#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MOGAT3	346606	hgsc.bcm.edu	37	7	100839608	100839608	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr7:100839608G>T	ENST00000223114.4	-	6	897	c.731C>A	c.(730-732)gCc>gAc	p.A244D	MOGAT3_ENST00000379423.3_Intron|MOGAT3_ENST00000440203.2_Missense_Mutation_p.A244D	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	244					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.A244D(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					GGAGCCTGTGGCAAAAGCCTT	0.577																																					p.A244D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C731A	7						.						42.0	46.0	45.0					7																	100839608		2203	4300	6503	100626328	SO:0001583	missense	346606	exon6			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.731C>A	7.37:g.100839608G>T	ENSP00000223114:p.Ala244Asp		100626328	NM_178176	Q496A6|Q496A7|Q496A8|Q9UDW7	Missense_Mutation	SNP	ENST00000223114.4	37	CCDS5714.1	.	.	.	.	.	.	.	.	.	.	G	7.391	0.630703	0.14322	.	.	ENSG00000106384	ENST00000223114;ENST00000440203	T;T	0.12039	2.72;2.72	4.83	2.92	0.33932	.	0.802766	0.11371	N	0.570828	T	0.07143	0.0181	N	0.05608	-0.01	0.09310	N	1	B	0.12630	0.006	B	0.14578	0.011	T	0.22277	-1.0221	10	0.33141	T	0.24	-3.4709	8.8231	0.35039	0.0:0.1693:0.677:0.1537	.	244	Q86VF5	MOGT3_HUMAN	D	244	ENSP00000223114:A244D;ENSP00000403756:A244D	ENSP00000223114:A244D	A	-	2	0	MOGAT3	100626328	0.000000	0.05858	0.003000	0.11579	0.045000	0.14185	0.050000	0.14120	2.216000	0.71823	0.650000	0.86243	GCC		0.577	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176	
GMFB	2764	hgsc.bcm.edu	37	14	54950418	54950418	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr14:54950418C>A	ENST00000358056.3	-	2	339	c.71G>T	c.(70-72)cGc>cTc	p.R24L	GMFB_ENST00000553566.1_5'UTR|GMFB_ENST00000554908.1_Missense_Mutation_p.R24L	NM_004124.2	NP_004115.1	P60983	GMFB_HUMAN	glia maturation factor, beta	24	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of protein kinase activity (GO:0006469)|nervous system development (GO:0007399)|positive regulation of catalytic activity (GO:0043085)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	intracellular (GO:0005622)	enzyme activator activity (GO:0008047)|protein kinase inhibitor activity (GO:0004860)|signal transducer activity (GO:0004871)	p.R24L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)	8						CGTTTCTTTGCGAAAACGAAA	0.333																																					p.R24L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G71T	14						.						83.0	72.0	76.0					14																	54950418		2202	4300	6502	54020168	SO:0001583	missense	2764	exon2			M86492	CCDS9718.1	14q22.2	2010-07-06			ENSG00000197045	ENSG00000197045			4373	protein-coding gene	gene with protein product		601713				1712830	Standard	NM_004124		Approved	GMF	uc021rtf.1	P60983	OTTHUMG00000140307	ENST00000358056.3:c.71G>T	14.37:g.54950418C>A	ENSP00000350757:p.Arg24Leu		54020168	NM_004124	B2R499|P17774|Q9BS35	Missense_Mutation	SNP	ENST00000358056.3	37	CCDS9718.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046402	0.93740	.	.	ENSG00000197045	ENST00000554908;ENST00000358056;ENST00000354747;ENST00000553333	T;T	0.32753	1.44;1.44	5.44	5.44	0.79542	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	T	0.57315	0.2045	M	0.77616	2.38	0.80722	D	1	P	0.41569	0.755	P	0.59288	0.855	T	0.55872	-0.8072	10	0.54805	T	0.06	-15.3782	18.5988	0.91240	0.0:1.0:0.0:0.0	.	24	P60983	GMFB_HUMAN	L	24;24;24;36	ENSP00000350757:R24L;ENSP00000451920:R36L	ENSP00000346789:R24L	R	-	2	0	GMFB	54020168	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.265000	0.78442	2.714000	0.92807	0.585000	0.79938	CGC		0.333	GMFB-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276903.2	NM_004124	
MAP3K9	4293	hgsc.bcm.edu	37	14	71199547	71199547	+	Missense_Mutation	SNP	G	G	A	rs140360648		TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr14:71199547G>A	ENST00000554752.2	-	11	2538	c.2539C>T	c.(2539-2541)Cgc>Tgc	p.R847C	MAP3K9_ENST00000555993.2_Missense_Mutation_p.R861C|MAP3K9_ENST00000553414.1_Missense_Mutation_p.R580C|MAP3K9_ENST00000381250.4_Missense_Mutation_p.R824C|MAP3K9_ENST00000554146.1_Missense_Mutation_p.R575C	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	847					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R861C(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		AGCAGGGAGCGTGTGGAGTTG	0.592																																					p.R861C	GBM(114;411 1587 13539 28235 50070)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2581T	14						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	64.0	58.0	60.0		2581	4.6	1.0	14	dbSNP_134	60	0,8600		0,0,4300	no	missense	MAP3K9	NM_033141.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	861/1119	71199547	1,13005	2203	4300	6503	70269300	SO:0001583	missense	4293	exon12			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.2539C>T	14.37:g.71199547G>A	ENSP00000451612:p.Arg847Cys		70269300	NM_033141	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	37		.	.	.	.	.	.	.	.	.	.	G	19.48	3.835040	0.71373	2.27E-4	0.0	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.79940	-1.28;-1.32;-1.25;-1.29	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.87026	0.6075	L	0.54323	1.7	0.58432	D	0.999993	D;D;D;D	0.89917	0.999;0.998;0.999;1.0	P;P;P;D	0.67103	0.862;0.623;0.897;0.949	D	0.88471	0.3062	10	0.72032	D	0.01	.	17.6702	0.88214	0.0:0.0:1.0:0.0	.	575;847;861;580	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	C	847;861;580;824;575;563	ENSP00000451612:R847C;ENSP00000451038:R580C;ENSP00000370649:R824C;ENSP00000451921:R575C	ENSP00000005198:R861C	R	-	1	0	MAP3K9	70269300	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	4.332000	0.59279	2.397000	0.81536	0.561000	0.74099	CGC		0.592	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
LARGE	9215	hgsc.bcm.edu	37	22	34000485	34000485	+	Missense_Mutation	SNP	G	G	A	rs138676820	byFrequency	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr22:34000485G>A	ENST00000354992.2	-	6	1122	c.551C>T	c.(550-552)aCg>aTg	p.T184M	LARGE_ENST00000402320.1_Missense_Mutation_p.T184M|LARGE_ENST00000397394.2_Missense_Mutation_p.T184M|LARGE_ENST00000437602.2_Missense_Mutation_p.T184M|LARGE_ENST00000337431.2_Missense_Mutation_p.T184M	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	184					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.T184M(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CTGGAAGAGCGTGGCCAGGAT	0.582													G|||	2	0.000399361	0.0	0.0	5008	,	,		19556	0.002		0.0	False		,,,				2504	0.0				p.T184M	Colon(70;397 1175 4573 19089 45288)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C551T	22						.	