#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OTOF	9381	broad.mit.edu	37	2	26696360	26696361	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:26696360_26696361insT	ENST00000272371.2	-	28	3609_3610	c.3483_3484insA	c.(3481-3486)gagtgtfs	p.C1162fs	OTOF_ENST00000403946.3_Frame_Shift_Ins_p.C1162fs|OTOF_ENST00000338581.6_Frame_Shift_Ins_p.C415fs|OTOF_ENST00000402415.3_Frame_Shift_Ins_p.C472fs|OTOF_ENST00000339598.3_Frame_Shift_Ins_p.C415fs	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1162					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCCTGCACACTCGATGTCCA	0.599																																					p.C472fs	GBM(102;732 1451 20652 24062 31372)											.	.	0			c.1414_1415insA	2						.																																			26549865	SO:0001589	frameshift_variant	9381	exon10			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3483_3484insA	2.37:g.26696360_26696361insT	ENSP00000272371:p.Cys1162fs		26549864	NM_194322	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Frame_Shift_Ins	INS	ENST00000272371.2	37	CCDS1725.1																																																																																				0.599	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
PDE4D	5144	broad.mit.edu	37	5	58334874	58334875	+	Intron	INS	-	-	C	rs532394208		TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:58334874_58334875insC	ENST00000340635.6	-	6	984				RP11-266N13.2_ENST00000500224.2_RNA|PDE4D_ENST00000360047.5_Intron|PDE4D_ENST00000546160.1_Intron|PDE4D_ENST00000507116.1_Intron|PDE4D_ENST00000502484.2_Intron|PDE4D_ENST00000405755.2_Intron|PDE4D_ENST00000358923.6_Intron|PDE4D_ENST00000503258.1_Intron	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific						adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	AAGGGGGCCATCCTGCCATACC	0.639																																					p.M21fs												.	.	0			c.61_62insG	5						.																																			58370632	SO:0001627	intron_variant	5144	exon1				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.809-76->G	5.37:g.58334876_58334876dupC			58370631	NM_001197222	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Frame_Shift_Ins	INS	ENST00000340635.6	37	CCDS47213.1																																																																																				0.639	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
MOGAT3	346606	broad.mit.edu	37	7	100843714	100843714	+	Silent	SNP	A	A	G	rs149668601	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:100843714A>G	ENST00000223114.4	-	2	358	c.192T>C	c.(190-192)taT>taC	p.Y64Y	MOGAT3_ENST00000379423.3_Silent_p.Y64Y|MOGAT3_ENST00000440203.2_Silent_p.Y64Y	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	64					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.Y64Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					CCCAGTCCACATAGAGCCACA	0.587																																					p.Y64Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T192C	7						.						75.0	77.0	76.0					7																	100843714		2203	4300	6503	100630434	SO:0001819	synonymous_variant	346606	exon2			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.192T>C	7.37:g.100843714A>G			100630434	NM_178176	Q496A6|Q496A7|Q496A8|Q9UDW7	Silent	SNP	ENST00000223114.4	37	CCDS5714.1																																																																																				0.587	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059649.3	NM_178176	
ARMC10	83787	broad.mit.edu	37	7	102738813	102738813	+	Missense_Mutation	SNP	C	C	T	rs150955727	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:102738813C>T	ENST00000323716.3	+	7	1237	c.845C>T	c.(844-846)aCg>aTg	p.T282M	ARMC10_ENST00000425331.1_Missense_Mutation_p.T223M|ARMC10_ENST00000428183.2_Missense_Mutation_p.T223M|ARMC10_ENST00000441711.2_Missense_Mutation_p.T247M|ARMC10_ENST00000541300.1_Missense_Mutation_p.T164M|ARMC10_ENST00000454559.1_Missense_Mutation_p.T188M	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	282					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)		p.T282M(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						CGAGTACTTACGCTATTTCAG	0.363													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19465	0.0		0.0	False		,,,				2504	0.0				p.T188M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C563T	7						.	C	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	5,4401	4.2+/-10.8	0,5,2198	103.0	89.0	94.0		740,668,668,563,491,845	4.5	0.7	7	dbSNP_134	94	0,8598		0,0,4299	no	missense,missense,missense,missense,missense,missense	ARMC10	NM_001161009.2,NM_001161010.2,NM_001161011.2,NM_001161012.2,NM_001161013.2,NM_031905.4	81,81,81,81,81,81	0,5,6497	TT,TC,CC		0.0,0.1135,0.0384	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	247/309,223/285,223/285,188/250,164/226,282/344	102738813	5,12999	2203	4299	6502	102526049	SO:0001583	missense	83787	exon5			AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.845C>T	7.37:g.102738813C>T	ENSP00000319412:p.Thr282Met		102526049	NM_001161012	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	ENST00000323716.3	37	CCDS5728.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501547	0.64298	0.001135	0.0	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153;ENST00000431642	T;T;T;T;T;T;T;T	0.49432	1.41;1.41;1.41;1.41;1.52;1.52;0.78;1.52	5.42	4.48	0.54585	Armadillo-type fold (1);	0.288557	0.40818	N	0.001011	T	0.61540	0.2355	M	0.72894	2.215	0.09310	N	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.99;0.998;0.978;0.998;0.999;0.995;0.991	T	0.55761	-0.8090	10	0.62326	D	0.03	-7.4805	5.3834	0.16204	0.0:0.6594:0.1779:0.1627	.	223;164;188;210;223;247;282	B4DWJ8;F5GX65;Q8N2F6-4;C9J5N7;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;.;ARM10_HUMAN	M	282;223;247;188;223;164;210;124	ENSP00000319412:T282M;ENSP00000396654:T223M;ENSP00000413619:T247M;ENSP00000405612:T188M;ENSP00000397969:T223M;ENSP00000440463:T164M;ENSP00000398201:T210M;ENSP00000406840:T124M	ENSP00000319412:T282M	T	+	2	0	ARMC10	102526049	0.093000	0.21703	0.717000	0.30585	0.966000	0.64601	0.571000	0.23669	2.709000	0.92574	0.591000	0.81541	ACG		0.363	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1	NM_031905	
LHFPL3	375612	broad.mit.edu	37	7	103969492	103969492	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:103969492A>G	ENST00000401970.2	+	1	345	c.223A>G	c.(223-225)Acc>Gcc	p.T75A	LHFPL3_ENST00000535008.1_Missense_Mutation_p.T89A|LHFPL3_ENST00000424859.1_Missense_Mutation_p.T75A|LHFPL3_ENST00000543266.1_Missense_Mutation_p.T89A			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	89						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)	9						CCGGGAGCTGACCTGCAGGGG	0.622																																					p.T89A												.	.	0			c.A265G	7						.						46.0	53.0	51.0					7																	103969492		2018	4200	6218	103756728	SO:0001583	missense	375612	exon1			AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.223A>G	7.37:g.103969492A>G	ENSP00000385374:p.Thr75Ala		103756728	NM_199000	A1L383|A4D0Q5	Missense_Mutation	SNP	ENST00000401970.2	37		.	.	.	.	.	.	.	.	.	.	A	12.20	1.866462	0.32977	.	.	ENSG00000187416	ENST00000424859;ENST00000535008;ENST00000401970;ENST00000543266	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.06	5.06	0.68205	.	0.411716	0.28161	N	0.016364	T	0.64983	0.2648	M	0.64997	1.995	0.43211	D	0.995079	B;B	0.09022	0.002;0.002	B;B	0.17979	0.02;0.02	T	0.60571	-0.7237	10	0.06365	T	0.9	-10.7493	14.8298	0.70139	1.0:0.0:0.0:0.0	.	89;89	A1L384;A4D0Q5	.;.	A	75;89;75;89	ENSP00000393128:T75A;ENSP00000444350:T89A;ENSP00000385374:T75A;ENSP00000445976:T89A	ENSP00000385374:T75A	T	+	1	0	LHFPL3	103756728	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.967000	0.49216	1.894000	0.54839	0.456000	0.33151	ACC		0.622	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000348284.1	NM_199000	
FLNC	2318	broad.mit.edu	37	7	128470916	128470916	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:128470916G>T	ENST00000325888.8	+	1	486	c.225G>T	c.(223-225)gaG>gaT	p.E75D	FLNC_ENST00000346177.6_Missense_Mutation_p.E75D	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	75	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.E75D(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CGCTGCTCGAGGTGCTCAGCC	0.647																																					p.E75D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G225T	7						.						51.0	52.0	52.0					7																	128470916		2203	4300	6503	128258152	SO:0001583	missense	2318	exon1			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.225G>T	7.37:g.128470916G>T	ENSP00000327145:p.Glu75Asp		128258152	NM_001458	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860687	0.71834	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	T;T	0.66815	-0.23;-0.23	4.49	3.59	0.41128	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.70806	0.3266	M	0.83774	2.66	0.40987	D	0.98482	B;B	0.27732	0.133;0.187	B;B	0.35931	0.108;0.214	T	0.73049	-0.4105	10	0.87932	D	0	.	10.651	0.45649	0.0986:0.0:0.9014:0.0	.	75;75	Q14315-2;Q14315	.;FLNC_HUMAN	D	75	ENSP00000327145:E75D;ENSP00000344002:E75D	ENSP00000327145:E75D	E	+	3	2	FLNC	128258152	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.385000	0.52485	0.979000	0.38497	0.561000	0.74099	GAG		0.647	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
CHST12	55501	broad.mit.edu	37	7	2473376	2473376	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:2473376T>C	ENST00000258711.6	+	2	1237	c.1102T>C	c.(1102-1104)Tac>Cac	p.Y368H		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	368					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)	p.Y368H(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		CCCCCCGAGCTACCGGAACAG	0.642																																					p.Y368H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1102C	7						.						29.0	32.0	31.0					7																	2473376		2203	4300	6503	2439902	SO:0001583	missense	55501	exon2			AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.1102T>C	7.37:g.2473376T>C	ENSP00000258711:p.Tyr368His		2439902	NM_018641	A4D1Z9|Q502W3|Q9NXY7	Missense_Mutation	SNP	ENST00000258711.6	37	CCDS5333.1	.	.	.	.	.	.	.	.	.	.	T	6.367	0.435895	0.12104	.	.	ENSG00000136213	ENST00000258711	T	0.21543	2.0	5.15	5.15	0.70609	.	0.466235	0.24691	N	0.036387	T	0.17959	0.0431	L	0.38692	1.165	0.43259	D	0.995192	B	0.20261	0.043	B	0.19666	0.026	T	0.05354	-1.0890	10	0.16420	T	0.52	-16.5209	14.9757	0.71269	0.0:0.0:0.0:1.0	.	368	Q9NRB3	CHSTC_HUMAN	H	368	ENSP00000258711:Y368H	ENSP00000258711:Y368H	Y	+	1	0	CHST12	2439902	1.000000	0.71417	0.988000	0.46212	0.963000	0.63663	3.975000	0.56859	1.957000	0.56846	0.459000	0.35465	TAC		0.642	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060170.3	NM_018641	
SNX13	23161	broad.mit.edu	37	7	17937006	17937006	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:17937006G>A	ENST00000409389.1	-	2	248	c.76C>T	c.(76-78)Ccc>Tcc	p.P26S	SNX13_ENST00000409604.1_Missense_Mutation_p.P26S|SNX13_ENST00000428135.3_Missense_Mutation_p.P26S			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	26					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					ATTACAAAGGGTCCAAAGGTT	0.313																																					p.P26S												.	.	0			c.C76T	7						.						58.0	54.0	55.0					7																	17937006		1811	4073	5884	17903531	SO:0001583	missense	23161	exon2			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.76C>T	7.37:g.17937006G>A	ENSP00000386705:p.Pro26Ser		17903531	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	G	26.7	4.759158	0.89843	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044;ENST00000409604	T;T;T	0.24723	1.84;1.84;1.84	5.54	4.66	0.58398	.	0.150433	0.64402	D	0.000009	T	0.19846	0.0477	L	0.29908	0.895	0.80722	D	1	B;B;B	0.21071	0.051;0.002;0.002	B;B;B	0.20577	0.03;0.001;0.005	T	0.03374	-1.1043	10	0.22109	T	0.4	-3.8784	14.5681	0.68194	0.0708:0.0:0.9292:0.0	.	26;26;26	Q9NSH0;B8ZZT9;Q9Y5W8-2	.;.;.	S	26;26;74;26	ENSP00000386705:P26S;ENSP00000398789:P26S;ENSP00000386639:P26S	ENSP00000242044:P74S	P	-	1	0	SNX13	17903531	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.476000	0.97823	1.332000	0.45431	0.313000	0.20887	CCC		0.313	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	
CNTNAP2	26047	broad.mit.edu	37	7	147869340	147869340	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr7:147869340C>T	ENST00000361727.3	+	18	3296	c.2780C>T	c.(2779-2781)gCt>gTt	p.A927V	CNTNAP2_ENST00000538075.1_5'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	927	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)	p.A927V(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCAGGTGGTGCTGGGGGCCAG	0.502										HNSCC(39;0.1)																											p.A927V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2780T	7						.						53.0	54.0	54.0					7																	147869340		2203	4300	6503	147500273	SO:0001583	missense	26047	exon18			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2780C>T	7.37:g.147869340C>T	ENSP00000354778:p.Ala927Val		147500273	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	37	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.518481	0.85495	.	.	ENSG00000174469	ENST00000361727	T	0.76060	-0.99	5.45	4.57	0.56435	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.063306	0.64402	D	0.000007	T	0.67353	0.2884	L	0.39633	1.23	0.80722	D	1	B	0.33345	0.409	B	0.38264	0.269	T	0.62320	-0.6879	10	0.22109	T	0.4	.	12.7302	0.57193	0.0:0.9201:0.0:0.0799	.	927	Q9UHC6	CNTP2_HUMAN	V	927	ENSP00000354778:A927V	ENSP00000354778:A927V	A	+	2	0	CNTNAP2	147500273	1.000000	0.71417	0.230000	0.23976	0.981000	0.71138	7.683000	0.84093	1.304000	0.44892	0.655000	0.94253	GCT		0.502	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
CBFA2T2	9139	broad.mit.edu	37	20	32211008	32211008	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr20:32211008C>G	ENST00000346541.3	+	6	1162	c.625C>G	c.(625-627)Cac>Gac	p.H209D	CBFA2T2_ENST00000397798.2_Missense_Mutation_p.H180D|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.H200D|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.H219D|CBFA2T2_ENST00000344201.3_Missense_Mutation_p.H180D|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.H180D|CBFA2T2_ENST00000375279.2_Missense_Mutation_p.H209D|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.H180D	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	209					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.H209D(1)		breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						TCAGCACGAACACCTTCTGCT	0.602																																					p.H200D	Esophageal Squamous(174;142 1955 14837 21276 28041)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C598G	20						.						127.0	107.0	114.0					20																	32211008		2203	4300	6503	31674669	SO:0001583	missense	9139	exon5			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.625C>G	20.37:g.32211008C>G	ENSP00000262653:p.His209Asp		31674669	NM_001032999	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	ENST00000346541.3	37	CCDS13221.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916151	0.92178	.	.	ENSG00000078699	ENST00000375279;ENST00000342704;ENST00000344201;ENST00000346541;ENST00000397800;ENST00000397798;ENST00000359606	T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	L	0.60455	1.87	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.77557	0.977;0.99	T	0.61317	-0.7087	10	0.56958	D	0.05	-2.5888	20.547	0.99278	0.0:1.0:0.0:0.0	.	209;200	O43439;F8W6D7	MTG8R_HUMAN;.	D	209;200;180;209;180;180;219	ENSP00000364428:H209D;ENSP00000345810:H200D;ENSP00000341865:H180D;ENSP00000262653:H209D;ENSP00000380902:H180D;ENSP00000380900:H180D;ENSP00000352622:H219D	ENSP00000345810:H200D	H	+	1	0	CBFA2T2	31674669	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.816000	0.86201	2.850000	0.98022	0.650000	0.86243	CAC		0.602	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
MATN4	8785	broad.mit.edu	37	20	43932919	43932919	+	Missense_Mutation	SNP	A	A	G	rs549592281		TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr20:43932919A>G	ENST00000372754.1	-	2	600	c.592T>C	c.(592-594)Tcc>Ccc	p.S198P	MATN4_ENST00000360607.6_Missense_Mutation_p.S198P|MATN4_ENST00000353917.5_Missense_Mutation_p.S198P|RBPJL_ENST00000372741.3_5'Flank|MATN4_ENST00000372751.4_Intron|MATN4_ENST00000537548.1_Missense_Mutation_p.S198P|RBPJL_ENST00000372743.1_5'Flank|MATN4_ENST00000342716.4_Missense_Mutation_p.S198P|RBPJL_ENST00000343694.3_5'Flank|MATN4_ENST00000372756.1_Missense_Mutation_p.S198P			O95460	MATN4_HUMAN	matrilin 4	198	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|response to axon injury (GO:0048678)	extracellular region (GO:0005576)		p.S198P(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.0122)				AGGTCGAAGGACTCTACGAGG	0.622													A|||	1	0.000199681	0.0008	0.0	5008	,	,		17054	0.0		0.0	False		,,,				2504	0.0				p.S198P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T592C	20						.						49.0	48.0	48.0					20																	43932919		2202	4297	6499	43366333	SO:0001583	missense	8785	exon3			AJ007581	CCDS13348.1, CCDS46607.1	20q13.1-q13.2	2008-07-07			ENSG00000124159	ENSG00000124159			6910	protein-coding gene	gene with protein product		603897				9827539, 9027493	Standard	NM_003833		Approved		uc002xnn.2	O95460	OTTHUMG00000033043	ENST00000372754.1:c.592T>C	20.37:g.43932919A>G	ENSP00000361840:p.Ser198Pro		43366333	NM_003833	A6NH94|A6NKN5|Q5QPU2|Q5QPU3|Q5QPU4|Q8N2M5|Q8N2M7|Q9H1F8|Q9H1F9	Missense_Mutation	SNP	ENST00000372754.1	37		.	.	.	.	.	.	.	.	.	.	A	18.50	3.637000	0.67130	.	.	ENSG00000124159	ENST00000372754;ENST00000372756;ENST00000353917;ENST00000360607;ENST00000342716;ENST00000537548;ENST00000255132	T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	4.81	2.43	0.29744	.	0.167016	0.28828	N	0.014020	D	0.87912	0.6297	M	0.83223	2.63	0.80722	D	1	P;D;D	0.89917	0.879;1.0;0.998	P;D;D	0.91635	0.637;0.999;0.994	D	0.85665	0.1291	10	0.72032	D	0.01	.	7.2652	0.26226	0.7045:0.1511:0.0:0.1444	.	198;198;198	A6NNA4;O95460-4;O95460-2	.;.;.	P	198	ENSP00000361840:S198P;ENSP00000361842:S198P;ENSP00000243983:S198P;ENSP00000353819:S198P;ENSP00000343164:S198P;ENSP00000440328:S198P	ENSP00000255132:S198P	S	-	1	0	MATN4	43366333	1.000000	0.71417	0.954000	0.39281	0.994000	0.84299	2.502000	0.45398	0.291000	0.22468	0.379000	0.24179	TCC		0.622	MATN4-002	KNOWN	non_canonical_conserved|non_canonical_U12|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000080335.1		
TRAF3	7187	broad.mit.edu	37	14	103371896	103371896	+	Silent	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr14:103371896G>T	ENST00000560371.1	+	11	1699	c.1482G>T	c.(1480-1482)gtG>gtT	p.V494V	TRAF3_ENST00000539721.1_Silent_p.V411V|TRAF3_ENST00000347662.4_Silent_p.V469V|TRAF3_ENST00000392745.2_Silent_p.V494V|TRAF3_ENST00000351691.5_Silent_p.V469V	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	494	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.V494V(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		AGCAGAAAGTGACACTCATGC	0.542																																					p.V494V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1482T	14						.						188.0	171.0	177.0					14																	103371896		2203	4300	6503	102441649	SO:0001819	synonymous_variant	7187	exon12			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1482G>T	14.37:g.103371896G>T			102441649	NM_145725	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Silent	SNP	ENST00000560371.1	37	CCDS9975.1																																																																																				0.542	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1	NM_145725	
MYH6	4624	broad.mit.edu	37	14	23869923	23869924	+	Missense_Mutation	DNP	AG	AG	GT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr14:23869923_23869924AG>GT	ENST00000356287.3	-	12	1433_1434	c.1404_1405CT>AC	c.(1402-1407)atCTtc>atACtc	p.F469L	MYH6_ENST00000405093.3_Missense_Mutation_p.F469L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	469	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.I468>?(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTCACGTCGAAGATCTCGAAGC	0.559																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1404_1405AC	14						.																																			22939764	SO:0001583	missense	4624	exon13			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1404_1405delinsGT	14.37:g.23869923_23869924delinsGT	ENSP00000348634:p.Phe469Leu		22939763	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	DNP	ENST00000356287.3	37	CCDS9600.1																																																																																				0.559	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
CCDC88C	440193	broad.mit.edu	37	14	91744454	91744454	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr14:91744454C>T	ENST00000389857.6	-	29	4956	c.4870G>A	c.(4870-4872)Gga>Aga	p.G1624R	CCDC88C_ENST00000331194.7_Missense_Mutation_p.G148R	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1624					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)	p.G1624R(1)|p.G148R(1)		central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCGTTGCGTCCCGGTGTGCTG	0.687																																					p.G1624R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G4870A	14						.						16.0	20.0	19.0					14																	91744454		2046	4182	6228	90814207	SO:0001583	missense	440193	exon29				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4870G>A	14.37:g.91744454C>T	ENSP00000374507:p.Gly1624Arg		90814207	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	37	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.694600	0.30052	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.42513	2.56;0.97	5.44	4.44	0.53790	.	0.502367	0.16523	U	0.210720	T	0.50429	0.1615	L	0.51422	1.61	0.09310	N	1	P;D;D	0.67145	0.893;0.996;0.996	B;D;D	0.63381	0.361;0.914;0.914	T	0.40646	-0.9552	10	0.51188	T	0.08	-28.5025	6.1509	0.20310	0.0:0.8418:0.0:0.1582	.	1624;148;74	Q9P219;Q9P219-2;Q9P219-3	DAPLE_HUMAN;.;.	R	1624;148;148	ENSP00000374507:G1624R;ENSP00000330332:G148R	ENSP00000330332:G148R	G	-	1	0	CCDC88C	90814207	0.001000	0.12720	0.101000	0.21167	0.047000	0.14425	0.475000	0.22164	2.550000	0.86006	0.462000	0.41574	GGA		0.687	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
SERPINA9	327657	broad.mit.edu	37	14	94936084	94936084	+	Missense_Mutation	SNP	G	G	A	rs370139069		TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr14:94936084G>A	ENST00000380365.3	-	2	172	c.94C>T	c.(94-96)Cgc>Tgc	p.R32C	SERPINA9_ENST00000546329.1_Intron|SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000298845.7_Missense_Mutation_p.R50C|SERPINA9_ENST00000424550.2_Intron|SERPINA9_ENST00000448305.2_Intron|SERPINA9_ENST00000337425.5_Missense_Mutation_p.R50C			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	32					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R50C(2)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GAGGAAGGGCGGGGGTATGCA	0.557																																					p.R50C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C148T	14						.	G	CYS/ARG,CYS/ARG	3,4045		0,3,2021	80.0	83.0	82.0		148,148	-4.6	0.0	14		82	0,8346		0,0,4173	no	missense,missense	SERPINA9	NM_001042518.1,NM_175739.3	180,180	0,3,6194	AA,AG,GG		0.0,0.0741,0.0242	benign,benign	50/336,50/436	94936084	3,12391	2024	4173	6197	94005837	SO:0001583	missense	327657	exon2			AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.94C>T	14.37:g.94936084G>A	ENSP00000369723:p.Arg32Cys		94005837	NM_001042518	B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	ENST00000380365.3	37		.	.	.	.	.	.	.	.	.	.	G	9.277	1.047155	0.19827	7.41E-4	0.0	ENSG00000170054	ENST00000298845;ENST00000337425;ENST00000380365	D;D;D	0.87571	-2.27;-2.27;-2.27	3.99	-4.58	0.03410	Serpin domain (1);	6.324830	0.00424	U	0.000062	T	0.72503	0.3468	N	0.08118	0	0.09310	N	0.999997	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.62656	-0.6808	10	0.87932	D	0	.	4.5267	0.11985	0.5484:0.0:0.2345:0.2171	.	32;50;50	Q86WD7;Q86WD7-7;Q86WD7-2	SPA9_HUMAN;.;.	C	50;50;32	ENSP00000298845:R50C;ENSP00000337133:R50C;ENSP00000369723:R32C	ENSP00000298845:R50C	R	-	1	0	SERPINA9	94005837	0.005000	0.15991	0.000000	0.03702	0.020000	0.10135	0.163000	0.16520	-0.508000	0.06540	0.313000	0.20887	CGC		0.557	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395803.2	NM_175739	
