#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PKD1L1	168507	hgsc.bcm.edu	37	7	47879158	47879158	+	Silent	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr7:47879158C>T	ENST00000289672.2	-	36	5705	c.5655G>A	c.(5653-5655)ctG>ctA	p.L1885L		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1885	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.L1885L(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GTCCCGTGTGCAGCTCCTTCA	0.657																																					p.L1885L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G5655A	7						.						46.0	32.0	37.0					7																	47879158		2201	4299	6500	47845683	SO:0001819	synonymous_variant	168507	exon36			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5655G>A	7.37:g.47879158C>T			47845683	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																				0.657	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
CUL1	8454	hgsc.bcm.edu	37	7	148451114	148451114	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr7:148451114C>T	ENST00000325222.4	+	3	466	c.187C>T	c.(187-189)Cga>Tga	p.R63*	CUL1_ENST00000602748.1_Nonsense_Mutation_p.R63*|CUL1_ENST00000409469.1_Nonsense_Mutation_p.R63*	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	63				Missing (in Ref. 1; AAC50544). {ECO:0000305}.	anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)		p.R63*(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			AAACCAAGCACGAGGAGCTGG	0.408																																					p.R63X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C187T	7						.						59.0	57.0	58.0					7																	148451114		2203	4300	6503	148082047	SO:0001587	stop_gained	8454	exon3			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.187C>T	7.37:g.148451114C>T	ENSP00000326804:p.Arg63*		148082047	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Nonsense_Mutation	SNP	ENST00000325222.4	37	CCDS34772.1	.	.	.	.	.	.	.	.	.	.	C	40	8.392545	0.98791	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583	.	.	.	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.4878	17.7333	0.88384	0.0:1.0:0.0:0.0	.	.	.	.	X	63;63;21	.	ENSP00000326804:R63X	R	+	1	2	CUL1	148082047	0.995000	0.38212	0.968000	0.41197	0.968000	0.65278	3.332000	0.52083	2.195000	0.70347	0.508000	0.49915	CGA		0.408	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
CDH22	64405	hgsc.bcm.edu	37	20	44869868	44869868	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr20:44869868C>T	ENST00000372262.3	-	2	684	c.284G>A	c.(283-285)gGg>gAg	p.G95E	CDH22_ENST00000537909.1_Missense_Mutation_p.G95E	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	95	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G95E(1)		endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CTTGATGGCCCCGTCACCCTC	0.597																																					p.G95E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G284A	20						.						62.0	53.0	56.0					20																	44869868		2203	4300	6503	44303275	SO:0001583	missense	64405	exon2			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.284G>A	20.37:g.44869868C>T	ENSP00000361336:p.Gly95Glu		44303275	NM_021248	B9EGK7|O43205	Missense_Mutation	SNP	ENST00000372262.3	37	CCDS13395.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571666	0.86542	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.60672	0.17;0.17	4.42	4.42	0.53409	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.79131	0.4394	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83439	0.0042	10	0.72032	D	0.01	.	16.5845	0.84724	0.0:1.0:0.0:0.0	.	95	Q9UJ99	CAD22_HUMAN	E	95	ENSP00000361336:G95E;ENSP00000437790:G95E	ENSP00000361336:G95E	G	-	2	0	CDH22	44303275	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	7.320000	0.79064	2.475000	0.83589	0.455000	0.32223	GGG		0.597	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
CSE1L	1434	hgsc.bcm.edu	37	20	47711485	47711485	+	Silent	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr20:47711485C>T	ENST00000262982.2	+	24	2934	c.2811C>T	c.(2809-2811)acC>acT	p.T937T	CSE1L_ENST00000396192.3_Silent_p.T881T|CSE1L_ENST00000469700.1_3'UTR|CSE1L_ENST00000542325.1_Silent_p.T720T	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	937					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)	p.T937T(2)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AGTTGTCTACCGCCTGTCCAG	0.438																																					p.T937T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C2811T	20						.						69.0	64.0	66.0					20																	47711485		2203	4300	6503	47144892	SO:0001819	synonymous_variant	1434	exon24			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2811C>T	20.37:g.47711485C>T			47144892	NM_001316	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	ENST00000262982.2	37	CCDS13412.1																																																																																				0.438	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
ZNFX1	57169	hgsc.bcm.edu	37	20	47865967	47865967	+	Silent	SNP	C	C	T	rs146287599		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr20:47865967C>T	ENST00000396105.1	-	14	3840	c.3594G>A	c.(3592-3594)tcG>tcA	p.S1198S	ZNFX1_ENST00000371754.4_Intron|ZNFX1_ENST00000371752.1_Silent_p.S1198S	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	1198							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S1198S(2)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TCCGCACTAGCGAGAGGAGGA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		21437	0.0		0.001	False		,,,				2504	0.0				p.S1198S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3594A	20						.	C		1,4405	2.1+/-5.4	0,1,2202	182.0	162.0	169.0		3594	-12.1	0.0	20	dbSNP_134	169	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	ZNFX1	NM_021035.2		0,6,6497	TT,TC,CC		0.0581,0.0227,0.0461		1198/1919	47865967	6,13000	2203	4300	6503	47299374	SO:0001819	synonymous_variant	57169	exon14			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.3594G>A	20.37:g.47865967C>T			47299374	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	ENST00000396105.1	37	CCDS13417.1																																																																																				0.532	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
MYT1	4661	hgsc.bcm.edu	37	20	62842648	62842648	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr20:62842648C>T	ENST00000328439.1	+	8	1745	c.1381C>T	c.(1381-1383)Cgc>Tgc	p.R461C	MYT1_ENST00000536311.1_Missense_Mutation_p.R461C|MYT1_ENST00000360149.4_Missense_Mutation_p.R163C	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Interaction with CDC2-CCNB1.|Interaction with PIN1.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R461C(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CCCTCACCACCGCAGCCTTTC	0.557																																					p.R461C	GBM(59;481 1041 20555 21139 33705)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1381T	20						.						136.0	102.0	114.0					20																	62842648		2203	4300	6503	62313092	SO:0001583	missense	4661	exon8			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.1381C>T	20.37:g.62842648C>T	ENSP00000327465:p.Arg461Cys		62313092	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.500982	0.64298	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.59906	0.44;0.23;0.25	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.79240	0.4412	M	0.90814	3.15	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.83617	0.0137	10	0.87932	D	0	-25.8002	13.071	0.59061	0.1607:0.8393:0.0:0.0	.	461;461;163	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	C	163;461;461	ENSP00000353269:R163C;ENSP00000327465:R461C;ENSP00000442412:R461C	ENSP00000327465:R461C	R	+	1	0	MYT1	62313092	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.656000	0.61483	2.298000	0.77334	0.563000	0.77884	CGC		0.557	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
MSR1	4481	hgsc.bcm.edu	37	8	16026285	16026285	+	Silent	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr8:16026285G>A	ENST00000262101.5	-	4	433	c.312C>T	c.(310-312)agC>agT	p.S104S	MSR1_ENST00000381998.4_Silent_p.S104S|MSR1_ENST00000350896.3_Silent_p.S104S|MSR1_ENST00000355282.2_Silent_p.S104S|MSR1_ENST00000445506.2_Silent_p.S122S|MSR1_ENST00000536385.1_Intron			P21757	MSRE_HUMAN	macrophage scavenger receptor 1	104	Spacer. {ECO:0000305}.				cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)	p.S104R(2)|p.S104S(1)		haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTTCCTCTTCGCTGTCATTTC	0.398																																					p.S104S												.	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	lung(2)|large_intestine(1)	c.C312T	8						.						228.0	209.0	215.0					8																	16026285		2203	4300	6503	16070656	SO:0001819	synonymous_variant	4481	exon4			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.312C>T	8.37:g.16026285G>A			16070656	NM_138716	D3DSP3|O60505|P21759|Q45F10	Silent	SNP	ENST00000262101.5	37	CCDS5995.1																																																																																				0.398	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211627.2		
ATP6V0D2	245972	hgsc.bcm.edu	37	8	87153754	87153754	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr8:87153754A>G	ENST00000285393.3	+	4	699	c.557A>G	c.(556-558)tAc>tGc	p.Y186C	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	186					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)	p.Y186C(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						AATAAACTATACAAGGTAATG	0.333																																					p.Y186C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A557G	8						.						98.0	98.0	98.0					8																	87153754		2203	4300	6503	87222870	SO:0001583	missense	245972	exon4			AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.557A>G	8.37:g.87153754A>G	ENSP00000285393:p.Tyr186Cys		87222870	NM_152565		Missense_Mutation	SNP	ENST00000285393.3	37	CCDS6241.1	.	.	.	.	.	.	.	.	.	.	A	15.32	2.798298	0.50208	.	.	ENSG00000147614	ENST00000285393	T	0.34275	1.37	5.29	5.29	0.74685	.	0.074898	0.56097	D	0.000034	T	0.70649	0.3248	H	0.96662	3.86	0.80722	D	1	D	0.65815	0.995	D	0.64237	0.923	T	0.81762	-0.0784	10	0.87932	D	0	-15.2305	14.4429	0.67330	1.0:0.0:0.0:0.0	.	186	Q8N8Y2	VA0D2_HUMAN	C	186	ENSP00000285393:Y186C	ENSP00000285393:Y186C	Y	+	2	0	ATP6V0D2	87222870	1.000000	0.71417	0.999000	0.59377	0.144000	0.21451	8.896000	0.92521	1.997000	0.58415	0.528000	0.53228	TAC		0.333	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374651.1	NM_152565	