G	MET/THR,MET/THR	0,4406		0,0,2203	152.0	125.0	134.0		551,551	5.8	1.0	22	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LARGE	NM_004737.4,NM_133642.3	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	184/757,184/757	34000485	1,13005	2203	4300	6503	32330485	SO:0001583	missense	9215	exon5			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.551C>T	22.37:g.34000485G>A	ENSP00000347088:p.Thr184Met		32330485	NM_133642	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	ENST00000354992.2	37	CCDS13912.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125012	0.56721	0.0	1.16E-4	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000437602	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.79	5.79	0.91817	.	0.209207	0.50627	D	0.000109	T	0.44829	0.1312	M	0.69358	2.11	0.80722	D	1	P;P;P	0.44946	0.694;0.794;0.846	B;B;B	0.37888	0.223;0.26;0.149	T	0.50550	-0.8815	10	0.54805	T	0.06	-2.9973	18.7926	0.91980	0.0:0.0:1.0:0.0	.	184;184;184	B7Z2I9;O95461-2;O95461	.;.;LARGE_HUMAN	M	184	ENSP00000347088:T184M;ENSP00000336636:T184M;ENSP00000380549:T184M;ENSP00000385223:T184M;ENSP00000388544:T184M	ENSP00000336636:T184M	T	-	2	0	LARGE	32330485	0.991000	0.36638	0.959000	0.39883	0.998000	0.95712	3.390000	0.52523	2.735000	0.93741	0.561000	0.74099	ACG		0.582	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
ZNF420	147923	hgsc.bcm.edu	37	19	37618514	37618514	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr19:37618514C>A	ENST00000337995.3	+	5	836	c.621C>A	c.(619-621)agC>agA	p.S207R	ZNF585A_ENST00000588723.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA|ZNF420_ENST00000304239.7_Missense_Mutation_p.S207R	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	207					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S207R(1)		breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTACTCAAAGCTCACAACTTA	0.398																																					p.S207R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C621A	19						.						53.0	55.0	55.0					19																	37618514		2203	4300	6503	42310354	SO:0001583	missense	147923	exon5			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.621C>A	19.37:g.37618514C>A	ENSP00000338770:p.Ser207Arg		42310354	NM_144689	B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	37	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	C	3.655	-0.070696	0.07228	.	.	ENSG00000197050	ENST00000304239;ENST00000337995	T;T	0.06768	3.26;3.26	3.65	-0.0537	0.13816	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02929	0.0087	N	0.05574	-0.02	0.09310	N	0.999999	B	0.09022	0.002	B	0.04013	0.001	T	0.46871	-0.9160	9	0.12103	T	0.63	.	1.1725	0.01829	0.1737:0.4394:0.1702:0.2167	.	207	Q8TAQ5	ZN420_HUMAN	R	207	ENSP00000306102:S207R;ENSP00000338770:S207R	ENSP00000306102:S207R	S	+	3	2	ZNF420	42310354	0.000000	0.05858	0.987000	0.45799	0.985000	0.73830	-3.132000	0.00590	0.238000	0.21222	-0.150000	0.13652	AGC		0.398	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689	
SLC8A2	6543	hgsc.bcm.edu	37	19	47969377	47969377	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr19:47969377G>A	ENST00000236877.6	-	2	679	c.284C>T	c.(283-285)gCg>gTg	p.A95V	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	95					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)	p.A95V(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CTCGATGGCCGCCATGAAACG	0.582																																					p.A95V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C284T	19						.						125.0	84.0	98.0					19																	47969377		2203	4300	6503	52661189	SO:0001583	missense	6543	exon2			AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.284C>T	19.37:g.47969377G>A	ENSP00000236877:p.Ala95Val		52661189	NM_015063	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	37	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944860	0.92593	.	.	ENSG00000118160	ENST00000236877	T	0.63744	-0.06	4.25	4.25	0.50352	Sodium/calcium exchanger membrane region (1);	0.062961	0.64402	D	0.000007	T	0.79730	0.4496	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.70016	0.967	D	0.83859	0.0267	10	0.87932	D	0	.	15.6004	0.76620	0.0:0.0:1.0:0.0	.	95	Q9UPR5	NAC2_HUMAN	V	95	ENSP00000236877:A95V	ENSP00000236877:A95V	A	-	2	0	SLC8A2	52661189	1.000000	0.71417	0.935000	0.37517	0.950000	0.60333	9.587000	0.98229	2.210000	0.71456	0.462000	0.41574	GCG		0.582	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
C3	718	hgsc.bcm.edu	37	19	6678219	6678221	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	CTC	CTC	CTC	-	CTC	CTC	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr19:6678219_6678221delCTC	ENST00000245907.6	-	40	4884_4886	c.4792_4794delGAG	c.(4792-4794)gagdel	p.E1598del	C3_ENST00000599668.1_5'UTR	NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1598	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)	p.E1598delE(1)		breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AGTGTTTCTTCTCCTCCAGCTTC	0.616																																					p.1598_1598del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.4792_4794del	19						.																																			6629221	SO:0001651	inframe_deletion	718	exon40			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.4792_4794delGAG	19.37:g.6678222_6678224delCTC	ENSP00000245907:p.Glu1598del		6629219	NM_000064	A7E236	In_Frame_Del	DEL	ENST00000245907.6	37	CCDS32883.1																																																																																				0.616	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
LILRB2	10288	hgsc.bcm.edu	37	19	54783718	54783718	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr19:54783718G>A	ENST00000391749.4	-	4	554	c.283C>T	c.(283-285)Cga>Tga	p.R95*	MIR4752_ENST00000579672.1_RNA|LILRB2_ENST00000391748.1_Nonsense_Mutation_p.R95*|LILRB2_ENST00000391746.1_Nonsense_Mutation_p.R95*|LILRB2_ENST00000471216.1_5'UTR|LILRB2_ENST00000314446.5_Nonsense_Mutation_p.R95*|LILRB2_ENST00000434421.1_5'UTR	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	95	Ig-like C2-type 1.				cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)	p.R95*(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGCCATATCGCCCTGTGTGT	0.552																																					p.R95X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C283T	19						.						177.0	168.0	171.0					19																	54783718		2203	4300	6503	59475530	SO:0001587	stop_gained	10288	exon4			AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.283C>T	19.37:g.54783718G>A	ENSP00000375629:p.Arg95*		59475530	NM_001080978	A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Nonsense_Mutation	SNP	ENST00000391749.4	37	CCDS12886.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093368	0.56075	.	.	ENSG00000131042	ENST00000391748;ENST00000314446;ENST00000391749;ENST00000391746	.	.	.	1.76	-0.909	0.10514	.	1.592300	0.04262	N	0.340541	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.8451	0.08931	0.0:0.273:0.4491:0.2779	.	.	.	.	X	95	.	ENSP00000319960:R95X	R	-	1	2	LILRB2	59475530	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.741000	0.01837	-0.094000	0.12374	0.289000	0.19496	CGA		0.552	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139510.1		