PLD4	122618	broad.mit.edu	37	14	105397224	105397224	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr14:105397224G>C	ENST00000392593.4	+	7	1031	c.863G>C	c.(862-864)cGt>cCt	p.R288P	PLD4_ENST00000553861.1_5'Flank|PLD4_ENST00000540372.1_Missense_Mutation_p.R295P	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	288					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)	p.R271P(1)		central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			CACTTCAACCGTTTCCAGCCC	0.577																																					p.R288P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G863C	14						.						108.0	115.0	112.0					14																	105397224		1896	4114	6010	104468269	SO:0001583	missense	122618	exon7				CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.863G>C	14.37:g.105397224G>C	ENSP00000376372:p.Arg288Pro		104468269	NM_138790	Q6UWD2	Missense_Mutation	SNP	ENST00000392593.4	37	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	G	5.753	0.323389	0.10900	.	.	ENSG00000166428	ENST00000540372;ENST00000392593	T;T	0.23754	1.89;1.89	4.46	0.463	0.16700	Phospholipase D/viral envelope (1);	0.521663	0.19822	N	0.105285	T	0.27866	0.0686	L	0.55834	1.745	0.28182	N	0.928118	P;B	0.44044	0.825;0.079	P;B	0.50490	0.642;0.111	T	0.10683	-1.0619	10	0.36615	T	0.2	-10.1406	4.4432	0.11584	0.3354:0.0:0.5189:0.1457	.	295;288	F5H2B5;Q96BZ4	.;PLD4_HUMAN	P	295;288	ENSP00000438677:R295P;ENSP00000376372:R288P	ENSP00000376372:R288P	R	+	2	0	PLD4	104468269	0.101000	0.21875	0.227000	0.23927	0.271000	0.26615	1.459000	0.35234	-0.133000	0.11537	-0.169000	0.13324	CGT		0.577	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2	NM_138790	
PI4KA	5297	broad.mit.edu	37	22	21119138	21119138	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr22:21119138T>C	ENST00000572273.1	-	22	2731	c.2501A>G	c.(2500-2502)tAc>tGc	p.Y834C	PI4KA_ENST00000466162.1_5'UTR|PI4KA_ENST00000255882.6_Missense_Mutation_p.Y892C			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	834					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			AGAGAGGAGGTAGGTGGACAT	0.557																																					p.Y834C	GBM(136;1332 1831 3115 23601 50806)											.	.	0			c.A2501G	22						.						93.0	66.0	75.0					22																	21119138		2203	4300	6503	19449138	SO:0001583	missense	5297	exon22			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.2501A>G	22.37:g.21119138T>C	ENSP00000458238:p.Tyr834Cys		19449138	NM_058004	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	T	26.6	4.752579	0.89753	.	.	ENSG00000241973	ENST00000255882	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.80116	0.4564	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.83326	-0.0015	9	0.87932	D	0	-14.8615	15.322	0.74129	0.0:0.0:0.0:1.0	.	834	P42356	PI4KA_HUMAN	C	834	.	ENSP00000255882:Y834C	Y	-	2	0	PI4KA	19449138	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	7.985000	0.88162	2.018000	0.59344	0.528000	0.53228	TAC		0.557	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
SNRPD3	6634	broad.mit.edu	37	22	24967917	24967917	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr22:24967917G>A	ENST00000215829.3	+	4	940	c.353G>A	c.(352-354)cGt>cAt	p.R118H	SNRPD3_ENST00000402849.1_Intron	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa	118	5 X 2 AA tandem repeats of [RM]-G.|Arg/Lys-rich (basic).				gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)	p.R118H(1)		endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						GGAATGGGACGTGGAAACATC	0.448																																					p.R118H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G353A	22						.						106.0	95.0	99.0					22																	24967917		2203	4300	6503	23297917	SO:0001583	missense	6634	exon4			U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	ENST00000215829.3:c.353G>A	22.37:g.24967917G>A	ENSP00000215829:p.Arg118His		23297917	NM_004175	B4DJP7|B5BU13|P43331	Missense_Mutation	SNP	ENST00000215829.3	37	CCDS13828.1	.	.	.	.	.	.	.	.	.	.	G	32	5.173155	0.94807	.	.	ENSG00000100028	ENST00000215829	T	0.44881	0.91	5.99	4.98	0.66077	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.100571	0.64402	D	0.000001	T	0.35335	0.0928	L	0.38175	1.15	0.80722	D	1	B	0.09022	0.002	B	0.01281	0.0	T	0.10800	-1.0614	10	0.49607	T	0.09	.	14.2783	0.66194	0.071:0.0:0.929:0.0	.	118	P62318	SMD3_HUMAN	H	118	ENSP00000215829:R118H	ENSP00000385994:R118H	R	+	2	0	SNRPD3	23297917	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.771000	0.74996	1.549000	0.49425	0.655000	0.94253	CGT		0.448	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319813.1	NM_004175	
SULT4A1	25830	broad.mit.edu	37	22	44225070	44225070	+	Silent	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr22:44225070C>A	ENST00000330884.4	-	6	732	c.612G>T	c.(610-612)gtG>gtT	p.V204V	SULT4A1_ENST00000249130.5_Silent_p.V204V|SULT4A1_ENST00000540422.1_Silent_p.V91V	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	204					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)	p.V204V(1)		kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		CCACCATCGTCACCAGGTCCT	0.622											OREG0026620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V204V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G612T	22						.						24.0	20.0	21.0					22																	44225070		2198	4279	6477	42556403	SO:0001819	synonymous_variant	25830	exon6			AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.612G>T	22.37:g.44225070C>A		922	42556403	NM_014351	B2R7N3|O43728	Silent	SNP	ENST00000330884.4	37	CCDS14051.1																																																																																				0.622	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280660.2	NM_014351	
ECSIT	51295	broad.mit.edu	37	19	11618839	11618839	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:11618839C>T	ENST00000270517.7	-	5	898	c.763G>A	c.(763-765)Ggt>Agt	p.G255S	ZNF653_ENST00000293771.5_5'Flank|CTC-398G3.6_ENST00000585656.1_5'Flank|ECSIT_ENST00000592312.1_Missense_Mutation_p.G139S|ECSIT_ENST00000591352.1_5'UTR|ECSIT_ENST00000588998.1_Missense_Mutation_p.G41S|ZNF653_ENST00000593191.1_5'Flank|ECSIT_ENST00000417981.2_Missense_Mutation_p.G41S|ECSIT_ENST00000252440.7_Missense_Mutation_p.G255S|ECSIT_ENST00000591104.1_Missense_Mutation_p.G255S	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	255					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.G255S(1)		kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						TCTGCTGCACCTGTTGAGTCT	0.557																																					p.G41S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G121A	19						.						103.0	111.0	108.0					19																	11618839		2203	4300	6503	11479839	SO:0001583	missense	51295	exon3			BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.763G>A	19.37:g.11618839C>T	ENSP00000270517:p.Gly255Ser		11479839	NM_001142465	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	ENST00000270517.7	37	CCDS12262.1	.	.	.	.	.	.	.	.	.	.	C	9.416	1.081692	0.20309	.	.	ENSG00000130159	ENST00000270517;ENST00000417981;ENST00000252440	T;T;T	0.75154	-0.91;1.53;-0.91	3.81	0.257	0.15574	.	1.103950	0.06786	N	0.786203	T	0.61739	0.2371	L	0.34521	1.04	0.09310	N	1	B;B;B	0.16802	0.019;0.019;0.005	B;B;B	0.20767	0.031;0.01;0.004	T	0.45411	-0.9263	10	0.31617	T	0.26	-1.3712	6.0847	0.19960	0.0:0.6054:0.0:0.3946	.	41;255;255	E9PAN9;Q9BQ95-2;Q9BQ95	.;.;ECSIT_HUMAN	S	255;41;255	ENSP00000270517:G255S;ENSP00000412712:G41S;ENSP00000252440:G255S	ENSP00000252440:G255S	G	-	1	0	ECSIT	11479839	0.000000	0.05858	0.003000	0.11579	0.089000	0.18198	0.942000	0.29017	0.004000	0.14682	0.561000	0.74099	GGT		0.557	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442603.2	NM_016581	
KMT2B	9757	broad.mit.edu	37	19	36210409	36210410	+	Missense_Mutation	DNP	CA	CA	GT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:36210409_36210410CA>GT	ENST00000222270.7	+	2	402_403	c.402_403CA>GT	c.(400-405)ccCAgt>ccGTgt	p.S135C	KMT2B_ENST00000420124.1_Missense_Mutation_p.S135C|KMT2B_ENST00000341701.1_Missense_Mutation_p.S135C|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	135					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.P134>?(1)									ATGTGGCCCCCAGTTCCCTGCG	0.569																																					.												.	.	1	Complex(1)	large_intestine(1)	c.402_403GT	19						.																																			40902250	SO:0001583	missense	9757	exon2			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	Exception_encountered	19.37:g.36210409_36210410delinsGT	ENSP00000222270:p.Ser135Cys		40902249	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	DNP	ENST00000222270.7	37	CCDS46055.1																																																																																				0.569	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
FCGBP	8857	broad.mit.edu	37	19	40389657	40389657	+	Missense_Mutation	SNP	T	T	G	rs3746010|rs148187888		TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:40389657T>G	ENST00000221347.6	-	18	8532	c.8525A>C	c.(8524-8526)aAc>aCc	p.N2842T		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2842	Cys-rich.			N -> T (in Ref. 1; BAA19526). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)		p.N2842T(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			agcACCTTTGTTGACGCAGCT	0.637																																					p.N2842T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A8525C	19						.						47.0	40.0	42.0					19																	40389657		2103	3809	5912	45081497	SO:0001583	missense	8857	exon18			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.8525A>C	19.37:g.40389657T>G	ENSP00000221347:p.Asn2842Thr		45081497	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	t	0.013	-1.641107	0.00799	.	.	ENSG00000090920	ENST00000221347	T	0.19938	2.11	2.94	-3.79	0.04320	von Willebrand factor, type C (1);	0.689783	0.12210	N	0.489415	T	0.04952	0.0133	N	0.01219	-0.95	0.09310	N	1	B	0.19935	0.04	B	0.18871	0.023	T	0.41179	-0.9523	10	0.13108	T	0.6	.	6.0306	0.19679	0.0:0.1722:0.2977:0.5301	.	2842	Q9Y6R7	FCGBP_HUMAN	T	2842	ENSP00000221347:N2842T	ENSP00000221347:N2842T	N	-	2	0	FCGBP	45081497	0.511000	0.26179	0.068000	0.19968	0.025000	0.11179	-0.344000	0.07780	-0.736000	0.04831	-0.708000	0.03648	AAC		0.637	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FCGBP	8857	broad.mit.edu	37	19	40399430	40399430	+	Missense_Mutation	SNP	T	T	C	rs76734965|rs149549244	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:40399430T>C	ENST00000221347.6	-	13	6272	c.6265A>G	c.(6265-6267)Aat>Gat	p.N2089D		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2089	VWFD 5. {ECO:0000255|PROSITE- ProRule:PRU00580}.		N -> D (in dbSNP:rs885723).			extracellular vesicular exosome (GO:0070062)		p.N2089D(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCTTGGAAATTGAATCGGTGC	0.632													C|||	3066	0.61222	0.6846	0.6066	5008	,	,		7331	0.4821		0.6421	False		,,,				2504	0.6217				p.N2089D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6265G	19						.						27.0	31.0	30.0					19																	40399430		1098	2103	3201	45091270	SO:0001583	missense	8857	exon13			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.6265A>G	19.37:g.40399430T>C	ENSP00000221347:p.Asn2089Asp		45091270	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	2.643	-0.283636	0.05642	.	.	ENSG00000090920	ENST00000221347	T	0.59772	0.24	3.01	3.01	0.34805	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.15565	0.0375	N	0.00202	-1.86	0.49483	P	2.0699999999995722E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.33854	-0.9852	8	0.02654	T	1	.	6.3672	0.21461	0.0:0.7561:0.0:0.2439	.	2089	Q9Y6R7	FCGBP_HUMAN	D	2089	ENSP00000221347:N2089D	ENSP00000221347:N2089D	N	-	1	0	FCGBP	45091270	0.006000	0.16342	0.994000	0.49952	0.789000	0.44602	0.160000	0.16462	0.492000	0.27815	-0.711000	0.03637	AAT		0.632	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
MAP3K10	4294	broad.mit.edu	37	19	40704296	40704296	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:40704296G>A	ENST00000253055.3	+	2	985	c.697G>A	c.(697-699)Gcc>Acc	p.A233T	MAP3K10_ENST00000593906.1_3'UTR	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)	p.A233T(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GATCCTGGAGGCCATCGAGAA	0.627																																					p.A233T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697A	19						.						87.0	73.0	78.0					19																	40704296		2203	4300	6503	45396136	SO:0001583	missense	4294	exon2			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.697G>A	19.37:g.40704296G>A	ENSP00000253055:p.Ala233Thr		45396136	NM_002446	Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	37	CCDS12549.1	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845818	0.51164	.	.	ENSG00000130758	ENST00000253055	T	0.74737	-0.87	5.08	4.03	0.46877	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.194452	0.44483	D	0.000441	T	0.50360	0.1611	N	0.05259	-0.085	0.37719	D	0.924844	B	0.19445	0.036	B	0.25987	0.065	T	0.50947	-0.8767	10	0.27082	T	0.32	.	7.1451	0.25579	0.1878:0.0:0.8122:0.0	.	233	Q02779	M3K10_HUMAN	T	233	ENSP00000253055:A233T	ENSP00000253055:A233T	A	+	1	0	MAP3K10	45396136	0.999000	0.42202	1.000000	0.80357	0.962000	0.63368	1.934000	0.40163	2.549000	0.85964	0.306000	0.20318	GCC		0.627	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
CADM4	199731	broad.mit.edu	37	19	44131796	44131796	+	Splice_Site	SNP	C	C	G			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:44131796C>G	ENST00000222374.2	-	2	259	c.211G>C	c.(211-213)Gcc>Ccc	p.A71P	CADM4_ENST00000593506.1_5'Flank	NM_145296.1	NP_660339.1	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	71	Ig-like V-type.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	12		Prostate(69;0.0199)				CAGCACTCACCACGGGTGCCA	0.582																																					p.A71P												.	.	0			c.G211C	19						.						91.0	88.0	89.0					19																	44131796		2203	4300	6503	48823636	SO:0001630	splice_region_variant	199731	exon2			AF363368	CCDS12627.1	19q13.32	2013-01-29	2007-02-07	2007-02-07		ENSG00000105767		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30825	protein-coding gene	gene with protein product	"""nectin-like 4"""	609744	"""immunoglobulin superfamily, member 4C"""	IGSF4C		11536053	Standard	NM_145296		Approved	TSLL2, Necl-4, SynCAM4	uc002oxc.1	Q8NFZ8		ENST00000222374.2:c.211+1G>C	19.37:g.44131796C>G			48823636	NM_145296	B2R7L5|Q9Y4A4	Missense_Mutation	SNP	ENST00000222374.2	37	CCDS12627.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223070	0.58668	.	.	ENSG00000105767	ENST00000222374	T	0.26518	1.73	5.17	4.11	0.48088	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.18964	0.0455	L	0.31752	0.955	0.46654	D	0.999143	B	0.24920	0.114	B	0.24701	0.055	T	0.04400	-1.0954	9	.	.	.	.	13.0193	0.58777	0.1628:0.8372:0.0:0.0	.	71	Q8NFZ8	CADM4_HUMAN	P	71	ENSP00000222374:A71P	.	A	-	1	0	CADM4	48823636	1.000000	0.71417	0.896000	0.35187	0.980000	0.70556	4.411000	0.59781	1.276000	0.44395	0.591000	0.81541	GCC		0.582	CADM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463352.1	NM_145296	Missense_Mutation
BCAM	4059	broad.mit.edu	37	19	45317529	45317529	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:45317529C>T	ENST00000270233.6	+	7	927	c.905C>T	c.(904-906)aCg>aTg	p.T302M	BCAM_ENST00000589651.1_Missense_Mutation_p.T302M	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	302	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)	p.T302M(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CCGGAGTATACGCTTTTCCGC	0.647																																					p.T302M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C905T	19	GRCh37	CM033644	BCAM	M		.						37.0	39.0	38.0					19																	45317529		2203	4300	6503	50009369	SO:0001583	missense	4059	exon7			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.905C>T	19.37:g.45317529C>T	ENSP00000270233:p.Thr302Met		50009369	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	5.994	0.367393	0.11352	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.13778	2.56;2.56	3.98	-0.528	0.11905	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10337	0.0253	L	0.56199	1.76	0.09310	N	1	B	0.34226	0.443	B	0.25140	0.058	T	0.23084	-1.0198	9	0.34782	T	0.22	-2.0869	5.9639	0.19315	0.0:0.5205:0.0:0.4795	.	302	P50895	BCAM_HUMAN	M	302	ENSP00000270233:T302M;ENSP00000375817:T302M	ENSP00000270233:T302M	T	+	2	0	BCAM	50009369	0.068000	0.21057	0.008000	0.14137	0.537000	0.34900	0.197000	0.17197	0.093000	0.17368	-0.379000	0.06801	ACG		0.647	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
CCDC155	147872	broad.mit.edu	37	19	49912498	49912498	+	Silent	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:49912498G>T	ENST00000447857.3	+	14	1309	c.1104G>T	c.(1102-1104)ctG>ctT	p.L368L		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	368						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.L368L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						GGACCGAGCTGCTACCCCCAT	0.612																																					p.L368L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1104T	19						.						54.0	59.0	57.0					19																	49912498		2008	4175	6183	54604310	SO:0001819	synonymous_variant	147872	exon14				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1104G>T	19.37:g.49912498G>T			54604310	NM_144688	Q96MC3	Silent	SNP	ENST00000447857.3	37	CCDS46140.1																																																																																				0.612	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688	
ZNF83	55769	broad.mit.edu	37	19	53117118	53117118	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:53117118C>T	ENST00000597597.1	-	2	2953	c.700G>A	c.(700-702)Gaa>Aaa	p.E234K	ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000301096.3_Missense_Mutation_p.E234K|ZNF83_ENST00000545872.1_Missense_Mutation_p.E234K|ZNF83_ENST00000541777.2_Missense_Mutation_p.E234K|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000536937.1_Missense_Mutation_p.E234K|ZNF83_ENST00000544146.1_Missense_Mutation_p.E234K|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000391789.4_Missense_Mutation_p.E234K			P51522	ZNF83_HUMAN	zinc finger protein 83	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E234K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TTGTTACATTCGTAAGGTTTT	0.388																																					p.E234K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G700A	19						.						85.0	77.0	80.0					19																	53117118		2203	4300	6503	57808930	SO:0001583	missense	55769	exon4			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.700G>A	19.37:g.53117118C>T	ENSP00000472619:p.Glu234Lys		57808930	NM_001105552	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	ENST00000597597.1	37	CCDS12854.1	.	.	.	.	.	.	.	.	.	.	N	0.009	-1.857421	0.00558	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;3.28	1.7	0.653	0.17828	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06005	0.0156	N	0.03224	-0.385	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.0;0.002	T	0.39231	-0.9624	9	0.02654	T	1	.	2.6726	0.05071	0.2252:0.1504:0.0:0.6244	.	234;234	P51522-2;P51522	.;ZNF83_HUMAN	K	234	ENSP00000445993:E234K;ENSP00000301096:E234K;ENSP00000445470:E234K;ENSP00000440713:E234K;ENSP00000439681:E234K;ENSP00000375666:E234K	ENSP00000301096:E234K	E	-	1	0	ZNF83	57808930	0.000000	0.05858	0.077000	0.20336	0.020000	0.10135	-1.889000	0.01614	0.111000	0.17947	-0.600000	0.04104	GAA		0.388	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
SLC25A23	79085	broad.mit.edu	37	19	6457532	6457533	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:6457532_6457533GC>AA	ENST00000301454.4	-	3	458_459	c.352_353GC>TT	c.(352-354)GCt>TTt	p.A118F	SLC25A23_ENST00000414491.2_5'Flank|SLC25A23_ENST00000334510.5_Missense_Mutation_p.A118F	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	118	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)	p.A118>?(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						AATTTTCTCAGCCTGCTCCAGC	0.559																																					.												.	.	1	Complex(1)	large_intestine(1)	c.352_353TT	19						.																																			6408533	SO:0001583	missense	79085	exon3			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.352_353delinsAA	19.37:g.6457532_6457533delinsAA	ENSP00000301454:p.Ala118Phe		6408532	NM_024103	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	DNP	ENST00000301454.4	37	CCDS32882.1																																																																																				0.559	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
ZNF121	7675	broad.mit.edu	37	19	9677159	9677159	+	Silent	SNP	A	A	T			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:9677159A>T	ENST00000586602.1	-	6	1046	c.630T>A	c.(628-630)gcT>gcA	p.A210A	ZNF121_ENST00000320451.6_Silent_p.A210A			P58317	ZN121_HUMAN	zinc finger protein 121	210					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A210A(1)		breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						CTGAGCGCCCAGCGAAGGCTC	0.418																																					p.A210A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T630A	19						.						47.0	48.0	48.0					19																	9677159		2203	4300	6503	9538159	SO:0001819	synonymous_variant	7675	exon4			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.630T>A	19.37:g.9677159A>T			9538159	NM_001008727		Silent	SNP	ENST00000586602.1	37																																																																																					0.418	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000449910.1	NM_001008727	
PEG3	5178	broad.mit.edu	37	19	57336002	57336003	+	Missense_Mutation	DNP	AC	AC	CT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr19:57336002_57336003AC>CT	ENST00000326441.9	-	4	384_385	c.21_22GT>AG	c.(19-24)ttGTct>ttAGct	p.S8A	ZIM2_ENST00000593931.1_5'Flank|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000594706.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.S8A|PEG3_ENST00000593695.1_Intron|PEG3_ENST00000598410.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000601070.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	8					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L7>?(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TTGGTGGCAGACAAGTGCTTTG	0.485																																					.												.	.	2	Complex(2)	large_intestine(2)	c.21_22AG	19						.																																			62027815	SO:0001583	missense	5178	exon1			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.21_22delinsCT	19.37:g.57336002_57336003delinsCT	ENSP00000326581:p.Ser8Ala		62027814	NM_001146186	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	DNP	ENST00000326441.9	37	CCDS12948.1																																																																																				0.485	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416099.2		