FLG	2312	hgsc.bcm.edu	37	1	152286282	152286282	+	Silent	SNP	G	G	A	rs375783519		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr1:152286282G>A	ENST00000368799.1	-	3	1115	c.1080C>T	c.(1078-1080)caC>caT	p.H360H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	360	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H360H(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGTCTCTGCGTGACGAGTGC	0.552									Ichthyosis																												p.H360H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1080T	1						.	G		1,4405		0,1,2202	294.0	286.0	289.0		1080	-4.9	0.0	1		289	1,8599		0,1,4299	no	coding-synonymous	FLG	NM_002016.1		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		360/4062	152286282	2,13004	2203	4300	6503	150552906	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.1080C>T	1.37:g.152286282G>A			150552906	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	37	CCDS30860.1																																																																																				0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SLC6A9	6536	hgsc.bcm.edu	37	1	44463248	44463248	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr1:44463248C>T	ENST00000360584.2	-	14	2281	c.2090G>A	c.(2089-2091)gGc>gAc	p.G697D	SLC6A9_ENST00000357730.2_Missense_Mutation_p.G643D|SLC6A9_ENST00000372306.3_Intron|SLC6A9_ENST00000372307.3_Intron|SLC6A9_ENST00000475075.2_Missense_Mutation_p.G513D|SLC6A9_ENST00000372310.3_Missense_Mutation_p.G624D	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	697					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G697D(1)|p.G624D(1)		endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	GCGGCTGGAGCCATTACTGCC	0.682																																					p.G697D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2090A	1						.						55.0	67.0	63.0					1																	44463248		2203	4300	6503	44235835	SO:0001583	missense	6536	exon14			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.2090G>A	1.37:g.44463248C>T	ENSP00000353791:p.Gly697Asp		44235835	NM_201649	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Missense_Mutation	SNP	ENST00000360584.2	37	CCDS41317.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196109	0.38806	.	.	ENSG00000196517	ENST00000372310;ENST00000475075;ENST00000360584;ENST00000357730	T;T;T;T	0.77229	-0.9;-0.96;-1.08;-0.93	4.92	4.02	0.46733	.	0.801042	0.11771	N	0.531157	T	0.74191	0.3684	L	0.53249	1.67	0.80722	D	1	B;B;B;P	0.36065	0.053;0.049;0.004;0.535	B;B;B;B	0.34722	0.018;0.027;0.003;0.188	T	0.69450	-0.5142	10	0.32370	T	0.25	.	15.2085	0.73198	0.0:0.8583:0.1417:0.0	.	628;624;643;697	B7Z3W8;P48067-2;P48067-3;P48067	.;.;.;SC6A9_HUMAN	D	624;513;697;643	ENSP00000361384:G624D;ENSP00000434460:G513D;ENSP00000353791:G697D;ENSP00000350362:G643D	ENSP00000350362:G643D	G	-	2	0	SLC6A9	44235835	1.000000	0.71417	0.961000	0.40146	0.852000	0.48524	3.382000	0.52463	1.312000	0.45043	-0.167000	0.13348	GGC		0.682	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000022825.2	NM_201649	
PGM1	5236	hgsc.bcm.edu	37	1	64120046	64120046	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr1:64120046G>A	ENST00000371084.3	+	10	1721	c.1508G>A	c.(1507-1509)cGa>cAa	p.R503Q	PGM1_ENST00000540265.1_Missense_Mutation_p.R306Q|RN7SL130P_ENST00000489463.2_RNA|PGM1_ENST00000483707.1_3'UTR|PGM1_ENST00000371083.4_Missense_Mutation_p.R521Q	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	503					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)	p.R503Q(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						ATCGTCTTCCGACTGAGCGGC	0.537																																					p.R521Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1562A	1						.						79.0	77.0	78.0					1																	64120046		2203	4300	6503	63892634	SO:0001583	missense	5236	exon10			BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1508G>A	1.37:g.64120046G>A	ENSP00000360125:p.Arg503Gln		63892634	NM_001172818	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Missense_Mutation	SNP	ENST00000371084.3	37	CCDS625.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000268	0.74818	.	.	ENSG00000079739	ENST00000538673;ENST00000371084;ENST00000540265;ENST00000371083	D;D;D	0.99042	-5.36;-5.36;-5.36	5.45	3.56	0.40772	Alpha-D-phosphohexomutase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99456	0.9807	H	0.97415	4	0.39937	D	0.974365	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99023	1.0818	10	0.87932	D	0	-17.3083	11.4745	0.50288	0.068:0.1259:0.8061:0.0	.	521;503	P36871-2;P36871	.;PGM1_HUMAN	Q	479;503;306;521	ENSP00000360125:R503Q;ENSP00000443449:R306Q;ENSP00000360124:R521Q	ENSP00000360124:R521Q	R	+	2	0	PGM1	63892634	1.000000	0.71417	0.998000	0.56505	0.292000	0.27327	9.767000	0.98960	0.779000	0.33543	-0.302000	0.09304	CGA		0.537	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024868.1	NM_002633	
TARBP1	6894	hgsc.bcm.edu	37	1	234527412	234527412	+	Missense_Mutation	SNP	G	G	A	rs560732693		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr1:234527412G>A	ENST00000040877.1	-	30	4776	c.4777C>T	c.(4777-4779)Cgc>Tgc	p.R1593C	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1593	S-adenosyl-L-methionine binding. {ECO:0000269|PubMed:18412263}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)	p.R1593C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TTCAGGGAGCGGATAATGCCC	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		14361	0.001		0.0	False		,,,				2504	0.0				p.R1593C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4777T	1						.						74.0	62.0	66.0					1																	234527412		2203	4300	6503	232594035	SO:0001583	missense	6894	exon30				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4777C>T	1.37:g.234527412G>A	ENSP00000040877:p.Arg1593Cys		232594035	NM_005646	Q9H581	Missense_Mutation	SNP	ENST00000040877.1	37	CCDS1601.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520998	0.85495	.	.	ENSG00000059588	ENST00000040877	T	0.34275	1.37	5.47	5.47	0.80525	tRNA/rRNA methyltransferase, SpoU (1);	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	H	0.94503	3.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80901	-0.1175	10	0.87932	D	0	-6.9886	19.3005	0.94143	0.0:0.0:1.0:0.0	.	1593	Q13395	TARB1_HUMAN	C	1593	ENSP00000040877:R1593C	ENSP00000040877:R1593C	R	-	1	0	TARBP1	232594035	1.000000	0.71417	0.982000	0.44146	0.555000	0.35460	9.829000	0.99411	2.575000	0.86900	0.591000	0.81541	CGC		0.502	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	
SLC5A12	159963	hgsc.bcm.edu	37	11	26743032	26743032	+	Missense_Mutation	SNP	A	A	C	rs549919551		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr11:26743032A>C	ENST00000396005.3	-	1	539	c.230T>G	c.(229-231)tTt>tGt	p.F77C	SLC5A12_ENST00000280467.6_Missense_Mutation_p.F77C	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	77					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)	p.F77C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GGATGCCCCAAAGCGGTAGAC	0.517																																					p.F77C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T230G	11						.						92.0	93.0	92.0					11																	26743032		2203	4299	6502	26699608	SO:0001583	missense	159963	exon1			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.230T>G	11.37:g.26743032A>C	ENSP00000379326:p.Phe77Cys		26699608	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	37	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	16.60	3.169081	0.57584	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.88046	-2.33;-2.33	5.59	4.44	0.53790	.	0.125321	0.53938	D	0.000059	D	0.93426	0.7903	M	0.89095	3.005	0.47862	D	0.999535	D;D	0.76494	0.991;0.999	D;D	0.73380	0.919;0.98	D	0.93266	0.6647	10	0.87932	D	0	.	10.1519	0.42799	0.6768:0.0:0.0:0.3232	.	77;77	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	C	77	ENSP00000379326:F77C;ENSP00000280467:F77C	ENSP00000280467:F77C	F	-	2	0	SLC5A12	26699608	0.996000	0.38824	1.000000	0.80357	0.852000	0.48524	3.239000	0.51360	0.916000	0.36871	0.477000	0.44152	TTT		0.517	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
TMEM14C	51522	hgsc.bcm.edu	37	6	10730852	10730852	+	Silent	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr6:10730852C>T	ENST00000541412.1	+	6	677	c.292C>T	c.(292-294)Ctg>Ttg	p.L98L	TMEM14C_ENST00000229563.5_Silent_p.L98L|TMEM14C_ENST00000467415.1_3'UTR	NM_001165258.1	NP_001158730.1	Q9P0S9	TM14C_HUMAN	transmembrane protein 14C	98					heme biosynthetic process (GO:0006783)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.L98L(1)		large_intestine(2)|lung(3)	5	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)	Epithelial(50;0.246)			AAACAGTTTGCTGATGGTCGC	0.393																																					p.L98L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C292T	6						.						106.0	96.0	99.0					6																	10730852		2203	4300	6503	10838838	SO:0001819	synonymous_variant	51522	exon6			AF151028	CCDS4514.1	6p24.1	2008-02-26	2004-04-16	2004-04-21	ENSG00000111843	ENSG00000111843			20952	protein-coding gene	gene with protein product		615318	"""chromosome 6 open reading frame 53"""	C6orf53		11042152, 12958361	Standard	NM_016462		Approved	HSPC194, bA421M1.6, NET26	uc021ylj.1	Q9P0S9	OTTHUMG00000014242	ENST00000541412.1:c.292C>T	6.37:g.10730852C>T			10838838	NM_016462	Q5T4I6	Silent	SNP	ENST00000541412.1	37	CCDS4514.1	.	.	.	.	.	.	.	.	.	.	C	7.787	0.710701	0.15239	.	.	ENSG00000111843	ENST00000342277	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	T	0.66915	0.2838	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72763	-0.4195	5	0.87932	D	0	.	13.7188	0.62714	0.0:1.0:0.0:0.0	.	.	.	.	V	97	.	ENSP00000343293:A97V	A	+	2	0	TMEM14C	10838838	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	2.697000	0.47060	2.000000	0.58554	0.455000	0.32223	GCT		0.393	TMEM14C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039829.1	NM_016462	
PEX3	8504	hgsc.bcm.edu	37	6	143806378	143806378	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr6:143806378T>C	ENST00000367591.4	+	11	1094	c.1031T>C	c.(1030-1032)tTt>tCt	p.F344S	RP1-20N2.6_ENST00000591892.1_RNA	NM_003630.2	NP_003621.1	P56589	PEX3_HUMAN	peroxisomal biogenesis factor 3	344					peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|protein import into peroxisome membrane (GO:0045046)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)|protein-lipid complex (GO:0032994)	lipid binding (GO:0008289)|protein dimerization activity (GO:0046983)	p.F344S(1)		endometrium(1)|large_intestine(9)|lung(4)|ovary(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(155;5.73e-06)|GBM - Glioblastoma multiforme(68;0.0117)		CCTAGTCATTTTGTTCAGGTA	0.368																																					p.F344S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1031C	6						.						127.0	130.0	129.0					6																	143806378		2203	4299	6502	143848071	SO:0001583	missense	8504	exon11			AJ001625	CCDS5199.1	6q24.2	2008-05-15			ENSG00000034693	ENSG00000034693			8858	protein-coding gene	gene with protein product		603164				9657383	Standard	NM_003630		Approved		uc003qjl.3	P56589	OTTHUMG00000015730	ENST00000367591.4:c.1031T>C	6.37:g.143806378T>C	ENSP00000356563:p.Phe344Ser		143848071	NM_003630	Q6FGP5	Missense_Mutation	SNP	ENST00000367591.4	37	CCDS5199.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.479222	0.63849	.	.	ENSG00000034693	ENST00000367591	T	0.44881	0.91	5.45	5.45	0.79879	.	0.093369	0.85682	D	0.000000	T	0.37100	0.0991	M	0.68952	2.095	0.80722	D	1	B	0.31611	0.331	B	0.39503	0.301	T	0.42207	-0.9465	10	0.62326	D	0.03	-13.0223	14.4996	0.67711	0.0:0.0:0.0:1.0	.	344	P56589	PEX3_HUMAN	S	344	ENSP00000356563:F344S	ENSP00000356563:F344S	F	+	2	0	PEX3	143848071	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.879000	0.75572	2.073000	0.62155	0.528000	0.53228	TTT		0.368	PEX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042525.1		