DKK4	27121	hgsc.bcm.edu	37	8	42233224	42233224	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr8:42233224C>G	ENST00000220812.2	-	2	422	c.236G>C	c.(235-237)tGc>tCc	p.C79S		NM_014420.2	NP_055235.1	Q9UBT3	DKK4_HUMAN	dickkopf WNT signaling pathway inhibitor 4	79	DKK-type Cys-1.				multicellular organismal development (GO:0007275)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)		p.C79S(1)		NS(1)|endometrium(1)|large_intestine(7)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)			CCCAGGGCAGCACATGGCATC	0.537																																					p.C79S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G236C	8						.						113.0	93.0	100.0					8																	42233224		2203	4300	6503	42352381	SO:0001583	missense	27121	exon2			AF177397	CCDS6130.1	8p11.2-p11.1	2013-05-15	2013-05-15		ENSG00000104371	ENSG00000104371			2894	protein-coding gene	gene with protein product		605417	"""dickkopf (Xenopus laevis) homolog 4"", ""dickkopf homolog 4 (Xenopus laevis)"""			10570958, 11701963	Standard	NM_014420		Approved		uc003xpb.3	Q9UBT3	OTTHUMG00000164167	ENST00000220812.2:c.236G>C	8.37:g.42233224C>G	ENSP00000220812:p.Cys79Ser		42352381	NM_014420	Q3KNX0|Q9Y4C3	Missense_Mutation	SNP	ENST00000220812.2	37	CCDS6130.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.595072	0.86953	.	.	ENSG00000104371	ENST00000543914;ENST00000220812	T	0.64991	-0.13	5.2	5.2	0.72013	Dickkopf, N-terminal cysteine-rich (1);	0.184843	0.39146	N	0.001460	T	0.80919	0.4716	M	0.84326	2.69	0.46564	D	0.999101	D	0.89917	1.0	D	0.91635	0.999	D	0.83760	0.0214	10	0.87932	D	0	-7.3548	16.5637	0.84573	0.0:1.0:0.0:0.0	.	79	Q9UBT3	DKK4_HUMAN	S	79	ENSP00000220812:C79S	ENSP00000220812:C79S	C	-	2	0	DKK4	42352381	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	6.738000	0.74822	2.567000	0.86603	0.491000	0.48974	TGC		0.537	DKK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377563.1		
FLG	2312	hgsc.bcm.edu	37	1	152282747	152282747	+	Missense_Mutation	SNP	T	T	G	rs536230632		TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr1:152282747T>G	ENST00000368799.1	-	3	4650	c.4615A>C	c.(4615-4617)Agt>Cgt	p.S1539R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1539	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1539R(2)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGCACTTCTGGGTCCT	0.572									Ichthyosis				T|||	1	0.000199681	0.0	0.0	5008	,	,		20676	0.0		0.0	False		,,,				2504	0.001				p.S1539R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.A4615C	1						.						303.0	293.0	296.0					1																	152282747		2203	4300	6503	150549371	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4615A>C	1.37:g.152282747T>G	ENSP00000357789:p.Ser1539Arg		150549371	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203497	0.22121	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	2.67	-0.792	0.10925	.	.	.	.	.	T	0.00784	0.0026	M	0.75447	2.3	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.42050	-0.9474	9	0.25106	T	0.35	.	5.1967	0.15243	0.0:0.4182:0.0:0.5818	.	1539	P20930	FILA_HUMAN	R	1539	ENSP00000357789:S1539R	ENSP00000357789:S1539R	S	-	1	0	FLG	150549371	0.003000	0.15002	0.000000	0.03702	0.169000	0.22640	0.226000	0.17776	-0.281000	0.09141	0.397000	0.26171	AGT		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
TADA1	117143	hgsc.bcm.edu	37	1	166833127	166833127	+	Silent	SNP	A	A	G			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr1:166833127A>G	ENST00000367874.4	-	4	357	c.264T>C	c.(262-264)ggT>ggC	p.G88G	TADA1_ENST00000467021.1_5'Flank	NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	88					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.G88G(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						TTGCTGCGGAACCCCCTGGCC	0.378																																					p.G88G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T264C	1						.						76.0	81.0	79.0					1																	166833127		2203	4300	6503	165099751	SO:0001819	synonymous_variant	117143	exon4			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.264T>C	1.37:g.166833127A>G			165099751	NM_053053	A8K4J9	Silent	SNP	ENST00000367874.4	37	CCDS1255.1																																																																																				0.378	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082881.1	NM_053053	
PINK1	65018	hgsc.bcm.edu	37	1	20977046	20977046	+	Silent	SNP	C	C	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr1:20977046C>T	ENST00000321556.4	+	8	1702	c.1608C>T	c.(1606-1608)gcC>gcT	p.A536A	PINK1_ENST00000492302.1_3'UTR|PINK1-AS_ENST00000451424.1_RNA	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1	536					activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.A536A(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AACAATCGGCCGCCACTTTGT	0.493																																					p.A536A	Esophageal Squamous(145;853 1803 8146 34412 35011)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1608T	1						.						70.0	64.0	66.0					1																	20977046		2203	4300	6503	20849633	SO:0001819	synonymous_variant	65018	exon8			AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.1608C>T	1.37:g.20977046C>T			20849633	NM_032409	Q8N6T9|Q8NBU3|Q96DE4	Silent	SNP	ENST00000321556.4	37	CCDS211.1																																																																																				0.493	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007954.1	NM_032409	
CRB1	23418	hgsc.bcm.edu	37	1	197446800	197446800	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr1:197446800G>T	ENST00000367400.3	+	12	4147	c.4012G>T	c.(4012-4014)Gat>Tat	p.D1338Y	CRB1_ENST00000538660.1_Missense_Mutation_p.D802Y|CRB1_ENST00000367399.2_Missense_Mutation_p.D1226Y|CRB1_ENST00000544212.1_Missense_Mutation_p.D819Y|CRB1_ENST00000535699.1_Missense_Mutation_p.D1314Y	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1338					cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1338Y(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CCAGTTGGCAGATGACTTGAT	0.433																																					p.D1338Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4012T	1						.						83.0	71.0	75.0					1																	197446800		2203	4300	6503	195713423	SO:0001583	missense	23418	exon12				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.4012G>T	1.37:g.197446800G>T	ENSP00000356370:p.Asp1338Tyr		195713423	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145939	0.37923	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000544212	D;D;D;D;D	0.95656	-3.77;-3.77;-3.77;-3.77;-3.77	5.92	5.0	0.66597	.	.	.	.	.	D	0.94414	0.8203	L	0.56124	1.755	0.50313	D	0.999866	P;P;P;P	0.47253	0.57;0.892;0.892;0.828	B;P;B;B	0.47251	0.235;0.542;0.413;0.293	D	0.94109	0.7369	9	0.72032	D	0.01	.	11.2422	0.48977	0.1903:0.0:0.8097:0.0	.	802;1314;1226;1338	B7Z5T2;F5H0L2;P82279-3;P82279	.;.;.;CRUM1_HUMAN	Y	1314;802;1338;1226;819	ENSP00000438786:D1314Y;ENSP00000438091:D802Y;ENSP00000356370:D1338Y;ENSP00000356369:D1226Y;ENSP00000444556:D819Y	ENSP00000356369:D1226Y	D	+	1	0	CRB1	195713423	1.000000	0.71417	0.317000	0.25265	0.018000	0.09664	3.469000	0.53093	1.492000	0.48499	0.650000	0.86243	GAT		0.433	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