CSMD1	64478	broad.mit.edu	37	8	3855603	3855603	+	Missense_Mutation	SNP	C	C	T	rs544220269		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr8:3855603C>T	ENST00000520002.1	-	5	1195	c.640G>A	c.(640-642)Ggg>Agg	p.G214R	CSMD1_ENST00000602723.1_Missense_Mutation_p.G214R|CSMD1_ENST00000400186.3_Missense_Mutation_p.G214R|CSMD1_ENST00000542608.1_Missense_Mutation_p.G214R|CSMD1_ENST00000602557.1_Missense_Mutation_p.G214R|CSMD1_ENST00000539096.1_Missense_Mutation_p.G214R|CSMD1_ENST00000537824.1_Missense_Mutation_p.G214R			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	214	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.G214R(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTGCTGGTCCCGCGTAAGGTT	0.572																																					p.G214R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G640A	8						.						33.0	36.0	35.0					8																	3855603		2090	4253	6343	3843011	SO:0001583	missense	64478	exon5					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.640G>A	8.37:g.3855603C>T	ENSP00000430733:p.Gly214Arg		3843011	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	20.6	4.015093	0.75161	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.17213	2.29;2.29;2.29;2.29;2.29	5.45	5.45	0.79879	.	0.000000	0.26832	U	0.022270	T	0.48021	0.1477	M	0.87381	2.88	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.45220	-0.9276	10	0.25751	T	0.34	-17.6909	18.2724	0.90072	0.0:1.0:0.0:0.0	.	214	E5RIG2	.	R	214;214;76;214;214;214	ENSP00000383047:G214R;ENSP00000430733:G214R;ENSP00000441462:G214R;ENSP00000446243:G214R;ENSP00000441675:G214R	ENSP00000320445:G76R	G	-	1	0	CSMD1	3843011	1.000000	0.71417	0.156000	0.22583	0.337000	0.28794	7.626000	0.83164	2.551000	0.86045	0.655000	0.94253	GGG		0.572	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
TTI2	80185	broad.mit.edu	37	8	33369725	33369726	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr8:33369725_33369726CC>AT	ENST00000431156.2	-	2	1024_1025	c.406_407GG>AT	c.(406-408)GGc>ATc	p.G136I	TTI2_ENST00000360742.5_Missense_Mutation_p.G136I|TTI2_ENST00000519356.1_5'Flank|TTI2_ENST00000520636.1_Missense_Mutation_p.G136I|SNORD13_ENST00000459299.1_RNA	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	136								p.G136>?(1)									CCATGCAGGGCCGACCAGGGAA	0.535																																					.												.	.	1	Complex(1)	large_intestine(1)	c.406_407AT	8						.																																			33489268	SO:0001583	missense	80185	exon1			AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.406_407delinsAT	8.37:g.33369725_33369726delinsAT	ENSP00000411169:p.Gly136Ile		33489267	NM_025115	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	DNP	ENST00000431156.2	37	CCDS6090.1																																																																																				0.535	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
ADCY8	114	broad.mit.edu	37	8	131848609	131848609	+	Silent	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr8:131848609C>A	ENST00000286355.5	-	12	4681	c.2589G>T	c.(2587-2589)ctG>ctT	p.L863L	ADCY8_ENST00000377928.3_Silent_p.L732L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	863					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.L863L(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CAATCATGATCAGCAGCACTG	0.537										HNSCC(32;0.087)																											p.L863L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2589T	8						.						167.0	128.0	141.0					8																	131848609		2203	4300	6503	131917791	SO:0001819	synonymous_variant	114	exon12			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2589G>T	8.37:g.131848609C>A			131917791	NM_001115		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																				0.537	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
CDC14A	8556	broad.mit.edu	37	1	100933607	100933607	+	Missense_Mutation	SNP	C	C	T	rs148737918		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:100933607C>T	ENST00000336454.3	+	10	1289	c.934C>T	c.(934-936)Cgg>Tgg	p.R312W	CDC14A_ENST00000361544.6_Missense_Mutation_p.R312W|RP5-837M10.4_ENST00000432210.1_RNA|CDC14A_ENST00000542213.1_Missense_Mutation_p.R254W|CDC14A_ENST00000370125.2_3'UTR|CDC14A_ENST00000370124.3_Missense_Mutation_p.R312W|CDC14A_ENST00000544534.1_Missense_Mutation_p.R312W	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	312	B.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R312W(1)		breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		TAGAATATGCCGGCCAGGCTC	0.418																																					p.R312W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C934T	1						.	C	TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	161.0	165.0	163.0		934,934,934	5.0	1.0	1	dbSNP_134	163	0,8600		0,0,4300	no	missense,missense,missense	CDC14A	NM_003672.3,NM_033312.2,NM_033313.2	101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	312/595,312/624,312/384	100933607	1,13005	2203	4300	6503	100706195	SO:0001583	missense	8556	exon10			AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.934C>T	1.37:g.100933607C>T	ENSP00000336739:p.Arg312Trp		100706195	NM_033312	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Missense_Mutation	SNP	ENST00000336454.3	37	CCDS769.1	.	.	.	.	.	.	.	.	.	.	C	16.79	3.219878	0.58560	2.27E-4	0.0	ENSG00000079335	ENST00000542213;ENST00000361544;ENST00000370124;ENST00000336454;ENST00000544534	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	4.96	4.96	0.65561	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	H	0.99746	4.745	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.89360	0.3667	10	0.87932	D	0	-7.6366	13.2024	0.59776	0.1594:0.8406:0.0:0.0	.	254;312;312;312;312	F5H7B3;A6MA65;Q9UNH5;Q9UNH5-2;Q52LH9	.;.;CC14A_HUMAN;.;.	W	254;312;312;312;312	ENSP00000442640:R254W;ENSP00000354916:R312W;ENSP00000359142:R312W;ENSP00000336739:R312W;ENSP00000442543:R312W	ENSP00000336739:R312W	R	+	1	2	CDC14A	100706195	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	1.949000	0.40313	2.290000	0.77057	0.591000	0.81541	CGG		0.418	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1	NM_033312	
VCAM1	7412	broad.mit.edu	37	1	101196837	101196837	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:101196837G>A	ENST00000294728.2	+	6	1389	c.1288G>A	c.(1288-1290)Gtg>Atg	p.V430M	VCAM1_ENST00000347652.2_Missense_Mutation_p.V338M|VCAM1_ENST00000370115.1_Intron|VCAM1_ENST00000370119.4_Missense_Mutation_p.V368M	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	430	Ig-like C2-type 5.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.V430M(2)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	GGTTCCTAGCGTGTACCCCCT	0.468																																					p.V368M												.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G1102A	1						.						68.0	71.0	70.0					1																	101196837		2203	4300	6503	100969425	SO:0001583	missense	7412	exon6			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1288G>A	1.37:g.101196837G>A	ENSP00000294728:p.Val430Met		100969425	NM_001199834	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581859	0.46006	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728	T;T;T	0.26957	1.7;1.7;1.7	5.52	4.58	0.56647	Immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.126553	0.52532	D	0.000063	T	0.44540	0.1298	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.997	T	0.26744	-1.0094	10	0.41790	T	0.15	-19.2323	13.2468	0.60028	0.0746:0.0:0.9254:0.0	.	368;338;430	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	M	368;338;430	ENSP00000359137:V368M;ENSP00000304611:V338M;ENSP00000294728:V430M	ENSP00000294728:V430M	V	+	1	0	VCAM1	100969425	1.000000	0.71417	0.968000	0.41197	0.025000	0.11179	6.029000	0.70895	2.873000	0.98535	0.563000	0.77884	GTG		0.468	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
IGSF3	3321	broad.mit.edu	37	1	117159024	117159024	+	Silent	SNP	C	C	T	rs201692914		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:117159024C>T	ENST00000369486.3	-	3	864	c.99G>A	c.(97-99)acG>acA	p.T33T	IGSF3_ENST00000318837.6_Silent_p.T33T|IGSF3_ENST00000369483.1_Silent_p.T33T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	33	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T33T(6)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGGAGCCCTCCGTGCGGTACA	0.547																																					p.T33T												.	.	6	Substitution - coding silent(6)	large_intestine(6)	c.G99A	1						.						18.0	19.0	18.0					1																	117159024		1976	3928	5904	116960547	SO:0001819	synonymous_variant	3321	exon3			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.99G>A	1.37:g.117159024C>T			116960547	NM_001542	A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	37	CCDS30813.1																																																																																				0.547	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
SPAG17	200162	broad.mit.edu	37	1	118629592	118629592	+	Missense_Mutation	SNP	G	G	A	rs139343615	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:118629592G>A	ENST00000336338.5	-	11	1464	c.1399C>T	c.(1399-1401)Cgg>Tgg	p.R467W		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	467						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.R467W(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GATGGCTCCCGCAGACTGGGT	0.517																																					p.R467W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1399T	1						.	G	TRP/ARG	4,4402	8.1+/-20.4	0,4,2199	125.0	121.0	123.0		1399	1.6	0.2	1	dbSNP_134	123	0,8600		0,0,4300	yes	missense	SPAG17	NM_206996.2	101	0,4,6499	AA,AG,GG		0.0,0.0908,0.0308	possibly-damaging	467/2224	118629592	4,13002	2203	4300	6503	118431115	SO:0001583	missense	200162	exon11				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1399C>T	1.37:g.118629592G>A	ENSP00000337804:p.Arg467Trp		118431115	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632467	0.46944	9.08E-4	0.0	ENSG00000155761	ENST00000336338	T	0.18502	2.21	4.76	1.59	0.23543	.	1.188320	0.05901	N	0.630029	T	0.05227	0.0139	L	0.29908	0.895	0.22521	N	0.999025	D	0.56968	0.978	B	0.40101	0.319	T	0.35919	-0.9769	10	0.66056	D	0.02	.	8.6773	0.34187	0.0:0.5932:0.3206:0.0862	.	467	Q6Q759	SPG17_HUMAN	W	467	ENSP00000337804:R467W	ENSP00000337804:R467W	R	-	1	2	SPAG17	118431115	0.000000	0.05858	0.241000	0.24154	0.829000	0.46940	-0.079000	0.11357	0.690000	0.31570	0.563000	0.77884	CGG		0.517	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
MTX1	4580	broad.mit.edu	37	1	155182266	155182266	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:155182266C>G	ENST00000368376.3	+	5	968	c.862C>G	c.(862-864)Ctg>Gtg	p.L288V	MTX1_ENST00000316721.4_Missense_Mutation_p.L257V|GBAP1_ENST00000486869.1_RNA|MTX1_ENST00000609421.1_Missense_Mutation_p.L139V|RP11-263K19.6_ENST00000455788.1_RNA|MTX1_ENST00000495589.1_3'UTR	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1	288					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)		p.L288V(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAACTTCTTCCTGCCTGGCCG	0.557																																					p.L257V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C769G	1						.						47.0	46.0	46.0					1																	155182266		2203	4297	6500	153448890	SO:0001583	missense	4580	exon4				CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708	ENST00000368376.3:c.862C>G	1.37:g.155182266C>G	ENSP00000357360:p.Leu288Val		153448890	NM_198883	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	Missense_Mutation	SNP	ENST00000368376.3	37	CCDS1100.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	14.75|14.75	2.629138|2.629138	0.46944|0.46944	.|.	.|.	ENSG00000173171|ENSG00000173171	ENST00000368376;ENST00000316721|ENST00000424959	T;T|.	0.33438|.	1.44;1.41|.	4.61|4.61	3.69|3.69	0.42338|0.42338	Glutathione S-transferase, C-terminal-like (1);|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.47377|0.47377	0.1442|0.1442	L|L	0.56340|0.56340	1.77|1.77	0.40726|0.40726	D|D	0.982701|0.982701	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.997;0.999|.	T|T	0.45644|0.45644	-0.9247|-0.9247	10|5	0.52906|.	T|.	0.07|.	-9.1266|-9.1266	10.4309|10.4309	0.44407|0.44407	0.0:0.9024:0.0:0.0976|0.0:0.9024:0.0:0.0976	.|.	257;288|.	Q13505-2;Q13505|.	.;MTX1_HUMAN|.	V|R	288;257|150	ENSP00000357360:L288V;ENSP00000317106:L257V|.	ENSP00000317106:L257V|.	L|P	+|+	1|2	2|0	MTX1|MTX1	153448890|153448890	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.053000|1.053000	0.30442|0.30442	1.049000|1.049000	0.40321|0.40321	0.563000|0.563000	0.77884|0.77884	CTG|CCT		0.557	MTX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086844.1	NM_198883	
FCRLA	84824	broad.mit.edu	37	1	161681039	161681039	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:161681039G>A	ENST00000236938.6	+	3	567	c.325G>A	c.(325-327)Ggg>Agg	p.G109R	FCRLA_ENST00000470841.1_3'UTR|FCRLA_ENST00000309691.6_Intron|FCRLA_ENST00000540521.1_Intron|FCRLA_ENST00000294796.4_Intron|FCRLA_ENST00000546024.1_Intron|FCRLA_ENST00000367953.3_Missense_Mutation_p.G98R|FCRLA_ENST00000367959.2_Missense_Mutation_p.G115R|FCRLA_ENST00000367949.2_Intron|FCRLA_ENST00000350710.3_Intron|FCRLA_ENST00000540926.1_Missense_Mutation_p.G98R|FCRLA_ENST00000349527.4_Missense_Mutation_p.G92R|FCRLA_ENST00000367957.2_Intron|FCRLA_ENST00000367950.1_Intron	NM_032738.3	NP_116127.3	Q7L513	FCRLA_HUMAN	Fc receptor-like A	92	Ig-like C2-type 1.				cell differentiation (GO:0030154)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)		p.G92R(1)		breast(1)|kidney(12)|large_intestine(4)|lung(13)|prostate(1)|skin(2)|stomach(1)	34	all_cancers(52;2.55e-15)|all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00301)			AGTTTTTGAAGGGGACCTGCT	0.617																																					p.G109R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G325A	1						.						36.0	39.0	38.0					1																	161681039		2203	4300	6503	159947663	SO:0001583	missense	84824	exon3			AF531423	CCDS30926.1, CCDS53415.1, CCDS53416.1, CCDS53417.1, CCDS53418.1, CCDS53419.1, CCDS53420.1	1q23.3	2014-01-28	2006-09-26	2006-09-26	ENSG00000132185	ENSG00000132185		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18504	protein-coding gene	gene with protein product		606891	"""Fc receptor-like and mucin-like 1"""	FCRLM1		11754007	Standard	NM_001184866		Approved	MGC4595, FCRLc2, FCRLb, FCRLc1, FCRLd, FCRLe, FCRL, FCRLa, FREB, FCRLX	uc001gbe.3	Q7L513	OTTHUMG00000034537	ENST00000236938.6:c.325G>A	1.37:g.161681039G>A	ENSP00000236938:p.Gly109Arg		159947663	NM_032738	A0N0M1|A6NC03|A6NL20|F5H720|F8W743|G3V1J2|Q5VXA1|Q5VXA2|Q5VXA3|Q5VXA4|Q5VXB0|Q5VXB1|Q8NEW4|Q8WXH3|Q96PC6|Q96PJ0|Q96PJ1|Q96PJ2|Q96PJ4|Q9BR57	Missense_Mutation	SNP	ENST00000236938.6	37	CCDS30926.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092924	0.56075	.	.	ENSG00000132185	ENST00000236938;ENST00000367959;ENST00000540926;ENST00000349527;ENST00000367953	T;T;T;T;T	0.01484	4.84;4.84;4.84;4.84;4.84	4.99	4.99	0.66335	.	0.000000	0.46442	D	0.000286	T	0.11537	0.0281	H	0.96111	3.77	0.43003	D	0.994521	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.995	T	0.00875	-1.1531	10	0.87932	D	0	.	13.6413	0.62253	0.0:0.0:1.0:0.0	.	115;109	A6NC03;Q7L513-9	.;.	R	109;115;98;92;98	ENSP00000236938:G109R;ENSP00000356936:G115R;ENSP00000446380:G98R;ENSP00000294798:G92R;ENSP00000356930:G98R	ENSP00000236938:G109R	G	+	1	0	FCRLA	159947663	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	4.487000	0.60293	2.568000	0.86640	0.655000	0.94253	GGG		0.617	FCRLA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083574.1	NM_032738	
ZNF648	127665	broad.mit.edu	37	1	182025960	182025960	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:182025960C>T	ENST00000339948.3	-	2	1393	c.1186G>A	c.(1186-1188)Gcc>Acc	p.A396T		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	396					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A396T(1)		breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						CGGTCGCAGGCGGGGCAGCGG	0.721																																					p.A396T	NSCLC(71;908 1374 5429 20458 35642)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1186A	1						.						17.0	18.0	17.0					1																	182025960		2159	4220	6379	180292583	SO:0001583	missense	127665	exon2			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.1186G>A	1.37:g.182025960C>T	ENSP00000344129:p.Ala396Thr		180292583	NM_001009992	B2RP16	Missense_Mutation	SNP	ENST00000339948.3	37	CCDS30952.1	.	.	.	.	.	.	.	.	.	.	C	9.855	1.194752	0.22037	.	.	ENSG00000179930	ENST00000339948	T	0.18016	2.24	2.81	-0.706	0.11249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05410	0.0143	N	0.02334	-0.595	0.09310	N	1	B	0.15719	0.014	B	0.10450	0.005	T	0.34054	-0.9844	9	0.49607	T	0.09	.	1.5293	0.02532	0.2051:0.2796:0.3727:0.1426	.	396	Q5T619	ZN648_HUMAN	T	396	ENSP00000344129:A396T	ENSP00000344129:A396T	A	-	1	0	ZNF648	180292583	0.000000	0.05858	0.092000	0.20876	0.992000	0.81027	0.655000	0.24933	-0.134000	0.11516	0.561000	0.74099	GCC		0.721	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090794.1	XM_060597	
KDM5B	10765	broad.mit.edu	37	1	202705510	202705510	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:202705510C>T	ENST00000367265.3	-	21	4259	c.3095G>A	c.(3094-3096)cGt>cAt	p.R1032H	KDM5B_ENST00000367264.2_Missense_Mutation_p.R1068H	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1032					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R1032H(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						CACTGGCACACGTCCTCCAGC	0.413																																					p.R1032H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3095A	1						.						82.0	75.0	77.0					1																	202705510		2203	4300	6503	200972133	SO:0001583	missense	10765	exon21			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3095G>A	1.37:g.202705510C>T	ENSP00000356234:p.Arg1032His		200972133	NM_006618	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.134007	0.37630	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	T;T;T	0.40756	1.02;1.02;1.02	5.66	5.66	0.87406	Lysine-specific demethylase-like domain (1);	0.098509	0.64402	D	0.000002	T	0.28830	0.0715	N	0.16602	0.42	0.58432	D	0.99999	D;B	0.53885	0.963;0.024	B;B	0.42692	0.395;0.018	T	0.10520	-1.0626	10	0.02654	T	1	-20.0717	20.1253	0.97977	0.0:1.0:0.0:0.0	.	1068;1032	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	H	1032;874;1068;874	ENSP00000356234:R1032H;ENSP00000356233:R1068H;ENSP00000235790:R874H	ENSP00000235790:R874H	R	-	2	0	KDM5B	200972133	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	4.826000	0.62715	2.832000	0.97577	0.655000	0.94253	CGT		0.413	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
DYRK3	8444	broad.mit.edu	37	1	206821586	206821586	+	Missense_Mutation	SNP	G	G	A	rs200323668		TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:206821586G>A	ENST00000367109.2	+	3	1211	c.1043G>A	c.(1042-1044)cGc>cAc	p.R348H	DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367106.1_Missense_Mutation_p.R328H|DYRK3_ENST00000367108.3_Missense_Mutation_p.R328H	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.R348H(2)|p.R313H(2)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CACCACGGGCGCAGTTCAACC	0.458																																					p.R348H	Melanoma(164;427 2622 26826 51707)											.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G1043A	1						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	89.0	96.0	94.0		983,1043	4.2	0.9	1		94	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DYRK3	NM_001004023.1,NM_003582.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	328/569,348/589	206821586	1,13005	2203	4300	6503	204888209	SO:0001583	missense	8444	exon3			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.1043G>A	1.37:g.206821586G>A	ENSP00000356076:p.Arg348His		204888209	NM_003582	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	ENST00000367109.2	37	CCDS30999.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990623	0.35131	0.0	1.16E-4	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000367106	T;T;T	0.20463	2.07;2.07;2.07	5.17	4.24	0.50183	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050585	0.85682	D	0.000000	T	0.27027	0.0662	L	0.31578	0.945	0.80722	D	1	B;D	0.65815	0.139;0.995	B;P	0.54965	0.043;0.765	T	0.02037	-1.1225	10	0.45353	T	0.12	.	14.1405	0.65316	0.0:0.0:0.8488:0.1512	.	348;328	O43781;O43781-2	DYRK3_HUMAN;.	H	348;328;328	ENSP00000356076:R348H;ENSP00000356075:R328H;ENSP00000356073:R328H	ENSP00000356073:R328H	R	+	2	0	DYRK3	204888209	1.000000	0.71417	0.874000	0.34290	0.810000	0.45777	7.760000	0.85248	1.376000	0.46267	0.448000	0.29417	CGC		0.458	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088458.1	NM_003582	
MARK1	4139	broad.mit.edu	37	1	220826465	220826465	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:220826465G>T	ENST00000366917.4	+	16	2025	c.1759G>T	c.(1759-1761)Gct>Tct	p.A587S	MARK1_ENST00000402574.1_Missense_Mutation_p.A452S|MARK1_ENST00000366918.4_Missense_Mutation_p.A565S					MAP/microtubule affinity-regulating kinase 1									p.A587S(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AGTGCCTGCTGCTTCCCCATC	0.468																																					p.A587S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1759T	1						.						81.0	68.0	72.0					1																	220826465		2203	4300	6503	218893088	SO:0001583	missense	4139	exon16			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1759G>T	1.37:g.220826465G>T	ENSP00000355884:p.Ala587Ser		218893088	NM_018650		Missense_Mutation	SNP	ENST00000366917.4	37	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874248	0.51695	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.36699	1.24;1.24;1.24	4.64	3.71	0.42584	.	0.249867	0.40064	N	0.001190	T	0.33059	0.0850	L	0.49126	1.545	0.37674	D	0.923245	B;B;B;B	0.15141	0.012;0.004;0.001;0.004	B;B;B;B	0.12837	0.005;0.008;0.001;0.004	T	0.20739	-1.0266	10	0.23891	T	0.37	.	15.0605	0.71947	0.0:0.1428:0.8572:0.0	.	587;452;587;565	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	S	452;565;587	ENSP00000386017:A452S;ENSP00000355885:A565S;ENSP00000355884:A587S	ENSP00000355884:A587S	A	+	1	0	MARK1	218893088	1.000000	0.71417	0.718000	0.30602	0.997000	0.91878	3.454000	0.52986	1.037000	0.40024	0.462000	0.41574	GCT		0.468	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
MARK1	4139	broad.mit.edu	37	1	220826676	220826676	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:220826676C>T	ENST00000366917.4	+	16	2236	c.1970C>T	c.(1969-1971)aCa>aTa	p.T657I	MARK1_ENST00000402574.1_Missense_Mutation_p.T522I|MARK1_ENST00000366918.4_Missense_Mutation_p.T635I					MAP/microtubule affinity-regulating kinase 1									p.T657I(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		AGCAAAATCACATCCAAATTT	0.383																																					p.T657I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1970T	1						.						62.0	64.0	63.0					1																	220826676		2203	4300	6503	218893299	SO:0001583	missense	4139	exon16			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1970C>T	1.37:g.220826676C>T	ENSP00000355884:p.Thr657Ile		218893299	NM_018650		Missense_Mutation	SNP	ENST00000366917.4	37	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404548	0.83230	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.74315	-0.83;-0.63;0.44	5.34	4.4	0.53042	.	0.000000	0.85682	D	0.000000	D	0.85936	0.5813	M	0.87269	2.87	0.52501	D	0.999954	P;P;D;P	0.58268	0.955;0.504;0.982;0.816	P;B;P;P	0.59703	0.709;0.356;0.862;0.614	D	0.88890	0.3345	10	0.87932	D	0	.	16.07	0.80919	0.0:0.8662:0.1338:0.0	.	657;522;657;635	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	I	522;635;657	ENSP00000386017:T522I;ENSP00000355885:T635I;ENSP00000355884:T657I	ENSP00000355884:T657I	T	+	2	0	MARK1	218893299	1.000000	0.71417	0.946000	0.38457	0.996000	0.88848	7.578000	0.82498	2.506000	0.84524	0.462000	0.41574	ACA		0.383	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