ME1	4199	hgsc.bcm.edu	37	6	84025099	84025099	+	Missense_Mutation	SNP	G	G	A	rs141363376	byFrequency	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr6:84025099G>A	ENST00000369705.3	-	6	750	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	ME1_ENST00000541327.1_Missense_Mutation_p.R46W|ME1_ENST00000543031.1_Missense_Mutation_p.R137W	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	212					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)	p.R212W(1)		NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		CTTCTCTGCCGTAGTCCAATG	0.313																																					p.R212W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C634T	6						.	G	TRP/ARG	0,4406		0,0,2203	102.0	103.0	102.0		634	3.8	0.9	6	dbSNP_134	102	6,8592	4.3+/-15.6	0,6,4293	yes	missense	ME1	NM_002395.4	101	0,6,6496	AA,AG,GG		0.0698,0.0,0.0461	probably-damaging	212/573	84025099	6,12998	2203	4299	6502	84081818	SO:0001583	missense	4199	exon6			X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.634C>T	6.37:g.84025099G>A	ENSP00000358719:p.Arg212Trp		84081818	NM_002395	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	ENST00000369705.3	37	CCDS34492.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.563089	0.65538	0.0	6.98E-4	ENSG00000065833	ENST00000369705;ENST00000541327;ENST00000543031	T;T;T	0.51071	0.72;0.72;0.72	5.76	3.79	0.43588	Malic enzyme, N-terminal (2);	0.044999	0.85682	D	0.000000	T	0.68604	0.3019	H	0.94582	3.555	0.51233	D	0.999912	D	0.89917	1.0	D	0.77004	0.989	T	0.77284	-0.2645	10	0.87932	D	0	-6.1497	10.9295	0.47209	0.0:0.0:0.5255:0.4744	.	212	P48163	MAOX_HUMAN	W	212;46;137	ENSP00000358719:R212W;ENSP00000439912:R46W;ENSP00000446114:R137W	ENSP00000358719:R212W	R	-	1	2	ME1	84081818	1.000000	0.71417	0.853000	0.33588	0.772000	0.43724	3.701000	0.54793	1.419000	0.47118	0.644000	0.83932	CGG		0.313	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041350.1		
SOD2	6648	hgsc.bcm.edu	37	6	160105983	160105983	+	Silent	SNP	G	G	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr6:160105983G>T	ENST00000546087.1	-	6	2115	c.288C>A	c.(286-288)gtC>gtA	p.V96V	SOD2_ENST00000444946.2_Intron|SOD2_ENST00000367054.2_Silent_p.V103V|SOD2_ENST00000538183.2_Silent_p.V142V|SOD2_ENST00000367055.4_Silent_p.V142V|SOD2_ENST00000337404.4_Silent_p.V103V			P04179	SODM_HUMAN	superoxide dismutase 2, mitochondrial	142					age-dependent response to reactive oxygen species (GO:0001315)|cellular response to ethanol (GO:0071361)|detection of oxygen (GO:0003032)|erythrophore differentiation (GO:0048773)|glutathione metabolic process (GO:0006749)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|hydrogen peroxide biosynthetic process (GO:0050665)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|iron ion homeostasis (GO:0055072)|liver development (GO:0001889)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|oxygen homeostasis (GO:0032364)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to lipopolysaccharide (GO:0032496)|response to manganese ion (GO:0010042)|response to selenium ion (GO:0010269)|response to silicon dioxide (GO:0034021)|response to superoxide (GO:0000303)|response to zinc ion (GO:0010043)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure (GO:0003069)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|manganese ion binding (GO:0030145)|oxygen binding (GO:0019825)|superoxide dismutase activity (GO:0004784)	p.V142V(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(3)|skin(1)	14		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)		CTGAGCCTTGGACACCAACAG	0.458																																					p.V103V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C309A	6						.						141.0	125.0	130.0					6																	160105983		2203	4300	6503	160025973	SO:0001819	synonymous_variant	6648	exon3			M36693	CCDS5265.1, CCDS34564.1	6q25	2008-02-05			ENSG00000112096	ENSG00000112096	1.15.1.1		11180	protein-coding gene	gene with protein product		147460					Standard	NM_000636		Approved		uc003qsg.3	P04179	OTTHUMG00000015940	ENST00000546087.1:c.288C>A	6.37:g.160105983G>T			160025973	NM_001024466	B2R7R1|B3KUK2|B4DL20|B4E3K9|E1P5A9|P78434|Q16792|Q5TCM1|Q96EE6|Q9P2Z3	Silent	SNP	ENST00000546087.1	37																																																																																					0.458	SOD2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000399943.1	NM_000636	
MAP2K3	5606	hgsc.bcm.edu	37	17	21204187	21204187	+	Splice_Site	SNP	G	G	T	rs56067280	byFrequency	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr17:21204187G>T	ENST00000342679.4	+	5	530	c.281G>T	c.(280-282)cGg>cTg	p.R94L	MAP2K3_ENST00000316920.6_Splice_Site_p.R65L|MAP2K3_ENST00000361818.5_Splice_Site_p.R65L	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	94	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> L (in dbSNP:rs56067280). {ECO:0000269|PubMed:17344846}.		activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R98L(1)							COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TCCCTGCAGCGGATCCGGGCC	0.607																																					p.R65L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G194T	17						.																																			21144780	SO:0001630	splice_region_variant	5606	exon5			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.280-1G>T	17.37:g.21204187G>T			21144780	NM_002756	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	CCDS11217.1	1092	0.5	246	0.5	181	0.5	286	0.5	379	0.5	G	17.14	3.314111	0.60414	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000526076;ENST00000316920	T;T;D	0.89123	1.09;1.09;-2.47	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.00012	0.0000	N	0.20610	0.595	0.09310	P	0.9999999857583	D	0.58268	0.982	P	0.51487	0.671	T	0.29458	-1.0011	9	0.72032	D	0.01	-28.208	18.4815	0.90813	0.0:0.0:1.0:0.0	rs56067280	94	P46734	MP2K3_HUMAN	L	94;65;65;65;98	ENSP00000345083:R94L;ENSP00000355081:R65L;ENSP00000434068:R65L	ENSP00000319139:R98L	R	+	2	0	MAP2K3	21144780	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.845000	0.86875	2.359000	0.80004	0.655000	0.94253	CGG		0.607	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	Missense_Mutation
TP53	7157	hgsc.bcm.edu	37	17	7578475	7578475	+	Missense_Mutation	SNP	G	G	C	rs137852790|rs137852791|rs587782705		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr17:7578475G>C	ENST00000269305.4	-	5	644	c.455C>G	c.(454-456)cCg>cGg	p.P152R	TP53_ENST00000413465.2_Missense_Mutation_p.P152R|TP53_ENST00000455263.2_Missense_Mutation_p.P152R|TP53_ENST00000420246.2_Missense_Mutation_p.P152R|TP53_ENST00000445888.2_Missense_Mutation_p.P152R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.P152R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	152	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1868473}.|P -> Q (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9450901}.|P -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P152L(66)|p.P152R(8)|p.0?(8)|p.T150fs*16(6)|p.?(5)|p.P153fs*28(5)|p.P152fs*18(5)|p.P152fs*14(5)|p.P152Q(4)|p.P59L(2)|p.P20L(2)|p.P153fs*16(1)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P59R(1)|p.P20R(1)|p.P152fs*28(1)|p.T57fs*16(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.P152fs*27(1)|p.Q144_G154del11(1)|p.Q144fs*16(1)|p.T18fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGTGCCGGGCGGGGGTGTGGA	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P152R	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,thyroid,NS,Substitution - Missense,0	.	132	Substitution - Missense(84)|Deletion - Frameshift(25)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)	large_intestine(22)|central_nervous_system(18)|upper_aerodigestive_tract(15)|oesophagus(10)|skin(9)|haematopoietic_and_lymphoid_tissue(8)|ovary(8)|prostate(8)|urinary_tract(7)|stomach(6)|bone(5)|breast(4)|lung(3)|liver(3)|vulva(2)|soft_tissue(2)|thyroid(1)|adrenal_gland(1)	c.C455G	17	GRCh37	CM941327	TP53	M		.						51.0	52.0	52.0					17																	7578475		2203	4300	6503	7519200	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.455C>G	17.37:g.7578475G>C	ENSP00000269305:p.Pro152Arg		7519200	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463848	0.63513	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99885	-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5;-7.5	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99906	0.9955	M	0.91768	3.24	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.998;1.0;0.996;0.999;0.998;0.994	D	0.96400	0.9296	10	0.87932	D	0	-5.4688	17.4784	0.87667	0.0:0.0:1.0:0.0	.	113;152;152;59;152;152;152	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	152;152;152;152;152;152;141;59;20;59;20;152	ENSP00000410739:P152R;ENSP00000352610:P152R;ENSP00000269305:P152R;ENSP00000398846:P152R;ENSP00000391127:P152R;ENSP00000391478:P152R;ENSP00000425104:P20R;ENSP00000423862:P59R;ENSP00000424104:P152R	ENSP00000269305:P152R	P	-	2	0	TP53	7519200	1.000000	0.71417	0.940000	0.37924	0.022000	0.10575	7.901000	0.87382	2.804000	0.96469	0.655000	0.94253	CCG		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KIF2B	84643	hgsc.bcm.edu	37	17	51901476	51901476	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr17:51901476G>A	ENST00000268919.4	+	1	1238	c.1082G>A	c.(1081-1083)gGg>gAg	p.G361E		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	361	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G361E(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GAGATTTATGGGGGCAAGGTG	0.463																																					p.G361E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1082A	17						.						100.0	103.0	102.0					17																	51901476		2203	4300	6503	49256475	SO:0001583	missense	84643	exon1			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1082G>A	17.37:g.51901476G>A	ENSP00000268919:p.Gly361Glu		49256475	NM_032559	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	37	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466328	0.84425	.	.	ENSG00000141200	ENST00000268919;ENST00000416491	T	0.17213	2.29	5.73	5.73	0.89815	Kinesin, motor domain (4);	0.000000	0.46758	D	0.000265	T	0.48537	0.1505	M	0.88241	2.94	0.49798	D	0.999826	D	0.58970	0.984	P	0.61477	0.889	T	0.54057	-0.8350	10	0.72032	D	0.01	.	19.2577	0.93952	0.0:0.0:1.0:0.0	.	361	Q8N4N8	KIF2B_HUMAN	E	361;249	ENSP00000268919:G361E	ENSP00000268919:G361E	G	+	2	0	KIF2B	49256475	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.567000	0.60850	2.854000	0.98071	0.655000	0.94253	GGG		0.463	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