KIAA1804	84451	hgsc.bcm.edu	37	1	233482260	233482260	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr1:233482260C>T	ENST00000366624.3	+	2	1139	c.878C>T	c.(877-879)gCg>gTg	p.A293V	MLK4_ENST00000366623.3_Missense_Mutation_p.A293V	NM_032435.2	NP_115811.2												p.A293V(1)									TTTGGGTTGGCGAGGGAATGG	0.428																																					p.A293V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C878T	1						.						92.0	88.0	90.0					1																	233482260		2203	4300	6503	231548883	SO:0001583	missense	84451	exon2																														ENST00000366624.3:c.878C>T	1.37:g.233482260C>T	ENSP00000355583:p.Ala293Val		231548883	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973935	0.92919	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	D;D	0.91740	-2.9;-2.9	4.49	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95915	0.8670	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.96575	0.9426	10	0.87932	D	0	.	17.3739	0.87386	0.0:1.0:0.0:0.0	.	293;293	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	V	293	ENSP00000355582:A293V;ENSP00000355583:A293V	ENSP00000355582:A293V	A	+	2	0	RP5-862P8.2	231548883	1.000000	0.71417	0.102000	0.21198	0.965000	0.64279	7.645000	0.83430	2.319000	0.78375	0.563000	0.77884	GCG		0.428	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
MRE11A	4361	hgsc.bcm.edu	37	11	94180584	94180584	+	Silent	SNP	T	T	C			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr11:94180584T>C	ENST00000323929.3	-	15	1806	c.1584A>G	c.(1582-1584)gcA>gcG	p.A528A	MRE11A_ENST00000393241.4_Silent_p.A528A|MRE11A_ENST00000407439.3_Silent_p.A531A|MRE11A_ENST00000323977.3_Silent_p.A528A	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	528					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.A528A(2)		breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				GAGATCTGAGTGCTCTGGCCC	0.423								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																												p.A528A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1584G	11						.						84.0	77.0	79.0					11																	94180584		2201	4298	6499	93820232	SO:0001819	synonymous_variant	4361	exon15	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.1584A>G	11.37:g.94180584T>C			93820232	NM_005591	O43475	Silent	SNP	ENST00000323929.3	37	CCDS8299.1																																																																																				0.423	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591	
VARS2	57176	hgsc.bcm.edu	37	6	30886629	30886629	+	Silent	SNP	A	A	C	rs190268810		TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr6:30886629A>C	ENST00000321897.5	+	10	1643	c.1011A>C	c.(1009-1011)acA>acC	p.T337T	VARS2_ENST00000541562.1_Silent_p.T367T|VARS2_ENST00000416670.2_Silent_p.T337T|VARS2_ENST00000542001.1_Silent_p.T197T			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	337			T -> I (in COXPD20; decreased levels of the protein). {ECO:0000269|PubMed:24827421}.		gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)	p.T337T(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						TAGGAACCACAAGGCCAGAGA	0.532																																					p.T197T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A591C	6						.						100.0	83.0	89.0					6																	30886629		1510	2708	4218	30994608	SO:0001819	synonymous_variant	57176	exon10			AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.1011A>C	6.37:g.30886629A>C			30994608	NM_001167733	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Silent	SNP	ENST00000321897.5	37	CCDS34387.1																																																																																				0.532	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
SLC22A16	85413	hgsc.bcm.edu	37	6	110746109	110746109	+	Silent	SNP	C	C	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr6:110746109C>T	ENST00000368919.3	-	8	1767	c.1701G>A	c.(1699-1701)gcG>gcA	p.A567A	SLC22A16_ENST00000330550.4_Silent_p.A533A	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	567					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.A567A(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	TGGGGGTAATCGCTTCCGTTT	0.428																																					p.A567A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1701A	6						.						147.0	138.0	141.0					6																	110746109		2203	4300	6503	110852802	SO:0001819	synonymous_variant	85413	exon8				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.1701G>A	6.37:g.110746109C>T			110852802	NM_033125	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Silent	SNP	ENST00000368919.3	37	CCDS5084.1																																																																																				0.428	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043428.1	NM_033125	
EFTUD2	9343	hgsc.bcm.edu	37	17	42942346	42942346	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr17:42942346G>A	ENST00000426333.2	-	14	1534	c.1237C>T	c.(1237-1239)Cgc>Tgc	p.R413C	EFTUD2_ENST00000402521.3_Missense_Mutation_p.R378C|EFTUD2_ENST00000591382.1_Missense_Mutation_p.R413C|EFTUD2_ENST00000592576.1_Missense_Mutation_p.R403C	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	413					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.R413C(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				AGCAAGGGGCGGATGTTCAGC	0.562											OREG0024466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R413C	Ovarian(10;65 485 10258 29980 30707)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1237T	17						.						168.0	145.0	153.0					17																	42942346		2203	4300	6503	40297872	SO:0001583	missense	9343	exon14			D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.1237C>T	17.37:g.42942346G>A	ENSP00000392094:p.Arg413Cys	912	40297872	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	37	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858946	0.71834	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.78246	-1.16;-1.16	5.95	5.95	0.96441	.	0.106362	0.64402	D	0.000006	D	0.90359	0.6983	M	0.90019	3.08	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64776	0.929;0.929	D	0.91326	0.5086	10	0.87932	D	0	-5.2287	20.3931	0.98965	0.0:0.0:1.0:0.0	.	403;413	B4DMC0;Q15029	.;U5S1_HUMAN	C	413;403;378	ENSP00000392094:R413C;ENSP00000385873:R378C	ENSP00000262414:R403C	R	-	1	0	EFTUD2	40297872	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.687000	0.68219	2.824000	0.97209	0.655000	0.94253	CGC		0.562	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