PTPRU	10076	broad.mit.edu	37	1	29642617	29642617	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:29642617G>A	ENST00000345512.3	+	25	3626	c.3497G>A	c.(3496-3498)cGc>cAc	p.R1166H	PTPRU_ENST00000460170.2_Missense_Mutation_p.R1162H|PTPRU_ENST00000373779.3_Missense_Mutation_p.R1156H|PTPRU_ENST00000428026.2_Missense_Mutation_p.R1153H|PTPRU_ENST00000356870.3_Missense_Mutation_p.R1162H|PTPRU_ENST00000323874.8_Missense_Mutation_p.R1162H	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1166					canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.R1166H(2)|p.R1162H(2)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GAGATGATCCGCATTGATCCT	0.527																																					p.R1166H												.	.	4	Substitution - Missense(4)	endometrium(3)|large_intestine(1)	c.G3497A	1						.						146.0	108.0	120.0					1																	29642617		2203	4300	6503	29515204	SO:0001583	missense	10076	exon25			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.3497G>A	1.37:g.29642617G>A	ENSP00000334941:p.Arg1166His		29515204	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425034	0.83667	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52;2.52	4.51	4.51	0.55191	.	0.076076	0.52532	D	0.000079	T	0.29288	0.0729	M	0.75264	2.295	0.45066	D	0.998085	D;D;D;D;D	0.64830	0.994;0.994;0.994;0.99;0.99	P;P;P;P;P	0.57846	0.828;0.828;0.828;0.677;0.677	T	0.01030	-1.1475	9	.	.	.	.	10.3953	0.44196	0.0899:0.0:0.9101:0.0	.	1153;1162;1156;1162;1166	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	H	1166;1156;1162;1162;1153;1162	ENSP00000334941:R1166H;ENSP00000362884:R1156H;ENSP00000349333:R1162H;ENSP00000314987:R1162H;ENSP00000392332:R1153H;ENSP00000432906:R1162H	.	R	+	2	0	PTPRU	29515204	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.603000	0.67619	2.498000	0.84270	0.561000	0.74099	CGC		0.527	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
KPNA6	23633	broad.mit.edu	37	1	32623933	32623933	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:32623933C>A	ENST00000373625.3	+	5	490	c.397C>A	c.(397-399)Ctg>Atg	p.L133M	KPNA6_ENST00000545542.1_Missense_Mutation_p.L138M|KPNA6_ENST00000469790.1_3'UTR|KPNA6_ENST00000537234.1_Missense_Mutation_p.L130M	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	133					maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)	p.L133M(1)		large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CGTGGAGTTTCTGAAGAGGAA	0.403																																					p.L133M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C397A	1						.						168.0	170.0	169.0					1																	32623933		2203	4300	6503	32396520	SO:0001583	missense	23633	exon5			AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.397C>A	1.37:g.32623933C>A	ENSP00000362728:p.Leu133Met		32396520	NM_012316	B2RDC7|D3DPP5|Q5VVU3	De_novo_Start_OutOfFrame	SNP	ENST00000373625.3	37	CCDS352.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789092	0.70337	.	.	ENSG00000025800	ENST00000373625;ENST00000373617;ENST00000537234;ENST00000545542;ENST00000446515	D;D;D;T	0.83837	-1.77;-1.77;-1.77;0.5	5.21	4.29	0.51040	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90731	0.7091	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.97110	1.0;1.0;0.985	D	0.91561	0.5264	10	0.59425	D	0.04	-6.0512	14.1683	0.65493	0.0:0.927:0.0:0.073	.	138;138;133	F5GYL8;B4DWX3;O60684	.;.;IMA7_HUMAN	M	133;107;130;138;84	ENSP00000362728:L133M;ENSP00000444930:L130M;ENSP00000440609:L138M;ENSP00000415677:L84M	ENSP00000362719:L107M	L	+	1	2	KPNA6	32396520	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.192000	0.50989	1.335000	0.45486	0.561000	0.74099	CTG		0.403	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000012527.4	NM_012316	
PLPPR5	163404	broad.mit.edu	37	1	99422174	99422174	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:99422174G>A	ENST00000263177.4	-	2	582	c.361C>T	c.(361-363)Cga>Tga	p.R121*	LPPR5_ENST00000370188.3_Nonsense_Mutation_p.R121*	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		121						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.R121*(2)									CCAAGAAATCGGACAGTTCGG	0.358																																					p.R121X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|central_nervous_system(1)	c.C361T	1						.						55.0	59.0	58.0					1																	99422174		2202	4300	6502	99194762	SO:0001587	stop_gained	163404	exon2																														ENST00000263177.4:c.361C>T	1.37:g.99422174G>A	ENSP00000263177:p.Arg121*		99194762	NM_001037317	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Nonsense_Mutation	SNP	ENST00000263177.4	37	CCDS30778.1	.	.	.	.	.	.	.	.	.	.	G	38	6.889546	0.97912	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	.	.	.	4.74	3.8	0.43715	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.9165	0.52767	0.0:0.0:0.5615:0.4385	.	.	.	.	X	121	.	ENSP00000263177:R121X	R	-	1	2	AL161744.1	99194762	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.382000	0.44345	1.064000	0.40671	0.591000	0.81541	CGA		0.358	LPPR5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393221.1		
WNT3A	89780	broad.mit.edu	37	1	228210497	228210497	+	Silent	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr1:228210497C>T	ENST00000284523.1	+	2	279	c.201C>T	c.(199-201)gcC>gcT	p.A67A	WNT3A_ENST00000366753.2_Silent_p.A67A	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	67					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)	p.A67A(1)		kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				CCAGCGTGGCCGAGGGCATCA	0.672																																					p.A67A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C201T	1						.						58.0	55.0	56.0					1																	228210497		2203	4300	6503	226277120	SO:0001819	synonymous_variant	89780	exon2			AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.201C>T	1.37:g.228210497C>T			226277120	NM_033131	Q3SY79|Q3SY80|Q969P2	Silent	SNP	ENST00000284523.1	37	CCDS1564.1																																																																																				0.672	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131	
MUC2	4583	broad.mit.edu	37	11	1093295	1093295	+	Missense_Mutation	SNP	C	C	T	rs200837746|rs200145328		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:1093295C>T	ENST00000441003.2	+	30	5141	c.5114C>T	c.(5113-5115)aCt>aTt	p.T1705I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1672I|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1705I(1)|p.T1672I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgacc	0.642																																					p.T1705I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5114T	11						.						113.0	161.0	144.0					11																	1093295		1882	3466	5348	1083295	SO:0001583	missense	4583	exon30			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5114C>T	11.37:g.1093295C>T	ENSP00000415183:p.Thr1705Ile		1083295	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.775	-0.764347	0.02996	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11277	3.02;2.79	1.6	-0.698	0.11280	.	0.547305	0.11728	U	0.535177	T	0.05868	0.0153	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.38457	-0.9660	9	0.34782	T	0.22	.	3.0673	0.06219	0.0:0.5189:0.2842:0.1969	.	1705	E7EUV1	.	I	1705;1672	ENSP00000415183:T1705I;ENSP00000351956:T1672I	ENSP00000351956:T1672I	T	+	2	0	MUC2	1083295	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.065000	0.14466	-0.392000	0.07751	-1.238000	0.01547	ACT		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC2	4583	broad.mit.edu	37	11	1093430	1093430	+	Missense_Mutation	SNP	C	C	A	rs199573018	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:1093430C>A	ENST00000441003.2	+	30	5276	c.5249C>A	c.(5248-5250)aCc>aAc	p.T1750N	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1717N|MUC2_ENST00000333592.6_Missense_Mutation_p.T38N	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1750N(2)|p.T1717N(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	atcaccaccaccaccacggtg	0.642													c|||	1883	0.375998	0.3865	0.3401	5008	,	,		24527	0.3621		0.3549	False		,,,				2504	0.4233				p.T1750N												.	.	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)	c.C5249A	11						.						201.0	230.0	220.0					11																	1093430		2046	4004	6050	1083430	SO:0001583	missense	4583	exon30			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5249C>A	11.37:g.1093430C>A	ENSP00000415183:p.Thr1750Asn		1083430	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.281	-0.147066	0.06627	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.11169	2.86;2.8;2.81	1.81	-3.61	0.04556	.	2587.460000	0.00766	U	0.001164	T	0.08313	0.0207	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.38607	-0.9653	9	0.49607	T	0.09	.	6.4546	0.21922	0.1652:0.6018:0.2329:0.0	.	1750	E7EUV1	.	N	1750;1717;38	ENSP00000415183:T1750N;ENSP00000351956:T1717N;ENSP00000331373:T38N	ENSP00000331373:T38N	T	+	2	0	MUC2	1083430	0.004000	0.15560	0.002000	0.10522	0.003000	0.03518	2.066000	0.41452	-0.510000	0.06523	0.195000	0.17529	ACC		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CUL5	8065	broad.mit.edu	37	11	107965671	107965672	+	Missense_Mutation	DNP	GT	GT	AG			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:107965671_107965672GT>AG	ENST00000393094.2	+	15	2316_2317	c.1700_1701GT>AG	c.(1699-1701)aGT>aAG	p.S567K		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	567					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)	p.S567>?(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		AAAAATCATAGTGGTAGAAAAT	0.381																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1700_1701AG	11						.																																			107470882	SO:0001583	missense	8065	exon15			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	Exception_encountered	11.37:g.107965671_107965672delinsAG	ENSP00000376808:p.Ser567Lys		107470881	NM_003478	A8K960|O14766|Q9BZC6	Missense_Mutation	DNP	ENST00000393094.2	37	CCDS31668.1																																																																																				0.381	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389429.1		
ZBTB16	7704	broad.mit.edu	37	11	114112927	114112927	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:114112927C>T	ENST00000335953.4	+	5	1872	c.1492C>T	c.(1492-1494)Cgc>Tgc	p.R498C	RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000392996.2_Missense_Mutation_p.R498C|ZBTB16_ENST00000535379.1_3'UTR	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	498					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R498C(1)		central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GTGTGGGAAGCGCTTCCAGGC	0.612																																					p.R498C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492T	11						.						81.0	56.0	65.0					11																	114112927		2201	4296	6497	113618137	SO:0001583	missense	7704	exon5			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1492C>T	11.37:g.114112927C>T	ENSP00000338157:p.Arg498Cys		113618137	NM_006006	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	37	CCDS8367.1	.	.	.	.	.	.	.	.	.	.	C	32	5.180751	0.94846	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.52295	0.67;0.67	5.33	5.33	0.75918	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	L	0.60845	1.875	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.67998	-0.5525	10	0.62326	D	0.03	-8.8717	19.4129	0.94683	0.0:1.0:0.0:0.0	.	498	Q05516	ZBT16_HUMAN	C	498;498;375	ENSP00000338157:R498C;ENSP00000376721:R498C	ENSP00000309507:R375C	R	+	1	0	ZBTB16	113618137	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	4.754000	0.62191	2.652000	0.90054	0.655000	0.94253	CGC		0.612	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398940.1	NM_006006	
OR10G7	390265	broad.mit.edu	37	11	123909245	123909245	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:123909245G>A	ENST00000330487.5	-	1	472	c.464C>T	c.(463-465)tCt>tTt	p.S155F		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S155F(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CTGGACAGCAGAGTGCAGAGA	0.572																																					p.S155F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C464T	11						.						138.0	135.0	136.0					11																	123909245		2200	4297	6497	123414455	SO:0001583	missense	390265	exon1			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.464C>T	11.37:g.123909245G>A	ENSP00000329689:p.Ser155Phe		123414455	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.734653	0.48939	.	.	ENSG00000182634	ENST00000330487	T	0.44881	0.91	3.24	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	0.347872	0.20989	N	0.082077	T	0.64549	0.2608	M	0.87269	2.87	0.34183	D	0.671209	D	0.67145	0.996	D	0.76575	0.988	T	0.75789	-0.3194	10	0.87932	D	0	.	8.6875	0.34247	0.1098:0.0:0.8902:0.0	.	155	Q8NGN6	O10G7_HUMAN	F	155	ENSP00000329689:S155F	ENSP00000329689:S155F	S	-	2	0	OR10G7	123414455	0.003000	0.15002	1.000000	0.80357	0.825000	0.46686	1.272000	0.33109	1.826000	0.53198	0.455000	0.32223	TCT		0.572	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
ROBO3	64221	broad.mit.edu	37	11	124750355	124750355	+	Missense_Mutation	SNP	C	C	T	rs374478103		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:124750355C>T	ENST00000397801.1	+	27	4192	c.4000C>T	c.(4000-4002)Cgg>Tgg	p.R1334W	ROBO3_ENST00000525482.1_3'UTR|ROBO3_ENST00000538940.1_Missense_Mutation_p.R1312W|ROBO3_ENST00000543966.1_Missense_Mutation_p.R97W	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	1334					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.R1334W(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CTTCCTGTCCCGGGGCCAGGG	0.662																																					p.R1334W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4000T	11						.	C	TRP/ARG	0,4020		0,0,2010	25.0	30.0	28.0		4000	4.7	0.8	11		28	1,8377		0,1,4188	no	missense	ROBO3	NM_022370.3	101	0,1,6198	TT,TC,CC		0.0119,0.0,0.0081	probably-damaging	1334/1387	124750355	1,12397	2010	4189	6199	124255565	SO:0001583	missense	64221	exon27			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.4000C>T	11.37:g.124750355C>T	ENSP00000380903:p.Arg1334Trp		124255565	NM_022370		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117955	0.56505	0.0	1.19E-4	ENSG00000154134	ENST00000397801;ENST00000538940;ENST00000543966	T;T;T	0.72942	-0.7;-0.69;0.4	5.62	4.7	0.59300	.	0.556287	0.13801	N	0.361808	T	0.77246	0.4102	L	0.58101	1.795	0.36107	D	0.844566	D	0.76494	0.999	P	0.54210	0.745	T	0.82212	-0.0569	10	0.87932	D	0	.	14.2659	0.66118	0.2709:0.7291:0.0:0.0	.	1334	Q96MS0	ROBO3_HUMAN	W	1334;1312;97	ENSP00000380903:R1334W;ENSP00000441797:R1312W;ENSP00000438799:R97W	ENSP00000380903:R1334W	R	+	1	2	ROBO3	124255565	0.997000	0.39634	0.809000	0.32408	0.415000	0.31203	0.781000	0.26774	1.356000	0.45884	0.655000	0.94253	CGG		0.662	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
ART5	116969	broad.mit.edu	37	11	3661063	3661064	+	Missense_Mutation	DNP	AG	AG	GC			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:3661063_3661064AG>GC	ENST00000397068.3	-	2	987_988	c.595_596CT>GC	c.(595-597)CTc>GCc	p.L199A	TRPC2_ENST00000526541.1_RNA|ART5_ENST00000397067.3_Intron|ART5_ENST00000359918.4_Missense_Mutation_p.L199A	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	199					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)	p.L199>?(1)		breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		TAGAGAGAAGAGGGTGGCATTA	0.55																																					.												.	.	1	Complex(1)	large_intestine(1)	c.595_596GC	11						.																																			3617640	SO:0001583	missense	116969	exon2			Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.595_596delinsGC	11.37:g.3661063_3661064delinsGC	ENSP00000380258:p.Leu199Ala		3617639	NM_053017	C9IYG7|Q6UX84|Q86W02	Missense_Mutation	DNP	ENST00000397068.3	37	CCDS7743.1																																																																																				0.550	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017	
ARNTL	406	broad.mit.edu	37	11	13397168	13397168	+	Missense_Mutation	SNP	C	C	T	rs370345058		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:13397168C>T	ENST00000403290.1	+	15	1539	c.1184C>T	c.(1183-1185)aCg>aTg	p.T395M	ARNTL_ENST00000403482.3_Missense_Mutation_p.T393M|ARNTL_ENST00000389707.4_Missense_Mutation_p.T394M|ARNTL_ENST00000396441.3_Missense_Mutation_p.T394M|ARNTL_ENST00000401424.1_Missense_Mutation_p.T352M|ARNTL_ENST00000389708.3_Missense_Mutation_p.T395M|ARNTL_ENST00000403510.3_Missense_Mutation_p.T351M|ARNTL_ENST00000361003.4_Missense_Mutation_p.T277M			O00327	BMAL1_HUMAN	aryl hydrocarbon receptor nuclear translocator-like	395	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of cell cycle (GO:0051726)|regulation of cellular senescence (GO:2000772)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|nuclear body (GO:0016604)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|Hsp90 protein binding (GO:0051879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|signal transducer activity (GO:0004871)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.T394M(2)		breast(1)|endometrium(2)|large_intestine(11)|lung(5)|upper_aerodigestive_tract(1)	20				Epithelial(150;0.0243)		GTTTTACAGACGAGAGAAAAA	0.323																																					p.T351M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1052T	11						.	C	MET/THR,MET/THR,MET/THR	2,4398	4.2+/-10.8	0,2,2198	40.0	41.0	41.0		1181,1052,1181	5.4	0.9	11		41	0,8584		0,0,4292	no	missense,missense,missense	ARNTL	NM_001178.4,NM_001030273.1,NM_001030272.1	81,81,81	0,2,6490	TT,TC,CC		0.0,0.0455,0.0154	benign,benign,benign	394/626,351/583,394/626	13397168	2,12982	2200	4292	6492	13353744	SO:0001583	missense	406	exon15			D89722	CCDS31430.1, CCDS44543.1, CCDS73259.1	11p15	2013-05-21			ENSG00000133794	ENSG00000133794		"""Basic helix-loop-helix proteins"""	701	protein-coding gene	gene with protein product		602550				9144434, 9079689	Standard	XM_005252930		Approved	MOP3, JAP3, BMAL1, PASD3, bHLHe5	uc001mkp.3	O00327	OTTHUMG00000150623	ENST00000403290.1:c.1184C>T	11.37:g.13397168C>T	ENSP00000384517:p.Thr395Met		13353744	NM_001030273	A2I2N6|A8K645|B5ME11|B7WPG7|D3DQW6|O00313|O00314|O00315|O00316|O00317|Q4G136|Q8IUT4|Q99631|Q99649	De_novo_Start_OutOfFrame	SNP	ENST00000403290.1	37		.	.	.	.	.	.	.	.	.	.	C	13.79	2.342650	0.41498	4.55E-4	0.0	ENSG00000133794	ENST00000396441;ENST00000389707;ENST00000401424;ENST00000403290;ENST00000361003;ENST00000389708;ENST00000403510;ENST00000339640;ENST00000403482	T;T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25	5.4	5.4	0.78164	PAS fold-3 (1);PAS (2);	0.092020	0.85682	D	0.000000	T	0.14399	0.0348	N	0.22421	0.69	0.43874	D	0.996489	B;B;B;B;B;B	0.27192	0.002;0.171;0.008;0.004;0.004;0.081	B;B;B;B;B;B	0.20184	0.004;0.027;0.01;0.006;0.003;0.028	T	0.04467	-1.0949	10	0.46703	T	0.11	.	18.7646	0.91866	0.0:1.0:0.0:0.0	.	277;393;352;395;394;351	O00327-4;O00327-7;O00327-1;O00327;O00327-8;A2I2N6	.;.;.;BMAL1_HUMAN;.;.	M	394;394;352;395;277;395;351;351;393	ENSP00000379718:T394M;ENSP00000374357:T394M;ENSP00000385915:T352M;ENSP00000384517:T395M;ENSP00000354278:T277M;ENSP00000374358:T395M;ENSP00000385581:T351M;ENSP00000385897:T393M	ENSP00000340289:T351M	T	+	2	0	ARNTL	13353744	1.000000	0.71417	0.947000	0.38551	0.884000	0.51177	5.587000	0.67510	2.510000	0.84645	0.555000	0.69702	ACG		0.323	ARNTL-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000319173.1	NM_001178	
OR4A5	81318	broad.mit.edu	37	11	51412212	51412212	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:51412212C>A	ENST00000319760.6	-	1	236	c.184G>T	c.(184-186)Gcc>Tcc	p.A62S		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A62S(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				GACAGGCAGGCAAGGAAGAAA	0.423																																					p.A62S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G184T	11						.						61.0	59.0	60.0					11																	51412212		2201	4296	6497	51268788	SO:0001583	missense	81318	exon1			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.184G>T	11.37:g.51412212C>A	ENSP00000367664:p.Ala62Ser		51268788	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	37	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	1.038	-0.679875	0.03353	.	.	ENSG00000221840	ENST00000319760	T	0.01084	5.36	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.643454	0.13420	N	0.389205	T	0.00666	0.0022	N	0.04090	-0.28	0.18873	N	0.999989	B	0.28128	0.201	B	0.31245	0.126	T	0.48603	-0.9021	10	0.10636	T	0.68	.	6.4367	0.21827	0.0:0.6895:0.3105:0.0	.	62	Q8NH83	OR4A5_HUMAN	S	62	ENSP00000367664:A62S	ENSP00000367664:A62S	A	-	1	0	OR4A5	51268788	0.000000	0.05858	0.837000	0.33122	0.025000	0.11179	-1.678000	0.01942	1.394000	0.46624	0.162000	0.16502	GCC		0.423	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
PLCB3	5331	broad.mit.edu	37	11	64033794	64033794	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:64033794A>T	ENST00000540288.1	+	28	3377	c.3274A>T	c.(3274-3276)Aag>Tag	p.K1092*	PLCB3_ENST00000325234.5_Nonsense_Mutation_p.K1025*|PLCB3_ENST00000279230.6_Nonsense_Mutation_p.K1092*	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1092				REKKELQKILDRKRHNSISEAKMRDKHKKEA -> SWPSWP RSVRSSGRGSPRRSAGACWARCRRG (in Ref. 2; CAA85776). {ECO:0000305}.	inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.K1092*(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CAGGGAGAAGAAGGAGCTGCA	0.587																																					p.K1025X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A3073T	11						.						59.0	64.0	62.0					11																	64033794		2201	4297	6498	63790370	SO:0001587	stop_gained	5331	exon26			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3274A>T	11.37:g.64033794A>T	ENSP00000443631:p.Lys1092*		63790370	NM_001184883	A5PKZ6|G5E960|Q8N1A4	Nonsense_Mutation	SNP	ENST00000540288.1	37	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	A	41	8.631788	0.98892	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	.	.	.	5.17	5.17	0.71159	.	0.653399	0.16815	N	0.198407	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9879	0.64348	1.0:0.0:0.0:0.0	.	.	.	.	X	1092;1092;1025	.	ENSP00000279230:K1092X	K	+	1	0	PLCB3	63790370	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	6.908000	0.75730	1.959000	0.56917	0.454000	0.30748	AAG		0.587	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
FRMD8	83786	broad.mit.edu	37	11	65156937	65156937	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:65156937T>G	ENST00000317568.5	+	3	354	c.191T>G	c.(190-192)gTc>gGc	p.V64G	FRMD8_ENST00000355991.5_Intron|FRMD8_ENST00000416776.2_Missense_Mutation_p.V64G	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	64	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						GTCCGCGAGGTCCTGCAGCTT	0.647																																					p.V64G												.	.	0			c.T191G	11						.						69.0	49.0	56.0					11																	65156937		2201	4297	6498	64913513	SO:0001583	missense	83786	exon3			AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.191T>G	11.37:g.65156937T>G	ENSP00000319726:p.Val64Gly		64913513	NM_031904	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	37	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	T	14.38	2.518510	0.44763	.	.	ENSG00000126391	ENST00000317568;ENST00000416776;ENST00000526201;ENST00000525156	D;D	0.83673	-1.6;-1.75	5.11	2.76	0.32466	Band 4.1 domain (1);FERM domain (1);	0.265266	0.35067	N	0.003467	T	0.68348	0.2991	L	0.44542	1.39	0.45930	D	0.998765	P;P	0.44734	0.483;0.842	B;B	0.35114	0.057;0.196	T	0.61618	-0.7026	10	0.22706	T	0.39	-11.2847	4.7882	0.13236	0.0:0.3906:0.0:0.6094	.	64;64	B4E2P1;Q9BZ67	.;FRMD8_HUMAN	G	64;64;56;64	ENSP00000319726:V64G;ENSP00000392111:V64G	ENSP00000319726:V64G	V	+	2	0	FRMD8	64913513	1.000000	0.71417	0.999000	0.59377	0.775000	0.43874	2.738000	0.47401	0.793000	0.33875	0.459000	0.35465	GTC		0.647	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