UQCRC2	7385	hgsc.bcm.edu	37	16	21974131	21974131	+	Missense_Mutation	SNP	C	C	T	rs267604456		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr16:21974131C>T	ENST00000268379.4	+	6	1203	c.439C>T	c.(439-441)Cgt>Tgt	p.R147C	UQCRC2_ENST00000561553.1_Missense_Mutation_p.R147C	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	147					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.R147C(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		ACCAGAATTTCGTCGTTGGGA	0.418																																					p.R147C	Colon(123;450 1645 12841 25393 45623)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C439T	16						.	C	CYS/ARG	1,4395	2.1+/-5.4	0,1,2197	121.0	110.0	114.0		439	3.9	1.0	16		114	0,8600		0,0,4300	no	missense	UQCRC2	NM_003366.2	180	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	147/454	21974131	1,12995	2198	4300	6498	21881632	SO:0001583	missense	7385	exon6			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.439C>T	16.37:g.21974131C>T	ENSP00000268379:p.Arg147Cys		21881632	NM_003366	B3KSN4|Q9BQ05	Missense_Mutation	SNP	ENST00000268379.4	37	CCDS10601.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101301	0.76983	2.27E-4	0.0	ENSG00000140740	ENST00000268379	T	0.30448	1.53	4.88	3.86	0.44501	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52240	0.1722	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.55679	-0.8103	10	0.66056	D	0.02	-4.5497	10.5193	0.44910	0.3412:0.6588:0.0:0.0	.	147	P22695	QCR2_HUMAN	C	147	ENSP00000268379:R147C	ENSP00000268379:R147C	R	+	1	0	UQCRC2	21881632	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	3.683000	0.54663	2.411000	0.81874	0.563000	0.77884	CGT		0.418	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254466.1	NM_003366	
RANBP10	57610	hgsc.bcm.edu	37	16	67768939	67768939	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr16:67768939G>A	ENST00000317506.3	-	6	713	c.598C>T	c.(598-600)Ctc>Ttc	p.L200F	RANBP10_ENST00000602887.1_5'Flank|RANBP10_ENST00000448631.2_Missense_Mutation_p.L144F|RANBP10_ENST00000536251.1_5'UTR|RANBP10_ENST00000602677.1_Missense_Mutation_p.L200F|RANBP10_ENST00000425512.2_Missense_Mutation_p.L68F|RANBP10_ENST00000411657.2_Missense_Mutation_p.L83F	NM_020850.1	NP_065901.1	Q6VN20	RBP10_HUMAN	RAN binding protein 10	200	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				microtubule cytoskeleton organization (GO:0000226)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)	p.L200F(1)		endometrium(5)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		GTGGGGTAGAGGTTGGCCTGA	0.592																																					p.L200F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C598T	16						.						49.0	45.0	46.0					16																	67768939		2198	4300	6498	66326440	SO:0001583	missense	57610	exon6			AB040897	CCDS32469.1	16q22	2008-02-05				ENSG00000141084			29285	protein-coding gene	gene with protein product		614031				14684163	Standard	NM_020850		Approved	KIAA1464	uc002eud.3	Q6VN20		ENST00000317506.3:c.598C>T	16.37:g.67768939G>A	ENSP00000316589:p.Leu200Phe		66326440	NM_020850	A4FTY2|B4DID0|B4DQH9|E7EW27|Q9P264	Missense_Mutation	SNP	ENST00000317506.3	37	CCDS32469.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.742944	0.69418	.	.	ENSG00000141084	ENST00000317506;ENST00000448631;ENST00000411657;ENST00000425512	T;T;T;T	0.74737	-0.87;-0.51;-0.87;-0.87	5.62	2.53	0.30540	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.79907	0.4527	L	0.60845	1.875	0.80722	D	1	D;D;D;D;D	0.89917	0.979;0.99;1.0;1.0;1.0	P;P;D;D;D	0.87578	0.868;0.903;0.998;0.973;0.998	T	0.77054	-0.2730	10	0.48119	T	0.1	-9.3412	6.5959	0.22672	0.2052:0.0:0.6642:0.1306	.	68;200;83;144;200	B4DHL9;B4E1Y2;B4DID0;B4DQH9;Q6VN20	.;.;.;.;RBP10_HUMAN	F	200;144;83;68	ENSP00000316589:L200F;ENSP00000392808:L144F;ENSP00000416460:L83F;ENSP00000410617:L68F	ENSP00000316589:L200F	L	-	1	0	RANBP10	66326440	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.814000	0.48010	0.830000	0.34757	-0.188000	0.12872	CTC		0.592	RANBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467896.1	NM_020850	
CDH2	1000	hgsc.bcm.edu	37	18	25573481	25573481	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr18:25573481C>T	ENST00000269141.3	-	8	1564	c.1141G>A	c.(1141-1143)Gag>Aag	p.E381K	CDH2_ENST00000399380.3_Missense_Mutation_p.E350K	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	381	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.E381K(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCAGTAAACTCTGGAGGATTG	0.438																																					p.E381K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1141A	18						.						294.0	252.0	266.0					18																	25573481		2203	4300	6503	23827479	SO:0001583	missense	1000	exon8			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1141G>A	18.37:g.25573481C>T	ENSP00000269141:p.Glu381Lys		23827479	NM_001792	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	ENST00000269141.3	37	CCDS11891.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029895	0.93575	.	.	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.61040	0.14;0.14	5.87	5.87	0.94306	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.62146	0.2404	N	0.21282	0.65	0.80722	D	1	P;D	0.89917	0.91;1.0	P;D	0.83275	0.489;0.996	T	0.50499	-0.8821	10	0.02654	T	1	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	350;381	A8MWK3;P19022	.;CADH2_HUMAN	K	381;350	ENSP00000269141:E381K;ENSP00000382312:E350K	ENSP00000269141:E381K	E	-	1	0	CDH2	23827479	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	GAG		0.438	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133246.3	NM_001792	
DTNA	1837	hgsc.bcm.edu	37	18	32459673	32459673	+	Missense_Mutation	SNP	C	C	T	rs368868084		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr18:32459673C>T	ENST00000399113.3	+	19	2071	c.2071C>T	c.(2071-2073)Cgt>Tgt	p.R691C	DTNA_ENST00000590831.2_Missense_Mutation_p.R117C|DTNA_ENST00000444659.1_Missense_Mutation_p.R691C|DTNA_ENST00000598334.1_Missense_Mutation_p.R631C|DTNA_ENST00000283365.9_Missense_Mutation_p.R634C|DTNA_ENST00000591182.1_Missense_Mutation_p.R339C|DTNA_ENST00000556414.3_Missense_Mutation_p.R343C|DTNA_ENST00000601125.1_Missense_Mutation_p.R313C|DTNA_ENST00000595022.1_Missense_Mutation_p.R631C|DTNA_ENST00000399097.3_Missense_Mutation_p.R339C|DTNA_ENST00000399121.5_Missense_Mutation_p.R638C|DTNA_ENST00000598142.1_Missense_Mutation_p.R634C|DTNA_ENST00000269190.7_Missense_Mutation_p.R692C|DTNA_ENST00000269192.7_Missense_Mutation_p.R400C			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	691					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R339C(1)|p.R691C(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						AAGTACCATGCGTGGCGACAT	0.433																																					p.R631C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1891T	18						.						66.0	60.0	62.0					18																	32459673		2203	4300	6503	30713671	SO:0001583	missense	1837	exon18			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.2071C>T	18.37:g.32459673C>T	ENSP00000382064:p.Arg691Cys		30713671	NM_001198938	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	37	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887499	0.52014	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000399114;ENST00000269190;ENST00000399097;ENST00000399121;ENST00000444659;ENST00000399113;ENST00000269192;ENST00000450377;ENST00000556414	T;T;T;T	0.19938	2.12;2.11;2.12;2.12	5.12	5.12	0.69794	.	0.294672	0.34725	N	0.003727	T	0.27241	0.0668	N	0.19112	0.55	0.41755	D	0.989684	D;D;D;D;D;D;D;D;D	0.71674	0.995;0.992;0.966;0.986;0.997;0.998;0.988;0.988;0.993	P;P;B;P;P;P;B;B;P	0.55824	0.707;0.785;0.258;0.614;0.656;0.768;0.265;0.265;0.453	T	0.05716	-1.0868	10	0.72032	D	0.01	-4.3178	17.0969	0.86637	0.0:1.0:0.0:0.0	.	343;400;381;691;634;339;638;642;634	B4DIU8;B4DIR0;B7Z3X3;Q9Y4J8;F5H5C1;Q9Y4J8-6;E9PEH8;Q59GK7;Q9Y4J8-2	.;.;.;DTNA_HUMAN;.;.;.;.;.	C	634;634;638;692;339;691;691;691;400;339;343	ENSP00000283365:R634C;ENSP00000269190:R692C;ENSP00000405819:R691C;ENSP00000382064:R691C	ENSP00000269190:R692C	R	+	1	0	DTNA	30713671	1.000000	0.71417	0.950000	0.38849	0.077000	0.17291	5.523000	0.67099	2.545000	0.85829	0.655000	0.94253	CGT		0.433	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
PLXNB1	5364	hgsc.bcm.edu	37	3	48465392	48465392	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr3:48465392C>T	ENST00000358536.4	-	3	898	c.629G>A	c.(628-630)cGc>cAc	p.R210H	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Missense_Mutation_p.R210H|PLXNB1_ENST00000456774.1_Missense_Mutation_p.R210H|PLXNB1_ENST00000296440.6_Missense_Mutation_p.R210H	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	210	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.R210H(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTCGGAGAGGCGGCCCACTGC	0.657																																					p.R210H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G629A	3						.						23.0	23.0	23.0					3																	48465392		2202	4300	6502	48440396	SO:0001583	missense	5364	exon3			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.629G>A	3.37:g.48465392C>T	ENSP00000351338:p.Arg210His		48440396	NM_002673	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	37	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	C	8.615	0.889983	0.17540	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.10005	2.92;2.92;2.92;2.92	4.41	2.61	0.31194	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.64402	D	0.000001	T	0.09555	0.0235	M	0.72479	2.2	0.80722	D	1	B;P	0.43909	0.104;0.821	B;B	0.32928	0.041;0.155	T	0.29941	-0.9995	10	0.15499	T	0.54	.	9.2539	0.37571	0.0:0.8237:0.0:0.1763	.	210;210	O43157;O43157-2	PLXB1_HUMAN;.	H	210	ENSP00000296440:R210H;ENSP00000351242:R210H;ENSP00000351338:R210H;ENSP00000414199:R210H	ENSP00000296440:R210H	R	-	2	0	PLXNB1	48440396	1.000000	0.71417	0.998000	0.56505	0.130000	0.20726	4.021000	0.57196	0.327000	0.23409	-0.229000	0.12294	CGC		0.657	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
SLC9A9	285195	hgsc.bcm.edu	37	3	143292939	143292939	+	Missense_Mutation	SNP	C	C	T	rs544613454		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr3:143292939C>T	ENST00000316549.6	-	8	1199	c.991G>A	c.(991-993)Ggc>Agc	p.G331S		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	331					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)	p.G331S(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						CCTGTTAGGCCGGCAGCCTCG	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		19456	0.001		0.0	False		,,,				2504	0.0				p.G331S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G991A	3						.						50.0	49.0	49.0					3																	143292939		2203	4300	6503	144775629	SO:0001583	missense	285195	exon8			AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.991G>A	3.37:g.143292939C>T	ENSP00000320246:p.Gly331Ser		144775629	NM_173653	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.906962	0.92107	.	.	ENSG00000181804	ENST00000316549;ENST00000450105	T	0.25250	1.81	5.39	3.6	0.41247	Cation/H+ exchanger (1);	0.081780	0.51477	N	0.000088	T	0.19685	0.0473	L	0.43152	1.355	0.58432	D	0.999997	P	0.46621	0.881	B	0.39531	0.302	T	0.02736	-1.1117	10	0.18276	T	0.48	.	11.6467	0.51265	0.0:0.8562:0.0:0.1438	.	331	Q8IVB4	SL9A9_HUMAN	S	331;214	ENSP00000320246:G331S	ENSP00000320246:G331S	G	-	1	0	SLC9A9	144775629	0.990000	0.36364	0.925000	0.36789	0.961000	0.63080	2.902000	0.48703	0.651000	0.30788	0.563000	0.77884	GGC		0.537	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653	
