	NM_014322.2	NP_055137.2	Q9H1Y3	OPN3_HUMAN	opsin 3	167			A -> V (in dbSNP:rs12072790).		detection of light stimulus (GO:0009583)|detection of visible light (GO:0009584)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)	p.A167A(1)		endometrium(1)|large_intestine(5)|lung(5)	11	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			CTCCTGCCCACGCCAGTGAGT	0.547																																					p.A167A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G501A	1						.	C		0,4406		0,0,2203	104.0	90.0	95.0		501	-10.5	0.0	1		95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OPN3	NM_014322.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		167/403	241767754	1,13005	2203	4300	6503	239834377	SO:0001819	synonymous_variant	23596	exon2			AF140242	CCDS31072.1	1q43	2014-06-13	2008-04-16		ENSG00000054277	ENSG00000054277		"""GPCR / Class A : Opsin receptors"""	14007	protein-coding gene	gene with protein product	"""panopsin"", ""protein phosphatase 1, regulatory subunit 116"""	606695	"""encephalopsin"""	ECPN		10234000, 11401433	Standard	NM_014322		Approved	ERO, NMO-1, encephalopsin, PPP1R116	uc001hza.3	Q9H1Y3	OTTHUMG00000039691	ENST00000366554.2:c.501G>A	1.37:g.241767754C>T			239834377	NM_014322	Q8IX08|Q9Y344	Silent	SNP	ENST00000366554.2	37	CCDS31072.1																																																																																				0.547	OPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095713.1	NM_014322	
PIK3C2A	5286	broad.mit.edu	37	11	17139085	17139085	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr11:17139085C>G	ENST00000265970.7	-	18	3168	c.3169G>C	c.(3169-3171)Gga>Cga	p.G1057R	RNU6-593P_ENST00000364716.1_RNA|PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Missense_Mutation_p.G677R	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1057					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)	p.G1057R(1)		central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GCTACTCCTCCTAAAAGCTGT	0.403																																					p.G1057R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3169C	11						.						136.0	137.0	137.0					11																	17139085		2200	4293	6493	17095661	SO:0001583	missense	5286	exon18			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3169G>C	11.37:g.17139085C>G	ENSP00000265970:p.Gly1057Arg		17095661	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.597470	0.87055	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.80653	-1.4;-1.4	5.51	5.51	0.81932	Protein kinase-like domain (1);	0.050098	0.85682	D	0.000000	D	0.88078	0.6340	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	D	0.85440	0.1154	10	0.30078	T	0.28	-13.798	19.4111	0.94673	0.0:1.0:0.0:0.0	.	1057	O00443	P3C2A_HUMAN	R	1057;677	ENSP00000265970:G1057R;ENSP00000438687:G677R	ENSP00000265970:G1057R	G	-	1	0	PIK3C2A	17095661	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.142000	0.77339	2.597000	0.87782	0.591000	0.81541	GGA		0.403	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
OR4C11	219429	broad.mit.edu	37	11	55371381	55371381	+	Missense_Mutation	SNP	G	G	T	rs75423534	byFrequency	TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr11:55371381G>T	ENST00000302231.4	-	1	493	c.469C>A	c.(469-471)Cag>Aag	p.Q157K		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q157K(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						AGGATAATCTGAGCTGTAGAG	0.458																																					p.Q157K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C469A	11						.						69.0	60.0	63.0					11																	55371381		2179	4007	6186	55127957	SO:0001583	missense	219429	exon1			AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.469C>A	11.37:g.55371381G>T	ENSP00000306651:p.Gln157Lys		55127957	NM_001004700	B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	G	9.152	1.016625	0.19355	.	.	ENSG00000172188	ENST00000302231	T	0.00091	8.74	4.34	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	U	0.000300	T	0.00271	0.0008	M	0.83012	2.62	0.27717	N	0.94527	B	0.14438	0.01	B	0.16289	0.015	T	0.33240	-0.9876	10	0.66056	D	0.02	.	15.9533	0.79861	0.0:0.0:1.0:0.0	.	157	Q6IEV9	OR4CB_HUMAN	K	157	ENSP00000306651:Q157K	ENSP00000306651:Q157K	Q	-	1	0	OR4C11	55127957	0.001000	0.12720	0.213000	0.23690	0.004000	0.04260	0.160000	0.16462	2.425000	0.82216	0.478000	0.44815	CAG		0.458	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
APLNR	187	broad.mit.edu	37	11	57003486	57003486	+	Silent	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr11:57003486G>A	ENST00000606794.1	-	1	1189	c.993C>T	c.(991-993)tgC>tgT	p.C331C		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	331					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.C331C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						AGGTGCCTGCGCACCTGCTCT	0.642																																					p.C331C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C993T	11						.						60.0	43.0	49.0					11																	57003486		2201	4296	6497	56760062	SO:0001819	synonymous_variant	187	exon1			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.993C>T	11.37:g.57003486G>A			56760062	NM_005161		Silent	SNP	ENST00000606794.1	37	CCDS7950.1																																																																																				0.642	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470575.1	NM_005161	
PDE7B	27115	broad.mit.edu	37	6	136429871	136429871	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr6:136429871G>C	ENST00000308191.6	+	3	388	c.85G>C	c.(85-87)Gat>Cat	p.D29H	RP13-143G15.4_ENST00000591521.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000417643.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	29					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)	p.D29H(1)		breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TTTTCTAGGAGATATACGACT	0.468																																					p.D29H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G85C	6						.						108.0	106.0	107.0					6																	136429871		2203	4300	6503	136471564	SO:0001583	missense	27115	exon3			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.85G>C	6.37:g.136429871G>C	ENSP00000310661:p.Asp29His		136471564	NM_018945	Q5W154	Missense_Mutation	SNP	ENST00000308191.6	37	CCDS5175.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778530	0.90195	.	.	ENSG00000171408	ENST00000308191;ENST00000367787	T	0.72051	-0.62	6.07	6.07	0.98685	.	2.452900	0.01451	N	0.015503	T	0.79896	0.4525	L	0.50333	1.59	0.58432	D	0.999994	D;D	0.76494	0.999;0.994	P;D	0.64687	0.887;0.928	T	0.64575	-0.6375	10	0.62326	D	0.03	.	17.5619	0.87910	0.0:0.0:1.0:0.0	.	81;29	A1E5M1;Q9NP56	.;PDE7B_HUMAN	H	29;165	ENSP00000310661:D29H	ENSP00000310661:D29H	D	+	1	0	PDE7B	136471564	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.864000	0.69575	2.885000	0.99019	0.650000	0.86243	GAT		0.468	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042371.1		
ATF6B	1388	broad.mit.edu	37	6	32088833	32088833	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr6:32088833C>T	ENST00000375203.3	-	7	665	c.633G>A	c.(631-633)tgG>tgA	p.W211*	ATF6B_ENST00000375201.4_Nonsense_Mutation_p.W208*	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	211					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.W211*(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						CTGGGACATCCCACAGGAGGC	0.542																																					p.W211X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G633A	6						.						47.0	47.0	47.0					6																	32088833		2203	4300	6503	32196811	SO:0001587	stop_gained	1388	exon7				CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.633G>A	6.37:g.32088833C>T	ENSP00000364349:p.Trp211*		32196811	NM_004381	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Nonsense_Mutation	SNP	ENST00000375203.3	37	CCDS4737.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.903792	0.52333	.	.	ENSG00000213676	ENST00000375203;ENST00000375201	.	.	.	4.91	4.04	0.47022	.	1.443690	0.05030	U	0.474380	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-1.3233	9.1701	0.37076	0.0:0.8982:0.0:0.1018	.	.	.	.	X	211;208	.	ENSP00000364347:W208X	W	-	3	0	ATF6B	32196811	0.223000	0.23663	0.879000	0.34478	0.044000	0.14063	0.376000	0.20535	1.079000	0.41038	-0.136000	0.14681	TGG		0.542	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2		
FRS3	10817	broad.mit.edu	37	6	41738472	41738472	+	Missense_Mutation	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr6:41738472T>C	ENST00000373018.3	-	7	1615	c.1364A>G	c.(1363-1365)tAc>tGc	p.Y455C	FRS3_ENST00000259748.2_Missense_Mutation_p.Y455C	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	455					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)	p.Y455C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AATCACGGCGTAGGAGTCTGA	0.647																																					p.Y455C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1364G	6						.						74.0	79.0	77.0					6																	41738472		2203	4300	6503	41846450	SO:0001583	missense	10817	exon7			AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1364A>G	6.37:g.41738472T>C	ENSP00000362109:p.Tyr455Cys		41846450	NM_006653	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928711	0.73327	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.62364	0.03;0.03	5.59	5.59	0.84812	.	0.113339	0.64402	D	0.000007	T	0.74427	0.3715	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78861	-0.2037	10	0.87932	D	0	-23.1523	15.4379	0.75160	0.0:0.0:0.0:1.0	.	455	O43559	FRS3_HUMAN	C	455	ENSP00000362109:Y455C;ENSP00000259748:Y455C	ENSP00000259748:Y455C	Y	-	2	0	FRS3	41846450	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	6.213000	0.72194	2.137000	0.66172	0.533000	0.62120	TAC		0.647	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653	
GPR116	221395	broad.mit.edu	37	6	46849286	46849286	+	Silent	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr6:46849286T>C	ENST00000283296.7	-	8	1008	c.720A>G	c.(718-720)tcA>tcG	p.S240S	GPR116_ENST00000265417.7_Silent_p.S240S|GPR116_ENST00000456426.2_Silent_p.S240S|GPR116_ENST00000362015.4_Silent_p.S240S	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	240	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S240S(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TTAACTCAAGTGATGGTGGTG	0.408																																					p.S240S	NSCLC(59;410 1274 8751 36715 50546)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A720G	6						.						329.0	259.0	283.0					6																	46849286		2203	4300	6503	46957245	SO:0001819	synonymous_variant	221395	exon8			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.720A>G	6.37:g.46849286T>C			46957245	NM_001098518	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Silent	SNP	ENST00000283296.7	37	CCDS4919.1																																																																																				0.408	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
HIVEP2	3097	broad.mit.edu	37	6	143090704	143090704	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr6:143090704C>A	ENST00000367604.1	-	4	5811	c.5172G>T	c.(5170-5172)tgG>tgT	p.W1724C	HIVEP2_ENST00000367603.2_Missense_Mutation_p.W1724C|HIVEP2_ENST00000012134.2_Missense_Mutation_p.W1724C			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1724					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.W1724C(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TAAACTGCTTCCAAGCACTTG	0.408																																					p.W1724C	Esophageal Squamous(107;843 1510 13293 16805 42198)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5172T	6						.						99.0	90.0	93.0					6																	143090704		1859	4117	5976	143132397	SO:0001583	missense	3097	exon5			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5172G>T	6.37:g.143090704C>A	ENSP00000356576:p.Trp1724Cys		143132397	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666854	0.47677	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02974	4.09;4.09;4.09	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.13243	0.0321	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00865	-1.1535	10	0.66056	D	0.02	-11.9478	19.8109	0.96545	0.0:1.0:0.0:0.0	.	1724	P31629	ZEP2_HUMAN	C	1724	ENSP00000356576:W1724C;ENSP00000356575:W1724C;ENSP00000012134:W1724C	ENSP00000012134:W1724C	W	-	3	0	HIVEP2	143132397	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.561000	0.82288	2.679000	0.91253	0.655000	0.94253	TGG		0.408	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
ADPRM	56985	broad.mit.edu	37	17	10608461	10608461	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr17:10608461G>C	ENST00000379774.4	+	2	309	c.218G>C	c.(217-219)gGa>gCa	p.G73A	ADPRM_ENST00000609540.1_Missense_Mutation_p.G73A	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	73							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)	p.G73A(1)									CTTCAGCTTGGAGATATCATC	0.423																																					p.G73A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G218C	17						.						159.0	149.0	152.0					17																	10608461		2203	4300	6503	10549186	SO:0001583	missense	56985	exon2			BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.218G>C	17.37:g.10608461G>C	ENSP00000369099:p.Gly73Ala		10549186	NM_020233	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	ENST00000379774.4	37	CCDS11159.2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126442	0.77549	.	.	ENSG00000170222	ENST00000379774	D	0.99946	-8.62	5.65	5.65	0.86999	Metallophosphoesterase domain (1);	0.050811	0.85682	D	0.000000	D	0.99947	0.9977	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95947	0.8951	10	0.87932	D	0	-12.9629	19.5221	0.95189	0.0:0.0:1.0:0.0	.	73	Q3LIE5	ADPRM_HUMAN	A	73	ENSP00000369099:G73A	ENSP00000369099:G73A	G	+	2	0	C17orf48	10549186	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	8.739000	0.91574	2.941000	0.99782	0.655000	0.94253	GGA		0.423	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