HYDIN	54768	hgsc.bcm.edu	37	16	71065798	71065798	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr16:71065798G>A	ENST00000393567.2	-	19	2702	c.2552C>T	c.(2551-2553)aCg>aTg	p.T851M	HYDIN_ENST00000448691.1_Missense_Mutation_p.T851M|HYDIN_ENST00000321489.5_Missense_Mutation_p.T851M|HYDIN_ENST00000448089.2_Missense_Mutation_p.T851M|HYDIN_ENST00000541601.1_Missense_Mutation_p.T868M|HYDIN_ENST00000538248.1_Missense_Mutation_p.T878M	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	851					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.T851M(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGGTTCAATCGTCCAAAGGGA	0.428																																					p.T851M												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C2552T	16						.																																			69623299	SO:0001583	missense	54768	exon19			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2552C>T	16.37:g.71065798G>A	ENSP00000377197:p.Thr851Met		69623299	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	13.08	2.129842	0.37630	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601	T;T;T;T;T;T	0.04156	5.55;3.7;3.7;3.7;3.69;3.7	4.78	1.47	0.22746	.	0.558512	0.13102	N	0.413710	T	0.04952	0.0133	L	0.52364	1.645	0.58432	D	0.999995	B;B;B;B	0.29716	0.129;0.129;0.129;0.255	B;B;B;B	0.32289	0.143;0.143;0.112;0.024	T	0.38542	-0.9656	10	0.31617	T	0.26	.	3.344	0.07128	0.1019:0.3663:0.3908:0.141	.	878;868;851;851	B4DRN4;F5H6V3;Q4G0P3-5;F8WD23	.;.;.;.	M	851;851;851;851;851;878;868	ENSP00000377197:T851M;ENSP00000398544:T851M;ENSP00000394826:T851M;ENSP00000314736:T851M;ENSP00000444970:T878M;ENSP00000437341:T868M	ENSP00000313052:T851M	T	-	2	0	HYDIN	69623299	0.988000	0.35896	0.780000	0.31762	0.958000	0.62258	2.377000	0.44300	1.039000	0.40074	0.499000	0.49734	ACG		0.428	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
ST8SIA3	51046	hgsc.bcm.edu	37	18	55027480	55027480	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr18:55027480C>A	ENST00000324000.3	+	4	3149	c.1115C>A	c.(1114-1116)aCc>aAc	p.T372N		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	372					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.T372N(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GAAGGGCTCACCAAGCTGACT	0.473																																					p.T372N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1115A	18						.						52.0	45.0	47.0					18																	55027480		2203	4300	6503	53178478	SO:0001583	missense	51046	exon4			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.1115C>A	18.37:g.55027480C>A	ENSP00000320431:p.Thr372Asn		53178478	NM_015879	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	37	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226499	0.58668	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.29917	1.55	6.11	5.23	0.72850	.	0.313497	0.38436	N	0.001686	T	0.20861	0.0502	N	0.08118	0	0.37651	D	0.92242	B	0.30937	0.301	B	0.35770	0.21	T	0.22034	-1.0228	10	0.87932	D	0	-11.0866	14.5541	0.68089	0.0:0.9299:0.0:0.0701	.	372	O43173	SIA8C_HUMAN	N	479;372	ENSP00000320431:T372N	ENSP00000320431:T372N	T	+	2	0	ST8SIA3	53178478	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.505000	0.60421	2.906000	0.99361	0.655000	0.94253	ACC		0.473	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879	
SERPINB13	5275	hgsc.bcm.edu	37	18	61264545	61264545	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr18:61264545G>T	ENST00000344731.5	+	8	1226	c.1124G>T	c.(1123-1125)aGg>aTg	p.R375M	SERPINB13_ENST00000269489.5_Missense_Mutation_p.R323M	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	375					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R375M(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						TTCTTCATCAGGCACAATGAA	0.483																																					p.R375M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1124T	18						.						108.0	89.0	95.0					18																	61264545		2203	4300	6503	59415525	SO:0001583	missense	5275	exon8			AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.1124G>T	18.37:g.61264545G>T	ENSP00000341584:p.Arg375Met		59415525	NM_012397	A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	ENST00000344731.5	37	CCDS11985.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.479228	0.63849	.	.	ENSG00000197641	ENST00000269489;ENST00000539341;ENST00000344731	D;D	0.86432	-2.12;-2.12	5.4	2.65	0.31530	Serpin domain (3);	0.210090	0.33180	N	0.005200	D	0.90696	0.7081	M	0.78223	2.4	0.40421	D	0.979842	D;P;D	0.76494	0.997;0.794;0.999	D;B;D	0.69479	0.964;0.268;0.923	D	0.87928	0.2708	10	0.66056	D	0.02	.	4.3779	0.11279	0.3277:0.0:0.5258:0.1464	.	384;293;375	B7ZKV6;F5GZ40;Q9UIV8	.;.;SPB13_HUMAN	M	323;293;375	ENSP00000269489:R323M;ENSP00000341584:R375M	ENSP00000269489:R323M	R	+	2	0	SERPINB13	59415525	0.016000	0.18221	0.996000	0.52242	0.979000	0.70002	1.188000	0.32102	0.272000	0.22027	-0.262000	0.10625	AGG		0.483	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133798.1	NM_012397	
TIPARP	25976	hgsc.bcm.edu	37	3	156413774	156413774	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr3:156413774C>A	ENST00000461166.1	+	4	1795	c.1207C>A	c.(1207-1209)Ccc>Acc	p.P403T	TIPARP_ENST00000295924.7_Missense_Mutation_p.P403T|TIPARP_ENST00000486483.1_Missense_Mutation_p.P403T|TIPARP_ENST00000542783.1_Missense_Mutation_p.P403T	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	403	WWE. {ECO:0000255|PROSITE- ProRule:PRU00248}.				androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.P403T(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			AAAAAGGAGACCCCTCTTCCG	0.393																																					p.P403T	Ovarian(171;276 1987 3319 6837 11197)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1207A	3						.						110.0	114.0	113.0					3																	156413774		2203	4300	6503	157896468	SO:0001583	missense	25976	exon4			BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.1207C>A	3.37:g.156413774C>A	ENSP00000420612:p.Pro403Thr		157896468	NM_015508	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Missense_Mutation	SNP	ENST00000461166.1	37	CCDS3177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.9|24.9	4.578356|4.578356	0.86645|0.86645	.|.	.|.	ENSG00000163659|ENSG00000163659	ENST00000486483;ENST00000295924;ENST00000461166;ENST00000473702;ENST00000481853;ENST00000542783|ENST00000495891	T;T;T;T;T;T|.	0.24908|.	2.86;2.86;2.86;1.83;2.86;2.86|.	5.47|5.47	5.47|5.47	0.80525|0.80525	WWE domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.79191|0.79191	0.4404|0.4404	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.62435|.	0.902|.	T|T	0.79729|0.79729	-0.1681|-0.1681	10|5	0.87932|.	D|.	0|.	.|.	18.9343|18.9343	0.92579|0.92579	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	403|.	Q7Z3E1|.	PARPT_HUMAN|.	T|N	403|105	ENSP00000418757:P403T;ENSP00000295924:P403T;ENSP00000420612:P403T;ENSP00000419982:P403T;ENSP00000418829:P403T;ENSP00000438345:P403T|.	ENSP00000295924:P403T|.	P|T	+|+	1|2	0|0	TIPARP|TIPARP	157896468|157896468	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.375000|7.375000	0.79646|0.79646	2.579000|2.579000	0.87056|0.87056	0.460000|0.460000	0.39030|0.39030	CCC|ACC		0.393	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351618.1	NM_015508	