KRAS	3845	hgsc.bcm.edu	37	12	25378561	25378561	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr12:25378561G>A	ENST00000256078.4	-	4	500	c.437C>T	c.(436-438)gCa>gTa	p.A146V	AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000311936.3_Missense_Mutation_p.A146V|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146V(20)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			TCTTGTCTTTGCTGATGTTTC	0.318		119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,large_intestine,NS,Substitution - Missense,-1	.	20	Substitution - Missense(20)	large_intestine(17)|thyroid(2)|haematopoietic_and_lymphoid_tissue(1)	c.C437T	12						.						207.0	188.0	194.0					12																	25378561		2203	4300	6503	25269828	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.437C>T	12.37:g.25378561G>A	ENSP00000256078:p.Ala146Val		25269828	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	G	33	5.217565	0.95104	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88818	-2.43;-2.43	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.95236	0.8455	M	0.90595	3.13	0.80722	D	1	D;D	0.76494	0.999;0.998	P;D	0.62955	0.802;0.909	D	0.95726	0.8770	10	0.87932	D	0	.	18.7849	0.91951	0.0:0.0:1.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	V	146	ENSP00000308495:A146V;ENSP00000256078:A146V	ENSP00000256078:A146V	A	-	2	0	KRAS	25269828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.795000	0.99099	2.757000	0.94681	0.585000	0.79938	GCA		0.318	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
MAP3K12	7786	hgsc.bcm.edu	37	12	53877728	53877728	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr12:53877728T>C	ENST00000267079.2	-	9	1451	c.1226A>G	c.(1225-1227)gAg>gGg	p.E409G	MAP3K12_ENST00000547035.1_Missense_Mutation_p.E442G|MAP3K12_ENST00000547488.1_Missense_Mutation_p.E442G|MAP3K12_ENST00000547151.1_5'Flank	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	409	Leucine-zipper 1.		E -> K (in a breast pleomorphic lobular carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E409G(1)		NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						CACCAGTTCCTCTTCTAGGCG	0.512																																					p.E442G												MAP3K12,breast,NS,Substitution - Missense,-1	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1325G	12						.						192.0	185.0	187.0					12																	53877728		2203	4300	6503	52163995	SO:0001583	missense	7786	exon8			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.1226A>G	12.37:g.53877728T>C	ENSP00000267079:p.Glu409Gly		52163995	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	37	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.910583	0.92107	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.79247	-1.23;-1.25;-1.25	4.85	4.85	0.62838	Protein kinase-like domain (1);	0.149661	0.31268	N	0.007941	D	0.84800	0.5552	M	0.66939	2.045	0.80722	D	1	D;D	0.58970	0.984;0.972	P;P	0.61201	0.885;0.771	D	0.86699	0.1928	10	0.87932	D	0	.	13.8578	0.63540	0.0:0.0:0.0:1.0	.	442;409	G3V1Y2;Q12852	.;M3K12_HUMAN	G	409;442;442	ENSP00000267079:E409G;ENSP00000449038:E442G;ENSP00000448689:E442G	ENSP00000267079:E409G	E	-	2	0	MAP3K12	52163995	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.636000	0.83301	2.180000	0.69256	0.379000	0.24179	GAG		0.512	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
TMTC3	160418	hgsc.bcm.edu	37	12	88542103	88542103	+	Missense_Mutation	SNP	T	T	C	rs148019384		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr12:88542103T>C	ENST00000266712.6	+	2	231	c.11T>C	c.(10-12)aTt>aCt	p.I4T		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	4					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)		p.I4T(1)		NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						ATGGCTAATATTAACCTAAAA	0.308																																					p.I4T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T11C	12						.	T	THR/ILE	0,4406		0,0,2203	103.0	100.0	101.0		11	5.2	1.0	12	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	missense	TMTC3	NM_181783.3	89	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	4/915	88542103	1,13005	2203	4300	6503	87066234	SO:0001583	missense	160418	exon2				CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.11T>C	12.37:g.88542103T>C	ENSP00000266712:p.Ile4Thr		87066234	NM_181783	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	ENST00000266712.6	37	CCDS9032.1	.	.	.	.	.	.	.	.	.	.	T	15.84	2.952042	0.53293	0.0	1.16E-4	ENSG00000139324	ENST00000549011;ENST00000266712;ENST00000551088	T	0.64618	-0.11	5.19	5.19	0.71726	.	0.352416	0.32687	N	0.005767	T	0.52224	0.1721	L	0.36672	1.1	0.46901	D	0.99924	B	0.26547	0.152	B	0.28011	0.085	T	0.47649	-0.9101	10	0.15952	T	0.53	-11.9846	15.3431	0.74314	0.0:0.0:0.0:1.0	.	4	Q6ZXV5-2	.	T	4	ENSP00000266712:I4T	ENSP00000266712:I4T	I	+	2	0	TMTC3	87066234	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	6.947000	0.75959	2.087000	0.62958	0.477000	0.44152	ATT		0.308	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406421.1	NM_181783	
ATP10A	57194	hgsc.bcm.edu	37	15	25928516	25928516	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr15:25928516C>T	ENST00000356865.6	-	17	3520	c.3409G>A	c.(3409-3411)Gtg>Atg	p.V1137M		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1137					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V1137M(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ACCCCAGTCACGAGCGGGGGA	0.522																																					p.V1137M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3409A	15						.						74.0	67.0	69.0					15																	25928516		2203	4300	6503	23479609	SO:0001583	missense	57194	exon17			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3409G>A	15.37:g.25928516C>T	ENSP00000349325:p.Val1137Met		23479609	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239248	0.58995	.	.	ENSG00000206190	ENST00000356865	D	0.89050	-2.46	4.81	3.67	0.42095	.	0.113555	0.64402	D	0.000020	T	0.81259	0.4785	L	0.47190	1.495	0.39777	D	0.972249	P	0.51653	0.947	B	0.38616	0.277	T	0.81531	-0.0890	10	0.52906	T	0.07	-31.1609	5.6533	0.17629	0.0:0.6856:0.0:0.3144	.	1137	O60312	AT10A_HUMAN	M	1137	ENSP00000349325:V1137M	ENSP00000349325:V1137M	V	-	1	0	ATP10A	23479609	0.791000	0.28800	0.990000	0.47175	0.589000	0.36550	1.259000	0.32956	2.205000	0.71048	0.655000	0.94253	GTG		0.522	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
PPP3CA	5530	hgsc.bcm.edu	37	4	101947108	101947108	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr4:101947108C>T	ENST00000394854.3	-	14	2163	c.1480G>A	c.(1480-1482)Gcc>Acc	p.A494T	PPP3CA_ENST00000523694.2_Missense_Mutation_p.A427T|PPP3CA_ENST00000394853.4_Missense_Mutation_p.A484T|PPP3CA_ENST00000323055.6_Missense_Mutation_p.A442T|PPP3CA_ENST00000512215.1_Missense_Mutation_p.A262T|PPP3CA_ENST00000507176.1_Missense_Mutation_p.A396T	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	494					calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)	p.A494T(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		TTAAGGTTGGCGTCAGAGGGC	0.493																																					p.A484T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1450A	4						.						243.0	226.0	232.0					4																	101947108		2203	4300	6503	102166131	SO:0001583	missense	5530	exon13				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1480G>A	4.37:g.101947108C>T	ENSP00000378323:p.Ala494Thr		102166131	NM_001130691	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	37	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.554077	0.65425	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853;ENST00000507176;ENST00000523694	T;T;T;T;T;T	0.45668	0.89;2.49;2.5;2.5;2.24;2.5	6.06	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.26882	0.0658	N	0.14661	0.345	0.53005	D	0.999963	P;P;P;P;B;B	0.50710	0.454;0.938;0.454;0.589;0.318;0.318	B;B;B;B;B;B	0.40285	0.075;0.325;0.075;0.157;0.047;0.048	T	0.03829	-1.1000	10	0.20519	T	0.43	-4.6924	15.6511	0.77095	0.0:0.9344:0.0:0.0656	.	494;262;442;484;396;427	Q08209;A8W6Z8;A8W6Z7;Q08209-2;E7ETC2;A1A441	PP2BA_HUMAN;.;.;.;.;.	T	262;494;442;484;396;427	ENSP00000422781:A262T;ENSP00000378323:A494T;ENSP00000320580:A442T;ENSP00000378322:A484T;ENSP00000422990:A396T;ENSP00000429350:A427T	ENSP00000320580:A442T	A	-	1	0	PPP3CA	102166131	1.000000	0.71417	0.977000	0.42913	0.997000	0.91878	3.821000	0.55700	1.570000	0.49709	0.655000	0.94253	GCC		0.493	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
GSTCD	79807	hgsc.bcm.edu	37	4	106744148	106744148	+	Silent	SNP	A	A	G			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr4:106744148A>G	ENST00000515279.1	+	6	1498	c.1278A>G	c.(1276-1278)caA>caG	p.Q426Q	GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000394728.3_Silent_p.Q426Q|RP11-45L9.1_ENST00000504955.1_RNA|RP11-45L9.1_ENST00000509003.1_RNA|GSTCD_ENST00000394730.3_Silent_p.Q339Q|RP11-45L9.1_ENST00000506527.1_RNA|GSTCD_ENST00000360505.5_Silent_p.Q426Q			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	426						extracellular vesicular exosome (GO:0070062)		p.Q339Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GGAAGCAGCAACAGTTGAACA	0.408																																					p.Q339Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1017G	4						.						186.0	166.0	173.0					4																	106744148		2203	4300	6503	106963597	SO:0001819	synonymous_variant	79807	exon6			BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1278A>G	4.37:g.106744148A>G			106963597	NM_024751	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Silent	SNP	ENST00000515279.1	37	CCDS43257.1																																																																																				0.408	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