MAP2K3	5606	broad.mit.edu	37	17	21202235	21202235	+	Missense_Mutation	SNP	C	C	A	rs75306459	byFrequency	TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	A	Unknown	Valid	Germline	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr17:21202235C>A	ENST00000342679.4	+	3	411	c.162C>A	c.(160-162)gaC>gaA	p.D54E	MAP2K3_ENST00000316920.6_Missense_Mutation_p.D25E|MAP2K3_ENST00000361818.5_Missense_Mutation_p.D25E	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	54					activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CCATTGGAGACAGAGTAGGTG	0.617													C|||	58	0.0115815	0.0408	0.0058	5008	,	,		16724	0.0		0.0	False		,,,				2504	0.0				p.D25E												.	.	0			c.C75A	17						.	C	GLU/ASP,GLU/ASP	129,4277	80.4+/-118.8	0,129,2074	60.0	60.0	60.0		75,162	0.1	1.0	17	dbSNP_131	60	0,8600		0,0,4300	yes	missense,missense	MAP2K3	NM_002756.4,NM_145109.2	45,45	0,129,6374	AA,AC,CC		0.0,2.9278,0.9918	benign,benign	25/319,54/348	21202235	129,12877	2203	4300	6503	21142828	SO:0001583	missense	5606	exon3			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.162C>A	17.37:g.21202235C>A	ENSP00000345083:p.Asp54Glu		21142828	NM_002756	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	C	12.97	2.098195	0.37048	0.029278	0.0	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	T;T;D	0.88818	1.13;1.13;-2.43	5.93	0.105	0.14535	Protein kinase-like domain (1);	0.071467	0.53938	D	0.000060	T	0.45816	0.1361	N	0.12637	0.245	0.35669	D	0.813142	B	0.06786	0.001	B	0.04013	0.001	T	0.52939	-0.8508	10	0.06099	T	0.92	-45.7003	2.8007	0.05414	0.1131:0.3422:0.1106:0.434	.	54	P46734	MP2K3_HUMAN	E	54;25;25;25;58	ENSP00000345083:D54E;ENSP00000355081:D25E;ENSP00000434068:D25E	ENSP00000319139:D58E	D	+	3	2	MAP2K3	21142828	0.002000	0.14202	0.991000	0.47740	0.991000	0.79684	-1.233000	0.02934	0.027000	0.15297	0.655000	0.94253	GAC		0.617	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
TP53	7157	broad.mit.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R175H	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,lung,NS,Substitution - Missense,0	.	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	c.G524A	17	GRCh37	CM062017|CM951224	TP53	M	rs28934578	.						50.0	50.0	50.0					17																	7578406		2203	4300	6503	7519131	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		7519131	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ABCA8	10351	broad.mit.edu	37	17	66913554	66913554	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr17:66913554C>T	ENST00000269080.2	-	15	2103	c.1966G>A	c.(1966-1968)Gcg>Acg	p.A656T	ABCA8_ENST00000586539.1_Missense_Mutation_p.A696T|ABCA8_ENST00000430352.2_Missense_Mutation_p.A696T	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	656	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.A656T(2)		breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GAAGAGCCCGCGCACTTTAGC	0.408																																					p.A656T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1966A	17						.						107.0	117.0	113.0					17																	66913554		2203	4300	6503	64425149	SO:0001583	missense	10351	exon15			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1966G>A	17.37:g.66913554C>T	ENSP00000269080:p.Ala656Thr		64425149	NM_007168	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	ENST00000269080.2	37	CCDS11680.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431150	0.43122	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225	T;T	0.62941	-0.01;-0.01	4.91	4.91	0.64330	ABC transporter-like (1);	0.000000	0.52532	D	0.000077	T	0.43523	0.1251	N	0.04655	-0.195	0.45139	D	0.998156	P;B;B;B;P	0.52061	0.95;0.394;0.314;0.163;0.599	B;B;B;B;B	0.42593	0.392;0.147;0.046;0.197;0.22	T	0.54105	-0.8343	10	0.45353	T	0.12	.	17.2483	0.87034	0.0:1.0:0.0:0.0	.	635;696;696;696;656	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	T	656;696;635	ENSP00000269080:A656T;ENSP00000402814:A696T	ENSP00000269080:A656T	A	-	1	0	ABCA8	64425149	1.000000	0.71417	1.000000	0.80357	0.050000	0.14768	3.277000	0.51654	2.554000	0.86153	0.549000	0.68633	GCG		0.408	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
COL6A2	1292	broad.mit.edu	37	21	47549221	47549221	+	Intron	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr21:47549221C>T	ENST00000300527.4	+	28	2565				COL6A2_ENST00000357838.4_Missense_Mutation_p.T858M|COL6A2_ENST00000310645.5_3'UTR|COL6A2_ENST00000409416.1_3'UTR|COL6A2_ENST00000397763.1_Missense_Mutation_p.T858M	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)		p.T858M(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CTAAACGCCACGGAGCTCACG	0.697																																					p.T858M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2573T	21						.						84.0	82.0	82.0					21																	47549221		2203	4300	6503	46373649	SO:0001627	intron_variant	1292	exon28			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2462-2647C>T	21.37:g.47549221C>T			46373649	NM_058174	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	37	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481435	0.44147	.	.	ENSG00000142173	ENST00000357838;ENST00000397763	D;D	0.90900	-2.75;-2.75	3.99	3.99	0.46301	.	.	.	.	.	D	0.90752	0.7097	.	.	.	0.80722	D	1	D	0.63880	0.993	P	0.50490	0.642	D	0.90374	0.4383	8	0.46703	T	0.11	.	12.0529	0.53518	0.0:0.8258:0.1742:0.0	.	858	P12110-2	.	M	858	ENSP00000350497:T858M;ENSP00000380870:T858M	ENSP00000350497:T858M	T	+	2	0	COL6A2	46373649	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.281000	0.43452	1.770000	0.52166	0.467000	0.42956	ACG		0.697	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
DNAH3	55567	broad.mit.edu	37	16	20975118	20975118	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	T	Unknown	Valid	Germline	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr16:20975118C>T	ENST00000261383.3	-	53	10087	c.10088G>A	c.(10087-10089)cGt>cAt	p.R3363H	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3363					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AAACAGAGAACGGCACACGTT	0.478																																					p.R3363H												.	.	0			c.G10088A	16						.						147.0	114.0	125.0					16																	20975118		2201	4300	6501	20882619	SO:0001583	missense	55567	exon53			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10088G>A	16.37:g.20975118C>T	ENSP00000261383:p.Arg3363His		20882619	NM_017539	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604646	0.87157	.	.	ENSG00000158486	ENST00000261383	T	0.80566	-1.39	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.94443	0.8212	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96080	0.9053	10	0.87932	D	0	.	20.0137	0.97470	0.0:1.0:0.0:0.0	.	3363	Q8TD57	DYH3_HUMAN	H	3363	ENSP00000261383:R3363H	ENSP00000261383:R3363H	R	-	2	0	DNAH3	20882619	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.734000	0.93682	0.563000	0.77884	CGT		0.478	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
CACNG3	10368	broad.mit.edu	37	16	24366209	24366209	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr16:24366209C>T	ENST00000005284.3	+	3	1553	c.351C>T	c.(349-351)ttC>ttT	p.F117F		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	117					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.F117F(1)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		TGCTGTTCTTCGGCGGGCTCT	0.617																																					p.F117F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C351T	16						.																																			24273710	SO:0001819	synonymous_variant	10368	exon3			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.351C>T	16.37:g.24366209C>T			24273710	NM_006539		Silent	SNP	ENST00000005284.3	37	CCDS10620.1																																																																																				0.617	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
WDR5B	54554	broad.mit.edu	37	3	122133553	122133553	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr3:122133553C>T	ENST00000330689.4	-	1	1329	c.823G>A	c.(823-825)Gag>Aag	p.E275K	RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	275								p.E275K(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		AGGTTATCCTCGGAACCAGAC	0.408																																					p.E275K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G823A	3						.						139.0	132.0	134.0					3																	122133553		2203	4300	6503	123616243	SO:0001583	missense	54554	exon1			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.823G>A	3.37:g.122133553C>T	ENSP00000330381:p.Glu275Lys		123616243	NM_019069	B2RCM9|Q9NUL4	Missense_Mutation	SNP	ENST00000330689.4	37	CCDS3012.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892951	0.91889	.	.	ENSG00000196981	ENST00000330689	T	0.59906	0.23	4.77	4.77	0.60923	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.71484	0.3345	L	0.60012	1.86	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68857	-0.5298	10	0.35671	T	0.21	.	15.7027	0.77555	0.0:1.0:0.0:0.0	.	275	Q86VZ2	WDR5B_HUMAN	K	275	ENSP00000330381:E275K	ENSP00000330381:E275K	E	-	1	0	WDR5B	123616243	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.838000	0.75359	2.644000	0.89710	0.561000	0.74099	GAG		0.408	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1	NM_019069	
COL6A6	131873	broad.mit.edu	37	3	130300575	130300575	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr3:130300575G>C	ENST00000358511.6	+	8	3749	c.3718G>C	c.(3718-3720)Gct>Cct	p.A1240P	COL6A6_ENST00000453409.2_Missense_Mutation_p.A1240P	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1240	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.A1240P(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGTCAGTGTGGCTTTTCAAGT	0.443																																					p.A1240P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3718C	3						.						97.0	97.0	97.0					3																	130300575		2008	4167	6175	131783265	SO:0001583	missense	131873	exon8			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3718G>C	3.37:g.130300575G>C	ENSP00000351310:p.Ala1240Pro		131783265	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	37	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581120	0.86748	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.38887	1.11;1.11	6.06	6.06	0.98353	von Willebrand factor, type A (2);	.	.	.	.	T	0.63674	0.2531	L	0.58101	1.795	0.42564	D	0.993151	D	0.89917	1.0	D	0.85130	0.997	T	0.60722	-0.7207	9	0.52906	T	0.07	.	19.3923	0.94587	0.0:0.0:1.0:0.0	.	1240	A6NMZ7	CO6A6_HUMAN	P	1240	ENSP00000351310:A1240P;ENSP00000399236:A1240P	ENSP00000351310:A1240P	A	+	1	0	COL6A6	131783265	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	6.472000	0.73567	2.882000	0.98803	0.655000	0.94253	GCT		0.443	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
COL6A6	131873	broad.mit.edu	37	3	130345385	130345385	+	Silent	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr3:130345385C>A	ENST00000358511.6	+	24	4966	c.4935C>A	c.(4933-4935)ggC>ggA	p.G1645G	COL6A6_ENST00000453409.2_Silent_p.G1645G	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1645	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1645G(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GTCCTCGTGGCTTGCAGGTTT	0.408																																					p.G1645G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4935A	3						.						160.0	160.0	160.0					3																	130345385		1874	4112	5986	131828075	SO:0001819	synonymous_variant	131873	exon24			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.4935C>A	3.37:g.130345385C>A			131828075	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	37	CCDS46911.1																																																																																				0.408	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
SCN8A	6334	broad.mit.edu	37	12	52168085	52168085	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr12:52168085C>A	ENST00000354534.6	+	20	3936	c.3758C>A	c.(3757-3759)gCc>gAc	p.A1253D	SCN8A_ENST00000545061.1_Missense_Mutation_p.A1253D	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1253					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.A1253D(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	AAGTGGACAGCCTATGGCTTC	0.488																																					p.A1253D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3758A	12						.						190.0	191.0	191.0					12																	52168085		2199	4300	6499	50454352	SO:0001583	missense	6334	exon20			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3758C>A	12.37:g.52168085C>A	ENSP00000346534:p.Ala1253Asp		50454352	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	C	28.7	4.938830	0.92526	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.99105	-5.43;-4.64;-4.64	4.86	4.86	0.63082	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99390	0.9785	M	0.89163	3.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	D	0.98818	1.0746	10	0.87932	D	0	.	18.564	0.91111	0.0:1.0:0.0:0.0	.	1253;1253	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	D	1253;1253;1253;1166	ENSP00000346534:A1253D;ENSP00000440360:A1253D;ENSP00000347255:A1253D	ENSP00000346534:A1253D	A	+	2	0	SCN8A	50454352	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.593000	0.82686	2.684000	0.91462	0.561000	0.74099	GCC		0.488	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