SLITRK3	22865	hgsc.bcm.edu	37	3	164907802	164907802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr3:164907802G>A	ENST00000475390.1	-	2	1260	c.817C>T	c.(817-819)Cga>Tga	p.R273*	SLITRK3_ENST00000241274.3_Nonsense_Mutation_p.R273*			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	273	LRRCT 1.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R273*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CTGATTTCTCGTAGGTCCTTT	0.468										HNSCC(40;0.11)																											p.R273X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C817T	3						.						121.0	125.0	124.0					3																	164907802		2203	4300	6503	166390496	SO:0001587	stop_gained	22865	exon2			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.817C>T	3.37:g.164907802G>A	ENSP00000420091:p.Arg273*		166390496	NM_014926	Q1RMY6	Nonsense_Mutation	SNP	ENST00000475390.1	37	CCDS3197.1	.	.	.	.	.	.	.	.	.	.	G	38	6.837759	0.97877	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	.	.	.	5.85	3.98	0.46160	.	0.000000	0.30969	N	0.008502	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-10.7448	14.3566	0.66742	0.0:0.0:0.5045:0.4955	.	.	.	.	X	273	.	ENSP00000241274:R273X	R	-	1	2	SLITRK3	166390496	0.994000	0.37717	0.987000	0.45799	0.941000	0.58515	1.654000	0.37334	1.453000	0.47775	0.655000	0.94253	CGA		0.468	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350126.1	NM_014926	
BSN	8927	hgsc.bcm.edu	37	3	49662512	49662512	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr3:49662512G>A	ENST00000296452.4	+	2	443	c.329G>A	c.(328-330)cGa>cAa	p.R110Q		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	110					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.R110Q(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GAGAGCCCCCGAGAGACAAGG	0.642																																					p.R110Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G329A	3						.						46.0	48.0	48.0					3																	49662512		2203	4300	6503	49637516	SO:0001583	missense	8927	exon2			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.329G>A	3.37:g.49662512G>A	ENSP00000296452:p.Arg110Gln		49637516	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	G	2.316	-0.356775	0.05138	.	.	ENSG00000164061	ENST00000296452	T	0.17370	2.28	5.48	0.701	0.18104	.	0.736785	0.12006	N	0.508282	T	0.11196	0.0273	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.40440	-0.9563	10	0.10377	T	0.69	-10.161	11.2435	0.48982	0.2965:0.0:0.7035:0.0	.	110	Q9UPA5	BSN_HUMAN	Q	110	ENSP00000296452:R110Q	ENSP00000296452:R110Q	R	+	2	0	BSN	49637516	0.005000	0.15991	0.888000	0.34837	0.010000	0.07245	0.148000	0.16224	-0.152000	0.11156	-2.311000	0.00256	CGA		0.642	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
ATP13A5	344905	hgsc.bcm.edu	37	3	193081069	193081069	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr3:193081069G>A	ENST00000342358.4	-	3	457	c.340C>T	c.(340-342)Cgc>Tgc	p.R114C		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	114						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.R114C(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		ACAGAGTGGCGGTCAGCCACC	0.388																																					p.R114C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C340T	3						.						94.0	94.0	94.0					3																	193081069		2203	4300	6503	194563763	SO:0001583	missense	344905	exon3			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.340C>T	3.37:g.193081069G>A	ENSP00000341942:p.Arg114Cys		194563763	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	4.150	0.026205	0.08054	.	.	ENSG00000187527	ENST00000342358;ENST00000446087	T;T	0.30448	1.53;1.53	5.02	-1.63	0.08345	.	1.281950	0.04988	N	0.466804	T	0.15825	0.0381	N	0.08118	0	0.09310	N	1	B	0.18863	0.031	B	0.15484	0.013	T	0.28650	-1.0037	10	0.56958	D	0.05	3.2484	5.8292	0.18570	0.3486:0.0:0.5274:0.1239	.	114	Q4VNC0	AT135_HUMAN	C	114;136	ENSP00000341942:R114C;ENSP00000389416:R136C	ENSP00000341942:R114C	R	-	1	0	ATP13A5	194563763	0.000000	0.05858	0.014000	0.15608	0.010000	0.07245	-1.510000	0.02262	-0.447000	0.07138	-0.850000	0.03035	CGC		0.388	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
ZNF518B	85460	hgsc.bcm.edu	37	4	10447328	10447328	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr4:10447328T>C	ENST00000326756.3	-	3	1063	c.625A>G	c.(625-627)Acg>Gcg	p.T209A		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	209					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.T209A(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						ACTCTCTTCGTGTGTTTGACA	0.428																																					p.T209A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A625G	4						.						172.0	177.0	175.0					4																	10447328		2203	4300	6503	10056426	SO:0001583	missense	85460	exon3			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.625A>G	4.37:g.10447328T>C	ENSP00000317614:p.Thr209Ala		10056426	NM_053042	Q96LN8	Missense_Mutation	SNP	ENST00000326756.3	37	CCDS33960.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.458789	0.43634	.	.	ENSG00000178163	ENST00000326756	T	0.27720	1.65	6.16	0.538	0.17150	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.279835	0.28354	N	0.015648	T	0.20373	0.0490	L	0.27053	0.805	0.09310	N	0.999999	B	0.27791	0.189	B	0.22386	0.039	T	0.09751	-1.0660	10	0.30854	T	0.27	-16.6232	15.1324	0.72536	0.0:0.0:0.5332:0.4668	.	209	Q9C0D4	Z518B_HUMAN	A	209	ENSP00000317614:T209A	ENSP00000317614:T209A	T	-	1	0	ZNF518B	10056426	1.000000	0.71417	0.818000	0.32626	0.955000	0.61496	1.899000	0.39818	-0.117000	0.11872	0.528000	0.53228	ACG		0.428	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359040.1	NM_053042	
DKK2	27123	hgsc.bcm.edu	37	4	107845202	107845202	+	Missense_Mutation	SNP	C	C	T	rs539488952		TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr4:107845202C>T	ENST00000285311.3	-	4	1394	c.689G>A	c.(688-690)cGt>cAt	p.R230H	DKK2_ENST00000513208.1_Missense_Mutation_p.R130H|DKK2_ENST00000510463.1_Missense_Mutation_p.R184H	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	230	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.R230H(3)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ACAGTCGCAACGCTGGAAAAT	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		18840	0.001		0.0	False		,,,				2504	0.0				p.R230H												.	.	3	Substitution - Missense(3)	large_intestine(2)|prostate(1)	c.G689A	4						.						161.0	147.0	152.0					4																	107845202		2203	4300	6503	108064651	SO:0001583	missense	27123	exon4			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.689G>A	4.37:g.107845202C>T	ENSP00000285311:p.Arg230His		108064651	NM_014421	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897895	0.91962	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.57595	0.39;0.52;0.54	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	M	0.81341	2.54	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.77051	-0.2731	10	0.59425	D	0.04	-11.8314	19.6876	0.95986	0.0:1.0:0.0:0.0	.	230	Q9UBU2	DKK2_HUMAN	H	230;130;184	ENSP00000285311:R230H;ENSP00000421255:R130H;ENSP00000423797:R184H	ENSP00000285311:R230H	R	-	2	0	DKK2	108064651	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.487000	0.81328	2.657000	0.90304	0.585000	0.79938	CGT		0.488	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4		