CTSO	1519	hgsc.bcm.edu	37	4	156849556	156849556	+	Missense_Mutation	SNP	C	C	T	rs138871272		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr4:156849556C>T	ENST00000433477.3	-	7	932	c.863G>A	c.(862-864)cGg>cAg	p.R288Q		NM_001334.2	NP_001325.1	P43235	CATK_HUMAN	cathepsin O	295					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)	p.R288Q(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|prostate(1)	16	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		CCAGGAATTCCGCACAATCCA	0.348																																					p.R288Q	Pancreas(148;2303 2598 8989 35298)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G863A	4						.	C	GLN/ARG	3,4403	6.2+/-15.9	0,3,2200	101.0	92.0	95.0		863	5.6	1.0	4	dbSNP_134	95	0,8600		0,0,4300	no	missense	CTSO	NM_001334.2	43	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	probably-damaging	288/322	156849556	3,13003	2203	4300	6503	157069006	SO:0001583	missense	1519	exon7			X77383	CCDS3794.1	4q32.1	2012-10-03			ENSG00000256043	ENSG00000256043		"""Cathepsins"""	2542	protein-coding gene	gene with protein product		600550		CTSO1		9790772	Standard	NM_001334		Approved		uc003ipg.3	P43234	OTTHUMG00000161942	ENST00000433477.3:c.863G>A	4.37:g.156849556C>T	ENSP00000414904:p.Arg288Gln		157069006	NM_001334	Q6FHS6	Missense_Mutation	SNP	ENST00000433477.3	37	CCDS3794.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530247	0.64860	6.81E-4	0.0	ENSG00000256043	ENST00000433477	T	0.34859	1.34	5.56	5.56	0.83823	Peptidase C1A, papain C-terminal (3);	0.194855	0.46442	D	0.000281	T	0.41581	0.1165	L	0.58302	1.8	0.39707	D	0.971271	P	0.50710	0.938	P	0.49953	0.627	T	0.45991	-0.9223	10	0.87932	D	0	.	7.2793	0.26302	0.0:0.7949:0.0:0.2051	.	288	P43234	CATO_HUMAN	Q	288	ENSP00000414904:R288Q	ENSP00000281527:R288Q	R	-	2	0	CTSO	157069006	0.997000	0.39634	0.990000	0.47175	0.744000	0.42396	2.244000	0.43124	2.624000	0.88883	0.650000	0.86243	CGG		0.348	CTSO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366469.1	NM_001334	
ZNF645	158506	hgsc.bcm.edu	37	X	22292068	22292068	+	Silent	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chrX:22292068C>T	ENST00000323684.1	+	1	1004	c.960C>T	c.(958-960)taC>taT	p.Y320Y		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	320	Pro-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.Y320Y(1)		cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						CCACGACCTACGATCCATCAT	0.458																																					p.Y320Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C960T	X						.						131.0	106.0	114.0					X																	22292068		2203	4300	6503	22201989	SO:0001819	synonymous_variant	158506	exon1			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.960C>T	X.37:g.22292068C>T			22201989	NM_152577	A0AV29|A0AV31|E3SBK4|Q6DJY9	Silent	SNP	ENST00000323684.1	37	CCDS14205.1																																																																																				0.458	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056037.1	NM_152577	
SRPX	8406	hgsc.bcm.edu	37	X	38009100	38009100	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chrX:38009100T>C	ENST00000378533.3	-	10	1365	c.1259A>G	c.(1258-1260)gAt>gGt	p.D420G	SRPX_ENST00000544439.1_Missense_Mutation_p.D400G|TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000343800.6_Missense_Mutation_p.D407G|SRPX_ENST00000538295.1_Silent_p.G379G|SRPX_ENST00000479015.1_5'UTR|SRPX_ENST00000432886.2_Missense_Mutation_p.D361G	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	420					autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.D420G(1)		autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						GCCATGCTTATCCACTAGCAC	0.493																																					p.D420G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1259G	X						.						145.0	90.0	109.0					X																	38009100		2202	4300	6502	37894044	SO:0001583	missense	8406	exon10			U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.1259A>G	X.37:g.38009100T>C	ENSP00000367794:p.Asp420Gly		37894044	NM_006307	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Missense_Mutation	SNP	ENST00000378533.3	37	CCDS14245.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.684166	0.88639	.	.	ENSG00000101955	ENST00000544439;ENST00000432886;ENST00000378533;ENST00000343800	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.40862	0.1134	L	0.31207	0.915	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.995;0.999	T	0.32798	-0.9893	10	0.87932	D	0	-18.4398	15.4637	0.75381	0.0:0.0:0.0:1.0	.	361;400;420	B4DQH5;G3V1L0;P78539	.;.;SRPX_HUMAN	G	400;361;420;407	ENSP00000440758:D400G;ENSP00000411165:D361G;ENSP00000367794:D420G;ENSP00000339211:D407G	ENSP00000339211:D407G	D	-	2	0	SRPX	37894044	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.626000	0.83164	2.036000	0.60181	0.486000	0.48141	GAT		0.493	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056243.1	NM_006307	
OPHN1	4983	hgsc.bcm.edu	37	X	67283720	67283720	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chrX:67283720G>A	ENST00000355520.5	-	21	2775	c.2134C>T	c.(2134-2136)Cgg>Tgg	p.R712W	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Intron	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	712	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)	p.R712W(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						GCCAGGGGCCGGGGAGCTGGT	0.577																																					p.R712W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2134T	X						.						24.0	20.0	22.0					X																	67283720		2195	4281	6476	67200445	SO:0001583	missense	4983	exon21			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.2134C>T	X.37:g.67283720G>A	ENSP00000347710:p.Arg712Trp		67200445	NM_002547	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	ENST00000355520.5	37	CCDS14388.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.065129	0.55432	.	.	ENSG00000079482	ENST00000355520	T	0.53423	0.62	5.04	1.54	0.23209	.	0.291572	0.30338	N	0.009848	T	0.45796	0.1360	N	0.19112	0.55	0.20196	N	0.999924	D	0.76494	0.999	P	0.60609	0.877	T	0.37430	-0.9706	10	0.66056	D	0.02	.	10.2416	0.43316	0.0:0.0:0.3508:0.6492	.	712	O60890	OPHN1_HUMAN	W	712	ENSP00000347710:R712W	ENSP00000347710:R712W	R	-	1	2	OPHN1	67200445	0.912000	0.30974	0.267000	0.24556	0.821000	0.46438	0.776000	0.26704	0.364000	0.24374	0.506000	0.49869	CGG		0.577	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057011.1	NM_002547	
AMOT	154796	hgsc.bcm.edu	37	X	112022804	112022804	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chrX:112022804G>A	ENST00000524145.1	-	11	2652	c.2578C>T	c.(2578-2580)Cga>Tga	p.R860*	AMOT_ENST00000371962.1_Nonsense_Mutation_p.R628*|AMOT_ENST00000304758.1_Nonsense_Mutation_p.R451*|AMOT_ENST00000371959.3_Nonsense_Mutation_p.R860*|MIR4329_ENST00000582643.1_RNA			Q4VCS5	AMOT_HUMAN	angiomotin	860					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.R451*(1)|p.R860*(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						CTGCAGTCTCGGCTGCCTGTC	0.592																																					p.R451X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1351T	X						.						105.0	73.0	84.0					X																	112022804		2203	4300	6503	111909460	SO:0001587	stop_gained	154796	exon11			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2578C>T	X.37:g.112022804G>A	ENSP00000429013:p.Arg860*		111909460	NM_133265	Q504X5|Q9HD27|Q9UPT1	Nonsense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	G	38	6.802785	0.97849	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214	.	.	.	5.5	5.5	0.81552	.	0.126462	0.51477	D	0.000089	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-3.5806	12.0864	0.53700	0.0:0.0:0.7087:0.2913	.	.	.	.	X	451;860;628;860;100	.	ENSP00000305557:R451X	R	-	1	2	AMOT	111909460	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.741000	0.38238	2.305000	0.77605	0.529000	0.55759	CGA		0.592	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
FAM49A	81553	hgsc.bcm.edu	37	2	16734217	16734217	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr2:16734217G>T	ENST00000381323.3	-	12	1179	c.959C>A	c.(958-960)gCa>gAa	p.A320E	FAM49A_ENST00000406434.1_Missense_Mutation_p.A320E|FAM49A_ENST00000355549.2_Missense_Mutation_p.A320E	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	320						intracellular (GO:0005622)		p.A320E(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CTGAAGCATTGCTCGAATCTG	0.398																																					p.A320E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C959A	2						.						212.0	185.0	194.0					2																	16734217		2203	4300	6503	16597698	SO:0001583	missense	81553	exon12			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.959C>A	2.37:g.16734217G>T	ENSP00000370724:p.Ala320Glu		16597698	NM_030797	B3KNZ1|Q53QW2	Missense_Mutation	SNP	ENST00000381323.3	37	CCDS1688.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151208	0.57151	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	T;T;T	0.44881	0.91;0.91;0.91	5.66	5.66	0.87406	.	0.146062	0.64402	D	0.000009	T	0.41696	0.1170	L	0.58101	1.795	0.51233	D	0.999917	B	0.24092	0.097	B	0.23150	0.044	T	0.26985	-1.0087	10	0.13853	T	0.58	-16.9606	19.1332	0.93415	0.0:0.0:1.0:0.0	.	320	Q9H0Q0	FA49A_HUMAN	E	320	ENSP00000370724:A320E;ENSP00000384771:A320E;ENSP00000347744:A320E	ENSP00000347744:A320E	A	-	2	0	FAM49A	16597698	1.000000	0.71417	0.976000	0.42696	0.988000	0.76386	6.597000	0.74118	2.840000	0.97914	0.655000	0.94253	GCA		0.398	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207203.2	NM_030797	
SLC30A3	7781	hgsc.bcm.edu	37	2	27479665	27479665	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr2:27479665G>A	ENST00000233535.4	-	6	1226	c.874C>T	c.(874-876)Ctc>Ttc	p.L292F	SLC30A3_ENST00000447008.2_Missense_Mutation_p.L287F	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	292					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)	p.L292F(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTTCCATGAGGATTCGAAGA	0.562																																					p.L292F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C874T	2						.						73.0	78.0	76.0					2																	27479665		2203	4300	6503	27333169	SO:0001583	missense	7781	exon6			U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.874C>T	2.37:g.27479665G>A	ENSP00000233535:p.Leu292Phe		27333169	NM_003459	Q8TC03	Missense_Mutation	SNP	ENST00000233535.4	37	CCDS1743.1	.	.	.	.	.	.	.	.	.	.	G	33	5.215880	0.95104	.	.	ENSG00000115194	ENST00000233535;ENST00000447008;ENST00000445870	D;D	0.84873	-1.91;-1.91	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.92763	0.7699	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93574	0.6906	10	0.87932	D	0	-26.2992	16.6997	0.85345	0.0:0.0:1.0:0.0	.	287;292	F5H3B7;Q99726	.;ZNT3_HUMAN	F	292;287;229	ENSP00000233535:L292F;ENSP00000415226:L287F	ENSP00000233535:L292F	L	-	1	0	SLC30A3	27333169	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.739000	0.84976	2.616000	0.88540	0.555000	0.69702	CTC		0.562	SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250189.2		