STAT2	6773	broad.mit.edu	37	12	56750243	56750243	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr12:56750243C>T	ENST00000314128.4	-	2	136	c.113G>A	c.(112-114)tGg>tAg	p.W38*	STAT2_ENST00000418572.2_Nonsense_Mutation_p.W38*|STAT2_ENST00000557235.1_Nonsense_Mutation_p.W38*			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	38					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.W38*(1)		NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						GTCTTCAATCCAGACAGCCAA	0.522																																					p.W38X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G113A	12						.						94.0	92.0	93.0					12																	56750243		2203	4300	6503	55036510	SO:0001587	stop_gained	6773	exon2			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.113G>A	12.37:g.56750243C>T	ENSP00000315768:p.Trp38*		55036510	NM_198332	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Nonsense_Mutation	SNP	ENST00000314128.4	37	CCDS8917.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.750887	0.89753	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000553337;ENST00000418572	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7979	15.6427	0.77020	0.0:1.0:0.0:0.0	.	.	.	.	X	38	.	ENSP00000315768:W38X	W	-	2	0	STAT2	55036510	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.579000	0.74036	2.769000	0.95229	0.655000	0.94253	TGG		0.522	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410277.1	NM_005419	
FAM90A1	55138	broad.mit.edu	37	12	8374624	8374624	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr12:8374624G>A	ENST00000538603.1	-	7	1747	c.1189C>T	c.(1189-1191)Cgg>Tgg	p.R397W	FAM90A1_ENST00000307435.6_Missense_Mutation_p.R397W	NM_018088.3	NP_060558.3	Q86YD7	F90A1_HUMAN	family with sequence similarity 90, member A1	397							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.R397W(1)		endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	25				Kidney(36;0.0866)		TCCAGTCTCCGAAAGAGCACT	0.632																																					p.R397W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1189T	12						.						15.0	21.0	19.0					12																	8374624		2032	3877	5909	8265891	SO:0001583	missense	55138	exon7			AK001270	CCDS31738.1	12p13.31	2011-08-31		2005-11-20	ENSG00000171847	ENSG00000171847			25526	protein-coding gene	gene with protein product		613041					Standard	NM_018088		Approved	FLJ10408	uc001qui.2	Q86YD7	OTTHUMG00000168641	ENST00000538603.1:c.1189C>T	12.37:g.8374624G>A	ENSP00000445418:p.Arg397Trp		8265891	NM_018088	D3DUU9|Q9NVZ6	Missense_Mutation	SNP	ENST00000538603.1	37	CCDS31738.1	.	.	.	.	.	.	.	.	.	.	.	11.43	1.636869	0.29157	.	.	ENSG00000171847	ENST00000307435;ENST00000538603	T;T	0.13307	2.6;2.6	1.06	-0.512	0.11966	.	.	.	.	.	T	0.18882	0.0453	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.72625	0.978	T	0.14868	-1.0457	9	0.66056	D	0.02	-1.1302	3.7926	0.08727	0.0:0.0:0.4156:0.5844	.	397	Q86YD7	F90A1_HUMAN	W	397	ENSP00000307798:R397W;ENSP00000445418:R397W	ENSP00000307798:R397W	R	-	1	2	FAM90A1	8265891	0.010000	0.17322	0.003000	0.11579	0.021000	0.10359	-0.738000	0.04871	-0.140000	0.11394	0.205000	0.17691	CGG		0.632	FAM90A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400468.1	NM_018088	
NAB2	4665	broad.mit.edu	37	12	57485247	57485247	+	Missense_Mutation	SNP	G	G	A	rs200872269		TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr12:57485247G>A	ENST00000300131.3	+	2	801	c.423G>A	c.(421-423)atG>atA	p.M141I	NAB2_ENST00000342556.6_Missense_Mutation_p.M141I|NAB2_ENST00000357680.4_Missense_Mutation_p.M141I|NAB2_ENST00000554718.1_3'UTR	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	141					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)	p.M141I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AAGGGAGCATGAGCAATGGGC	0.587																																					p.M141I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G423A	12						.						69.0	72.0	71.0					12																	57485247		2203	4300	6503	55771514	SO:0001583	missense	4665	exon2			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.423G>A	12.37:g.57485247G>A	ENSP00000300131:p.Met141Ile		55771514	NM_005967	B2RAK3|O76006|Q14797	Missense_Mutation	SNP	ENST00000300131.3	37	CCDS8930.1	.	.	.	.	.	.	.	.	.	.	G	9.613	1.131879	0.21041	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.59	1.65	0.23941	.	0.410743	0.25380	N	0.031098	T	0.21590	0.0520	N	0.14661	0.345	0.34994	D	0.755284	B	0.02656	0.0	B	0.01281	0.0	T	0.08027	-1.0742	9	0.18276	T	0.48	-4.4298	1.7106	0.02891	0.1867:0.1624:0.4839:0.167	.	141	Q15742	NAB2_HUMAN	I	141	.	ENSP00000300131:M141I	M	+	3	0	NAB2	55771514	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.807000	0.27140	0.533000	0.28675	0.462000	0.41574	ATG		0.587	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412222.1	NM_005967	
SLC6A15	55117	broad.mit.edu	37	12	85257235	85257235	+	Missense_Mutation	SNP	C	C	T	rs376347410		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr12:85257235C>T	ENST00000266682.5	-	11	2342	c.1801G>A	c.(1801-1803)Gca>Aca	p.A601T	SLC6A15_ENST00000309283.7_Missense_Mutation_p.A309T|SLC6A15_ENST00000552192.1_Missense_Mutation_p.A494T	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	601					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)	p.A601T(1)		kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TCAATCCATGCGTTATAGCCA	0.299																																					p.A601T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1801A	12						.	C	THR/ALA,THR/ALA	0,4406		0,0,2203	88.0	94.0	92.0		1480,1801	5.7	1.0	12		92	1,8591	1.2+/-3.3	0,1,4295	no	missense,missense	SLC6A15	NM_001146335.1,NM_182767.4	58,58	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	494/624,601/731	85257235	1,12997	2203	4296	6499	83781366	SO:0001583	missense	55117	exon11			AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.1801G>A	12.37:g.85257235C>T	ENSP00000266682:p.Ala601Thr		83781366	NM_182767	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	37	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	C	33	5.207705	0.95033	0.0	1.16E-4	ENSG00000072041	ENST00000309283;ENST00000266682;ENST00000552192;ENST00000548267	T;T;T	0.74947	-0.89;-0.89;-0.89	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.85729	0.5764	M	0.69248	2.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.975	D	0.85102	0.0958	10	0.51188	T	0.08	.	19.8516	0.96743	0.0:1.0:0.0:0.0	.	309;601	F8WJN6;Q9H2J7	.;S6A15_HUMAN	T	309;601;494;79	ENSP00000311645:A309T;ENSP00000266682:A601T;ENSP00000450145:A494T	ENSP00000266682:A601T	A	-	1	0	SLC6A15	83781366	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.395000	0.79876	2.685000	0.91497	0.585000	0.79938	GCA		0.299	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
ANO4	121601	broad.mit.edu	37	12	101413842	101413842	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr12:101413842C>A	ENST00000392977.3	+	9	975	c.765C>A	c.(763-765)ttC>ttA	p.F255L	ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000538618.1_3'UTR|ANO4_ENST00000392979.3_Missense_Mutation_p.F220L			Q32M45	ANO4_HUMAN	anoctamin 4	255					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.F220L(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AAACGTTCTTCAACAATGCCA	0.289										HNSCC(74;0.22)																											p.F220L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C660A	12						.						84.0	83.0	84.0					12																	101413842		2203	4299	6502	99937973	SO:0001583	missense	121601	exon8			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.765C>A	12.37:g.101413842C>A	ENSP00000376703:p.Phe255Leu		99937973	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	37		.	.	.	.	.	.	.	.	.	.	C	34	5.294507	0.95546	.	.	ENSG00000151572	ENST00000392979;ENST00000392977	T;T	0.71222	-0.55;-0.55	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.87168	0.6110	M	0.89214	3.015	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.80764	0.993;0.994	D	0.88896	0.3349	10	0.87932	D	0	.	18.7759	0.91911	0.0:1.0:0.0:0.0	.	255;220	Q32M45;Q32M45-2	ANO4_HUMAN;.	L	220;255	ENSP00000376705:F220L;ENSP00000376703:F255L	ENSP00000376703:F255L	F	+	3	2	ANO4	99937973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.035000	0.76517	2.714000	0.92807	0.650000	0.86243	TTC		0.289	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
RYR3	6263	broad.mit.edu	37	15	33944956	33944956	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr15:33944956G>C	ENST00000389232.4	+	32	4250	c.4180G>C	c.(4180-4182)Gac>Cac	p.D1394H	RYR3_ENST00000415757.3_Missense_Mutation_p.D1394H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1394	4 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.D1394H(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTGGGGTGGAGACATTGTAGC	0.527																																					p.D1394H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4180C	15						.						96.0	97.0	97.0					15																	33944956		2023	4192	6215	31732248	SO:0001583	missense	6263	exon32				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4180G>C	15.37:g.33944956G>C	ENSP00000373884:p.Asp1394His		31732248	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	37	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704921	0.68615	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.69561	-0.41;-0.41	5.52	5.52	0.82312	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.79919	0.4529	L	0.54323	1.7	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.77557	0.985;0.99	T	0.80377	-0.1408	10	0.87932	D	0	.	19.6435	0.95767	0.0:0.0:1.0:0.0	.	1394;1394	Q15413-2;Q15413	.;RYR3_HUMAN	H	1394	ENSP00000373884:D1394H;ENSP00000399610:D1394H	ENSP00000354735:D1394H	D	+	1	0	RYR3	31732248	1.000000	0.71417	0.995000	0.50966	0.606000	0.37113	9.646000	0.98474	2.866000	0.98385	0.650000	0.86243	GAC		0.527	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SORD	6652	broad.mit.edu	37	15	45365703	45365703	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr15:45365703G>T	ENST00000267814.9	+	9	1229	c.1049G>T	c.(1048-1050)tGt>tTt	p.C350F	SORD_ENST00000559562.1_3'UTR|RP11-109D20.2_ENST00000560967.1_RNA|SORD_ENST00000558580.1_Missense_Mutation_p.C329F	NM_003104.5	NP_003095.2	Q00796	DHSO_HUMAN	sorbitol dehydrogenase	350					fructose biosynthetic process (GO:0046370)|glucose metabolic process (GO:0006006)|L-xylitol catabolic process (GO:0051160)|L-xylitol metabolic process (GO:0051164)|sorbitol catabolic process (GO:0006062)|sperm motility (GO:0030317)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)	carbohydrate binding (GO:0030246)|L-iditol 2-dehydrogenase activity (GO:0003939)|NAD binding (GO:0051287)|zinc ion binding (GO:0008270)	p.C350F(1)		endometrium(2)|large_intestine(3)|lung(4)	9		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)		ATGCTCAAGTGTGACCCCAGT	0.502																																					p.C350F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1049T	15						.						39.0	49.0	46.0					15																	45365703		2093	4269	6362	43152995	SO:0001583	missense	6652	exon9				CCDS10116.1	15q15-q21.1	2012-10-02			ENSG00000140263	ENSG00000140263	1.1.1.14		11184	protein-coding gene	gene with protein product		182500				7782086	Standard	NM_003104		Approved		uc001zul.4	Q00796	OTTHUMG00000131265	ENST00000267814.9:c.1049G>T	15.37:g.45365703G>T	ENSP00000267814:p.Cys350Phe		43152995	NM_003104	B2R655|B7Z3A6|J3JZZ5|Q16682|Q9UMD6	Missense_Mutation	SNP	ENST00000267814.9	37	CCDS10116.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.085710	0.76642	.	.	ENSG00000140263	ENST00000267814	T	0.01947	4.54	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.07098	0.0180	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.988	T	0.46762	-0.9168	10	0.56958	D	0.05	-9.2148	18.2799	0.90096	0.0:0.0:1.0:0.0	.	271;350	B4DKI2;Q00796	.;DHSO_HUMAN	F	350	ENSP00000267814:C350F	ENSP00000267814:C350F	C	+	2	0	SORD	43152995	1.000000	0.71417	1.000000	0.80357	0.608000	0.37181	9.294000	0.96088	2.577000	0.86979	0.563000	0.77884	TGT		0.502	SORD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254033.3		
MYO5C	55930	broad.mit.edu	37	15	52539205	52539205	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr15:52539205T>A	ENST00000261839.7	-	16	2049	c.1888A>T	c.(1888-1890)Agc>Tgc	p.S630C	MYO5C_ENST00000443683.2_3'UTR	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	630	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.S630C(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TACAGAGAGCTGCGGAACTAG	0.438																																					p.S630C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1888T	15						.						104.0	104.0	104.0					15																	52539205		1994	4166	6160	50326497	SO:0001583	missense	55930	exon16			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1888A>T	15.37:g.52539205T>A	ENSP00000261839:p.Ser630Cys		50326497	NM_018728	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	37	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	T	25.4	4.638286	0.87760	.	.	ENSG00000128833	ENST00000261839	T	0.19250	2.16	5.27	4.14	0.48551	Myosin head, motor domain (2);	0.085120	0.85682	D	0.000000	T	0.42765	0.1217	M	0.85710	2.77	0.80722	D	1	P	0.46706	0.883	P	0.54544	0.755	T	0.43327	-0.9398	10	0.66056	D	0.02	.	11.3127	0.49372	0.0:0.0721:0.0:0.9279	.	630	Q9NQX4	MYO5C_HUMAN	C	630	ENSP00000261839:S630C	ENSP00000261839:S630C	S	-	1	0	MYO5C	50326497	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.161000	0.64935	0.944000	0.37579	0.459000	0.35465	AGC		0.438	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