TENM1	10178	hgsc.bcm.edu	37	X	123780572	123780572	+	Silent	SNP	A	A	G			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chrX:123780572A>G	ENST00000371130.3	-	9	1731	c.1668T>C	c.(1666-1668)ccT>ccC	p.P556P	TENM1_ENST00000422452.2_Silent_p.P556P	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	556	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.P558P(1)									TAGCACAGTCAGGTCCAAGGA	0.368																																					p.P556P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1668C	X						.						126.0	97.0	107.0					X																	123780572		2203	4300	6503	123608253	SO:0001819	synonymous_variant	10178	exon9			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1668T>C	X.37:g.123780572A>G			123608253	NM_014253	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																				0.368	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
ITGB1BP2	26548	hgsc.bcm.edu	37	X	70522363	70522363	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chrX:70522363G>C	ENST00000373829.3	+	4	347	c.274G>C	c.(274-276)Gtg>Ctg	p.V92L	ITGB1BP2_ENST00000538820.1_Missense_Mutation_p.V74L	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	92					muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.V92L(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					ACCTCTGAATGTGATTCCAAA	0.517																																					p.V92L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G274C	X						.						40.0	39.0	39.0					X																	70522363		2203	4300	6503	70439088	SO:0001583	missense	26548	exon4			AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.274G>C	X.37:g.70522363G>C	ENSP00000362935:p.Val92Leu		70439088	NM_012278	Q32N04|Q549J7	Missense_Mutation	SNP	ENST00000373829.3	37	CCDS14411.1	.	.	.	.	.	.	.	.	.	.	g	0.195	-1.049826	0.01981	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	.	.	.	4.84	-2.27	0.06846	.	1.038600	0.07547	N	0.914778	T	0.12092	0.0294	N	0.02539	-0.55	0.09310	N	1	B;B	0.12013	0.0;0.005	B;B	0.08055	0.0;0.003	T	0.20174	-1.0283	9	0.24483	T	0.36	4.818	3.1423	0.06460	0.322:0.0:0.344:0.3339	.	74;92	Q32N04;Q9UKP3	.;ITBP2_HUMAN	L	92;74	.	ENSP00000362935:V92L	V	+	1	0	ITGB1BP2	70439088	0.763000	0.28462	0.006000	0.13384	0.888000	0.51559	0.466000	0.22019	-0.646000	0.05452	-0.229000	0.12294	GTG		0.517	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057126.1	NM_012278	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718116	142718116	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chrX:142718116A>G	ENST00000381779.4	-	2	1034	c.809T>C	c.(808-810)tTt>tCt	p.F270S	SLITRK4_ENST00000338017.4_Missense_Mutation_p.F270S|SLITRK4_ENST00000356928.1_Missense_Mutation_p.F270S	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	270						integral component of membrane (GO:0016021)		p.F270S(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GCGCACGTCAAAATCACTGCC	0.448																																					p.F270S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T809C	X						.						102.0	89.0	94.0					X																	142718116		2203	4300	6503	142545782	SO:0001583	missense	139065	exon2			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.809T>C	X.37:g.142718116A>G	ENSP00000371198:p.Phe270Ser		142545782	NM_173078	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	A	11.32	1.605153	0.28623	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.41758	0.99;0.99;0.99	5.88	5.88	0.94601	.	0.000000	0.85682	U	0.000000	T	0.26629	0.0651	N	0.12569	0.235	0.80722	D	1	B	0.15141	0.012	B	0.19148	0.024	T	0.09530	-1.0670	10	0.21540	T	0.41	-11.152	13.9232	0.63945	1.0:0.0:0.0:0.0	.	270	Q8IW52	SLIK4_HUMAN	S	270	ENSP00000371198:F270S;ENSP00000349400:F270S;ENSP00000336627:F270S	ENSP00000336627:F270S	F	-	2	0	SLITRK4	142545782	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.522000	0.81844	1.973000	0.57446	0.486000	0.48141	TTT		0.448	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
DENND4C	55667	hgsc.bcm.edu	37	9	19358055	19358055	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr9:19358055G>T	ENST00000380432.2	+	23	4235	c.4202G>T	c.(4201-4203)cGa>cTa	p.R1401L	DENND4C_ENST00000434457.2_Missense_Mutation_p.R1686L|DENND4C_ENST00000602925.1_Missense_Mutation_p.R1637L			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1401					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.R1401L(1)		breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TCTTTGACTCGAAGTCACAGT	0.398																																					p.R1401L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4202T	9						.						102.0	91.0	95.0					9																	19358055		2203	4300	6503	19348055	SO:0001583	missense	55667	exon23			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4202G>T	9.37:g.19358055G>T	ENSP00000369797:p.Arg1401Leu		19348055	NM_017925	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	37		.	.	.	.	.	.	.	.	.	.	G	34	5.370031	0.95900	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000453857;ENST00000540671;ENST00000380432;ENST00000380427;ENST00000361024	T;T	0.36340	1.27;1.26	5.67	5.67	0.87782	.	1.146860	0.06258	N	0.693460	T	0.68375	0.2994	M	0.78049	2.395	0.54753	D	0.999985	D;D;D	0.71674	0.998;0.998;0.992	D;D;P	0.72982	0.972;0.979;0.702	T	0.59984	-0.7351	10	0.72032	D	0.01	-10.0663	20.1358	0.98028	0.0:0.0:1.0:0.0	.	731;583;1401	B7Z660;Q5VZ89-3;Q5VZ89	.;.;DEN4C_HUMAN	L	1401;874;583;731;874;583;398	ENSP00000305795:R874L;ENSP00000443804:R731L	ENSP00000305795:R874L	R	+	2	0	DENND4C	19348055	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.765000	0.74965	2.833000	0.97629	0.585000	0.79938	CGA		0.398	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