SPDYA	245711	hgsc.bcm.edu	37	2	29045231	29045231	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr2:29045231A>C	ENST00000334056.5	+	5	524	c.335A>C	c.(334-336)aAa>aCa	p.K112T	SPDYA_ENST00000462832.1_3'UTR|SPDYA_ENST00000379579.4_Missense_Mutation_p.K112T	NM_182756.3	NP_877433.2			speedy/RINGO cell cycle regulator family member A									p.K112T(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					AAGAGGGCTAAATTTACTATA	0.264																																					p.K112T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A335C	2						.						53.0	53.0	53.0					2																	29045231		2178	4248	6426	28898735	SO:0001583	missense	245711	exon5			AA424209	CCDS1767.2	2p23	2013-05-08	2013-05-08	2006-03-31	ENSG00000163806	ENSG00000163806		"""Speedy homologs"""	30613	protein-coding gene	gene with protein product		614029	"""speedy homolog 1 (Drosophila)"", ""speedy homolog A (Xenopus laevis)"""	SPDY1		11980914, 12839962, 15611625	Standard	NM_182756		Approved	SPY1, Ringo3	uc002rmk.3	Q5MJ70	OTTHUMG00000074041	ENST00000334056.5:c.335A>C	2.37:g.29045231A>C	ENSP00000335628:p.Lys112Thr		28898735	NM_182756		Missense_Mutation	SNP	ENST00000334056.5	37	CCDS1767.2	.	.	.	.	.	.	.	.	.	.	A	13.93	2.384279	0.42308	.	.	ENSG00000163806	ENST00000379579;ENST00000334056;ENST00000449210	.	.	.	5.32	4.17	0.49024	.	0.417565	0.23155	U	0.051313	T	0.24314	0.0589	L	0.29908	0.895	0.27599	N	0.949034	P;P	0.39424	0.673;0.491	B;B	0.36608	0.229;0.146	T	0.10405	-1.0631	9	0.48119	T	0.1	-30.8646	7.6914	0.28569	0.7705:0.0:0.2295:0.0	.	112;112	Q5MJ70;Q5MJ70-1	SPDYA_HUMAN;.	T	112	.	ENSP00000335628:K112T	K	+	2	0	SPDYA	28898735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.019000	0.41001	0.968000	0.38212	0.477000	0.44152	AAA		0.264	SPDYA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157171.1	NM_182756	
SLC25A12	8604	hgsc.bcm.edu	37	2	172641848	172641848	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr2:172641848G>A	ENST00000422440.2	-	18	2010	c.1973C>T	c.(1972-1974)cCg>cTg	p.P658L	SLC25A12_ENST00000392592.4_Missense_Mutation_p.P551L	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	658					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)	p.P658L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	CTTAAATTTCGGGAGATAAAG	0.507																																					p.P658L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1973T	2						.						137.0	128.0	131.0					2																	172641848		2203	4300	6503	172350094	SO:0001583	missense	8604	exon18			Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1973C>T	2.37:g.172641848G>A	ENSP00000388658:p.Pro658Leu		172350094	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	37	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008237	0.93346	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	D;D	0.87491	-2.03;-2.26	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.94735	0.8301	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93482	0.6828	10	0.46703	T	0.11	-11.7866	20.8598	0.99761	0.0:0.0:1.0:0.0	.	551;658	B3KR64;O75746	.;CMC1_HUMAN	L	658;551	ENSP00000388658:P658L;ENSP00000376371:P551L	ENSP00000376371:P551L	P	-	2	0	SLC25A12	172350094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.937000	0.99478	0.650000	0.86243	CCG		0.507	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
FRMPD1	22844	hgsc.bcm.edu	37	9	37740790	37740790	+	Silent	SNP	C	C	G			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr9:37740790C>G	ENST00000539465.1	+	15	2858	c.2265C>G	c.(2263-2265)gcC>gcG	p.A755A	FRMPD1_ENST00000377765.3_Silent_p.A755A|FRMPD1_ENST00000536622.1_Silent_p.A577A|FRMPD1_ENST00000541302.1_Silent_p.A624A|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	755						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.A755A(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AACCCCTGGCCCTGCACCCAC	0.652																																					p.A755A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2265G	9						.						36.0	37.0	37.0					9																	37740790		2203	4300	6503	37730790	SO:0001819	synonymous_variant	22844	exon15			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.2265C>G	9.37:g.37740790C>G			37730790	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	ENST00000539465.1	37	CCDS6612.1																																																																																				0.652	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PTCH1	5727	hgsc.bcm.edu	37	9	98231267	98231267	+	Silent	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr9:98231267C>T	ENST00000331920.6	-	14	2315	c.2016G>A	c.(2014-2016)acG>acA	p.T672T	PTCH1_ENST00000375274.2_Silent_p.T671T|PTCH1_ENST00000421141.1_Silent_p.T521T|PTCH1_ENST00000437951.1_Silent_p.T606T|PTCH1_ENST00000430669.2_Silent_p.T606T|PTCH1_ENST00000429896.2_Silent_p.T521T|PTCH1_ENST00000418258.1_Silent_p.T521T	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	672					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.T672T(4)|p.T671T(3)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AGTACACGTGCGTGTGGGGGT	0.627																																					p.T521T												.	.	7	Substitution - coding silent(7)	large_intestine(7)	c.G1563A	9	GRCh37	CI050947	PTCH1	I		.						160.0	147.0	152.0					9																	98231267		2203	4300	6503	97271088	SO:0001819	synonymous_variant	5727	exon14			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2016G>A	9.37:g.98231267C>T			97271088	NM_001083605	A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	ENST00000331920.6	37	CCDS6714.1																																																																																				0.627	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053229.2	NM_000264	
COL5A1	1289	hgsc.bcm.edu	37	9	137591755	137591755	+	Splice_Site	SNP	C	C	T	rs41306397	byFrequency	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr9:137591755C>T	ENST00000371817.3	+	3	692	c.278C>T	c.(277-279)gCg>gTg	p.A93V	COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	93	Laminin G-like.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.A93V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TCTGTTCCAGCGTCTGCATTT	0.587													C|||	5	0.000998403	0.0	0.0029	5008	,	,		16831	0.0		0.002	False		,,,				2504	0.001				p.A93V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C278T	9						.	C	VAL/ALA	5,4401	9.9+/-24.2	0,5,2198	78.0	73.0	75.0		278	3.9	0.8	9	dbSNP_127	75	27,8573	19.2+/-60.6	0,27,4273	yes	missense-near-splice	COL5A1	NM_000093.3	64	0,32,6471	TT,TC,CC		0.314,0.1135,0.246	benign	93/1839	137591755	32,12974	2203	4300	6503	136731576	SO:0001630	splice_region_variant	1289	exon3			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.278-1C>T	9.37:g.137591755C>T			136731576	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	3	0.0013736263736263737	0	0.0	1	0.0027624309392265192	0	0.0	2	0.002638522427440633	C	12.74	2.028929	0.35797	0.001135	0.00314	ENSG00000130635	ENST00000371817	T	0.02323	4.34	4.81	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.354834	0.24720	U	0.036144	T	0.01800	0.0057	N	0.12182	0.205	0.26201	N	0.979441	B	0.12630	0.006	B	0.08055	0.003	T	0.47341	-0.9125	9	.	.	.	.	7.9591	0.30060	0.166:0.7528:0.0:0.0812	rs41306397	93	P20908	CO5A1_HUMAN	V	93	ENSP00000360882:A93V	.	A	+	2	0	COL5A1	136731576	0.820000	0.29190	0.766000	0.31476	0.190000	0.23558	1.372000	0.34261	1.082000	0.41137	0.655000	0.94253	GCG		0.587	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	Missense_Mutation
NALCN	259232	hgsc.bcm.edu	37	13	101762984	101762984	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr13:101762984T>C	ENST00000251127.6	-	20	2431	c.2350A>G	c.(2350-2352)Act>Gct	p.T784A		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	784					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.T784A(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGAGTCAAAGTTTCAAGAGAT	0.373																																					p.T784A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2350G	13						.						167.0	153.0	158.0					13																	101762984		2203	4300	6503	100560985	SO:0001583	missense	259232	exon20			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2350A>G	13.37:g.101762984T>C	ENSP00000251127:p.Thr784Ala		100560985	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	37	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	T	10.59	1.393135	0.25118	.	.	ENSG00000102452	ENST00000251127	D	0.97480	-4.4	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.92743	0.7693	N	0.22421	0.69	0.80722	D	1	B	0.26318	0.146	B	0.26094	0.066	D	0.90583	0.4531	10	0.08381	T	0.77	.	15.6584	0.77162	0.0:0.0:0.0:1.0	.	784	Q8IZF0	NALCN_HUMAN	A	784	ENSP00000251127:T784A	ENSP00000251127:T784A	T	-	1	0	NALCN	100560985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.106000	0.64143	0.454000	0.30748	ACT		0.373	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
GPC5	2262	hgsc.bcm.edu	37	13	92380835	92380835	+	Missense_Mutation	SNP	G	G	A	rs199631822		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr13:92380835G>A	ENST00000377067.3	+	4	1442	c.1070G>A	c.(1069-1071)cGt>cAt	p.R357H	GPC5_ENST00000483422.1_3'UTR	NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	357					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.R357H(1)		NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CAAAGCCCCCGTTGTTCTTTT	0.408													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14209	0.0		0.0	False		,,,				2504	0.0				p.R357H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1070A	13						.						125.0	129.0	128.0					13																	92380835		2203	4300	6503	91178836	SO:0001583	missense	2262	exon4			AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.1070G>A	13.37:g.92380835G>A	ENSP00000366267:p.Arg357His		91178836	NM_004466	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	ENST00000377067.3	37	CCDS9468.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	8.211	0.800329	0.16397	.	.	ENSG00000179399	ENST00000377067	T	0.55052	0.54	5.88	-2.59	0.06209	.	1.139230	0.06161	N	0.675933	T	0.37073	0.0990	L	0.35854	1.095	0.09310	N	1	B	0.13145	0.007	B	0.13407	0.009	T	0.20739	-1.0266	10	0.15066	T	0.55	-2.7689	6.8158	0.23829	0.4537:0.2053:0.3411:0.0	.	357	P78333	GPC5_HUMAN	H	357	ENSP00000366267:R357H	ENSP00000366267:R357H	R	+	2	0	GPC5	91178836	0.000000	0.05858	0.017000	0.16124	0.985000	0.73830	-0.242000	0.08928	-0.679000	0.05217	-0.259000	0.10710	CGT		0.408	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045454.1	NM_004466	
TMCO3	55002	hgsc.bcm.edu	37	13	114193725	114193725	+	Silent	SNP	G	G	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr13:114193725G>A	ENST00000434316.2	+	10	1952	c.1593G>A	c.(1591-1593)gcG>gcA	p.A531A	TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	531						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.A531A(1)		NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			TGGCTGGAGCGCTCGTCTCCT	0.612																																					p.A531A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1593A	13						.						112.0	91.0	98.0					13																	114193725		2203	4300	6503	113241726	SO:0001819	synonymous_variant	55002	exon10			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1593G>A	13.37:g.114193725G>A			113241726	NM_017905	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Silent	SNP	ENST00000434316.2	37	CCDS9537.1																																																																																				0.612	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