UNC13C	440279	broad.mit.edu	37	15	54542626	54542626	+	Silent	SNP	C	C	T	rs531463822	byFrequency	TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr15:54542626C>T	ENST00000260323.11	+	7	3432	c.3432C>T	c.(3430-3432)aaC>aaT	p.N1144N	UNC13C_ENST00000537900.1_Silent_p.N1142N|UNC13C_ENST00000545554.1_Silent_p.N1144N	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1144					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.N1144N(2)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ACCTGCTAAACGCTGACTGCT	0.483													c|||	2	0.000399361	0.0	0.0014	5008	,	,		19452	0.0		0.001	False		,,,				2504	0.0				p.N1144N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C3432T	15						.						66.0	68.0	68.0					15																	54542626		2174	4280	6454	52329918	SO:0001819	synonymous_variant	440279	exon6			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3432C>T	15.37:g.54542626C>T			52329918	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	37	CCDS45264.1																																																																																				0.483	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
TLN2	83660	broad.mit.edu	37	15	62949993	62949993	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr15:62949993C>T	ENST00000561311.1	+	8	914	c.684C>T	c.(682-684)ggC>ggT	p.G228G	TLN2_ENST00000306829.6_Silent_p.G228G			Q9Y4G6	TLN2_HUMAN	talin 2	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G228G(1)		NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TCCTGAATGGCTCTCACCCTG	0.488																																					p.G228G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C684T	15						.						159.0	136.0	144.0					15																	62949993		2203	4300	6503	60737285	SO:0001819	synonymous_variant	83660	exon6			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.684C>T	15.37:g.62949993C>T			60737285	NM_015059	A6NLB8	Silent	SNP	ENST00000561311.1	37	CCDS32261.1																																																																																				0.488	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
ADAMTSL3	57188	broad.mit.edu	37	15	84558897	84558897	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr15:84558897G>C	ENST00000286744.5	+	11	1333	c.1109G>C	c.(1108-1110)cGc>cCc	p.R370P	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R370P	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	370						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R370P(1)		NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GTGGATATCCGCTTGAAGAGG	0.403																																					p.R370P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1109C	15						.						190.0	168.0	175.0					15																	84558897		2203	4300	6503	82349901	SO:0001583	missense	57188	exon11			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.1109G>C	15.37:g.84558897G>C	ENSP00000286744:p.Arg370Pro		82349901	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790594	0.90367	.	.	ENSG00000156218	ENST00000286744	T	0.60672	0.17	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.73674	0.3617	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.76168	-0.3058	10	0.62326	D	0.03	.	18.304	0.90174	0.0:0.0:1.0:0.0	.	370;370	P82987-2;P82987	.;ATL3_HUMAN	P	370	ENSP00000286744:R370P	ENSP00000286744:R370P	R	+	2	0	ADAMTSL3	82349901	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.224000	0.95209	2.377000	0.81083	0.655000	0.94253	CGC		0.403	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
PRSS12	8492	broad.mit.edu	37	4	119204223	119204223	+	Missense_Mutation	SNP	A	A	C			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr4:119204223A>C	ENST00000296498.3	-	12	2365	c.2083T>G	c.(2083-2085)Tat>Gat	p.Y695D	PRSS12_ENST00000510903.1_5'UTR	NM_003619.3	NP_003610.2	P56730	NETR_HUMAN	protease, serine, 12 (neurotrypsin, motopsin)	695	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocytosis (GO:0006887)|zymogen activation (GO:0031638)	axon (GO:0030424)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)|terminal bouton (GO:0043195)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.Y695D(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(11)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	29						AGAGTATGATAATCTCCAACC	0.438																																					p.Y695D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2083G	4						.						145.0	151.0	149.0					4																	119204223		2203	4300	6503	119423671	SO:0001583	missense	8492	exon12			AJ001531	CCDS3709.1	4q25-q26	2010-05-07			ENSG00000164099	ENSG00000164099		"""Serine peptidases / Serine peptidases"""	9477	protein-coding gene	gene with protein product		606709				9540828, 9245503	Standard	NM_003619		Approved	BSSP-3, MRT1	uc003ica.2	P56730	OTTHUMG00000161166	ENST00000296498.3:c.2083T>G	4.37:g.119204223A>C	ENSP00000296498:p.Tyr695Asp		119423671	NM_003619	Q9UP16	Missense_Mutation	SNP	ENST00000296498.3	37	CCDS3709.1	.	.	.	.	.	.	.	.	.	.	A	17.09	3.300484	0.60195	.	.	ENSG00000164099	ENST00000296498	D	0.93189	-3.18	5.88	3.43	0.39272	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.128903	0.53938	D	0.000050	D	0.94686	0.8286	L	0.49455	1.56	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	D	0.93506	0.6849	10	0.66056	D	0.02	.	10.4299	0.44400	0.8676:0.0:0.1324:0.0	.	695	P56730	NETR_HUMAN	D	695	ENSP00000296498:Y695D	ENSP00000296498:Y695D	Y	-	1	0	PRSS12	119423671	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	6.946000	0.75953	0.475000	0.27415	0.482000	0.46254	TAT		0.438	PRSS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256516.2		
FABP2	2169	broad.mit.edu	37	4	120241984	120241984	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr4:120241984C>T	ENST00000274024.3	-	2	368	c.81G>A	c.(79-81)gtG>gtA	p.V27V		NM_000134.3	NP_000125.2	P12104	FABPI_HUMAN	fatty acid binding protein 2, intestinal	27					digestion (GO:0007586)	cytoplasm (GO:0005737)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)	p.V27V(1)		breast(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	8					Estradiol(DB00783)|Ibuprofen(DB01050)|Sulfinpyrazone(DB01138)	GCTTCCTTTTCACTATATTAA	0.313																																					p.V27V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G81A	4						.						61.0	66.0	65.0					4																	120241984		2203	4299	6502	120461432	SO:0001819	synonymous_variant	2169	exon2			J03465	CCDS3712.1	4q28-q31	2013-03-01			ENSG00000145384	ENSG00000145384		"""Fatty acid binding protein family"""	3556	protein-coding gene	gene with protein product		134640					Standard	NM_000134		Approved	I-FABP	uc003icw.3	P12104	OTTHUMG00000132972	ENST00000274024.3:c.81G>A	4.37:g.120241984C>T			120461432	NM_000134	Q2NKJ1	Silent	SNP	ENST00000274024.3	37	CCDS3712.1																																																																																				0.313	FABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256531.1	NM_000134	
CEP44	80817	broad.mit.edu	37	4	175225427	175225427	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr4:175225427T>A	ENST00000503780.1	+	6	828	c.414T>A	c.(412-414)agT>agA	p.S138R	CEP44_ENST00000457424.2_Missense_Mutation_p.S138R|CEP44_ENST00000296519.4_Missense_Mutation_p.S138R|CEP44_ENST00000426172.1_Missense_Mutation_p.S138R	NM_001040157.2	NP_001035247.1	Q9C0F1	CEP44_HUMAN	centrosomal protein 44kDa	138						centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|spindle pole (GO:0000922)		p.S138R(1)		endometrium(2)|large_intestine(4)|lung(5)|stomach(1)	12						AGAAAATCAGTTCTGGTAAGT	0.338																																					p.S138R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T414A	4						.						67.0	70.0	69.0					4																	175225427		2203	4300	6503	175462002	SO:0001583	missense	80817	exon6			AB051499	CCDS34106.1, CCDS47163.1	4q34	2014-02-20	2011-05-06	2011-05-06	ENSG00000164118	ENSG00000164118			29356	protein-coding gene	gene with protein product			"""KIAA1712"""	KIAA1712		21399614	Standard	NM_001040157		Approved		uc010iro.2	Q9C0F1	OTTHUMG00000160752	ENST00000503780.1:c.414T>A	4.37:g.175225427T>A	ENSP00000423153:p.Ser138Arg		175462002	NM_001040157	A8K8W9|A8MW11|B3KT53|D3DP42|Q8IXZ4	Missense_Mutation	SNP	ENST00000503780.1	37	CCDS34106.1	.	.	.	.	.	.	.	.	.	.	T	6.711	0.499955	0.12762	.	.	ENSG00000164118	ENST00000503780;ENST00000457424;ENST00000515299;ENST00000503053;ENST00000426172;ENST00000296519	T;T;T;T;T	0.43294	0.98;0.96;0.95;0.96;0.98	5.01	5.01	0.66863	.	1.113100	0.06533	N	0.741830	T	0.39733	0.1089	L	0.34521	1.04	0.26684	N	0.971481	P;P	0.39157	0.662;0.513	B;B	0.40009	0.316;0.238	T	0.29882	-0.9997	10	0.30854	T	0.27	.	13.5906	0.61957	0.0:0.0:0.0:1.0	.	138;138	Q9C0F1-2;Q9C0F1	.;CEP44_HUMAN	R	138	ENSP00000423153:S138R;ENSP00000389427:S138R;ENSP00000421128:S138R;ENSP00000408221:S138R;ENSP00000296519:S138R	ENSP00000296519:S138R	S	+	3	2	CEP44	175462002	0.003000	0.15002	0.098000	0.21074	0.282000	0.26991	1.191000	0.32138	1.998000	0.58463	0.379000	0.24179	AGT		0.338	CEP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362109.2	NM_030633	
SGCB	6443	broad.mit.edu	37	4	52899640	52899640	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr4:52899640C>A	ENST00000381431.5	-	2	422	c.200G>T	c.(199-201)tGt>tTt	p.C67F	SGCB_ENST00000535450.1_Intron	NM_000232.4	NP_000223.1	Q16585	SGCB_HUMAN	sarcoglycan, beta (43kDa dystrophin-associated glycoprotein)	67					cardiac muscle cell development (GO:0055013)|muscle fiber development (GO:0048747)|muscle organ development (GO:0007517)|vascular smooth muscle cell development (GO:0097084)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.C67F(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(6)|prostate(1)	17			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			GATAATCACACAGATGGCTAA	0.363																																					p.C67F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G200T	4						.						162.0	149.0	154.0					4																	52899640		2203	4300	6503	52594397	SO:0001583	missense	6443	exon2			U29586	CCDS3488.1	4q12	2014-09-17	2002-08-29		ENSG00000163069	ENSG00000163069			10806	protein-coding gene	gene with protein product		600900	"""sarcoglycan, beta (43kD dystrophin-associated glycoprotein)"""	LGMD2E		8968749	Standard	NM_000232		Approved	SGC, A3b	uc003gzj.2	Q16585	OTTHUMG00000128697	ENST00000381431.5:c.200G>T	4.37:g.52899640C>A	ENSP00000370839:p.Cys67Phe		52594397	NM_000232	B7Z635|O00661	Missense_Mutation	SNP	ENST00000381431.5	37	CCDS3488.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807856	0.50421	.	.	ENSG00000163069	ENST00000381431	D	0.94138	-3.36	5.29	5.29	0.74685	.	0.043261	0.85682	D	0.000000	D	0.94371	0.8190	L	0.50333	1.59	0.80722	D	1	D	0.55385	0.971	P	0.60541	0.876	D	0.91865	0.5502	10	0.12430	T	0.62	-16.2361	17.921	0.88966	0.0:1.0:0.0:0.0	.	67	Q16585	SGCB_HUMAN	F	67	ENSP00000370839:C67F	ENSP00000370839:C67F	C	-	2	0	SGCB	52594397	1.000000	0.71417	1.000000	0.80357	0.023000	0.10783	7.750000	0.85110	2.476000	0.83614	0.650000	0.86243	TGT		0.363	SGCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250596.2		
DSPP	1834	broad.mit.edu	37	4	88533324	88533324	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr4:88533324C>G	ENST00000282478.7	+	2	152	c.119C>G	c.(118-120)tCa>tGa	p.S40*	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Nonsense_Mutation_p.S40*			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	40					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S40*(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		CTAGCAAGATCAAATGTGTCA	0.358																																					p.S40X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C119G	4						.						106.0	101.0	103.0					4																	88533324		1843	4082	5925	88752348	SO:0001587	stop_gained	1834	exon3			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.119C>G	4.37:g.88533324C>G	ENSP00000282478:p.Ser40*		88752348	NM_014208	A8MUI0|O95815	Nonsense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747722	0.49257	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	.	.	.	4.89	-1.85	0.07784	.	1.492390	0.05048	N	0.477580	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	1.8005	9.0281	0.36243	0.0:0.4071:0.0:0.5929	.	.	.	.	X	40	.	ENSP00000282478:S40X	S	+	2	0	DSPP	88752348	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.142000	0.03203	-0.256000	0.09473	0.460000	0.39030	TCA		0.358	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT1	2195	broad.mit.edu	37	4	187535391	187535391	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr4:187535391C>T	ENST00000441802.2	-	12	9392	c.9183G>A	c.(9181-9183)acG>acA	p.T3061T		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3061	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T3061T(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						AACCCAATAACGTGTAAGTAA	0.383										HNSCC(5;0.00058)																											p.T3061T	Colon(197;1040 2055 4143 4984 49344)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9183A	4						.						193.0	186.0	188.0					4																	187535391		1878	4107	5985	187772385	SO:0001819	synonymous_variant	2195	exon12			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.9183G>A	4.37:g.187535391C>T			187772385	NM_005245		Silent	SNP	ENST00000441802.2	37	CCDS47177.1																																																																																				0.383	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
WNK3	65267	broad.mit.edu	37	X	54263730	54263730	+	Silent	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chrX:54263730G>A	ENST00000375159.2	-	19	4268	c.4269C>T	c.(4267-4269)agC>agT	p.S1423S	WNK3_ENST00000375169.3_Silent_p.S1376S|WNK3_ENST00000354646.2_Silent_p.S1423S			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1423					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S1423S(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CACAAGCTGCGCTGAAAGATA	0.408																																					p.S1376S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4128T	X						.						85.0	72.0	76.0					X																	54263730		2203	4300	6503	54280455	SO:0001819	synonymous_variant	65267	exon20			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4269C>T	X.37:g.54263730G>A			54280455	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	ENST00000375159.2	37	CCDS14357.1																																																																																				0.408	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