OPCML	4978	broad.mit.edu	37	11	132527122	132527122	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr11:132527122C>T	ENST00000331898.7	-	2	838	c.260G>A	c.(259-261)cGt>cAt	p.R87H	OPCML_ENST00000541867.1_Missense_Mutation_p.R87H|OPCML_ENST00000374778.4_Missense_Mutation_p.R46H|OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000524381.1_Missense_Mutation_p.R80H	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	87	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.R87H(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GATGATCACACGAGGGTCTAT	0.532																																					p.R80H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G239A	11						.						231.0	169.0	190.0					11																	132527122		2201	4297	6498	132032332	SO:0001583	missense	4978	exon3			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.260G>A	11.37:g.132527122C>T	ENSP00000330862:p.Arg87His		132032332	NM_001012393	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	De_novo_Start_OutOfFrame	SNP	ENST00000331898.7	37	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	C	32	5.192401	0.94960	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000541867	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.92	5.02	0.67125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.058301	0.64402	N	0.000001	T	0.75361	0.3839	H	0.96365	3.81	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	D	0.84226	0.0464	10	0.87932	D	0	-5.6923	15.0633	0.71973	0.0:0.9322:0.0:0.0678	.	87;80;87;87	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	H	87;80;46;87	ENSP00000330862:R87H;ENSP00000434750:R80H;ENSP00000363910:R46H;ENSP00000445496:R87H	ENSP00000330862:R87H	R	-	2	0	OPCML	132032332	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	7.764000	0.85297	1.521000	0.48983	0.655000	0.94253	CGT		0.532	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
DAAM2	23500	broad.mit.edu	37	6	39847198	39847198	+	Missense_Mutation	SNP	G	G	A	rs181701991	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr6:39847198G>A	ENST00000398904.2	+	14	1972	c.1790G>A	c.(1789-1791)cGt>cAt	p.R597H	DAAM2_ENST00000274867.4_Missense_Mutation_p.R597H|RP11-61I13.3_ENST00000607675.1_RNA|DAAM2_ENST00000538976.1_Missense_Mutation_p.R597H			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	597	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.|Pro-rich.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)			p.R597H(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					AGGAAAAAGCGTGTCCCCCAG	0.632													G|||	12	0.00239617	0.0	0.0014	5008	,	,		14562	0.006		0.001	False		,,,				2504	0.0041				p.R597H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1790A	6						.						71.0	73.0	72.0					6																	39847198		1974	4133	6107	39955176	SO:0001583	missense	23500	exon14			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.1790G>A	6.37:g.39847198G>A	ENSP00000381876:p.Arg597His		39955176	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	4	0.0018315018315018315	0	0.0	1	0.0027624309392265192	2	0.0034965034965034965	1	0.0013192612137203166	G	10.93	1.490231	0.26686	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.18016	2.24;2.24;2.24	5.15	-1.29	0.09288	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.620813	0.16621	N	0.206470	T	0.09291	0.0229	N	0.22421	0.69	0.09310	N	0.999999	D;D	0.76494	0.992;0.999	B;D	0.64877	0.35;0.93	T	0.14392	-1.0474	10	0.59425	D	0.04	.	6.6426	0.22917	0.4393:0.2235:0.3372:0.0	.	597;597	G5EA45;Q86T65	.;DAAM2_HUMAN	H	597	ENSP00000274867:R597H;ENSP00000381876:R597H;ENSP00000437808:R597H	ENSP00000274867:R597H	R	+	2	0	DAAM2	39955176	0.997000	0.39634	0.844000	0.33320	0.028000	0.11728	1.290000	0.33319	-0.108000	0.12066	-0.157000	0.13467	CGT		0.632	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
PGC	5225	broad.mit.edu	37	6	41712141	41712141	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr6:41712141C>T	ENST00000373025.3	-	3	384	c.322G>A	c.(322-324)Gcc>Acc	p.A108T	PGC_ENST00000425343.2_Missense_Mutation_p.A108T	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	108					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.A108T(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TCACTGCAGGCCTGGCTCTGG	0.612																																					p.A108T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A	6						.						60.0	62.0	61.0					6																	41712141		2203	4300	6503	41820119	SO:0001583	missense	5225	exon3				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.322G>A	6.37:g.41712141C>T	ENSP00000362116:p.Ala108Thr		41820119	NM_001166424	B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	ENST00000373025.3	37	CCDS4859.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821681	0.50633	.	.	ENSG00000096088	ENST00000373025;ENST00000425343	T;T	0.60672	0.17;0.17	4.65	3.79	0.43588	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.063203	0.64402	N	0.000010	T	0.72391	0.3454	M	0.88377	2.95	0.44175	D	0.996986	D	0.89917	1.0	D	0.79784	0.993	T	0.79014	-0.1976	10	0.87932	D	0	.	12.4447	0.55645	0.0:0.9174:0.0:0.0826	.	108	P20142	PEPC_HUMAN	T	108	ENSP00000362116:A108T;ENSP00000405094:A108T	ENSP00000362116:A108T	A	-	1	0	PGC	41820119	1.000000	0.71417	0.999000	0.59377	0.011000	0.07611	4.216000	0.58540	1.203000	0.43233	-0.225000	0.12378	GCC		0.612	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040521.2		
COL12A1	1303	broad.mit.edu	37	6	75828815	75828815	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr6:75828815G>A	ENST00000322507.8	-	46	7607	c.7298C>T	c.(7297-7299)aCg>aTg	p.T2433M	COL12A1_ENST00000483888.2_Missense_Mutation_p.T2433M|COL12A1_ENST00000416123.2_Missense_Mutation_p.T2433M|COL12A1_ENST00000345356.6_Missense_Mutation_p.T1269M	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2433	VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.T2433M(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CCGACCGTCCGTGACCACAAC	0.488																																					p.T2433M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7298T	6						.						132.0	131.0	131.0					6																	75828815		1979	4167	6146	75885535	SO:0001583	missense	1303	exon46			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.7298C>T	6.37:g.75828815G>A	ENSP00000325146:p.Thr2433Met		75885535	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261183	0.80246	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37	5.78	5.78	0.91487	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.96571	0.8881	H	0.96301	3.8	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97195	0.9860	10	0.87932	D	0	.	20.0175	0.97485	0.0:0.0:1.0:0.0	.	1269;2433	Q99715-2;Q99715	.;COCA1_HUMAN	M	2433;71;2433;1269;2433;2433	ENSP00000325146:T2433M;ENSP00000399812:T71M;ENSP00000305147:T1269M;ENSP00000412864:T2433M;ENSP00000421216:T2433M	ENSP00000325146:T2433M	T	-	2	0	COL12A1	75885535	1.000000	0.71417	0.968000	0.41197	0.435000	0.31806	9.869000	0.99810	2.730000	0.93505	0.650000	0.86243	ACG		0.488	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
COL12A1	1303	broad.mit.edu	37	6	75855840	75855840	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr6:75855840G>A	ENST00000322507.8	-	24	4847	c.4538C>T	c.(4537-4539)aCa>aTa	p.T1513I	COL12A1_ENST00000483888.2_Missense_Mutation_p.T1513I|COL12A1_ENST00000416123.2_Missense_Mutation_p.T1513I|COL12A1_ENST00000345356.6_Missense_Mutation_p.T349I	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1513	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.T1513I(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGTTGGCTCTGTGTCCTTAAC	0.433																																					p.T1513I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4538T	6						.						122.0	118.0	119.0					6																	75855840		1952	4155	6107	75912560	SO:0001583	missense	1303	exon24			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4538C>T	6.37:g.75855840G>A	ENSP00000325146:p.Thr1513Ile		75912560	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500463	0.64298	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.19	4.29	0.51040	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.253027	0.33253	N	0.005102	T	0.48295	0.1492	M	0.76002	2.32	0.32147	N	0.584756	P;P	0.48016	0.676;0.904	B;P	0.48063	0.429;0.565	T	0.54443	-0.8293	10	0.46703	T	0.11	.	15.4227	0.75025	0.0:0.1397:0.8603:0.0	.	349;1513	Q99715-2;Q99715	.;COCA1_HUMAN	I	1513;1513;349;1513;1513	ENSP00000325146:T1513I;ENSP00000305147:T349I;ENSP00000412864:T1513I;ENSP00000421216:T1513I	ENSP00000325146:T1513I	T	-	2	0	COL12A1	75912560	1.000000	0.71417	0.002000	0.10522	0.006000	0.05464	6.554000	0.73923	1.129000	0.42072	0.655000	0.94253	ACA		0.433	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
CASP8AP2	9994	broad.mit.edu	37	6	90577280	90577281	+	RNA	DNP	GT	GT	AG	rs544986776		TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr6:90577280_90577281GT>AG	ENST00000551025.1	+	0	5708_5709									caspase 8 associated protein 2									p.S1424>?(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		AATGTGTGTAGTGTAGAAAAGA	0.411																																					.	Colon(187;1656 2025 17045 31481 39901)											.	.	1	Complex(1)	large_intestine(1)	c.4271_4272AG	6						.																																			90634002			9994	exon8			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212	Exception_encountered	6.37:g.90577280_90577281delinsAG			90634001	NM_001137667		Missense_Mutation	DNP	ENST00000551025.1	37																																																																																					0.411	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
GSG2	83903	broad.mit.edu	37	17	3628021	3628021	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:3628021G>C	ENST00000325418.4	+	1	811	c.792G>C	c.(790-792)aaG>aaC	p.K264N	ITGAE_ENST00000263087.4_Intron|CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000571185.1_5'UTR	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	264					histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										CAGATGGGAAGAATATGAGAG	0.557																																					p.K264N												.	.	0			c.G792C	17						.						60.0	70.0	67.0					17																	3628021		2203	4300	6503	3574770	SO:0001583	missense	83903	exon1			AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.792G>C	17.37:g.3628021G>C	ENSP00000325290:p.Lys264Asn		3574770	NM_031965	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	37	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025694	0.35701	.	.	ENSG00000177602	ENST00000325418	T	0.06528	3.29	3.95	1.89	0.25635	.	1.261060	0.05831	N	0.617532	T	0.04634	0.0126	N	0.19112	0.55	0.09310	N	1	B	0.33694	0.421	B	0.27500	0.08	T	0.39860	-0.9593	10	0.87932	D	0	-18.5179	5.3166	0.15858	0.1136:0.2082:0.6782:0.0	.	264	Q8TF76	HASP_HUMAN	N	264	ENSP00000325290:K264N	ENSP00000325290:K264N	K	+	3	2	GSG2	3574770	0.001000	0.12720	0.011000	0.14972	0.160000	0.22226	0.006000	0.13152	0.584000	0.29591	0.655000	0.94253	AAG		0.557	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
KRT17	3872	broad.mit.edu	37	17	39777093	39777093	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:39777093G>T	ENST00000311208.8	-	6	1066	c.999C>A	c.(997-999)aaC>aaA	p.N333K	JUP_ENST00000540235.1_Missense_Mutation_p.N492K	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	333	Coil 2.|Peptide epitope S4; induces T-cell and keratinocyte proliferation and IFN-gamma production.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				CGCAGTAGCGGTTCTCTGTCT	0.622																																					p.N333K	Pancreas(92;1242 2086 39193 50508)											.	.	0			c.C999A	17						.						50.0	51.0	50.0					17																	39777093		2203	4300	6503	37030619	SO:0001583	missense	3872	exon6			X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.999C>A	17.37:g.39777093G>T	ENSP00000308452:p.Asn333Lys		37030619	NM_000422	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	37	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679947	0.47886	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	D;D	0.88201	-2.35;-2.35	4.02	3.05	0.35203	Filament (1);	0.294463	0.24798	N	0.035506	T	0.80592	0.4652	N	0.16130	0.375	0.27146	N	0.96154	B	0.29571	0.249	B	0.36030	0.216	T	0.74705	-0.3575	10	0.72032	D	0.01	.	9.0039	0.36100	0.0875:0.1599:0.7526:0.0	.	333	Q04695	K1C17_HUMAN	K	333;492	ENSP00000308452:N333K;ENSP00000441751:N492K	ENSP00000441751:N492K	N	-	3	2	JUP;KRT17	37030619	0.068000	0.21057	1.000000	0.80357	0.992000	0.81027	0.302000	0.19192	1.048000	0.40298	0.561000	0.74099	AAC		0.622	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
HDAC5	10014	broad.mit.edu	37	17	42169092	42169092	+	Silent	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:42169092G>T	ENST00000393622.2	-	10	1471	c.1140C>A	c.(1138-1140)gtC>gtA	p.V380V	HDAC5_ENST00000586802.1_Silent_p.V380V|HDAC5_ENST00000225983.6_Silent_p.V381V|HDAC5_ENST00000336057.5_Silent_p.V380V	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	380					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.V380V(1)		central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		TGGTGACAGTGACCGTGGCCT	0.587																																					p.V381V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1143A	17						.						159.0	131.0	141.0					17																	42169092		2203	4300	6503	39524618	SO:0001819	synonymous_variant	10014	exon10			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.1140C>A	17.37:g.42169092G>T			39524618	NM_001015053	C9JFV9|O60340|O60528|Q96DY4	Silent	SNP	ENST00000393622.2	37	CCDS45696.1																																																																																				0.587	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
MYCBPAP	84073	broad.mit.edu	37	17	48603500	48603501	+	Missense_Mutation	DNP	CA	CA	GT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:48603500_48603501CA>GT	ENST00000323776.5	+	14	2332_2333	c.2170_2171CA>GT	c.(2170-2172)CAg>GTg	p.Q724V	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.Q687V	NM_032133.4	NP_115509.4			MYCBP associated protein									p.Q687>?(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CAAGAGTCCTCAGCGGAAGAGC	0.624																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2170_2171GT	17						.																																			45958500	SO:0001583	missense	84073	exon14			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	Exception_encountered	17.37:g.48603500_48603501delinsGT	ENSP00000323184:p.Gln724Val		45958499	NM_032133		Missense_Mutation	DNP	ENST00000323776.5	37	CCDS32680.2																																																																																				0.624	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347814.1	NM_032133	
SEPT4	5414	broad.mit.edu	37	17	56599407	56599407	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:56599407C>T	ENST00000317268.3	-	6	894	c.718G>A	c.(718-720)Gag>Aag	p.E240K	SEPT4_ENST00000393086.1_Missense_Mutation_p.E221K|SEPT4_ENST00000580809.1_Missense_Mutation_p.E122K|SEPT4_ENST00000583114.1_Missense_Mutation_p.E93K|SEPT4_ENST00000580844.1_Missense_Mutation_p.E141K|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000412945.3_Missense_Mutation_p.E232K|SEPT4_ENST00000457347.2_Missense_Mutation_p.E255K|SEPT4_ENST00000317256.6_Missense_Mutation_p.E221K|SEPT4_ENST00000579371.1_Missense_Mutation_p.E141K|SEPT4_ENST00000426861.1_Missense_Mutation_p.E221K	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	240	Septin-type G.				apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGCCACTCTCGTCTCGGAAA	0.542																																					p.E221K												.	.	0			c.G661A	17						.						172.0	142.0	152.0					17																	56599407		2203	4300	6503	53954406	SO:0001583	missense	5414	exon6			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.718G>A	17.37:g.56599407C>T	ENSP00000321674:p.Glu240Lys		53954406	NM_080416	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	ENST00000317268.3	37	CCDS11610.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.956857	0.53293	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086;ENST00000426861	T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.84705	0.5531	H	0.96833	3.89	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.979;1.0;1.0;0.998;0.966;0.999	D	0.89206	0.3561	10	0.87932	D	0	.	17.7759	0.88508	0.0:1.0:0.0:0.0	.	232;255;93;221;221;93;240	O43236-3;O43236-4;B3KR63;O43236-6;O43236-2;O43236-5;O43236	.;.;.;.;.;.;SEPT4_HUMAN	K	232;254;221;240;221;221	ENSP00000414779:E232K;ENSP00000321071:E221K;ENSP00000321674:E240K;ENSP00000376801:E221K;ENSP00000402348:E221K	ENSP00000321071:E221K	E	-	1	0	SEPT4	53954406	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.786000	0.95864	0.563000	0.77884	GAG		0.542	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417	
MYBBP1A	10514	broad.mit.edu	37	17	4455909	4455909	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:4455909delT	ENST00000254718.4	-	6	880	c.574delA	c.(574-576)acafs	p.T192fs	MYBBP1A_ENST00000381556.2_Frame_Shift_Del_p.T192fs			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	192	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)	p.T192fs*14(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						TCCTGCAATGTGGCCTTCGAG	0.567																																					p.T192fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.574delA	17						.						54.0	48.0	50.0					17																	4455909		2203	4300	6503	4402658	SO:0001589	frameshift_variant	10514	exon6			AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.574delA	17.37:g.4455909delT	ENSP00000254718:p.Thr192fs		4402658	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Frame_Shift_Del	DEL	ENST00000254718.4	37	CCDS11046.1																																																																																				0.567	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
PITPNM3	83394	broad.mit.edu	37	17	6441380	6441380	+	Silent	SNP	A	A	T			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:6441380A>T	ENST00000262483.8	-	2	132	c.45T>A	c.(43-45)ggT>ggA	p.G15G	PITPNM3_ENST00000421306.3_Silent_p.G15G	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	15					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)	p.G15G(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		GCCAGGGGGCACCGCCGCCCG	0.552																																					p.G15G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T45A	17						.						37.0	36.0	36.0					17																	6441380		2203	4300	6503	6382104	SO:0001819	synonymous_variant	83394	exon2			AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.45T>A	17.37:g.6441380A>T			6382104	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	37	CCDS11076.1																																																																																				0.552	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
TP53	7157	broad.mit.edu	37	17	7577081	7577081	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:7577081T>C	ENST00000269305.4	-	8	1046	c.857A>G	c.(856-858)gAa>gGa	p.E286G	TP53_ENST00000359597.4_Missense_Mutation_p.E286G|TP53_ENST00000455263.2_Missense_Mutation_p.E286G|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.E286G|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.E286G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286G(18)|p.E286V(9)|p.0?(8)|p.?(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E286A(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAGATTCTCTTCCTCTGTGCG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E286G	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,-1	.	51	Substitution - Missense(28)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	large_intestine(9)|liver(6)|haematopoietic_and_lymphoid_tissue(5)|upper_aerodigestive_tract(4)|lung(4)|breast(4)|bone(4)|stomach(3)|central_nervous_system(3)|urinary_tract(3)|oesophagus(2)|ovary(2)|soft_tissue(1)|skin(1)	c.A857G	17	GRCh37	CM920679	TP53	M		.						95.0	81.0	86.0					17																	7577081		2203	4300	6503	7517806	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.857A>G	17.37:g.7577081T>C	ENSP00000269305:p.Glu286Gly		7517806	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.431106	0.62844	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99859	-7.24;-7.24;-7.24;-7.24;-7.24;-7.24	5.12	4.04	0.47022	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99857	0.9933	M	0.92077	3.27	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.81914	0.992;0.989;0.992;0.995	D	0.97429	1.0014	10	0.87932	D	0	-23.2961	9.0226	0.36209	0.0:0.0873:0.0:0.9127	.	286;286;286;286	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	G	286;286;286;286;286;275;154	ENSP00000352610:E286G;ENSP00000269305:E286G;ENSP00000398846:E286G;ENSP00000391127:E286G;ENSP00000391478:E286G;ENSP00000425104:E154G	ENSP00000269305:E286G	E	-	2	0	TP53	7517806	1.000000	0.71417	0.970000	0.41538	0.305000	0.27757	7.447000	0.80620	0.965000	0.38133	-0.379000	0.06801	GAA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CD79B	974	broad.mit.edu	37	17	62007479	62007479	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr17:62007479T>C	ENST00000006750.3	-	3	477	c.385A>G	c.(385-387)Acc>Gcc	p.T129A	CD79B_ENST00000392795.3_Missense_Mutation_p.T130A|CD79B_ENST00000349817.2_Intron	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	129	Ig-like V-type.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.T129A(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						ACCTCCGAGGTGTTGTTGCAC	0.602			"""Mis, O"""		DLBCL																																p.T130A			Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A388G	17						.						111.0	89.0	96.0					17																	62007479		2203	4300	6503	59361211	SO:0001583	missense	974	exon3			L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.385A>G	17.37:g.62007479T>C	ENSP00000006750:p.Thr129Ala		59361211	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	T	2.603	-0.292535	0.05568	.	.	ENSG00000007312	ENST00000392795;ENST00000006750	T;T	0.76316	-1.01;-1.01	4.21	-8.17	0.01057	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	2.989320	0.00855	N	0.001879	T	0.61160	0.2325	L	0.35854	1.095	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56798	-0.7919	10	0.05833	T	0.94	1.1638	8.6672	0.34127	0.0:0.5552:0.1299:0.3149	.	129	P40259	CD79B_HUMAN	A	130;129	ENSP00000376544:T130A;ENSP00000006750:T129A	ENSP00000006750:T129A	T	-	1	0	CD79B	59361211	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.015000	0.00313	-1.539000	0.01732	-1.202000	0.01658	ACC		0.602	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
SAMSN1	64092	broad.mit.edu	37	21	15893508	15893508	+	Missense_Mutation	SNP	C	C	T	rs199748093		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr21:15893508C>T	ENST00000400566.1	-	2	173	c.92G>A	c.(91-93)cGg>cAg	p.R31Q	SAMSN1_ENST00000285670.2_Missense_Mutation_p.R99Q|SAMSN1_ENST00000400564.1_Intron	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	31					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.R31Q(2)|p.R99Q(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		AGAATTATTCCGAAAACGATC	0.299																																					p.R31Q												.	.	3	Substitution - Missense(3)	endometrium(2)|large_intestine(1)	c.G92A	21						.	C	GLN/ARG	1,3603		0,1,1801	38.0	36.0	36.0		92	5.5	1.0	21		36	0,8126		0,0,4063	yes	missense	SAMSN1	NM_022136.3	43	0,1,5864	TT,TC,CC		0.0,0.0277,0.0085	probably-damaging	31/374	15893508	1,11729	1802	4063	5865	14815379	SO:0001583	missense	64092	exon2			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.92G>A	21.37:g.15893508C>T	ENSP00000383411:p.Arg31Gln		14815379	NM_022136	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000400566.1	37	CCDS42906.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.826551	0.90955	2.77E-4	0.0	ENSG00000155307	ENST00000285670;ENST00000400566	T;T	0.50001	0.76;0.76	5.48	5.48	0.80851	.	0.111985	0.56097	D	0.000022	T	0.70850	0.3271	M	0.78916	2.43	0.41089	D	0.985589	D;D	0.89917	0.999;1.0	P;D	0.73380	0.889;0.98	T	0.73091	-0.4092	10	0.54805	T	0.06	-13.6929	19.3408	0.94340	0.0:1.0:0.0:0.0	.	99;31	F8WAA1;Q9NSI8	.;SAMN1_HUMAN	Q	99;31	ENSP00000285670:R99Q;ENSP00000383411:R31Q	ENSP00000285670:R99Q	R	-	2	0	SAMSN1	14815379	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	5.338000	0.65947	2.555000	0.86185	0.557000	0.71058	CGG		0.299	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157914.1		