BEND7	222389	hgsc.bcm.edu	37	10	13542067	13542067	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr10:13542067C>T	ENST00000396900.2	-	3	158	c.159G>A	c.(157-159)atG>atA	p.M53I	BEND7_ENST00000341083.3_Start_Codon_SNP_p.M1I|BEND7_ENST00000378605.3_Start_Codon_SNP_p.M1I|BEND7_ENST00000396898.2_Missense_Mutation_p.M53I			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	53						extracellular vesicular exosome (GO:0070062)		p.M1I(2)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						TTTTTATTTCCATGCTTTCAT	0.388																																					p.M1I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3A	10						.						95.0	98.0	97.0					10																	13542067		2203	4300	6503	13582073	SO:0001583	missense	222389	exon3			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.159G>A	10.37:g.13542067C>T	ENSP00000380108:p.Met53Ile		13582073	NM_152751	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Missense_Mutation	SNP	ENST00000396900.2	37		.	.	.	.	.	.	.	.	.	.	C	17.42	3.386354	0.61956	.	.	ENSG00000165626	ENST00000396900;ENST00000341083;ENST00000396898;ENST00000378605	T;T;T;T	0.54866	0.82;0.55;0.86;0.63	5.63	5.63	0.86233	.	0.081003	0.85682	D	0.000000	T	0.52484	0.1737	L	0.58101	1.795	0.43039	D	0.994624	P;P	0.39022	0.627;0.655	B;B	0.35039	0.096;0.194	T	0.59968	-0.7354	10	0.87932	D	0	-22.4437	19.7509	0.96268	0.0:1.0:0.0:0.0	.	53;1	E5RFC0;Q8N7W2-3	.;.	I	53;1;53;1	ENSP00000380108:M53I;ENSP00000345773:M1I;ENSP00000380107:M53I;ENSP00000367868:M1I	ENSP00000345773:M1I	M	-	3	0	BEND7	13582073	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.362000	0.66098	2.693000	0.91896	0.650000	0.86243	ATG		0.388	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751	
TDRD1	56165	hgsc.bcm.edu	37	10	115947736	115947736	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr10:115947736A>C	ENST00000369280.1	+	2	606	c.146A>C	c.(145-147)aAc>aCc	p.N49T	TDRD1_ENST00000369282.1_Missense_Mutation_p.N49T|TDRD1_ENST00000251864.2_Missense_Mutation_p.N49T|TDRD1_ENST00000422662.1_5'UTR|TDRD1_ENST00000369281.2_Missense_Mutation_p.N49T			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	49					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)	p.N49T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		ACACTTCCTAACCACCCTAAT	0.378																																					p.N49T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A146C	10						.						106.0	110.0	109.0					10																	115947736		2203	4300	6503	115937726	SO:0001583	missense	56165	exon2			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.146A>C	10.37:g.115947736A>C	ENSP00000358286:p.Asn49Thr		115937726	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	37		.	.	.	.	.	.	.	.	.	.	A	16.09	3.024774	0.54683	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000369280	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	4.86	2.57	0.30868	.	0.643972	0.14952	N	0.288879	T	0.34803	0.0910	L	0.29908	0.895	0.80722	D	1	P;P;P;P	0.51537	0.666;0.91;0.775;0.946	B;B;B;P	0.48840	0.112;0.388;0.225;0.592	T	0.16808	-1.0390	10	0.87932	D	0	-9.3375	5.5612	0.17144	0.7871:0.0:0.2129:0.0	.	49;49;49;49	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	T	49	ENSP00000358288:N49T;ENSP00000251864:N49T;ENSP00000358287:N49T;ENSP00000358286:N49T	ENSP00000251864:N49T	N	+	2	0	TDRD1	115937726	0.975000	0.34042	0.995000	0.50966	0.985000	0.73830	0.873000	0.28052	0.964000	0.38108	0.460000	0.39030	AAC		0.378	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
APC	324	hgsc.bcm.edu	37	5	112164625	112164625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr5:112164625G>T	ENST00000457016.1	+	14	2079	c.1699G>T	c.(1699-1701)Gga>Tga	p.G567*	APC_ENST00000257430.4_Nonsense_Mutation_p.G567*|CTC-554D6.1_ENST00000520401.1_Missense_Mutation_p.L62F|APC_ENST00000508376.2_Nonsense_Mutation_p.G567*			P25054	APC_HUMAN	adenomatous polyposis coli	567	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.G567*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCGAGAAGTTGGAAGTGTGAA	0.313		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.G549X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.G1645T	5						.						128.0	139.0	135.0					5																	112164625		2202	4300	6502	112192524	SO:0001587	stop_gained	324	exon12	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1699G>T	5.37:g.112164625G>T	ENSP00000413133:p.Gly567*		112192524	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	40	8.225014	0.98714	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.8304	19.6604	0.95864	0.0:0.0:1.0:0.0	.	.	.	.	X	567;549;567;567;567	.	ENSP00000257430:G567X	G	+	1	0	APC	112192524	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.439000	0.97543	2.648000	0.89879	0.655000	0.94253	GGA		0.313	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CDH9	1007	hgsc.bcm.edu	37	5	26886111	26886111	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr5:26886111T>A	ENST00000231021.4	-	10	1766	c.1594A>T	c.(1594-1596)Act>Tct	p.T532S		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	532	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T532S(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GGATTGAGAGTAAATTCTGGC	0.308																																					p.T532S	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1594T	5						.						70.0	80.0	77.0					5																	26886111		2202	4300	6502	26921868	SO:0001583	missense	1007	exon10			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1594A>T	5.37:g.26886111T>A	ENSP00000231021:p.Thr532Ser		26921868	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.396701	0.25205	.	.	ENSG00000113100	ENST00000231021	T	0.48201	0.82	5.76	3.92	0.45320	Cadherin (4);Cadherin-like (1);	0.398164	0.26421	N	0.024474	T	0.18383	0.0441	N	0.02916	-0.46	0.23862	N	0.996636	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.15636	-1.0430	9	.	.	.	.	4.0745	0.09897	0.0771:0.137:0.4795:0.3064	.	125;532	B4DFP0;Q9ULB4	.;CADH9_HUMAN	S	532	ENSP00000231021:T532S	.	T	-	1	0	CDH9	26921868	0.591000	0.26824	0.975000	0.42487	0.941000	0.58515	0.238000	0.18004	0.735000	0.32537	-0.644000	0.03951	ACT		0.308	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
RAI14	26064	hgsc.bcm.edu	37	5	34824362	34824362	+	Silent	SNP	G	G	A	rs141530324		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr5:34824362G>A	ENST00000265109.3	+	15	2702	c.2415G>A	c.(2413-2415)tcG>tcA	p.S805S	RAI14_ENST00000397449.1_Silent_p.S798S|RAI14_ENST00000428746.2_Silent_p.S805S|RAI14_ENST00000515799.1_Silent_p.S808S|RAI14_ENST00000512629.1_Silent_p.S776S|RAI14_ENST00000503673.1_Silent_p.S805S|RAI14_ENST00000506376.1_Silent_p.S797S	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	805						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.S805S(2)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					TGTTGGCATCGAAATTAAAGG	0.408																																					p.S776S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2328A	5						.	G	,,,,,	1,4405	2.1+/-5.4	0,1,2202	127.0	131.0	130.0		2415,2415,2328,2391,2424,2415	-11.0	0.0	5	dbSNP_134	130	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RAI14	NM_001145520.1,NM_001145521.1,NM_001145522.1,NM_001145523.1,NM_001145525.1,NM_015577.2	,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,	805/981,805/981,776/952,797/973,808/984,805/981	34824362	1,13005	2203	4300	6503	34860119	SO:0001819	synonymous_variant	26064	exon14			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.2415G>A	5.37:g.34824362G>A			34860119	NM_001145522	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	ENST00000265109.3	37	CCDS34142.1																																																																																				0.408	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
NDST1	3340	hgsc.bcm.edu	37	5	149927842	149927842	+	Silent	SNP	C	C	T	rs201043334		TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr5:149927842C>T	ENST00000261797.6	+	12	2710	c.2208C>T	c.(2206-2208)gcC>gcT	p.A736A	NDST1_ENST00000523767.1_Intron	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	736	Heparan sulfate N-sulfotransferase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.A736A(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGATTACCGCCGGCTCTGACG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		17302	0.0		0.001	False		,,,				2504	0.0				p.A736A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2208T	5						.	C		0,4406		0,0,2203	89.0	62.0	71.0		2208	-9.8	0.0	5	dbSNP_132	71	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NDST1	NM_001543.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		736/883	149927842	1,13005	2203	4300	6503	149908035	SO:0001819	synonymous_variant	3340	exon12			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.2208C>T	5.37:g.149927842C>T			149908035	NM_001543	Q96E57	Silent	SNP	ENST00000261797.6	37	CCDS34277.1																																																																																				0.622	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
AMY1B	277	hgsc.bcm.edu	37	1	104236035	104236035	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-3611-01A-01W-0833-10	TCGA-AG-3611-10A-01W-0833-10	g.chr1:104236035T>G	ENST00000330330.5	-	5	925	c.631A>C	c.(631-633)Att>Ctt	p.I211L	AMY1B_ENST00000370080.3_Missense_Mutation_p.I211L|AMY1B_ENST00000464691.1_5'UTR	NM_001008218.1	NP_001008219.1	P04745	AMY1_HUMAN	amylase, alpha 1B (salivary)	211					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)	p.I211L(1)		large_intestine(1)|lung(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		GAAGCATCAATTCTGAACCCT	0.433																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	1						.						1.0	1.0	1.0					1																	104236035		4	10	14	104037558	SO:0001583	missense	277	.				CCDS30783.1	1p21	2012-10-02	2007-05-03		ENSG00000174876	ENSG00000174876	3.2.1.1		475	protein-coding gene	gene with protein product		104701	"""amylase, alpha 1B; salivary"""	AMY1			Standard	XM_005270758		Approved			P04745	OTTHUMG00000011021	ENST00000330330.5:c.631A>C	1.37:g.104236035T>G	ENSP00000330484:p.Ile211Leu		104037558	.	A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	ENST00000330330.5	37	CCDS30783.1	.	.	.	.	.	.	.	.	.	.	-	4.573	0.106493	0.08780	.	.	ENSG00000174876	ENST00000416771;ENST00000370080;ENST00000330330;ENST00000446703	D;D;D	0.98164	-4.76;-4.76;-4.76	2.08	0.934	0.19477	.	0.604997	0.17383	N	0.176244	D	0.94145	0.8122	.	.	.	0.24160	N	0.995664	.	.	.	.	.	.	D	0.89483	0.3751	7	0.32370	T	0.25	.	11.1212	0.48291	0.0:0.0:0.5065:0.4935	.	.	.	.	L	211	ENSP00000359097:I211L;ENSP00000330484:I211L;ENSP00000390219:I211L	ENSP00000330484:I211L	I	-	1	0	AMY1B	104037558	0.994000	0.37717	0.993000	0.49108	0.262000	0.26303	0.279000	0.18771	-0.419000	0.07439	-1.122000	0.02009	ATT		0.433	AMY1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030309.1	NM_001008218	