CPXCR1	53336	broad.mit.edu	37	X	88008496	88008496	+	Silent	SNP	T	T	C			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chrX:88008496T>C	ENST00000276127.4	+	3	340	c.81T>C	c.(79-81)tgT>tgC	p.C27C	CPXCR1_ENST00000373111.1_Silent_p.C27C	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	27							metal ion binding (GO:0046872)	p.C27C(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CTAATGACTGTAGTACAGACA	0.433																																					p.C27C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T81C	X						.						38.0	33.0	35.0					X																	88008496		2203	4300	6503	87895152	SO:0001819	synonymous_variant	53336	exon3			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.81T>C	X.37:g.88008496T>C			87895152	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Silent	SNP	ENST00000276127.4	37	CCDS14458.1																																																																																				0.433	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
LONRF3	79836	broad.mit.edu	37	X	118147049	118147049	+	Missense_Mutation	SNP	T	T	A			TCGA-AF-3913-01	TCGA-AF-3913-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chrX:118147049T>A	ENST00000371628.3	+	9	1890	c.1859T>A	c.(1858-1860)tTt>tAt	p.F620Y	LONRF3_ENST00000422289.2_Missense_Mutation_p.F364Y|LONRF3_ENST00000304778.7_Missense_Mutation_p.F579Y|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	620	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.F579Y(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GTTCAATTCTTTGCTGATGGC	0.483																																					p.F579Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1736A	X						.						132.0	130.0	130.0					X																	118147049		2203	4300	6503	118031077	SO:0001583	missense	79836	exon8			AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1859T>A	X.37:g.118147049T>A	ENSP00000360690:p.Phe620Tyr		118031077	NM_024778	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	CCDS35374.1	.	.	.	.	.	.	.	.	.	.	T	33	5.193389	0.94960	.	.	ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.88	5.88	0.94601	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.58680	0.2139	L	0.51914	1.62	0.46654	D	0.999148	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.79108	0.988;0.982;0.992	T	0.59742	-0.7397	10	0.54805	T	0.06	-28.1277	14.2923	0.66286	0.0:0.0:0.0:1.0	.	364;579;620	B3KUN7;Q496Y0-2;Q496Y0	.;.;LONF3_HUMAN	Y	579;579;620;364	ENSP00000360691:F579Y;ENSP00000307732:F579Y;ENSP00000360690:F620Y;ENSP00000408894:F364Y	ENSP00000307732:F579Y	F	+	2	0	LONRF3	118031077	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	8.040000	0.89188	1.973000	0.57446	0.486000	0.48141	TTT		0.483	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
GTDC1	79712	broad.mit.edu	37	2	144764947	144764947	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:144764947C>T	ENST00000392869.2	-	6	829	c.677G>A	c.(676-678)tGt>tAt	p.C226Y	GTDC1_ENST00000409298.1_Intron|GTDC1_ENST00000344850.4_Missense_Mutation_p.C226Y|GTDC1_ENST00000392867.3_Missense_Mutation_p.C226Y|GTDC1_ENST00000409214.1_Missense_Mutation_p.C226Y|GTDC1_ENST00000241391.5_Missense_Mutation_p.C226Y|GTDC1_ENST00000463875.2_Missense_Mutation_p.C97Y|GTDC1_ENST00000542155.1_Missense_Mutation_p.C226Y	NM_001284234.1	NP_001271163.1	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	226					biosynthetic process (GO:0009058)		transferase activity, transferring glycosyl groups (GO:0016757)	p.C226Y(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(17)|ovary(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.0914)		ATCAAGGCCACAGTGTGTATC	0.418																																					p.C226Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G677A	2						.						108.0	105.0	106.0					2																	144764947		2203	4300	6503	144481417	SO:0001583	missense	79712	exon7			AY281366	CCDS2185.1, CCDS33300.1, CCDS63029.1, CCDS74582.1, CCDS74583.1	2q22.3	2013-02-22			ENSG00000121964	ENSG00000121964		"""Glycosyltransferase group 1 domain containing"""	20887	protein-coding gene	gene with protein product	"""mannosyltransferase-like"""	610165				15068588, 21821951	Standard	NM_024659		Approved	FLJ11753, Hmat-Xa	uc010fnn.3	Q4AE62	OTTHUMG00000131835	ENST00000392869.2:c.677G>A	2.37:g.144764947C>T	ENSP00000376608:p.Cys226Tyr		144481417	NM_001164629	A8K5P2|D3DP81|Q53SM7|Q53TC5|Q6P7E7|Q6PJB6|Q6WKW6|Q9HAE5	Missense_Mutation	SNP	ENST00000392869.2	37	CCDS33300.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512743	0.27123	.	.	ENSG00000121964	ENST00000392869;ENST00000409214;ENST00000392867;ENST00000542155;ENST00000241391;ENST00000344850;ENST00000463875	T;T;T;T;T;T;T	0.41758	1.0;1.0;0.99;1.0;0.99;1.0;1.0	5.42	0.99	0.19807	.	0.441905	0.24633	N	0.036864	T	0.31949	0.0813	L	0.44542	1.39	0.09310	N	1	B;B;B;B	0.18013	0.025;0.025;0.021;0.025	B;B;B;B	0.21708	0.036;0.036;0.011;0.036	T	0.24190	-1.0167	10	0.52906	T	0.07	-24.4104	7.8726	0.29576	0.0987:0.2903:0.611:0.0	.	226;226;226;226	G1UFN1;Q4AE62-2;Q4AE62;Q4AE62-3	.;.;GTDC1_HUMAN;.	Y	226;226;226;226;226;226;97	ENSP00000376608:C226Y;ENSP00000386581:C226Y;ENSP00000376606:C226Y;ENSP00000438323:C226Y;ENSP00000241391:C226Y;ENSP00000339750:C226Y;ENSP00000437964:C97Y	ENSP00000241391:C226Y	C	-	2	0	GTDC1	144481417	0.030000	0.19436	0.001000	0.08648	0.031000	0.12232	0.536000	0.23129	-0.052000	0.13311	-0.147000	0.13772	TGT		0.418	GTDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254779.2	NM_024659	
FIGN	55137	broad.mit.edu	37	2	164466241	164466241	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:164466241C>T	ENST00000333129.3	-	3	2415	c.2101G>A	c.(2101-2103)Gtg>Atg	p.V701M	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	701					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.V701M(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GGGCCCACCACTGCTTCCTGA	0.507																																					p.V701M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2101A	2						.						54.0	57.0	56.0					2																	164466241		2008	4179	6187	164174487	SO:0001583	missense	55137	exon3			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.2101G>A	2.37:g.164466241C>T	ENSP00000333836:p.Val701Met		164174487	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443462	0.25987	.	.	ENSG00000182263	ENST00000333129	D	0.98345	-4.88	5.89	5.89	0.94794	.	0.530996	0.20443	N	0.092260	D	0.97312	0.9121	L	0.45581	1.43	0.26513	N	0.974568	B	0.29253	0.239	B	0.35859	0.212	D	0.93003	0.6425	10	0.87932	D	0	-7.0114	20.2527	0.98410	0.0:1.0:0.0:0.0	.	701	Q5HY92	FIGN_HUMAN	M	701	ENSP00000333836:V701M	ENSP00000333836:V701M	V	-	1	0	FIGN	164174487	0.955000	0.32602	0.949000	0.38748	0.988000	0.76386	2.955000	0.49121	2.788000	0.95919	0.557000	0.71058	GTG		0.507	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
TTN	7273	broad.mit.edu	37	2	179428320	179428320	+	Silent	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:179428320G>A	ENST00000591111.1	-	276	77840	c.77616C>T	c.(77614-77616)ggC>ggT	p.G25872G	TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Silent_p.G27513G|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.G18573G|TTN_ENST00000460472.2_Silent_p.G18448G|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.G18640G|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Silent_p.G24945G|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25872	Fibronectin type-III 88. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G18640G(1)|p.G24943G(1)|p.G18448G(1)|p.G18573G(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCATCTAACGCCTTCCTTAT	0.468																																					p.A18448V												.	.	4	Substitution - coding silent(4)	large_intestine(4)	c.C55343T	2						.						122.0	121.0	121.0					2																	179428320		1984	4163	6147	179136566	SO:0001819	synonymous_variant	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77616C>T	2.37:g.179428320G>A			179136566	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.468	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PIKFYVE	200576	broad.mit.edu	37	2	209163489	209163489	+	Missense_Mutation	SNP	C	C	T	rs61752183		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:209163489C>T	ENST00000264380.4	+	8	1194	c.1036C>T	c.(1036-1038)Cgc>Tgc	p.R346C	PIKFYVE_ENST00000392202.3_Missense_Mutation_p.R249C|PIKFYVE_ENST00000407449.1_Missense_Mutation_p.R346C|PIKFYVE_ENST00000308862.6_Missense_Mutation_p.R260C	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	346					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)	p.R346C(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						TGAGGATGAACGCAAAATTCT	0.418																																					p.R346C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1036T	2						.						145.0	116.0	126.0					2																	209163489		2203	4300	6503	208871734	SO:0001583	missense	200576	exon8			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.1036C>T	2.37:g.209163489C>T	ENSP00000264380:p.Arg346Cys		208871734	NM_001178000	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	ENST00000264380.4	37	CCDS2382.1	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769890	0.69992	.	.	ENSG00000115020	ENST00000392202;ENST00000264380;ENST00000407449;ENST00000308862;ENST00000452564	T;T;T	0.68181	1.44;-0.31;1.53	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.72309	0.3444	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.993;0.993;0.984;0.973;0.992	T	0.71830	-0.4474	10	0.45353	T	0.12	-12.4426	14.6352	0.68682	0.1456:0.8544:0.0:0.0	rs61752183	346;346;260;346;249	Q9Y2I7;E9PDH4;Q9Y2I7-3;Q08AR7;Q9Y2I7-2	FYV1_HUMAN;.;.;.;.	C	249;346;346;260;346	ENSP00000264380:R346C;ENSP00000384356:R346C;ENSP00000405736:R346C	ENSP00000264380:R346C	R	+	1	0	PIKFYVE	208871734	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.300000	0.43620	2.747000	0.94245	0.650000	0.86243	CGC		0.418	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256477.2	NM_015040	
ALLC	55821	broad.mit.edu	37	2	3730543	3730543	+	Silent	SNP	C	C	T	rs201690293		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:3730543C>T	ENST00000252505.3	+	7	552	c.390C>T	c.(388-390)gaC>gaT	p.D130D		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	149					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)	p.D130D(1)		breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TAAAATCCGACGACTGGAGTT	0.428										HNSCC(21;0.051)																											p.D130D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C390T	2						.						124.0	125.0	125.0					2																	3730543		1893	4117	6010	3708418	SO:0001819	synonymous_variant	55821	exon7			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.390C>T	2.37:g.3730543C>T			3708418	NM_018436	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Silent	SNP	ENST00000252505.3	37	CCDS46223.1																																																																																				0.428	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322855.1		
KCNK3	3777	broad.mit.edu	37	2	26950590	26950590	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:26950590C>T	ENST00000302909.3	+	2	464	c.339C>T	c.(337-339)taC>taT	p.Y113Y		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	113					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)	p.Y113Y(1)		endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	GCATGTTCTACGCGCTGCTGG	0.622																																					p.Y113Y	GBM(80;1457 1631 27100 45946)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C339T	2						.						127.0	121.0	123.0					2																	26950590		2203	4300	6503	26804094	SO:0001819	synonymous_variant	3777	exon2			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.339C>T	2.37:g.26950590C>T			26804094	NM_002246	Q53SU2	Silent	SNP	ENST00000302909.3	37	CCDS1727.1																																																																																				0.622	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
EIF2AK2	5610	broad.mit.edu	37	2	37353494	37353494	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AF-3913-01	TCGA-AF-3913-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:37353494delG	ENST00000233057.4	-	11	1168	c.846delC	c.(844-846)ttcfs	p.F282fs	EIF2AK2_ENST00000395127.2_Frame_Shift_Del_p.F282fs|EIF2AK2_ENST00000405334.1_Intron	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	282	Interaction with TRAF5.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)	p.F282fs*28(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				GTTTTGCTTTGAAAACTTGGC	0.308																																					p.F282fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.846delC	2						.						95.0	94.0	94.0					2																	37353494		2203	4300	6503	37206998	SO:0001589	frameshift_variant	5610	exon11			BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.846delC	2.37:g.37353494delG	ENSP00000233057:p.Phe282fs		37206998	NM_002759	A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Frame_Shift_Del	DEL	ENST00000233057.4	37	CCDS1786.1																																																																																				0.308	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218571.2	NM_002759	