RWDD2B	10069	broad.mit.edu	37	21	30380383	30380383	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr21:30380383G>T	ENST00000493196.1	-	4	524	c.424C>A	c.(424-426)Caa>Aaa	p.Q142K	RWDD2B_ENST00000486719.1_5'UTR	NM_016940.2	NP_058636.1	P57060	RWD2B_HUMAN	RWD domain containing 2B	142	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.							p.Q142K(1)		endometrium(1)|kidney(1)|large_intestine(8)|lung(2)	12						CAATGTTTTTGCAGGAATGCA	0.408																																					p.Q142K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C424A	21						.						64.0	63.0	63.0					21																	30380383		2203	4300	6503	29302254	SO:0001583	missense	10069	exon4			AF212232	CCDS13582.1	21q22.11	2012-12-07	2007-07-17	2007-07-17	ENSG00000156253	ENSG00000156253			1302	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 6"""	C21orf6		10729227	Standard	NM_016940		Approved	GL011	uc002yms.3	P57060	OTTHUMG00000078805	ENST00000493196.1:c.424C>A	21.37:g.30380383G>T	ENSP00000418693:p.Gln142Lys		29302254	NM_016940		Missense_Mutation	SNP	ENST00000493196.1	37	CCDS13582.1	.	.	.	.	.	.	.	.	.	.	G	2.128	-0.399721	0.04865	.	.	ENSG00000156253	ENST00000493196	T	0.21191	2.02	5.38	5.38	0.77491	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.458779	0.23208	N	0.050717	T	0.12433	0.0302	N	0.17872	0.535	0.19775	N	0.99996	B;B	0.11235	0.0;0.004	B;B	0.17433	0.001;0.018	T	0.23691	-1.0181	10	0.05436	T	0.98	-19.5931	13.4227	0.61007	0.0:0.0:0.7496:0.2504	.	142;142	Q53FD2;P57060	.;RWD2B_HUMAN	K	142	ENSP00000418693:Q142K	ENSP00000418693:Q142K	Q	-	1	0	RWDD2B	29302254	0.972000	0.33761	0.747000	0.31113	0.958000	0.62258	1.035000	0.30216	2.793000	0.96121	0.655000	0.94253	CAA		0.408	RWDD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171858.1		
CCT8	10694	broad.mit.edu	37	21	30445900	30445900	+	Silent	SNP	G	G	A	rs16983693		TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr21:30445900G>A	ENST00000286788.4	-	1	218	c.12C>T	c.(10-12)caC>caT	p.H4H	CCT8_ENST00000540844.1_De_novo_Start_InFrame|CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000542732.1_5'Flank	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	4			H -> Q (in dbSNP:rs16983693).		'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)	p.H4H(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						CCTTGGGAACGTGAAGCGCCA	0.627																																					p.H4H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C12T	21						.						84.0	75.0	78.0					21																	30445900		2203	4300	6503	29367771	SO:0001819	synonymous_variant	10694	exon1			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.12C>T	21.37:g.30445900G>A			29367771	NM_006585	A6NN54|B4DEM7|B4DQH4|Q4VBP8	De_novo_Start_InFrame	SNP	ENST00000286788.4	37	CCDS33528.1																																																																																				0.627	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1		
SETD6	79918	broad.mit.edu	37	16	58552125	58552125	+	Silent	SNP	A	A	G			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr16:58552125A>G	ENST00000219315.4	+	6	1013	c.963A>G	c.(961-963)gcA>gcG	p.A321A	SETD6_ENST00000418480.1_3'UTR|SETD6_ENST00000394266.4_Silent_p.A252A|SETD6_ENST00000310682.2_Silent_p.A297A			Q8TBK2	SETD6_HUMAN	SET domain containing 6	321					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)	p.A297A(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						TTCGTGAGGCAGCATTACAGG	0.418																																					p.A297A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A891G	16						.						140.0	119.0	126.0					16																	58552125		2198	4300	6498	57109626	SO:0001819	synonymous_variant	79918	exon7			AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.963A>G	16.37:g.58552125A>G			57109626	NM_024860	A8K380|B5ME38|Q9H787	Silent	SNP	ENST00000219315.4	37	CCDS54013.1																																																																																				0.418	SETD6-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317274.2	NM_024860	
TAF4B	6875	broad.mit.edu	37	18	23866438	23866438	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr18:23866438C>T	ENST00000269142.5	+	7	2563	c.1565C>T	c.(1564-1566)cCa>cTa	p.P522L	TAF4B_ENST00000400466.2_Missense_Mutation_p.P522L|TAF4B_ENST00000578121.1_Missense_Mutation_p.P522L	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	522	Nuclear export signal.|Required for interaction with P65/RELA.				gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P522L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			GCTGGGATTCCACAGGCAGTT	0.438																																					p.P522L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1565T	18						.						54.0	52.0	53.0					18																	23866438		1823	4083	5906	22120436	SO:0001583	missense	6875	exon7			Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.1565C>T	18.37:g.23866438C>T	ENSP00000269142:p.Pro522Leu		22120436	NM_005640	Q29YA4|Q29YA5	Missense_Mutation	SNP	ENST00000269142.5	37	CCDS42421.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.752479	0.31046	.	.	ENSG00000141384	ENST00000418698;ENST00000269142;ENST00000400466	T;T	0.24723	1.92;1.84	5.28	5.28	0.74379	.	0.809542	0.11469	N	0.560980	T	0.22513	0.0543	L	0.29908	0.895	0.39196	D	0.963057	P;P	0.48764	0.915;0.845	B;B	0.44315	0.446;0.421	T	0.02301	-1.1180	10	0.16896	T	0.51	-6.447	12.8986	0.58113	0.1622:0.8378:0.0:0.0	.	522;522	Q92750;A4PBF7	TAF4B_HUMAN;.	L	520;522;522	ENSP00000269142:P522L;ENSP00000383314:P522L	ENSP00000269142:P522L	P	+	2	0	TAF4B	22120436	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	1.533000	0.36040	2.483000	0.83821	0.557000	0.71058	CCA		0.438	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
ACAA2	10449	broad.mit.edu	37	18	47323934	47323934	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr18:47323934G>C	ENST00000285093.10	-	3	689	c.214C>G	c.(214-216)Cat>Gat	p.H72D	RP11-886H22.1_ENST00000590532.2_3'UTR|ACAA2_ENST00000589432.1_Missense_Mutation_p.H17D|ACAA2_ENST00000587994.1_Missense_Mutation_p.H69D	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	72					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)	p.H72D(1)		large_intestine(2)|lung(7)|ovary(1)	10						AAACCAACATGCCTTGCCAAA	0.393																																					p.H72D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C214G	18						.						55.0	58.0	57.0					18																	47323934		2203	4300	6503	45577932	SO:0001583	missense	10449	exon3			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.214C>G	18.37:g.47323934G>C	ENSP00000285093:p.His72Asp		45577932	NM_006111	Q9BUT6	Missense_Mutation	SNP	ENST00000285093.10	37	CCDS11939.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021762	0.75275	.	.	ENSG00000167315	ENST00000285093	D	0.90004	-2.6	5.78	5.78	0.91487	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.95529	0.8547	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.95605	0.8666	10	0.87932	D	0	-23.2864	20.0086	0.97443	0.0:0.0:1.0:0.0	.	72;72	B2RB23;P42765	.;THIM_HUMAN	D	72	ENSP00000285093:H72D	ENSP00000285093:H72D	H	-	1	0	ACAA2	45577932	1.000000	0.71417	0.996000	0.52242	0.418000	0.31294	9.405000	0.97313	2.717000	0.92951	0.655000	0.94253	CAT		0.393	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255921.2	NM_006111	
IFT57	55081	broad.mit.edu	37	3	107941064	107941065	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:107941064_107941065CG>TT	ENST00000264538.3	-	1	352_353	c.105_106CG>AA	c.(103-108)ggCGcg>ggAAcg	p.A36T		NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	36					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)	p.G35>?(1)		kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			TGGTAGGCCGCGCCGGGCCCCC	0.649																																					.												.	.	1	Complex(1)	large_intestine(1)	c.105_106AA	3						.																																			109423755	SO:0001583	missense	55081	exon1			AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.105_106delinsTT	3.37:g.107941064_107941065delinsTT	ENSP00000264538:p.Ala36Thr		109423754	NM_018010	Q96DA9	Missense_Mutation	DNP	ENST00000264538.3	37	CCDS2951.1																																																																																				0.649	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353918.1	NM_018010	
ABTB1	80325	broad.mit.edu	37	3	127395267	127395267	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:127395267A>T	ENST00000232744.8	+	5	559	c.473A>T	c.(472-474)cAc>cTc	p.H158L	ABTB1_ENST00000393363.3_Missense_Mutation_p.H16L|ABTB1_ENST00000453791.2_Missense_Mutation_p.H16L|ABTB1_ENST00000468137.1_Missense_Mutation_p.H16L					ankyrin repeat and BTB (POZ) domain containing 1									p.H158L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						GTTCTCAGGCACCCACTGGTA	0.567																																					p.H158L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A473T	3						.						152.0	114.0	127.0					3																	127395267		2203	4300	6503	128877957	SO:0001583	missense	80325	exon5			AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.473A>T	3.37:g.127395267A>T	ENSP00000232744:p.His158Leu		128877957	NM_172027		Missense_Mutation	SNP	ENST00000232744.8	37	CCDS3045.1	.	.	.	.	.	.	.	.	.	.	A	17.12	3.307579	0.60305	.	.	ENSG00000114626	ENST00000361019;ENST00000393363;ENST00000232744;ENST00000453791;ENST00000468137	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	4.58	4.58	0.56647	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	N	0.10685	0.025	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.71414	0.939;0.973	T	0.53585	-0.8418	10	0.10111	T	0.7	-22.2876	13.9857	0.64334	1.0:0.0:0.0:0.0	.	158;133	Q969K4;Q969K4-3	ABTB1_HUMAN;.	L	63;16;158;16;16	ENSP00000377030:H16L;ENSP00000232744:H158L;ENSP00000412684:H16L;ENSP00000417366:H16L	ENSP00000232744:H158L	H	+	2	0	ABTB1	128877957	1.000000	0.71417	0.830000	0.32933	0.176000	0.22953	7.236000	0.78154	1.706000	0.51276	0.459000	0.35465	CAC		0.567	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027	
GRM7	2917	broad.mit.edu	37	3	7340412	7340412	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:7340412C>T	ENST00000357716.4	+	3	1052	c.778C>T	c.(778-780)Cgc>Tgc	p.R260C	GRM7_ENST00000486284.1_Missense_Mutation_p.R260C|GRM7_ENST00000402647.2_Missense_Mutation_p.R260C|GRM7_ENST00000403881.1_Missense_Mutation_p.R260C|GRM7_ENST00000389336.4_Missense_Mutation_p.R260C	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	260					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.R260C(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CCCCCAGGAACGCAAAGACAG	0.463																																					p.R260C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C778T	3						.						83.0	82.0	82.0					3																	7340412		2203	4299	6502	7315412	SO:0001583	missense	2917	exon3			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.778C>T	3.37:g.7340412C>T	ENSP00000350348:p.Arg260Cys		7315412	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	De_novo_Start_OutOfFrame	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900503	0.72754	.	.	ENSG00000196277	ENST00000448328;ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	5.32	5.32	0.75619	Extracellular ligand-binding receptor (1);	0.122178	0.56097	D	0.000025	D	0.82995	0.5158	L	0.39898	1.24	0.80722	D	1	D;D;P	0.64830	0.993;0.994;0.773	P;P;B	0.51895	0.555;0.683;0.279	T	0.83056	-0.0150	10	0.44086	T	0.13	.	16.1106	0.81261	0.0:1.0:0.0:0.0	.	260;260;260	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	C	52;260;260;260;260;260;260;260	ENSP00000393799:R52C;ENSP00000350348:R260C;ENSP00000417536:R260C;ENSP00000373987:R260C;ENSP00000385664:R260C;ENSP00000384585:R260C	ENSP00000350348:R260C	R	+	1	0	GRM7	7315412	0.998000	0.40836	1.000000	0.80357	0.984000	0.73092	3.900000	0.56295	2.648000	0.89879	0.650000	0.86243	CGC		0.463	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
KCNH8	131096	broad.mit.edu	37	3	19554600	19554600	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:19554600A>C	ENST00000328405.2	+	13	2484	c.2218A>C	c.(2218-2220)Aag>Cag	p.K740Q		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	740					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.K740Q(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TTCGCGCAACAAGAAGGTTGG	0.542																																					p.K740Q	NSCLC(124;1625 1765 8018 24930 42026)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2218C	3						.						79.0	68.0	72.0					3																	19554600		2203	4300	6503	19529604	SO:0001583	missense	131096	exon13			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2218A>C	3.37:g.19554600A>C	ENSP00000328813:p.Lys740Gln		19529604	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	37	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.088807	0.36855	.	.	ENSG00000183960	ENST00000328405	D	0.98649	-5.05	5.78	5.78	0.91487	.	0.000000	0.32671	U	0.005787	D	0.96602	0.8891	L	0.44542	1.39	0.80722	D	1	B	0.23128	0.08	B	0.20384	0.029	D	0.95271	0.8377	9	.	.	.	.	14.3553	0.66733	1.0:0.0:0.0:0.0	.	740	Q96L42	KCNH8_HUMAN	Q	740	ENSP00000328813:K740Q	.	K	+	1	0	KCNH8	19529604	1.000000	0.71417	0.575000	0.28536	0.839000	0.47603	6.021000	0.70832	2.205000	0.71048	0.477000	0.44152	AAG		0.542	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
TRANK1	9881	broad.mit.edu	37	3	36896883	36896883	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:36896883G>A	ENST00000429976.2	-	12	4445	c.4198C>T	c.(4198-4200)Cag>Tag	p.Q1400*	TRANK1_ENST00000428977.2_Nonsense_Mutation_p.Q850*|TRANK1_ENST00000301807.6_Nonsense_Mutation_p.Q850*	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	1400							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						AGCTCGGCCTGGGTAAAGTCT	0.557																																					p.Q1400X												.	.	0			c.C4198T	3						.						127.0	130.0	129.0					3																	36896883		2080	4207	6287	36871887	SO:0001587	stop_gained	9881	exon12			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.4198C>T	3.37:g.36896883G>A	ENSP00000416168:p.Gln1400*		36871887	NM_014831	Q8N8K0	Nonsense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	G	42	9.341488	0.99142	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	.	.	.	4.99	4.99	0.66335	.	0.000000	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.1672	0.93562	0.0:0.0:1.0:0.0	.	.	.	.	X	850;1400;850	.	ENSP00000301807:Q850X	Q	-	1	0	TRANK1	36871887	1.000000	0.71417	0.997000	0.53966	0.873000	0.50193	7.517000	0.81783	2.700000	0.92200	0.561000	0.74099	CAG		0.557	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
VILL	50853	broad.mit.edu	37	3	38048437	38048437	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:38048437A>C	ENST00000283713.6	+	20	2728	c.2462A>C	c.(2461-2463)tAt>tCt	p.Y821S	VILL_ENST00000465644.1_Missense_Mutation_p.Y539S|VILL_ENST00000383759.2_Missense_Mutation_p.Y821S			O15195	VILL_HUMAN	villin-like	821	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.				actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)	p.Y821S(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GCCCAGTTCTATCTCTCAGAC	0.557																																					p.Y821S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2462C	3						.						178.0	188.0	185.0					3																	38048437		2203	4300	6503	38023441	SO:0001583	missense	50853	exon19				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.2462A>C	3.37:g.38048437A>C	ENSP00000283713:p.Tyr821Ser		38023441	NM_015873	A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	ENST00000283713.6	37	CCDS2670.2	.	.	.	.	.	.	.	.	.	.	a	19.73	3.881434	0.72294	.	.	ENSG00000136059	ENST00000283713;ENST00000383759;ENST00000356246;ENST00000465644	T;T;T	0.27256	2.06;2.06;1.68	3.96	3.96	0.45880	Villin headpiece (5);	0.269718	0.37809	N	0.001932	T	0.54983	0.1892	M	0.88105	2.93	0.44469	D	0.997409	D	0.76494	0.999	D	0.79108	0.992	T	0.63501	-0.6623	10	0.54805	T	0.06	-8.6343	12.973	0.58524	1.0:0.0:0.0:0.0	.	821	O15195	VILL_HUMAN	S	821;821;807;539	ENSP00000283713:Y821S;ENSP00000373266:Y821S;ENSP00000422096:Y539S	ENSP00000283713:Y821S	Y	+	2	0	VILL	38023441	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.549000	0.73900	1.807000	0.52817	0.529000	0.55759	TAT		0.557	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
MYRIP	25924	broad.mit.edu	37	3	40285980	40285980	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:40285980T>A	ENST00000302541.6	+	13	2486	c.2144T>A	c.(2143-2145)cTg>cAg	p.L715Q	MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000444716.1_Missense_Mutation_p.L715Q|MYRIP_ENST00000539167.1_Missense_Mutation_p.L528Q|MYRIP_ENST00000396217.3_Missense_Mutation_p.L626Q|MYRIP_ENST00000425621.1_Missense_Mutation_p.L650Q	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	715	Actin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)	p.L715Q(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		GAGACCCAGCTGACTGAGCTA	0.582																																					p.L715Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2144A	3						.						71.0	67.0	68.0					3																	40285980		2203	4300	6503	40260984	SO:0001583	missense	25924	exon13			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.2144T>A	3.37:g.40285980T>A	ENSP00000301972:p.Leu715Gln		40260984	NM_015460	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	ENST00000302541.6	37	CCDS2689.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517639	0.85495	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.3	5.3	0.74995	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.000000	0.64402	D	0.000005	T	0.61527	0.2354	M	0.67397	2.05	0.50171	D	0.999857	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.62048	-0.6936	9	.	.	.	.	13.4832	0.61348	0.0:0.0:0.0:1.0	.	626;650;715	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	Q	715;715;650;626;528	ENSP00000398665:L715Q;ENSP00000301972:L715Q;ENSP00000389323:L650Q;ENSP00000379519:L626Q;ENSP00000438297:L528Q	.	L	+	2	0	MYRIP	40260984	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.141000	0.66446	0.533000	0.62120	CTG		0.582	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254181.2	NM_015460	
TRAK1	22906	broad.mit.edu	37	3	42244137	42244138	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:42244137_42244138CC>AA	ENST00000327628.5	+	13	2037_2038	c.1637_1638CC>AA	c.(1636-1638)tCC>tAA	p.S546*	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000449246.1_Nonsense_Mutation_p.S472*|TRAK1_ENST00000341421.3_Nonsense_Mutation_p.S488*|TRAK1_ENST00000396175.1_Nonsense_Mutation_p.S488*	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	546					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.S488>?(2)|p.S546>?(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						AGCATCATGTCCCTGGGCACGC	0.624																																					.	GBM(44;195 884 22595 31865 41850)											.	.	3	Complex(3)	large_intestine(3)	c.1637_1638AA	3						.																																			42219142	SO:0001587	stop_gained	22906	exon13				CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	Exception_encountered	3.37:g.42244137_42244138delinsAA	ENSP00000328998:p.Ser546*		42219141	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Nonsense_Mutation	DNP	ENST00000327628.5	37	CCDS43072.1																																																																																				0.624	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
ZNF197	10168	broad.mit.edu	37	3	44685501	44685501	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:44685501G>C	ENST00000396058.1	+	5	3046	c.2879G>C	c.(2878-2880)tGt>tCt	p.C960S	ZNF197_ENST00000344387.4_Missense_Mutation_p.C960S|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383744.4_Intron|ZNF197_ENST00000383745.2_Intron			O14709	ZN197_HUMAN	zinc finger protein 197	960					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C960S(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		CCCTATGGGTGTAATGATTGT	0.368																																					p.C960S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2879C	3						.						63.0	69.0	67.0					3																	44685501		2203	4300	6503	44660505	SO:0001583	missense	10168	exon6			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.2879G>C	3.37:g.44685501G>C	ENSP00000379370:p.Cys960Ser		44660505	NM_006991	B2RAH8|Q86VG0	Missense_Mutation	SNP	ENST00000396058.1	37	CCDS2717.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593955	0.66219	.	.	ENSG00000186448	ENST00000344387;ENST00000396058	D;D	0.85171	-1.95;-1.95	4.07	4.07	0.47477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94447	0.8213	H	0.95187	3.635	0.44454	D	0.997382	D	0.89917	1.0	D	0.91635	0.999	D	0.96078	0.9051	9	0.87932	D	0	.	15.5545	0.76180	0.0:0.0:1.0:0.0	.	960	O14709	ZN197_HUMAN	S	960	ENSP00000345809:C960S;ENSP00000379370:C960S	ENSP00000345809:C960S	C	+	2	0	ZNF197	44660505	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.476000	0.81055	2.252000	0.74401	0.557000	0.71058	TGT		0.368	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991	
BSN	8927	broad.mit.edu	37	3	49689416	49689417	+	Missense_Mutation	DNP	AT	AT	CC			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:49689416_49689417AT>CC	ENST00000296452.4	+	5	2541_2542	c.2427_2428AT>CC	c.(2425-2430)caATtg>caCCtg	p.Q809H		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	809					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.Q809>?(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		TTGGCAGCCAATTGAGGCACGA	0.599																																					.												.	.	1	Complex(1)	large_intestine(1)	c.2427_2428CC	3						.																																			49664421	SO:0001583	missense	8927	exon5			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	Exception_encountered	3.37:g.49689416_49689417delinsCC	ENSP00000296452:p.Gln809His		49664420	NM_003458	O43161|Q7LGH3	Missense_Mutation	DNP	ENST00000296452.4	37	CCDS2800.1																																																																																				0.599	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
BSN	8927	broad.mit.edu	37	3	49689583	49689583	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:49689583C>G	ENST00000296452.4	+	5	2708	c.2594C>G	c.(2593-2595)tCc>tGc	p.S865C		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	865					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		ACTGCCACCTCCGGGCGTGGC	0.632																																					p.S865C												.	.	0			c.C2594G	3						.						38.0	41.0	40.0					3																	49689583		2203	4299	6502	49664587	SO:0001583	missense	8927	exon5			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.2594C>G	3.37:g.49689583C>G	ENSP00000296452:p.Ser865Cys		49664587	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	9.582	1.123790	0.20959	.	.	ENSG00000164061	ENST00000296452	T	0.18657	2.2	3.64	3.64	0.41730	.	0.367863	0.23228	N	0.050494	T	0.16085	0.0387	L	0.36672	1.1	0.09310	N	1	P	0.47034	0.889	B	0.40702	0.338	T	0.12760	-1.0535	10	0.56958	D	0.05	.	8.8767	0.35350	0.2813:0.7187:0.0:0.0	.	865	Q9UPA5	BSN_HUMAN	C	865	ENSP00000296452:S865C	ENSP00000296452:S865C	S	+	2	0	BSN	49664587	0.001000	0.12720	0.007000	0.13788	0.865000	0.49528	1.380000	0.34351	2.318000	0.78349	0.561000	0.74099	TCC		0.632	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