DAPK1	1612	hgsc.bcm.edu	37	9	90252859	90252859	+	Splice_Site	SNP	G	G	A	rs200255856		TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr9:90252859G>A	ENST00000408954.3	+	4	621	c.286G>A	c.(286-288)Gtt>Att	p.V96I	DAPK1_ENST00000491893.1_Splice_Site_p.V96I|DAPK1_ENST00000469640.2_Splice_Site_p.V96I|DAPK1_ENST00000358077.5_Splice_Site_p.V96I|DAPK1_ENST00000472284.1_Splice_Site_p.V96I	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	96	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.V96I(2)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						GGTTCTCAGCGTTGCAGGTGG	0.398									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.V96I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G286A	9						.						103.0	103.0	103.0					9																	90252859		2074	4243	6317	89442679	SO:0001630	splice_region_variant	1612	exon4	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.285-1G>A	9.37:g.90252859G>A			89442679	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	37	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474124	0.84640	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43579	D	0.000544	T	0.53658	0.1810	N	0.25825	0.765	0.80722	D	1	P;P;D	0.64830	0.792;0.802;0.994	P;B;D	0.71414	0.502;0.218;0.973	T	0.57271	-0.7840	10	0.87932	D	0	.	19.0661	0.93110	0.0:0.0:1.0:0.0	.	96;96;96	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	I	96	ENSP00000350785:V96I;ENSP00000417076:V96I;ENSP00000418885:V96I;ENSP00000386135:V96I;ENSP00000419026:V96I	ENSP00000350785:V96I	V	+	1	0	DAPK1	89442679	1.000000	0.71417	0.973000	0.42090	0.688000	0.40055	9.657000	0.98554	2.746000	0.94184	0.655000	0.94253	GTT		0.398	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	Missense_Mutation
TCF7L2	6934	hgsc.bcm.edu	37	10	114912186	114912186	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr10:114912186C>T	ENST00000355995.4	+	11	1763	c.1256C>T	c.(1255-1257)gCg>gTg	p.A419V	TCF7L2_ENST00000543371.1_Missense_Mutation_p.A419V|TCF7L2_ENST00000538897.1_Missense_Mutation_p.A419V|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000369397.4_Missense_Mutation_p.A396V|TCF7L2_ENST00000542695.1_Missense_Mutation_p.A135V|TCF7L2_ENST00000369386.1_Missense_Mutation_p.A62V|TCF7L2_ENST00000352065.5_Missense_Mutation_p.A396V|TCF7L2_ENST00000545257.1_Missense_Mutation_p.A419V|TCF7L2_ENST00000534894.1_Missense_Mutation_p.A419V|TCF7L2_ENST00000355717.4_Missense_Mutation_p.A443V|TCF7L2_ENST00000536810.1_Missense_Mutation_p.A419V|TCF7L2_ENST00000369389.1_Missense_Mutation_p.A130V			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	419					blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A396V(1)|p.A419V(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GGCTGGTCCGCGCGGGATAAC	0.527			T	VTI1A	colorectal																																p.A392V			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1175T	10						.						109.0	115.0	113.0					10																	114912186		2203	4300	6503	114902176	SO:0001583	missense	6934	exon10			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1256C>T	10.37:g.114912186C>T	ENSP00000348274:p.Ala419Val		114902176	NM_001146284	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	c	36	5.635243	0.96682	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000352065;ENST00000542695;ENST00000369389;ENST00000277945;ENST00000369386	D;D;D;D;D;D;D;D;D;D;D;D	0.99376	-5.27;-5.28;-5.26;-5.27;-5.75;-5.79;-5.79;-5.28;-5.78;-5.22;-5.68;-5.71	5.66	5.66	0.87406	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (2);	0.105150	0.64402	D	0.000005	D	0.99453	0.9806	M	0.83603	2.65	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.997;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0	P;D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.846;0.957;0.987;0.842;0.98;0.956;0.997;0.976;0.987;0.956;0.98;0.97;0.97;0.973;0.996;0.967;0.987;0.992;0.999	D	0.99129	1.0852	10	0.54805	T	0.06	-5.0689	19.7439	0.96243	0.0:1.0:0.0:0.0	.	276;236;318;419;290;334;392;396;396;362;419;396;396;401;443;396;419;392;396	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	V	419;419;419;419;443;419;419;396;396;135;130;136;62	ENSP00000348274:A419V;ENSP00000440547:A419V;ENSP00000444972:A419V;ENSP00000446238:A419V;ENSP00000347949:A443V;ENSP00000446172:A419V;ENSP00000443626:A419V;ENSP00000358404:A396V;ENSP00000344823:A396V;ENSP00000443883:A135V;ENSP00000358396:A130V;ENSP00000277945:A136V	ENSP00000277945:A136V	A	+	2	0	TCF7L2	114902176	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.814000	0.86154	2.669000	0.90835	0.655000	0.94253	GCG		0.527	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
HTR1A	3350	hgsc.bcm.edu	37	5	63257014	63257014	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr5:63257014G>T	ENST00000323865.3	-	1	766	c.533C>A	c.(532-534)cCg>cAg	p.P178Q	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	178					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.P178Q(1)		cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCGGTCTTCCGGGGTGCGCCA	0.597																																					p.P178Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C533A	5						.						108.0	126.0	120.0					5																	63257014		2203	4300	6503	63292770	SO:0001583	missense	3350	exon1			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.533C>A	5.37:g.63257014G>T	ENSP00000316244:p.Pro178Gln		63292770	NM_000524	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	37	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841366	0.71488	.	.	ENSG00000178394	ENST00000323865	T	0.36520	1.25	5.7	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.174290	0.50627	D	0.000118	T	0.44201	0.1282	N	0.20766	0.605	0.80722	D	1	D	0.69078	0.997	D	0.69654	0.965	T	0.41215	-0.9521	10	0.40728	T	0.16	.	15.8421	0.78857	0.0:0.136:0.864:0.0	.	178	P08908	5HT1A_HUMAN	Q	178	ENSP00000316244:P178Q	ENSP00000316244:P178Q	P	-	2	0	HTR1A	63292770	1.000000	0.71417	0.901000	0.35422	0.997000	0.91878	5.748000	0.68697	1.402000	0.46780	0.655000	0.94253	CCG		0.597	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
PCDHB5	26167	hgsc.bcm.edu	37	5	140517265	140517265	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3582-01A-01W-0831-10	TCGA-AG-3582-10A-01W-0831-10	g.chr5:140517265A>G	ENST00000231134.5	+	1	2466	c.2249A>G	c.(2248-2250)tAc>tGc	p.Y750C		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	750					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y750C(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTACCACTACGAGGTGTGT	0.627																																					p.Y750C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2249G	5						.						107.0	126.0	120.0					5																	140517265		2203	4300	6503	140497449	SO:0001583	missense	26167	exon1			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2249A>G	5.37:g.140517265A>G	ENSP00000231134:p.Tyr750Cys		140497449	NM_015669	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	A	15.03	2.712323	0.48517	.	.	ENSG00000113209	ENST00000231134	T	0.55413	0.52	4.38	4.38	0.52667	.	.	.	.	.	T	0.61788	0.2375	M	0.93016	3.37	0.41808	D	0.989951	P	0.36577	0.558	B	0.33620	0.167	T	0.72852	-0.4167	9	0.72032	D	0.01	.	13.9261	0.63964	1.0:0.0:0.0:0.0	.	750	Q9Y5E4	PCDB5_HUMAN	C	750	ENSP00000231134:Y750C	ENSP00000231134:Y750C	Y	+	2	0	PCDHB5	140497449	1.000000	0.71417	0.837000	0.33122	0.083000	0.17756	6.884000	0.75600	1.756000	0.51951	0.414000	0.27820	TAC		0.627	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