KIAA1841	84542	broad.mit.edu	37	2	61361295	61361295	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:61361295C>T	ENST00000295031.5	+	21	2429	c.2052C>T	c.(2050-2052)gaC>gaT	p.D684D		NM_032506.2	NP_115895.2	Q6NSI8	K1841_HUMAN	KIAA1841	0								p.D684D(1)		breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			gacccagagacggcactgtgt	0.403																																					p.D684D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2052T	2						.						152.0	139.0	144.0					2																	61361295		2203	4300	6503	61214799	SO:0001819	synonymous_variant	84542	exon21			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000295031.5:c.2052C>T	2.37:g.61361295C>T			61214799	NM_032506	Q49AF0|Q6ZND0|Q96JI6	Silent	SNP	ENST00000295031.5	37	CCDS1867.1																																																																																				0.403	KIAA1841-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251580.1	NM_032506	
SLC19A3	80704	broad.mit.edu	37	2	228552899	228552899	+	Silent	SNP	A	A	G			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr2:228552899A>G	ENST00000258403.3	-	5	1368	c.1297T>C	c.(1297-1299)Ttg>Ctg	p.L433L	SLC19A3_ENST00000541617.1_Silent_p.L429L|SLC19A3_ENST00000409287.1_Intron	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	433					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)	p.L433L(1)		breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CTGACTGGCAAGTTGAGCCCT	0.393																																					p.L433L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1297C	2						.						156.0	139.0	145.0					2																	228552899		2203	4300	6503	228261143	SO:0001819	synonymous_variant	80704	exon5			AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.1297T>C	2.37:g.228552899A>G			228261143	NM_025243		Silent	SNP	ENST00000258403.3	37	CCDS2468.1																																																																																				0.393	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
ANKS6	203286	broad.mit.edu	37	9	101513343	101513343	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:101513343C>G	ENST00000353234.4	-	13	2409	c.2362G>C	c.(2362-2364)Gag>Cag	p.E788Q	ANKS6_ENST00000375019.2_Missense_Mutation_p.E487Q|ANKS6_ENST00000375018.1_Missense_Mutation_p.E789Q|ANKS6_ENST00000540940.1_Missense_Mutation_p.E593Q			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	788	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.					cilium (GO:0005929)|cytoplasm (GO:0005737)		p.E788Q(1)		endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TGATATTTCTCAAGTGATAAT	0.308																																					p.E788Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2362C	9						.						98.0	93.0	94.0					9																	101513343		1813	4087	5900	100553164	SO:0001583	missense	203286	exon13			AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.2362G>C	9.37:g.101513343C>G	ENSP00000297837:p.Glu788Gln		100553164	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	ENST00000353234.4	37	CCDS43856.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.6|25.6	4.657537|4.657537	0.88154|0.88154	.|.	.|.	ENSG00000165138|ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940|ENST00000444472	T;T;T;T|.	0.46819|.	0.86;0.86;0.86;0.86|.	5.91|5.91	5.91|5.91	0.95273|0.95273	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.67730|.	0.2924|.	L|L	0.45285|0.45285	1.41|1.41	0.51012|0.51012	D|D	0.999905|0.999905	D;D|.	0.76494|.	0.989;0.999|.	P;D|.	0.83275|.	0.883;0.996|.	T|.	0.62338|.	-0.6875|.	10|.	0.87932|.	D|.	0|.	-38.4283|-38.4283	17.7923|17.7923	0.88558|0.88558	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	789;788|.	Q68DC2-4;Q68DC2|.	.;ANKS6_HUMAN|.	Q|S	487;789;788;593|257	ENSP00000364159:E487Q;ENSP00000364158:E789Q;ENSP00000297837:E788Q;ENSP00000442189:E593Q|.	ENSP00000297837:E788Q|.	E|X	-|-	1|2	0|2	ANKS6|ANKS6	100553164|100553164	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.081000|7.081000	0.76844|0.76844	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GAG|TGA		0.308	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
GLIS3	169792	broad.mit.edu	37	9	4118682	4118682	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:4118682A>T	ENST00000324333.10	-	3	524	c.331T>A	c.(331-333)Tct>Act	p.S111T	GLIS3_ENST00000381971.3_Missense_Mutation_p.S266T	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	111	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.S111T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		AATGAGTTAGAGACACTATTG	0.562																																					p.S111T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T331A	9						.						163.0	146.0	152.0					9																	4118682		2203	4300	6503	4108682	SO:0001583	missense	169792	exon3			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.331T>A	9.37:g.4118682A>T	ENSP00000325494:p.Ser111Thr		4108682	NM_152629	B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	CCDS6451.1	.	.	.	.	.	.	.	.	.	.	A	7.509	0.654300	0.14580	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.12147	2.74;2.71	5.59	4.41	0.53225	.	0.272854	0.25564	N	0.029811	T	0.09686	0.0238	L	0.39467	1.215	0.37025	D	0.896402	B;B	0.18310	0.027;0.006	B;B	0.13407	0.009;0.004	T	0.15378	-1.0439	10	0.09084	T	0.74	.	7.6424	0.28300	0.714:0.1462:0.0:0.1398	.	266;111	Q8NEA6-2;Q8NEA6	.;GLIS3_HUMAN	T	111;266	ENSP00000325494:S111T;ENSP00000371398:S266T	ENSP00000325494:S111T	S	-	1	0	GLIS3	4108682	1.000000	0.71417	0.996000	0.52242	0.862000	0.49288	2.315000	0.43752	0.904000	0.36572	0.533000	0.62120	TCT		0.562	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629	
KIAA1045	23349	broad.mit.edu	37	9	34977130	34977130	+	Silent	SNP	C	C	T	rs374791324		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:34977130C>T	ENST00000242315.3	+	6	982	c.900C>T	c.(898-900)gcC>gcT	p.A300A	KIAA1045_ENST00000476115.2_3'UTR|KIAA1045_ENST00000544237.1_Silent_p.A300A	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	300							metal ion binding (GO:0046872)	p.A300A(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			GAGCCCGAGCCGCCTTCCTGG	0.582																																					p.A300A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C900T	9						.	C		0,3788		0,0,1894	45.0	50.0	49.0		900	0.4	0.9	9		49	2,8208		0,2,4103	no	coding-synonymous	KIAA1045	NM_015297.1		0,2,5997	TT,TC,CC		0.0244,0.0,0.0167		300/401	34977130	2,11996	1894	4105	5999	34967130	SO:0001819	synonymous_variant	23349	exon6			AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.900C>T	9.37:g.34977130C>T			34967130	NM_015297	B7Z253|Q58FE9|Q5T662	Silent	SNP	ENST00000242315.3	37	CCDS43796.1																																																																																				0.582	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052256.2	XM_048592	
ZNF658	26149	broad.mit.edu	37	9	40774130	40774130	+	Missense_Mutation	SNP	A	A	T			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:40774130A>T	ENST00000602553.1	-	5	1439	c.1145T>A	c.(1144-1146)cTt>cAt	p.L382H	ZNF658_ENST00000377626.3_Missense_Mutation_p.L382H|ZNF658_ENST00000441795.1_Missense_Mutation_p.L380H			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L382H(1)		breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTCATCAGAAAGGTAGAATTT	0.398																																					p.L382H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1145A	9						.						210.0	211.0	211.0					9																	40774130		2203	4300	6503	40764130	SO:0001583	missense	26149	exon5			AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.1145T>A	9.37:g.40774130A>T	ENSP00000473484:p.Leu382His		40764130	NM_033160	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Missense_Mutation	SNP	ENST00000602553.1	37	CCDS35023.1	.	.	.	.	.	.	.	.	.	.	a	5.269	0.234977	0.09969	.	.	ENSG00000196409	ENST00000441795;ENST00000377626	T;T	0.15718	2.4;2.4	1.96	-0.601	0.11638	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05135	0.0137	N	0.03608	-0.345	0.09310	N	1	P;P	0.40032	0.699;0.574	B;B	0.34931	0.192;0.094	T	0.21895	-1.0232	9	0.56958	D	0.05	.	0.193	0.00136	0.2373:0.1586:0.2321:0.372	.	382;382	Q5TYW1-2;Q5TYW1	.;ZN658_HUMAN	H	380;382	ENSP00000408462:L380H;ENSP00000366853:L382H	ENSP00000366853:L382H	L	-	2	0	ZNF658	40764130	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.015000	0.12634	-0.135000	0.11495	-0.940000	0.02684	CTT		0.398	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467800.1	NM_033160	
IDNK	414328	broad.mit.edu	37	9	86243847	86243847	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:86243847G>A	ENST00000376419.4	+	3	145	c.141G>A	c.(139-141)atG>atA	p.M47I	IDNK_ENST00000277124.8_Start_Codon_SNP_p.M1I|IDNK_ENST00000454393.1_Missense_Mutation_p.M90I|IDNK_ENST00000376417.4_Missense_Mutation_p.M47I|IDNK_ENST00000405990.3_Nonsense_Mutation_p.W37*	NM_001001551.3	NP_001001551.2	Q5T6J7	GNTK_HUMAN	idnK, gluconokinase homolog (E. coli)	47					D-gluconate catabolic process (GO:0046177)		ATP binding (GO:0005524)|gluconokinase activity (GO:0046316)	p.M1I(1)									GAAGGAAGATGGGAAAAGGCA	0.468																																					p.W37X												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G110A	9						.						251.0	188.0	210.0					9																	86243847		2203	4300	6503	85433667	SO:0001583	missense	414328	exon2			BC036421	CCDS35048.1, CCDS35048.2, CCDS59134.1	9q21.32	2012-03-30	2012-03-30	2012-03-30	ENSG00000148057	ENSG00000148057			31367	protein-coding gene	gene with protein product		611343	"""chromosome 9 open reading frame 103"""	C9orf103			Standard	NM_001001551		Approved	bA522I20.2	uc004amu.3	Q5T6J7	OTTHUMG00000020105	ENST00000376419.4:c.141G>A	9.37:g.86243847G>A	ENSP00000365601:p.Met47Ile		85433667	NM_001190727	A5PLN6|Q5T6J6	Missense_Mutation	SNP	ENST00000376419.4	37	CCDS35048.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.59|13.59	2.282028|2.282028	0.40394|0.40394	.|.	.|.	ENSG00000148057|ENSG00000148057	ENST00000277124;ENST00000530832;ENST00000376417;ENST00000376419;ENST00000454393|ENST00000405990	T;T;T;T|.	0.68624|.	-0.34;1.31;1.31;1.31|.	4.7|4.7	4.7|4.7	0.59300|0.59300	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73361|.	0.3577|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.71674|.	0.998|.	D|.	0.79108|.	0.992|.	T|.	0.77088|.	-0.2717|.	9|.	0.87932|0.87932	D|D	0|0	-15.6057|-15.6057	13.4681|13.4681	0.61268|0.61268	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	47|.	Q5T6J7|.	GNTK_HUMAN|.	I|X	1;1;47;47;90|37	ENSP00000277124:M1I;ENSP00000365599:M47I;ENSP00000365601:M47I;ENSP00000403290:M90I|.	ENSP00000277124:M1I|ENSP00000385324:W37X	M|W	+|+	3|2	0|0	C9orf103|C9orf103	85433667|85433667	0.999000|0.999000	0.42202|0.42202	0.972000|0.972000	0.41901|0.41901	0.065000|0.065000	0.16274|0.16274	4.569000|4.569000	0.60865|0.60865	2.286000|2.286000	0.76751|0.76751	0.558000|0.558000	0.71614|0.71614	ATG|TGG		0.468	IDNK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052837.2	NM_001001551	
SYK	6850	broad.mit.edu	37	9	93637111	93637111	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:93637111G>T	ENST00000375754.4	+	9	1309	c.1161G>T	c.(1159-1161)aaG>aaT	p.K387N	SYK_ENST00000375747.1_Missense_Mutation_p.K364N|SYK_ENST00000375746.1_Missense_Mutation_p.K387N|SYK_ENST00000375751.4_Missense_Mutation_p.K364N	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	387	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.K364N(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						CTGTGAAAAAGGGCTACTACC	0.468			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																p.K364N			Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1092T	9						.						103.0	111.0	108.0					9																	93637111		2203	4300	6503	92676932	SO:0001583	missense	6850	exon8			L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.1161G>T	9.37:g.93637111G>T	ENSP00000364907:p.Lys387Asn		92676932	NM_001174168		Missense_Mutation	SNP	ENST00000375754.4	37	CCDS6688.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545791	0.65198	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	4.29	2.44	0.29823	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.181985	0.47455	D	0.000235	T	0.71290	0.3322	M	0.73753	2.245	0.58432	D	0.999998	D;D	0.65815	0.971;0.995	P;D	0.67231	0.832;0.95	T	0.70288	-0.4913	10	0.54805	T	0.06	.	4.4892	0.11805	0.4444:0.0:0.5556:0.0	.	364;387	P43405-2;P43405	.;KSYK_HUMAN	N	387;364;364;387	ENSP00000364907:K387N;ENSP00000364904:K364N;ENSP00000364899:K364N;ENSP00000364898:K387N	ENSP00000364898:K387N	K	+	3	2	SYK	92676932	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.394000	0.34509	1.164000	0.42652	-0.137000	0.14449	AAG		0.468	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053018.1		
KIAA0368	23392	broad.mit.edu	37	9	114156515	114156515	+	Missense_Mutation	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr9:114156515G>C	ENST00000338205.5	-	25	3066	c.2847C>G	c.(2845-2847)aaC>aaG	p.N949K	KIAA0368_ENST00000259335.4_Missense_Mutation_p.N1127K|KIAA0368_ENST00000374378.3_5'UTR			Q5VYK3	ECM29_HUMAN	KIAA0368	955					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.N1127K(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TCACGTGTGGGTTGGGGCTGA	0.463																																					p.N1127K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3381G	9						.						66.0	66.0	66.0					9																	114156515		1960	4147	6107	113196336	SO:0001583	missense	23392	exon27			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.2847C>G	9.37:g.114156515G>C	ENSP00000339889:p.Asn949Lys		113196336	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	37		.	.	.	.	.	.	.	.	.	.	G	12.88	2.071218	0.36566	.	.	ENSG00000136813	ENST00000338205;ENST00000259335;ENST00000543827	T	0.68903	-0.36	5.68	0.679	0.17975	.	0.149513	0.56097	D	0.000023	T	0.41328	0.1154	N	0.17278	0.47	0.80722	D	1	B	0.16396	0.017	B	0.20184	0.028	T	0.33879	-0.9851	10	0.02654	T	1	.	9.4678	0.38824	0.4059:0.0:0.5941:0.0	.	424	B3KXF2	.	K	949;1127;424	ENSP00000259335:N1127K	ENSP00000259335:N1127K	N	-	3	2	KIAA0368	113196336	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.608000	0.36847	0.080000	0.16959	-0.140000	0.14226	AAC		0.463	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