PLSCR5	389158	broad.mit.edu	37	3	146307458	146307458	+	Silent	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:146307458G>A	ENST00000443512.1	-	6	1762	c.759C>T	c.(757-759)atC>atT	p.I253I	PLSCR5_ENST00000492200.1_Silent_p.I253I|PLSCR5_ENST00000482567.1_Silent_p.I241I|PLSCR5-AS1_ENST00000473817.1_RNA	NM_001085420.1	NP_001078889.1	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	253								p.I253I(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						AACAGGCACCGATCATTGCTG	0.383																																					p.I253I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C759T	3						.						146.0	137.0	140.0					3																	146307458		1901	4121	6022	147790148	SO:0001819	synonymous_variant	389158	exon6			AY436642	CCDS46931.1	3q24	2004-06-28			ENSG00000231213	ENSG00000231213			19952	protein-coding gene	gene with protein product							Standard	NM_001085420		Approved		uc010hvc.3	A0PG75	OTTHUMG00000159437	ENST00000443512.1:c.759C>T	3.37:g.146307458G>A			147790148	NM_001085420	B2RXK5	Silent	SNP	ENST00000443512.1	37	CCDS46931.1																																																																																				0.383	PLSCR5-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355365.1	XM_371670	
KIAA0226	9711	broad.mit.edu	37	3	197402375	197402375	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AG-3726-01	TCGA-AG-3726-01			G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr3:197402375delG	ENST00000296343.5	-	19	2657	c.2658delC	c.(2656-2658)gccfs	p.A886fs	MIR922_ENST00000401223.1_RNA|KIAA0226_ENST00000273582.5_Frame_Shift_Del_p.A841fs	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	886	Cys-rich.				autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TGAAGCCTTTGGCTTGGCAGA	0.547																																					p.A886fs	Esophageal Squamous(3;167 355 3763 15924)											.	.	0			c.2658delC	3						.						118.0	117.0	117.0					3																	197402375		2001	4183	6184	198886772	SO:0001589	frameshift_variant	9711	exon19			D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.2658delC	3.37:g.197402375delG	ENSP00000296343:p.Ala886fs		198886772	NM_014687	Q96CK5	Frame_Shift_Del	DEL	ENST00000296343.5	37	CCDS43195.1																																																																																				0.547	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
TAS2R10	50839	broad.mit.edu	37	12	10978857	10978857	+	Silent	SNP	T	T	A			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:10978857T>A	ENST00000240619.2	-	1	100	c.12A>T	c.(10-12)gtA>gtT	p.V4V		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	4					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.V4V(1)		breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TGCCTTCCACTACACGTAGCA	0.403																																					p.V4V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A12T	12						.						77.0	69.0	72.0					12																	10978857		2202	4296	6498	10870124	SO:0001819	synonymous_variant	50839	exon1			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.12A>T	12.37:g.10978857T>A			10870124	NM_023921	Q3MIM9|Q6NTD9	Silent	SNP	ENST00000240619.2	37	CCDS8634.1																																																																																				0.403	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399934.1		
SLC5A8	160728	broad.mit.edu	37	12	101581229	101581229	+	Missense_Mutation	SNP	C	C	T	rs377445681		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:101581229C>T	ENST00000536262.2	-	7	1456	c.898G>A	c.(898-900)Gcc>Acc	p.A300T		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8									p.A300T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAATATAGGGCGAGCCCACAA	0.453																																					p.A300T	GBM(60;420 1056 13605 22380 47675)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G898A	12						.	C	THR/ALA	0,4406		0,0,2203	113.0	104.0	107.0		898	3.5	1.0	12		107	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC5A8	NM_145913.3	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	300/611	101581229	1,13005	2203	4300	6503	100105360	SO:0001583	missense	160728	exon7			AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.898G>A	12.37:g.101581229C>T	ENSP00000445340:p.Ala300Thr		100105360	NM_145913		Missense_Mutation	SNP	ENST00000536262.2	37	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	C	7.110	0.575850	0.13623	0.0	1.16E-4	ENSG00000256870	ENST00000536262	D	0.87809	-2.3	5.35	3.46	0.39613	.	0.227900	0.46442	D	0.000294	T	0.77903	0.4200	N	0.16368	0.405	0.35630	D	0.810134	B	0.21381	0.055	B	0.22753	0.041	T	0.73748	-0.3885	10	0.33940	T	0.23	.	14.2763	0.66181	0.3865:0.6135:0.0:0.0	.	300	Q8N695	SC5A8_HUMAN	T	300	ENSP00000445340:A300T	ENSP00000445340:A300T	A	-	1	0	SLC5A8	100105360	0.000000	0.05858	0.968000	0.41197	0.102000	0.19082	-0.479000	0.06567	0.582000	0.29556	-0.535000	0.04281	GCC		0.453	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
HECTD4	283450	broad.mit.edu	37	12	112621004	112621004	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:112621004A>T	ENST00000430131.2	-	61	10725	c.9580T>A	c.(9580-9582)Ttg>Atg	p.L3194M	HECTD4_ENST00000377560.5_Missense_Mutation_p.L3444M|HECTD4_ENST00000550722.1_Missense_Mutation_p.L3470M			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3194					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										AAACTTGACAAACCAATCAAG	0.378																																					p.L3444M												.	.	0			c.T10330A	12						.						177.0	173.0	174.0					12																	112621004		1835	4097	5932	111105387	SO:0001583	missense	283450	exon61			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9580T>A	12.37:g.112621004A>T	ENSP00000404379:p.Leu3194Met		111105387	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	A	19.95	3.920853	0.73213	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.51071	0.72;0.73;0.72	5.7	4.56	0.56223	.	.	.	.	.	T	0.50309	0.1608	N	0.19112	0.55	0.39853	D	0.973261	D	0.65815	0.995	D	0.72982	0.979	T	0.55655	-0.8107	9	0.87932	D	0	.	8.9654	0.35874	0.8489:0.0:0.1511:0.0	.	3194	Q9Y4D8	K0614_HUMAN	M	3444;3194;3470	ENSP00000366783:L3444M;ENSP00000404379:L3194M;ENSP00000449784:L3470M	ENSP00000366783:L3444M	L	-	1	2	C12orf51	111105387	0.994000	0.37717	1.000000	0.80357	0.999000	0.98932	3.100000	0.50275	1.001000	0.39076	0.533000	0.62120	TTG		0.378	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
LRP6	4040	broad.mit.edu	37	12	12284793	12284793	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:12284793G>A	ENST00000261349.4	-	18	4008	c.3932C>T	c.(3931-3933)gCa>gTa	p.A1311V	LRP6_ENST00000540415.1_5'UTR|LRP6_ENST00000543091.1_Missense_Mutation_p.A1266V|BCL2L14_ENST00000396369.1_Intron	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1311	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.A1311V(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CTGGCAGTTTGCATCTCCATT	0.463																																					p.A1311V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3932T	12						.						152.0	122.0	132.0					12																	12284793		2203	4300	6503	12176060	SO:0001583	missense	4040	exon18			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3932C>T	12.37:g.12284793G>A	ENSP00000261349:p.Ala1311Val		12176060	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276820	0.40294	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.95518	-3.73;-3.73	5.92	5.92	0.95590	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000010	D	0.92430	0.7597	L	0.31065	0.9	0.45762	D	0.998651	B;B	0.02656	0.0;0.0	B;B	0.10450	0.002;0.005	D	0.87155	0.2211	10	0.28530	T	0.3	.	20.3081	0.98638	0.0:0.0:1.0:0.0	.	1266;1311	F5H7J9;O75581	.;LRP6_HUMAN	V	1311;1266	ENSP00000261349:A1311V;ENSP00000442472:A1266V	ENSP00000261349:A1311V	A	-	2	0	LRP6	12176060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.035000	0.57297	2.795000	0.96236	0.655000	0.94253	GCA		0.463	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
HNF1A	6927	broad.mit.edu	37	12	121426705	121426706	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:121426705_121426706GG>AA	ENST00000257555.6	+	2	622_623	c.396_397GG>AA	c.(394-399)gaGGtg>gaAAtg	p.V133M	HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Missense_Mutation_p.V16M|HNF1A_ENST00000402929.1_Missense_Mutation_p.V133M|HNF1A_ENST00000400024.2_Missense_Mutation_p.V133M|HNF1A_ENST00000541395.1_Missense_Mutation_p.V133M|HNF1A_ENST00000544413.1_Missense_Mutation_p.V133M			P20823	HNF1A_HUMAN	HNF1 homeobox A	133			V -> M (in MODY3).		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.E132>?(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACAGCGGGAGGTGGTCGATAC	0.619									Hepatic Adenoma, Familial Clustering of																												.												.	.	1	Complex(1)	large_intestine(1)	c.396_397AA	12	GRCh37	CM002110|CM082851|CM082870	HNF1A	M		.																																			119911089	SO:0001583	missense	6927	exon2	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	Exception_encountered	12.37:g.121426705_121426706delinsAA	ENSP00000257555:p.Val133Met		119911088	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	DNP	ENST00000257555.6	37	CCDS9209.1																																																																																				0.619	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
LRP6	4040	broad.mit.edu	37	12	12317470	12317470	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:12317470C>A	ENST00000261349.4	-	9	1865	c.1789G>T	c.(1789-1791)Ggg>Tgg	p.G597W	LRP6_ENST00000543091.1_Missense_Mutation_p.G597W	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	597	EGF-like 2.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.G597W(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CTACATCCCCCGTTTTCCTCA	0.443																																					p.G597W												.	.	1	Substitution - Missense(1)	lung(1)	c.G1789T	12						.						95.0	91.0	92.0					12																	12317470		2203	4300	6503	12208737	SO:0001583	missense	4040	exon9			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1789G>T	12.37:g.12317470C>A	ENSP00000261349:p.Gly597Trp		12208737	NM_002336	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663784	0.88251	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.98493	-4.96;-4.96	5.65	5.65	0.86999	Epidermal growth factor-like (1);	0.000000	0.64402	D	0.000007	D	0.99542	0.9836	H	0.99535	4.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97737	1.0206	10	0.87932	D	0	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	597;597	F5H7J9;O75581	.;LRP6_HUMAN	W	597	ENSP00000261349:G597W;ENSP00000442472:G597W	ENSP00000261349:G597W	G	-	1	0	LRP6	12208737	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	7.670000	0.83925	2.824000	0.97209	0.655000	0.94253	GGG		0.443	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
BHLHE41	79365	broad.mit.edu	37	12	26276012	26276012	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:26276012G>A	ENST00000242728.4	-	5	783	c.436C>T	c.(436-438)Ctc>Ttc	p.L146F	RP11-283G6.3_ENST00000545819.1_RNA|RP11-283G6.3_ENST00000535914.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	146	Orange. {ECO:0000255|PROSITE- ProRule:PRU00380}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)	p.L146F(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						AACCGGGAGAGGTATTGCAAG	0.582											OREG0021711	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L146F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C436T	12						.						25.0	27.0	26.0					12																	26276012		2203	4300	6503	26167279	SO:0001583	missense	79365	exon5			AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.436C>T	12.37:g.26276012G>A	ENSP00000242728:p.Leu146Phe	785	26167279	NM_030762	A2I2N8	Missense_Mutation	SNP	ENST00000242728.4	37	CCDS8706.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238760	0.79800	.	.	ENSG00000123095	ENST00000242728;ENST00000540731	T	0.72725	-0.68	2.85	2.85	0.33270	Orange subgroup (1);Orange (2);	0.000000	0.64402	U	0.000013	D	0.82449	0.5039	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85111	0.0963	10	0.87932	D	0	-9.0858	12.6715	0.56870	0.0:0.0:1.0:0.0	.	146	Q9C0J9	BHE41_HUMAN	F	146	ENSP00000242728:L146F	ENSP00000242728:L146F	L	-	1	0	BHLHE41	26167279	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	6.898000	0.75676	1.598000	0.50083	0.467000	0.42956	CTC		0.582	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
KLHL42	57542	broad.mit.edu	37	12	27950731	27950731	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:27950731C>A	ENST00000381271.2	+	3	1461	c.1150C>A	c.(1150-1152)Cag>Aag	p.Q384K	RP11-860B13.3_ENST00000543527.1_RNA	NM_020782.1	NP_065833.1	Q9P2K6	KLH42_HUMAN	kelch-like family member 42	384					mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of microtubule-based process (GO:0032886)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.Q384K(1)									CATTCGCAAGCAGCAGATGGT	0.547																																					p.Q384K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1150A	12						.						153.0	148.0	150.0					12																	27950731		2203	4300	6503	27841998	SO:0001583	missense	57542	exon3			AB037761	CCDS31763.1	12p11.22	2013-04-24	2013-02-22	2013-01-30	ENSG00000087448	ENSG00000087448		"""Kelch-like"""	29252	protein-coding gene	gene with protein product			"""kelch domain containing 5"""	KLHDC5		19261606	Standard	NM_020782		Approved	KIAA1340, Ctb9	uc001rij.3	Q9P2K6	OTTHUMG00000169217	ENST00000381271.2:c.1150C>A	12.37:g.27950731C>A	ENSP00000370671:p.Gln384Lys		27841998	NM_020782	Q2VPK1|Q8N334	Missense_Mutation	SNP	ENST00000381271.2	37	CCDS31763.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858775	0.91433	.	.	ENSG00000087448	ENST00000381271	T	0.65916	-0.18	5.29	5.29	0.74685	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.70500	0.3231	L	0.51422	1.61	0.58432	D	0.999995	D	0.63880	0.993	D	0.70935	0.971	T	0.64580	-0.6374	10	0.02654	T	1	.	17.9151	0.88947	0.0:1.0:0.0:0.0	.	384	Q9P2K6	KLDC5_HUMAN	K	384	ENSP00000370671:Q384K	ENSP00000370671:Q384K	Q	+	1	0	KLHDC5	27841998	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.270000	0.78493	2.452000	0.82932	0.561000	0.74099	CAG		0.547	KLHL42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402904.1	NM_020782	
KRT7	3855	broad.mit.edu	37	12	52642412	52642413	+	Missense_Mutation	DNP	TG	TG	AA			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:52642412_52642413TG>AA	ENST00000331817.5	+	9	1461_1462	c.1278_1279TG>AA	c.(1276-1281)ggTGgc>ggAAgc	p.G427S	KRT7_ENST00000552322.1_3'UTR|KRT121P_ENST00000529785.1_RNA|KRT86_ENST00000544024.1_5'Flank|RP3-416H24.1_ENST00000546686.1_RNA	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	427	Tail.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.G426>?(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	GCAGTGGCGGTGGCATTGGGCT	0.614																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1278_1279AA	12						.																																			50928680	SO:0001583	missense	3855	exon9				CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	Exception_encountered	12.37:g.52642412_52642413delinsAA	ENSP00000329243:p.Gly427Ser		50928679	NM_005556	Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	DNP	ENST00000331817.5	37	CCDS8822.1																																																																																				0.614	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
KRT86	3892	broad.mit.edu	37	12	52699515	52699515	+	Silent	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:52699515C>T	ENST00000423955.2	+	8	1147	c.969C>T	c.(967-969)aaC>aaT	p.N323N	RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000544024.1_Silent_p.N323N|KRT86_ENST00000293525.5_Silent_p.N323N			O43790	KRT86_HUMAN	keratin 86	323	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.N323N(1)		breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGAGATCAACGAGCTGAACC	0.592																																					p.N323N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C969T	12						.						128.0	113.0	118.0					12																	52699515		2203	4300	6503	50985782	SO:0001819	synonymous_variant	3892	exon6			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.969C>T	12.37:g.52699515C>T			50985782	NM_002284	P78387	Silent	SNP	ENST00000423955.2	37	CCDS41785.1																																																																																				0.592	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404911.1	NM_002284	
ERBB3	2065	broad.mit.edu	37	12	56494864	56494864	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:56494864G>A	ENST00000267101.3	+	27	3661	c.3221G>A	c.(3220-3222)aGc>aAc	p.S1074N	RP11-603J24.9_ENST00000548861.1_5'Flank|ERBB3_ENST00000549832.1_Missense_Mutation_p.S194N|ERBB3_ENST00000553131.1_Missense_Mutation_p.S315N|ERBB3_ENST00000415288.2_Missense_Mutation_p.S1015N|ERBB3_ENST00000450146.2_Missense_Mutation_p.S431N	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1074					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.S1074N(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GTTTCTGGGAGCAGTGAACGG	0.468																																					p.S1074N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3221A	12						.						34.0	32.0	33.0					12																	56494864		2203	4300	6503	54781131	SO:0001583	missense	2065	exon27			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3221G>A	12.37:g.56494864G>A	ENSP00000267101:p.Ser1074Asn		54781131	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	37	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.337484	0.00224	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.78481	-1.05;-0.96;-1.04;-1.18;-0.91	5.39	1.49	0.22878	.	0.464806	0.21330	N	0.076316	T	0.53626	0.1808	N	0.08118	0	0.09310	N	1	B;B;B	0.13594	0.004;0.008;0.002	B;B;B	0.16289	0.015;0.007;0.007	T	0.39542	-0.9609	10	0.33940	T	0.23	.	6.4261	0.21770	0.1564:0.2824:0.5612:0.0	.	1015;194;1074	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	N	1074;431;1015;197;315;194	ENSP00000267101:S1074N;ENSP00000399178:S431N;ENSP00000408340:S1015N;ENSP00000449129:S315N;ENSP00000448729:S194N	ENSP00000267101:S1074N	S	+	2	0	ERBB3	54781131	0.009000	0.17119	0.000000	0.03702	0.042000	0.13812	1.098000	0.31000	0.100000	0.17581	0.655000	0.94253	AGC		0.468	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
SLC17A8	246213	broad.mit.edu	37	12	100751241	100751241	+	Silent	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:100751241C>T	ENST00000323346.5	+	1	385	c.72C>T	c.(70-72)gcC>gcT	p.A24A	SLC17A8_ENST00000392989.3_Silent_p.A24A	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	24					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.A24A(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						TGAAGAACGCCGTGGGAGATT	0.408																																					p.A24A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C72T	12						.						78.0	88.0	84.0					12																	100751241		2203	4300	6503	99275372	SO:0001819	synonymous_variant	246213	exon1			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.72C>T	12.37:g.100751241C>T			99275372	NM_139319	B3KXZ6|B7ZKV4|Q17RQ8	Silent	SNP	ENST00000323346.5	37	CCDS9077.1																																																																																				0.408	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408673.2	NM_139319	
HCAR3	8843	broad.mit.edu	37	12	123201276	123201276	+	Silent	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr12:123201276C>T	ENST00000528880.2	-	1	163	c.9G>A	c.(7-9)cgG>cgA	p.R3R	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	3					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R3R(3)		endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	GCAGATGGTGCCGATTCATGA	0.542																																					p.R3R												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G9A	12						.						80.0	69.0	73.0					12																	123201276		2203	4300	6503	121767229	SO:0001819	synonymous_variant	8843	exon1			D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.9G>A	12.37:g.123201276C>T			121767229	NM_006018	A8K4G5|B2R830|E9PI97|Q8NGE4	Silent	SNP	ENST00000528880.2	37	CCDS53842.1																																																																																				0.542	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018	
NIPA2	81614	broad.mit.edu	37	15	23006754	23006754	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr15:23006754T>C	ENST00000337451.3	-	8	1162	c.550A>G	c.(550-552)Atc>Gtc	p.I184V	NIPA2_ENST00000359727.4_Missense_Mutation_p.I165V|NIPA2_ENST00000539711.2_Missense_Mutation_p.I165V|NIPA2_ENST00000398013.3_Missense_Mutation_p.I184V|NIPA2_ENST00000398014.2_Missense_Mutation_p.I184V	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2	184						early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)	p.I165V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		ACAGAGCAGATTGTTATGTAC	0.502																																					p.I184V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A550G	15						.						75.0	66.0	69.0					15																	23006754		2203	4300	6503	20558195	SO:0001583	missense	81614	exon7			AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.550A>G	15.37:g.23006754T>C	ENSP00000337618:p.Ile184Val		20558195	NM_001008860	F8W7Y8|Q96F03|Q9BVS2	Missense_Mutation	SNP	ENST00000337451.3	37	CCDS10010.1	.	.	.	.	.	.	.	.	.	.	T	19.23	3.788159	0.70337	.	.	ENSG00000140157	ENST00000337451;ENST00000398014;ENST00000359727;ENST00000539711;ENST00000398013	D;D;D;D	0.92249	-2.73;-2.73;-2.73;-3.0	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.92662	0.7668	M	0.66560	2.04	0.80722	D	1	B;P	0.40578	0.421;0.722	B;P	0.45946	0.421;0.498	D	0.91832	0.5476	10	0.35671	T	0.21	-3.113	15.9649	0.79961	0.0:0.0:0.0:1.0	.	165;184	F8W7Y8;Q8N8Q9	.;NIPA2_HUMAN	V	184;184;165;184;165	ENSP00000337618:I184V;ENSP00000381096:I184V;ENSP00000352762:I165V;ENSP00000437746:I184V	ENSP00000337618:I184V	I	-	1	0	NIPA2	20558195	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.932000	0.87634	2.232000	0.73038	0.533000	0.62120	ATC		0.502	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251137.1	NM_030922	
SLC30A4	7782	broad.mit.edu	37	15	45814167	45814168	+	Missense_Mutation	DNP	AG	AG	TC			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr15:45814167_45814168AG>TC	ENST00000261867.4	-	2	699_700	c.385_386CT>GA	c.(385-387)CTt>GAt	p.L129D	SLC30A4_ENST00000559667.1_5'UTR|HMGN2P46_ENST00000409454.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	129					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)	p.L129>?(1)		endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		CTCACCTACAAGTTCTCCAATC	0.441																																					.												.	.	1	Complex(1)	large_intestine(1)	c.385_386GA	15						.																																			43601460	SO:0001583	missense	7782	exon2				CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.385_386delinsTC	15.37:g.45814167_45814168delinsTC	ENSP00000261867:p.Leu129Asp		43601459	NM_013309	Q8TC39	Missense_Mutation	DNP	ENST00000261867.4	37	CCDS10125.1																																																																																				0.441	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254236.1		