ING1	3621	broad.mit.edu	37	13	111372025	111372025	+	Nonsense_Mutation	SNP	C	C	T	rs368239053		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr13:111372025C>T	ENST00000375774.3	+	2	1477	c.1015C>T	c.(1015-1017)Cga>Tga	p.R339*	ING1_ENST00000375775.3_Nonsense_Mutation_p.R127*|ING1_ENST00000333219.7_Nonsense_Mutation_p.R196*|ING1_ENST00000338450.7_Nonsense_Mutation_p.R152*	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	339					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.R196*(3)|p.R339*(1)|p.R152*(1)		endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CAAGGCGGAGCGAGAGGCGTC	0.627																																					p.R196X												.	.	5	Substitution - Nonsense(5)	endometrium(3)|large_intestine(2)	c.C586T	13						.						102.0	71.0	81.0					13																	111372025		2203	4300	6503	110170026	SO:0001587	stop_gained	3621	exon2				CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.1015C>T	13.37:g.111372025C>T	ENSP00000364929:p.Arg339*		110170026	NM_198219	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Nonsense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461577	0.63513	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	.	.	.	5.41	-4.77	0.03219	.	0.047098	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-45.0616	23.0881	0.99979	0.1965:0.8034:0.0:0.0	.	.	.	.	X	152;196;127;339	.	ENSP00000328436:R196X	R	+	1	2	ING1	110170026	0.974000	0.33945	0.853000	0.33588	0.380000	0.30137	0.240000	0.18042	-1.095000	0.03050	-0.500000	0.04577	CGA		0.627	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
NOLC1	9221	broad.mit.edu	37	10	103912176	103912176	+	Silent	SNP	C	C	T	rs540452525	byFrequency	TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:103912176C>T	ENST00000605788.1	+	1	244	c.9C>T	c.(7-9)gaC>gaT	p.D3D	NOLC1_ENST00000488254.2_Silent_p.D3D|NOLC1_ENST00000405356.1_Silent_p.D3D|NOLC1_ENST00000603742.1_5'UTR	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	3				D -> A (in Ref. 6; BAA04803). {ECO:0000305}.	cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)	p.D3D(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		GGATGGCGGACGCCGGCATTC	0.617													C|||	2	0.000399361	0.0	0.0	5008	,	,		17405	0.0		0.0	False		,,,				2504	0.002				p.D3D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C9T	10						.						76.0	75.0	75.0					10																	103912176		2203	4300	6503	103902166	SO:0001819	synonymous_variant	9221	exon1			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.9C>T	10.37:g.103912176C>T			103902166	NM_004741	Q15030|Q5VV70|Q9BUV3	De_novo_Start_OutOfFrame	SNP	ENST00000605788.1	37	CCDS7530.1																																																																																				0.617	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
PCDH15	65217	broad.mit.edu	37	10	55996623	55996623	+	Silent	SNP	C	C	T	rs150450873		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:55996623C>T	ENST00000320301.6	-	9	1339	c.945G>A	c.(943-945)ccG>ccA	p.P315P	PCDH15_ENST00000373957.3_Silent_p.P293P|PCDH15_ENST00000395442.1_Silent_p.P315P|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395433.1_Silent_p.P293P|PCDH15_ENST00000373955.1_Silent_p.P315P|PCDH15_ENST00000414778.1_Silent_p.P320P|PCDH15_ENST00000437009.1_Silent_p.P315P|PCDH15_ENST00000395446.1_Silent_p.P315P|PCDH15_ENST00000395432.2_Silent_p.P278P|PCDH15_ENST00000395438.1_Silent_p.P315P|PCDH15_ENST00000395430.1_Silent_p.P315P|PCDH15_ENST00000395445.1_Silent_p.P315P|PCDH15_ENST00000373965.2_Silent_p.P315P|PCDH15_ENST00000395440.1_Silent_p.P315P|PCDH15_ENST00000361849.3_Silent_p.P315P	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	315	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.P320P(2)|p.P315P(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TATCTGATGGCGGTTGAATAT	0.378										HNSCC(58;0.16)																											p.P278P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G834A	10						.						177.0	166.0	169.0					10																	55996623		2203	4300	6503	55666629	SO:0001819	synonymous_variant	65217	exon8			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.945G>A	10.37:g.55996623C>T			55666629	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																				0.378	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
TET1	80312	broad.mit.edu	37	10	70450734	70450734	+	Silent	SNP	A	A	T			TCGA-AF-3913-01	TCGA-AF-3913-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:70450734A>T	ENST00000373644.4	+	12	5783	c.5574A>T	c.(5572-5574)acA>acT	p.T1858T		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1858					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.T1858T(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CTTCAGCCACACCAGCTCCAC	0.542																																					p.T1858T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A5574T	10						.						84.0	78.0	80.0					10																	70450734		2203	4300	6503	70120740	SO:0001819	synonymous_variant	80312	exon12			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5574A>T	10.37:g.70450734A>T			70120740	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																				0.542	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
DLG5	9231	broad.mit.edu	37	10	79579711	79579711	+	Silent	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:79579711C>T	ENST00000372391.2	-	16	3473	c.3468G>A	c.(3466-3468)tcG>tcA	p.S1156S	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Silent_p.S816S	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1156					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)	p.S1156S(1)		breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			AATGCCCAGGCGAGTAAGGTG	0.627																																					p.S1156S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3468A	10						.						62.0	70.0	68.0					10																	79579711		2203	4299	6502	79249717	SO:0001819	synonymous_variant	9231	exon16			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3468G>A	10.37:g.79579711C>T			79249717	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Silent	SNP	ENST00000372391.2	37	CCDS7353.2																																																																																				0.627	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
BTAF1	9044	broad.mit.edu	37	10	93784547	93784547	+	Missense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:93784547C>A	ENST00000265990.6	+	35	5206	c.4898C>A	c.(4897-4899)aCt>aAt	p.T1633N	BTAF1_ENST00000544642.1_Missense_Mutation_p.T461N	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1633					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T1633N(1)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				AATGGCAGCACTTCCGAGAGT	0.418																																					p.T1633N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4898A	10						.						104.0	94.0	98.0					10																	93784547		2203	4300	6503	93774527	SO:0001583	missense	9044	exon35			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.4898C>A	10.37:g.93784547C>A	ENSP00000265990:p.Thr1633Asn		93774527	NM_003972	B4E0W6|O43578	Missense_Mutation	SNP	ENST00000265990.6	37	CCDS7419.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.738191	0.30774	.	.	ENSG00000095564	ENST00000265990;ENST00000544642;ENST00000538688	D;D	0.90261	-2.64;-2.59	5.95	5.95	0.96441	.	0.233433	0.43919	D	0.000514	D	0.87136	0.6102	L	0.40543	1.245	0.37125	D	0.900994	B	0.06786	0.001	B	0.08055	0.003	T	0.82796	-0.0280	10	0.14656	T	0.56	-15.4489	20.3697	0.98890	0.0:1.0:0.0:0.0	.	1633	O14981	BTAF1_HUMAN	N	1633;461;483	ENSP00000265990:T1633N;ENSP00000439924:T461N	ENSP00000265990:T1633N	T	+	2	0	BTAF1	93774527	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.995000	0.63908	2.811000	0.96726	0.655000	0.94253	ACT		0.418	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
SLIT1	6585	broad.mit.edu	37	10	98807528	98807528	+	Missense_Mutation	SNP	C	C	T	rs373698645		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:98807528C>T	ENST00000266058.4	-	16	1798	c.1553G>A	c.(1552-1554)cGc>cAc	p.R518H	SLIT1_ENST00000371070.4_Missense_Mutation_p.R518H|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	518	LRRNT 3.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.R518H(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GGCCTCACAGCGGCACTTGTG	0.647																																					p.R518H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1553A	10						.	C	HIS/ARG	0,4406		0,0,2203	75.0	69.0	71.0		1553	4.7	1.0	10		71	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLIT1	NM_003061.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	518/1535	98807528	1,13005	2203	4300	6503	98797518	SO:0001583	missense	6585	exon16			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1553G>A	10.37:g.98807528C>T	ENSP00000266058:p.Arg518His		98797518	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.360998	0.82353	0.0	1.16E-4	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;D	0.95885	-3.84;-3.84;-3.84	4.73	4.73	0.59995	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95551	0.8554	M	0.66439	2.03	0.80722	D	1	B;D	0.63046	0.377;0.992	B;P	0.49502	0.093;0.613	D	0.94662	0.7849	10	0.33141	T	0.24	.	17.8954	0.88886	0.0:1.0:0.0:0.0	.	528;518	E7EWQ8;O75093	.;SLIT1_HUMAN	H	518;528;518;511	ENSP00000266058:R518H;ENSP00000360109:R518H;ENSP00000315005:R511H	ENSP00000266058:R518H	R	-	2	0	SLIT1	98797518	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	7.097000	0.76967	2.448000	0.82819	0.462000	0.41574	CGC		0.647	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
PDZD8	118987	broad.mit.edu	37	10	119042838	119042838	+	Missense_Mutation	SNP	C	C	G			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr10:119042838C>G	ENST00000334464.5	-	5	3645	c.3406G>C	c.(3406-3408)Gac>Cac	p.D1136H	PDZD8_ENST00000482496.1_5'Flank	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	1136					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)	p.D1136H(1)		kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		GGCTGAGAGTCTATTAGTTGG	0.383																																					p.D1136H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3406C	10						.						161.0	152.0	155.0					10																	119042838		2203	4300	6503	119032828	SO:0001583	missense	118987	exon5			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.3406G>C	10.37:g.119042838C>G	ENSP00000334642:p.Asp1136His		119032828	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	37	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151119	0.38021	.	.	ENSG00000165650	ENST00000334464	D	0.86627	-2.15	5.81	4.9	0.64082	.	0.326990	0.33057	N	0.005339	T	0.81805	0.4900	N	0.19112	0.55	0.35923	D	0.831936	P	0.51351	0.944	P	0.49012	0.598	D	0.85825	0.1388	10	0.72032	D	0.01	-17.0826	9.8966	0.41322	0.0:0.7982:0.0:0.2018	.	1136	Q8NEN9	PDZD8_HUMAN	H	1136	ENSP00000334642:D1136H	ENSP00000334642:D1136H	D	-	1	0	PDZD8	119032828	0.846000	0.29590	1.000000	0.80357	0.993000	0.82548	1.676000	0.37565	2.746000	0.94184	0.655000	0.94253	GAC		0.383	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
PPIP5K2	23262	broad.mit.edu	37	5	102484941	102484941	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:102484941G>A	ENST00000358359.3	+	8	1339	c.830G>A	c.(829-831)gGa>gAa	p.G277E	PPIP5K2_ENST00000414217.1_Missense_Mutation_p.G277E|PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.G277E	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	277					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)	p.G277E(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GACAGTGAAGGAAAAGAAGTA	0.408																																					p.G277E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G830A	5						.						103.0	102.0	102.0					5																	102484941		2203	4300	6503	102512840	SO:0001583	missense	23262	exon7			AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.830G>A	5.37:g.102484941G>A	ENSP00000351126:p.Gly277Glu		102512840	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	G	33	5.198576	0.94997	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T	0.36520	1.29;1.25;1.29	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000001	T	0.70579	0.3240	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.993	T	0.78792	-0.2065	10	0.87932	D	0	.	19.0897	0.93221	0.0:0.0:1.0:0.0	.	199;277;277	D6RBU4;O43314-2;O43314	.;.;VIP2_HUMAN	E	277;199;277;277;277	ENSP00000313070:G277E;ENSP00000351126:G277E;ENSP00000416016:G277E	ENSP00000313070:G277E	G	+	2	0	PPIP5K2	102512840	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.809000	0.99208	2.569000	0.86673	0.655000	0.94253	GGA		0.408	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
FTMT	94033	broad.mit.edu	37	5	121188017	121188017	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:121188017G>A	ENST00000321339.1	+	1	368	c.359G>A	c.(358-360)cGg>cAg	p.R120Q		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	120	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.R120Q(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CACCAGTCCCGGGAGGAGACC	0.582																																					p.R120Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G359A	5						.						59.0	57.0	57.0					5																	121188017		2203	4300	6503	121215916	SO:0001583	missense	94033	exon1			BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.359G>A	5.37:g.121188017G>A	ENSP00000313691:p.Arg120Gln		121215916	NM_177478		Missense_Mutation	SNP	ENST00000321339.1	37	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845465	0.32606	.	.	ENSG00000181867	ENST00000321339	T	0.61742	0.08	3.6	1.72	0.24424	Ferritin/ribonucleotide reductase-like (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.757310	0.12053	N	0.503928	T	0.28234	0.0697	N	0.03084	-0.415	0.09310	N	0.999998	B	0.15473	0.013	B	0.14578	0.011	T	0.14476	-1.0471	10	0.35671	T	0.21	.	3.094	0.06303	0.2303:0.0:0.5471:0.2225	.	120	Q8N4E7	FTMT_HUMAN	Q	120	ENSP00000313691:R120Q	ENSP00000313691:R120Q	R	+	2	0	FTMT	121215916	0.669000	0.27502	0.066000	0.19879	0.944000	0.59088	3.858000	0.55979	0.455000	0.26910	0.655000	0.94253	CGG		0.582	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
PCDHA12	56137	broad.mit.edu	37	5	140256339	140256339	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:140256339C>T	ENST00000398631.2	+	1	1282	c.1282C>T	c.(1282-1284)Cgg>Tgg	p.R428W	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R428W(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGACTGCGCGGGATGGGGG	0.637																																					p.R428W	Pancreas(113;759 1672 13322 24104 50104)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1282T	5						.						158.0	162.0	161.0					5																	140256339		2203	4300	6503	140236523	SO:0001583	missense	56137	exon1			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1282C>T	5.37:g.140256339C>T	ENSP00000381628:p.Arg428Trp		140236523	NM_031864	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	C	9.650	1.141217	0.21205	.	.	ENSG00000251664	ENST00000398631	T	0.01804	4.63	4.96	-0.91	0.10511	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01940	0.0061	N	0.13327	0.33	0.09310	N	1	P;P	0.43094	0.586;0.799	B;P	0.49708	0.133;0.62	T	0.49908	-0.8889	9	0.87932	D	0	.	5.3836	0.16206	0.4642:0.3574:0.104:0.0744	.	428;428	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	W	428	ENSP00000381628:R428W	ENSP00000381628:R428W	R	+	1	2	PCDHA12	140236523	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.867000	0.00346	-0.080000	0.12685	-0.345000	0.07892	CGG		0.637	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
CDH9	1007	broad.mit.edu	37	5	26906107	26906107	+	Missense_Mutation	SNP	G	G	T			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:26906107G>T	ENST00000231021.4	-	5	944	c.772C>A	c.(772-774)Ctg>Atg	p.L258M		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	258	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L258M(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ACATCTGTCAGCGTGATGTTC	0.463																																					p.L258M	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C772A	5						.						248.0	227.0	234.0					5																	26906107		2203	4300	6503	26941864	SO:0001583	missense	1007	exon5			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.772C>A	5.37:g.26906107G>T	ENSP00000231021:p.Leu258Met		26941864	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338216	0.81911	.	.	ENSG00000113100	ENST00000231021	T	0.56275	0.47	5.6	4.71	0.59529	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.76652	0.4017	M	0.93808	3.46	0.51482	D	0.99992	D	0.54047	0.964	P	0.61328	0.887	T	0.82448	-0.0452	9	.	.	.	.	14.1793	0.65564	0.077:0.0:0.923:0.0	.	258	Q9ULB4	CADH9_HUMAN	M	258	ENSP00000231021:L258M	.	L	-	1	2	CDH9	26941864	1.000000	0.71417	0.956000	0.39512	0.958000	0.62258	4.817000	0.62650	2.802000	0.96397	0.650000	0.86243	CTG		0.463	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
C5orf42	65250	broad.mit.edu	37	5	37121812	37121812	+	Missense_Mutation	SNP	G	G	A			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:37121812G>A	ENST00000508244.1	-	47	9023	c.8930C>T	c.(8929-8931)tCa>tTa	p.S2977L	C5orf42_ENST00000512288.1_5'UTR|C5orf42_ENST00000274258.7_Missense_Mutation_p.S1875L|C5orf42_ENST00000425232.2_Missense_Mutation_p.S2977L			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2977						integral component of membrane (GO:0016021)		p.S2977L(1)|p.S1875L(1)		breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TAGCTGTACTGACTCAGATAA	0.448																																					p.S2977L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C8930T	5						.						310.0	272.0	285.0					5																	37121812		2203	4300	6503	37157569	SO:0001583	missense	65250	exon48				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.8930C>T	5.37:g.37121812G>A	ENSP00000421690:p.Ser2977Leu		37157569	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	G	37	6.171485	0.97343	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.28	5.28	0.74379	.	0.239166	0.29403	N	0.012243	T	0.71048	0.3294	M	0.72118	2.19	0.24876	N	0.992258	D;D	0.89917	0.996;1.0	P;D	0.83275	0.906;0.996	T	0.65500	-0.6153	10	0.87932	D	0	.	14.4287	0.67233	0.0:0.0:1.0:0.0	.	2977;1875	E9PH94;Q9H799	.;CE042_HUMAN	L	2977;2977;1875;2043	ENSP00000421690:S2977L;ENSP00000389014:S2977L;ENSP00000274258:S1875L;ENSP00000424223:S2043L	ENSP00000274258:S1875L	S	-	2	0	C5orf42	37157569	0.996000	0.38824	0.293000	0.24932	0.925000	0.55904	5.045000	0.64220	2.470000	0.83445	0.591000	0.81541	TCA		0.448	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
LIFR	3977	broad.mit.edu	37	5	38482732	38482732	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:38482732C>A	ENST00000263409.4	-	19	2791	c.2629G>T	c.(2629-2631)Gaa>Taa	p.E877*	LIFR_ENST00000453190.2_Nonsense_Mutation_p.E877*	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	877					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.E877*(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TTACAGTTTTCTGGATTTGGA	0.234			T	PLAG1	salivary adenoma																																p.E877X	Melanoma(13;4 730 6426 9861 34751)		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G2629T	5						.						41.0	51.0	48.0					5																	38482732		2183	4254	6437	38518489	SO:0001587	stop_gained	3977	exon19			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2629G>T	5.37:g.38482732C>A	ENSP00000263409:p.Glu877*		38518489	NM_001127671	Q6LCD9	Nonsense_Mutation	SNP	ENST00000263409.4	37	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	41	8.669285	0.98908	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	6.07	6.07	0.98685	.	0.217657	0.48767	D	0.000171	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-37.2953	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	877	.	ENSP00000263409:E877X	E	-	1	0	LIFR	38518489	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.359000	0.66074	2.885000	0.99019	0.655000	0.94253	GAA		0.234	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
MROH2B	133558	broad.mit.edu	37	5	41007469	41007469	+	Missense_Mutation	SNP	C	C	G	rs200376875		TCGA-AF-3913-01	TCGA-AF-3913-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:41007469C>G	ENST00000399564.4	-	34	4146	c.3696G>C	c.(3694-3696)tgG>tgC	p.W1232C	MROH2B_ENST00000506092.2_Missense_Mutation_p.W787C	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1232								p.W1232C(1)									TGAGTAGAGTCCATAAGTTGT	0.438																																					p.W1232C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3696C	5						.						70.0	67.0	68.0					5																	41007469		1888	4110	5998	41043226	SO:0001583	missense	133558	exon34				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.3696G>C	5.37:g.41007469C>G	ENSP00000382476:p.Trp1232Cys		41043226	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	37	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359979	0.61403	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.04706	3.57;3.82	6.08	6.08	0.98989	Armadillo-type fold (1);	0.000000	0.64402	D	0.000019	T	0.22437	0.0541	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00007	-1.2504	10	0.87932	D	0	.	16.1635	0.81734	0.0:1.0:0.0:0.0	.	1232	Q7Z745	HTRB2_HUMAN	C	787;937;1232	ENSP00000441504:W787C;ENSP00000382476:W1232C	ENSP00000296803:W937C	W	-	3	0	HEATR7B2	41043226	0.991000	0.36638	0.943000	0.38184	0.708000	0.40852	3.458000	0.53014	2.894000	0.99253	0.655000	0.94253	TGG		0.438	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
RASGRF2	5924	broad.mit.edu	37	5	80476046	80476046	+	Silent	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:80476046G>C	ENST00000265080.4	+	18	2806	c.2739G>C	c.(2737-2739)acG>acC	p.T913T		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	913					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T913T(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TACGGAGAACGGCTACCAATC	0.423																																					p.T913T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2739C	5						.						155.0	148.0	150.0					5																	80476046		2203	4300	6503	80511802	SO:0001819	synonymous_variant	5924	exon18			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.2739G>C	5.37:g.80476046G>C			80511802	NM_006909	B9EG89|Q9UK56	Silent	SNP	ENST00000265080.4	37	CCDS4052.1																																																																																				0.423	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
APC	324	broad.mit.edu	37	5	112175246	112175246	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AF-3913-01	TCGA-AF-3913-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:112175246delC	ENST00000457016.1	+	16	4335	c.3955delC	c.(3955-3957)cctfs	p.P1319fs	APC_ENST00000257430.4_Frame_Shift_Del_p.P1319fs|APC_ENST00000508376.2_Frame_Shift_Del_p.P1319fs|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1319	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P1319fs*2(1)|p.P1319T(1)|p.K1192fs*3(1)|p.?(1)|p.A1316fs*9(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCTGAAGATCCTGTGAGCGA	0.443		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.P1301fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,central_nervous_system,cerebellum,Substitution - Missense,-1	.	5	Deletion - Frameshift(3)|Substitution - Missense(1)|Unknown(1)	large_intestine(2)|soft_tissue(1)|liver(1)|skin(1)	c.3901delC	5						.						61.0	63.0	62.0					5																	112175246		2202	4300	6502	112203145	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3955delC	5.37:g.112175246delC	ENSP00000413133:p.Pro1319fs		112203145	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.443	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
RUFY1	80230	broad.mit.edu	37	5	179020615	179020615	+	Missense_Mutation	SNP	C	C	T			TCGA-AF-3913-01	TCGA-AF-3913-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr5:179020615C>T	ENST00000319449.4	+	11	1394	c.1382C>T	c.(1381-1383)gCg>gTg	p.A461V	RP11-1379J22.2_ENST00000500262.1_RNA|RUFY1_ENST00000393438.2_Missense_Mutation_p.A353V|RUFY1_ENST00000377001.2_3'UTR|RUFY1_ENST00000437570.2_Missense_Mutation_p.A353V	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	461					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.A353V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGTCAAAGCGATTAATTTA	0.478										HNSCC(44;0.11)																											p.A461V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1382T	5						.						98.0	103.0	101.0					5																	179020615		2203	4300	6503	178953221	SO:0001583	missense	80230	exon11			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1382C>T	5.37:g.179020615C>T	ENSP00000325594:p.Ala461Val		178953221	NM_025158	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.57|11.57	1.678595|1.678595	0.29783|0.29783	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000319449;ENST00000437570;ENST00000393438;ENST00000360569|ENST00000508609	T;T;T|.	0.55052|.	0.54;0.6;0.6|.	4.95|4.95	3.11|3.11	0.35812|0.35812	.|.	0.377601|.	0.32386|.	N|.	0.006170|.	T|.	0.50411|.	0.1614|.	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P|.	0.41748|.	0.761|.	B|.	0.35073|.	0.195|.	T|.	0.34054|.	-0.9844|.	10|.	0.44086|.	T|.	0.13|.	-2.9847|-2.9847	9.7858|9.7858	0.40675|0.40675	0.1396:0.7867:0.0:0.0736|0.1396:0.7867:0.0:0.0736	.|.	461|.	Q96T51|.	RUFY1_HUMAN|.	V|X	461;353;353;63|250	ENSP00000325594:A461V;ENSP00000390025:A353V;ENSP00000377087:A353V|.	ENSP00000325594:A461V|.	A|R	+|+	2|1	0|2	RUFY1|RUFY1	178953221|178953221	1.000000|1.000000	0.71417|0.71417	0.510000|0.510000	0.27712|0.27712	0.002000|0.002000	0.02628|0.02628	4.463000|4.463000	0.60128|0.60128	0.564000|0.564000	0.29238|0.29238	-0.291000|-0.291000	0.09656|0.09656	GCG|CGA		0.478	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451	
TP73-AS1	57212	broad.mit.edu	37	1	3662495	3662495	+	RNA	SNP	G	G	C			TCGA-AF-3913-01	TCGA-AF-3913-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AF-3913-01	TCGA-AF-3913-01	g.chr1:3662495G>C	ENST00000452079.1	-	0	1391				TP73-AS1_ENST00000418088.1_RNA|TP73-AS1_ENST00000544565.1_RNA|TP73-AS1_ENST00000423764.1_RNA|TP73-AS1_ENST00000608600.1_RNA	NR_033711.1		Q9UF72	T73AS_HUMAN	TP73 antisense RNA 1							extracellular region (GO:0005576)											TCTTTACTTGGAAAGCAGGAA	0.592																																					.												.	.	0			.	1						.						65.0	73.0	71.0					1																	3662495		2068	4213	6281	3652355			57212	.					1p36.32	2014-01-20	2014-01-20	2014-01-20	ENSG00000227372	ENSG00000227372		"""Long non-coding RNAs"""	29052	non-coding RNA	RNA, long non-coding	"""p53-dependent apoptosis modulator"""		"""KIAA0495"""	KIAA0495		9455484, 20477830, 23726844	Standard	NR_033708		Approved	PDAM	uc009vlm.3	Q9UF72	OTTHUMG00000003414		1.37:g.3662495G>C			3652355	.		Missense_Mutation	SNP	ENST00000452079.1	37																																																																																					0.592	TP73-AS1-003	KNOWN	basic	antisense	antisense	OTTHUMT00000009558.1	NR_033708	