IGDCC4	57722	broad.mit.edu	37	15	65703604	65703604	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr15:65703604G>C	ENST00000352385.2	-	2	384	c.175C>G	c.(175-177)Ctg>Gtg	p.L59V		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	59	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L59V(1)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GCAGCCCCCAGGCTACAGTTT	0.642																																					p.L59V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C175G	15						.						38.0	35.0	36.0					15																	65703604		2201	4299	6500	63490657	SO:0001583	missense	57722	exon2				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.175C>G	15.37:g.65703604G>C	ENSP00000319623:p.Leu59Val		63490657	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	37	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	G	0.207	-1.039700	0.02013	.	.	ENSG00000103742	ENST00000352385	T	0.74632	-0.86	5.19	1.18	0.20946	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.257299	0.32190	N	0.006446	T	0.48077	0.1480	N	0.05510	-0.035	0.34214	D	0.674587	B	0.31026	0.304	B	0.26310	0.068	T	0.47837	-0.9086	10	0.30854	T	0.27	-11.4112	8.0142	0.30372	0.3321:0.0:0.6679:0.0	.	59	Q8TDY8	IGDC4_HUMAN	V	59	ENSP00000319623:L59V	ENSP00000319623:L59V	L	-	1	2	IGDCC4	63490657	1.000000	0.71417	0.181000	0.23098	0.143000	0.21401	4.981000	0.63819	-0.031000	0.13781	-0.253000	0.11424	CTG		0.642	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
CSK	1445	broad.mit.edu	37	15	75094753	75094753	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr15:75094753G>A	ENST00000220003.9	+	13	1981	c.1252G>A	c.(1252-1254)Gtc>Atc	p.V418I	CSK_ENST00000439220.2_Missense_Mutation_p.V418I|CSK_ENST00000567571.1_Missense_Mutation_p.V418I|CSK_ENST00000309470.9_Missense_Mutation_p.V418I	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	418	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)	p.V418I(1)		central_nervous_system(1)|lung(2)	3						AGTCTATGAAGTCATGAAGAA	0.637																																					p.V418I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1252A	15						.						63.0	71.0	68.0					15																	75094753		2197	4296	6493	72881806	SO:0001583	missense	1445	exon13				CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1252G>A	15.37:g.75094753G>A	ENSP00000220003:p.Val418Ile		72881806	NM_004383	Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	G	4.175	0.031078	0.08101	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	T;T;T	0.33216	1.42;1.42;1.42	4.28	4.28	0.50868	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.168211	0.41712	D	0.000840	T	0.09642	0.0237	N	0.01679	-0.765	0.48901	D	0.999722	B	0.02656	0.0	B	0.06405	0.002	T	0.19877	-1.0292	10	0.05436	T	0.98	-30.6387	10.9679	0.47422	0.0:0.0:0.8128:0.1872	.	418	P41240	CSK_HUMAN	I	418;418;367;418	ENSP00000220003:V418I;ENSP00000414764:V418I;ENSP00000438808:V418I	ENSP00000220003:V418I	V	+	1	0	CSK	72881806	0.508000	0.26154	0.995000	0.50966	0.799000	0.45148	0.669000	0.25142	2.218000	0.71995	0.563000	0.77884	GTC		0.637	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	
POLG	5428	broad.mit.edu	37	15	89872218	89872218	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr15:89872218T>G	ENST00000268124.5	-	4	1312	c.979A>C	c.(979-981)Aag>Cag	p.K327Q	POLG_ENST00000442287.2_Missense_Mutation_p.K327Q	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	327					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)	p.K327Q(1)		breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			TGGCCTTGCTTTGTGGGGGGC	0.607								DNA polymerases (catalytic subunits)																													p.K327Q	Colon(73;648 1203 11348 18386 27782)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A979C	15						.						88.0	78.0	81.0					15																	89872218		2200	4299	6499	87673222	SO:0001583	missense	5428	exon4			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.979A>C	15.37:g.89872218T>G	ENSP00000268124:p.Lys327Gln		87673222	NM_001126131	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	T	2.774	-0.254971	0.05829	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.92149	-2.98;-2.98	6.06	1.7	0.24286	Ribonuclease H-like (1);	0.665958	0.16084	N	0.230382	D	0.83156	0.5193	N	0.19112	0.55	0.25471	N	0.987828	B	0.02656	0.0	B	0.04013	0.001	T	0.65874	-0.6062	10	0.15499	T	0.54	-2.2493	10.9052	0.47076	0.0:0.2064:0.4381:0.3555	.	327	P54098	DPOG1_HUMAN	Q	327	ENSP00000268124:K327Q;ENSP00000399851:K327Q	ENSP00000268124:K327Q	K	-	1	0	POLG	87673222	0.987000	0.35691	0.002000	0.10522	0.017000	0.09413	1.470000	0.35354	0.359000	0.24239	-0.213000	0.12676	AAG		0.607	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
CRTC3	64784	broad.mit.edu	37	15	91169107	91169107	+	Silent	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr15:91169107G>T	ENST00000268184.6	+	10	853	c.849G>T	c.(847-849)tcG>tcT	p.S283S	CRTC3_ENST00000420329.2_Silent_p.S283S|RP11-387D10.2_ENST00000559531.1_RNA			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	283					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)	p.S283S(1)	CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TCCACTACTCGACACCCCTGC	0.542			T	MAML2	salivary gland mucoepidermoid																																p.S283S			Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G849T	15						.						278.0	275.0	276.0					15																	91169107		2198	4298	6496	88970111	SO:0001819	synonymous_variant	64784	exon10				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.849G>T	15.37:g.91169107G>T			88970111	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Silent	SNP	ENST00000268184.6	37	CCDS32331.1																																																																																				0.542	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
INTU	27152	broad.mit.edu	37	4	128628017	128628017	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr4:128628017G>C	ENST00000335251.6	+	12	2267	c.2164G>C	c.(2164-2166)Ggt>Cgt	p.G722R		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	722					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.G722R(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						TGGTTGTGAAGGTGGAGAAGA	0.468																																					p.G722R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2164C	4						.						222.0	223.0	223.0					4																	128628017		2203	4300	6503	128847467	SO:0001583	missense	27152	exon12			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.2164G>C	4.37:g.128628017G>C	ENSP00000334003:p.Gly722Arg		128847467	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	37	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494636	0.64186	.	.	ENSG00000164066	ENST00000335251	.	.	.	4.92	4.92	0.64577	.	0.251667	0.39083	N	0.001471	T	0.70718	0.3256	L	0.59436	1.845	0.80722	D	1	P	0.47962	0.903	P	0.51806	0.68	T	0.74090	-0.3777	9	0.72032	D	0.01	-3.9062	18.6723	0.91516	0.0:0.0:1.0:0.0	.	722	Q9ULD6	PDZD6_HUMAN	R	722	.	ENSP00000334003:G722R	G	+	1	0	INTU	128847467	1.000000	0.71417	0.782000	0.31804	0.191000	0.23601	8.612000	0.90909	2.717000	0.92951	0.650000	0.86243	GGT		0.468	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
SMAD1	4086	broad.mit.edu	37	4	146435885	146435885	+	Silent	SNP	A	A	G			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr4:146435885A>G	ENST00000515385.1	+	2	662	c.120A>G	c.(118-120)aaA>aaG	p.K40K	SMAD1_ENST00000302085.4_Silent_p.K40K|RP11-301H24.4_ENST00000513542.1_RNA|SMAD1_ENST00000515527.1_3'UTR|SMAD1_ENST00000394092.2_Silent_p.K40K			Q15797	SMAD1_HUMAN	SMAD family member 1	40	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.|Poly-Lys.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle cell proliferation (GO:0060038)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|embryonic pattern specification (GO:0009880)|gamete generation (GO:0007276)|hindbrain development (GO:0030902)|homeostatic process (GO:0042592)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|mesodermal cell fate commitment (GO:0001710)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|osteoblast fate commitment (GO:0002051)|positive regulation of cartilage development (GO:0061036)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of gene expression (GO:0010628)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|primary miRNA processing (GO:0031053)|protein phosphorylation (GO:0006468)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|signal transduction (GO:0007165)|SMAD protein complex assembly (GO:0007183)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)	p.K40K(1)		endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	17	all_hematologic(180;0.151)					TGGTGAAAAAACTGAAGAAAA	0.483																																					p.K40K	Pancreas(182;1287 2092 10326 35158 50562)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A120G	4						.						78.0	77.0	77.0					4																	146435885		2203	4300	6503	146655335	SO:0001819	synonymous_variant	4086	exon2			U59423	CCDS3765.1	4q31.21	2013-10-22	2006-11-06	2004-05-26	ENSG00000170365	ENSG00000170365		"""SMADs"""	6767	protein-coding gene	gene with protein product		601595	"""MAD, mothers against decapentaplegic homolog 1 (Drosophila)"", ""SMAD, mothers against DPP homolog 1 (Drosophila)"""	MADH1		8653785, 8673135	Standard	NM_005900		Approved	MADR1, JV4-1	uc003ikc.3	Q15797	OTTHUMG00000161592	ENST00000515385.1:c.120A>G	4.37:g.146435885A>G			146655335	NM_001003688	A8KAJ0|D3DNZ9|Q16636|Q9UFT8	Silent	SNP	ENST00000515385.1	37	CCDS3765.1																																																																																				0.483	SMAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365467.1	NM_005900	
TRAPPC11	60684	broad.mit.edu	37	4	184601385	184601385	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr4:184601385C>T	ENST00000334690.6	+	10	1280	c.1078C>T	c.(1078-1080)Cgg>Tgg	p.R360W	TRAPPC11_ENST00000357207.4_Missense_Mutation_p.R360W	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	360					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)		p.R360W(1)									TGCCCAGGAGCGGAAACAGCT	0.388																																					p.R360W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1078T	4						.						118.0	117.0	117.0					4																	184601385		2203	4300	6503	184838379	SO:0001583	missense	60684	exon10				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.1078C>T	4.37:g.184601385C>T	ENSP00000335371:p.Arg360Trp		184838379	NM_199053	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	ENST00000334690.6	37	CCDS34112.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072598	0.76415	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109	.	.	.	5.96	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.84257	0.5432	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87530	0.2452	9	0.87932	D	0	.	16.5523	0.84475	0.1317:0.8683:0.0:0.0	.	360;360	Q7Z392;Q7Z392-3	TPC11_HUMAN;.	W	360	.	ENSP00000335371:R360W	R	+	1	2	C4orf41	184838379	0.976000	0.34144	1.000000	0.80357	0.962000	0.63368	2.008000	0.40893	1.513000	0.48852	-0.188000	0.12872	CGG		0.388	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361654.2	NM_021942	
ATP10D	57205	broad.mit.edu	37	4	47593390	47593391	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr4:47593390_47593391GA>TC	ENST00000273859.3	+	23	4542_4543	c.4273_4274GA>TC	c.(4273-4275)GAa>TCa	p.E1425S		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1425					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.E1425>?(1)		NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CAAAGGTAAAGAAAGCTAGATA	0.416																																					.												.	.	1	Complex(1)	large_intestine(1)	c.4273_4274TC	4						.																																			47288148	SO:0001583	missense	57205	exon23			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	Exception_encountered	4.37:g.47593390_47593391delinsTC	ENSP00000273859:p.Glu1425Ser		47288147	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	DNP	ENST00000273859.3	37	CCDS3476.1																																																																																				0.416	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
TUBB7P	56604	broad.mit.edu	37	4	190905976	190905976	+	IGR	SNP	G	G	C	rs76536163	byFrequency	TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr4:190905976G>C								FRG1 (21617 upstream) : RNA5SP174 (30316 downstream)																							CAACCTTGGCGCCGATCTGGT	0.711																																					p.R17G												.	.	0			c.C49G	4						.						6.0	8.0	7.0					4																	190905976		2077	4108	6185	191142970	SO:0001628	intergenic_variant	56604	exon1																															4.37:g.190905976G>C			191142970	NM_020040		Silent	SNP		37																																																																																				0	0.711								
WWC3	55841	broad.mit.edu	37	X	10094280	10094280	+	Silent	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chrX:10094280G>A	ENST00000380861.4	+	15	2431	c.2040G>A	c.(2038-2040)gcG>gcA	p.A680A	WWC3_ENST00000454666.1_Silent_p.A680A	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	680	C2.				negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)	p.A680A(1)		NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						ATTCCAGCGCGTTGACACTGA	0.577																																					p.A680A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2040A	X						.						138.0	117.0	124.0					X																	10094280		2203	4300	6503	10054280	SO:0001819	synonymous_variant	55841	exon15			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2040G>A	X.37:g.10094280G>A			10054280	NM_015691	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	ENST00000380861.4	37	CCDS14136.1																																																																																				0.577	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055725.1	NM_015691	
DMD	1756	broad.mit.edu	37	X	32563361	32563361	+	Silent	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chrX:32563361G>A	ENST00000357033.4	-	17	2289	c.2083C>T	c.(2083-2085)Ctg>Ttg	p.L695L	DMD_ENST00000288447.4_Silent_p.L687L|DMD_ENST00000378677.2_Silent_p.L691L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	695					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L691L(1)|p.L690L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGCTTTACCAGGATCTGTTCC	0.458																																					p.L695L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2083T	X						.						277.0	199.0	225.0					X																	32563361		2202	4300	6502	32473282	SO:0001819	synonymous_variant	1756	exon17			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2083C>T	X.37:g.32563361G>A			32473282	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1																																																																																				0.458	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
POU3F4	5456	broad.mit.edu	37	X	82764015	82764015	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chrX:82764015C>T	ENST00000373200.2	+	1	747	c.683C>T	c.(682-684)tCg>tTg	p.S228L	RP3-326L13.3_ENST00000607789.1_lincRNA|RP3-326L13.2_ENST00000607095.1_RNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	228	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S228L(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						AACGTGTTCTCGCAGACCACC	0.532																																					p.S228L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C683T	X	GRCh37	CM056683	POU3F4	M		.						81.0	62.0	69.0					X																	82764015		2203	4300	6503	82650671	SO:0001583	missense	5456	exon1			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.683C>T	X.37:g.82764015C>T	ENSP00000362296:p.Ser228Leu		82650671	NM_000307	B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	ENST00000373200.2	37	CCDS14450.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487647	0.84854	.	.	ENSG00000196767	ENST00000373200	D	0.87491	-2.26	5.07	5.07	0.68467	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.95287	0.8471	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96579	0.9429	10	0.87932	D	0	.	17.4614	0.87620	0.0:1.0:0.0:0.0	.	228	P49335	PO3F4_HUMAN	L	228	ENSP00000362296:S228L	ENSP00000362296:S228L	S	+	2	0	POU3F4	82650671	1.000000	0.71417	0.973000	0.42090	0.979000	0.70002	7.579000	0.82511	2.244000	0.73946	0.525000	0.51046	TCG		0.532	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057368.2	NM_000307	
CDR1	1038	broad.mit.edu	37	X	139866052	139866052	+	Silent	SNP	G	G	A	rs146276960		TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chrX:139866052G>A	ENST00000370532.2	-	1	671	c.480C>T	c.(478-480)tcC>tcT	p.S160S		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	160	6 X 6 AA approximate repeats.							p.S160S(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CAAGTCTTCCGGATAATTTGG	0.443													G|||	1	0.000264901	0.0	0.0	3775	,	,		15094	0.0		0.0	False		,,,				2504	0.001				p.S160S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C480T	X						.	G		1,3832		0,1,1630,571	134.0	140.0	138.0		480	-7.0	0.0	X	dbSNP_134	138	1,6727		0,1,2427,1872	no	coding-synonymous	CDR1	NM_004065.2		0,2,4057,2443	AA,AG,GG,G		0.0149,0.0261,0.0189		160/263	139866052	2,10559	2202	4300	6502	139693718	SO:0001819	synonymous_variant	1038	exon1				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.480C>T	X.37:g.139866052G>A			139693718	NM_004065	Q5JXH6	Silent	SNP	ENST00000370532.2	37	CCDS14670.1																																																																																				0.443	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058583.1	NM_004065	
GPR45	11250	broad.mit.edu	37	2	105859240	105859240	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:105859240G>A	ENST00000258456.1	+	1	1041	c.925G>A	c.(925-927)Gtc>Atc	p.V309I		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V309I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						CAGCACCTGCGTCCTGTGGCT	0.567																																					p.V309I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G925A	2						.						137.0	134.0	135.0					2																	105859240		2203	4300	6503	105225672	SO:0001583	missense	11250	exon1			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.925G>A	2.37:g.105859240G>A	ENSP00000258456:p.Val309Ile		105225672	NM_007227	Q6NWS4|Q6NXU6	Missense_Mutation	SNP	ENST00000258456.1	37	CCDS2066.1	.	.	.	.	.	.	.	.	.	.	G	10.59	1.392572	0.25118	.	.	ENSG00000135973	ENST00000258456	T	0.71222	-0.55	4.63	-1.89	0.07689	GPCR, rhodopsin-like superfamily (1);	0.306652	0.30911	N	0.008634	T	0.49115	0.1538	N	0.22421	0.69	0.18873	N	0.999986	B	0.15473	0.013	B	0.11329	0.006	T	0.30851	-0.9964	10	0.18710	T	0.47	-18.1173	10.3933	0.44185	0.5306:0.0:0.4694:0.0	.	309	Q9Y5Y3	GPR45_HUMAN	I	309	ENSP00000258456:V309I	ENSP00000258456:V309I	V	+	1	0	GPR45	105225672	0.040000	0.19996	0.611000	0.29010	0.983000	0.72400	0.362000	0.20284	-0.504000	0.06577	-0.464000	0.05259	GTC		0.567	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253348.1	NM_007227	
MYO7B	4648	broad.mit.edu	37	2	128335723	128335723	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:128335723T>G	ENST00000409816.2	+	8	897	c.865T>G	c.(865-867)Tgt>Ggt	p.C289G	MYO7B_ENST00000389524.4_Missense_Mutation_p.C289G|MYO7B_ENST00000428314.1_Missense_Mutation_p.C289G			Q6PIF6	MYO7B_HUMAN	myosin VIIB	289	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CTGCACTTCCTGTGAGGGGCT	0.627																																					p.C289G												.	.	0			c.T865G	2						.						50.0	57.0	55.0					2																	128335723		2104	4214	6318	128052193	SO:0001583	missense	4648	exon9				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.865T>G	2.37:g.128335723T>G	ENSP00000386461:p.Cys289Gly		128052193	NM_001080527	Q14786|Q8TEE1	Missense_Mutation	SNP	ENST00000409816.2	37	CCDS46405.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.434686	0.43224	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.87103	-2.21;-2.21;-2.21	4.25	3.08	0.35506	Myosin head, motor domain (2);	0.138056	0.56097	D	0.000036	D	0.90410	0.6998	M	0.73753	2.245	0.43317	D	0.995338	D	0.53151	0.958	P	0.57846	0.828	D	0.89914	0.4054	10	0.87932	D	0	.	9.6536	0.39912	0.0:0.0835:0.0:0.9165	.	289	Q6PIF6	MYO7B_HUMAN	G	289	ENSP00000374175:C289G;ENSP00000415090:C289G;ENSP00000386461:C289G	ENSP00000374175:C289G	C	+	1	0	MYO7B	128052193	1.000000	0.71417	0.212000	0.23672	0.325000	0.28411	4.922000	0.63404	0.788000	0.33755	0.460000	0.39030	TGT		0.627	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
CXCR4	7852	broad.mit.edu	37	2	136873184	136873184	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:136873184C>G	ENST00000241393.3	-	2	418	c.314G>C	c.(313-315)gGg>gCg	p.G105A	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Missense_Mutation_p.G109A	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	105					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)	p.G109A(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TAGGAAGTTCCCAAAGTACCA	0.542																																					p.G105A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G314C	2						.						146.0	136.0	140.0					2																	136873184		2203	4300	6503	136589654	SO:0001583	missense	7852	exon2			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.314G>C	2.37:g.136873184C>G	ENSP00000241393:p.Gly105Ala		136589654	NM_003467	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.96|15.96	2.986497|2.986497	0.53934|0.53934	.|.	.|.	ENSG00000121966|ENSG00000121966	ENST00000409817;ENST00000241393|ENST00000537957	T;T|.	0.50548|.	0.74;0.74|.	5.79|5.79	5.79|5.79	0.91817|0.91817	GPCR, rhodopsin-like superfamily (1);|.	0.095449|0.095449	0.64402|0.64402	D|D	0.000001|0.000001	D|D	0.85682|0.85682	0.5753|0.5753	H|H	0.94542|0.94542	3.55|3.55	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.984|.	D;P|.	0.76071|.	0.987;0.479|.	D|D	0.88851|0.88851	0.3319|0.3319	10|7	0.87932|0.87932	D|D	0|0	.|.	13.2582|13.2582	0.60091|0.60091	0.0:0.9279:0.0:0.0721|0.0:0.9279:0.0:0.0721	.|.	105;109|.	P61073;P61073-2|.	CXCR4_HUMAN;.|.	A|R	109;105|9	ENSP00000386884:G109A;ENSP00000241393:G105A|.	ENSP00000241393:G105A|ENSP00000440311:G9R	G|G	-|-	2|1	0|0	CXCR4|CXCR4	136589654|136589654	1.000000|1.000000	0.71417|0.71417	0.962000|0.962000	0.40283|0.40283	0.426000|0.426000	0.31534|0.31534	6.091000|6.091000	0.71406|0.71406	2.734000|2.734000	0.93682|0.93682	0.655000|0.655000	0.94253|0.94253	GGG|GGA		0.542	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
CALCRL	10203	broad.mit.edu	37	2	188223964	188223964	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:188223964C>A	ENST00000409998.1	-	12	1598	c.817G>T	c.(817-819)Gct>Tct	p.A273S	CALCRL_ENST00000410068.1_Missense_Mutation_p.A273S|CALCRL_ENST00000392370.3_Missense_Mutation_p.A273S|AC007319.1_ENST00000412276.1_RNA|AC007319.1_ENST00000453517.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	273					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)	p.A273S(1)		endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			AAGCTTCTAGCAATGGCATGT	0.239																																					p.A273S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G817T	2						.						21.0	23.0	22.0					2																	188223964		2184	4286	6470	187932209	SO:0001583	missense	10203	exon11			U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.817G>T	2.37:g.188223964C>A	ENSP00000386972:p.Ala273Ser		187932209	NM_005795	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	ENST00000409998.1	37	CCDS2293.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572613	0.65765	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068	T;T;T	0.36878	1.23;1.23;1.23	5.5	5.5	0.81552	GPCR, family 2-like (1);	0.087235	0.48286	D	0.000193	T	0.41073	0.1143	L	0.49699	1.58	0.80722	D	1	B	0.21520	0.057	B	0.32342	0.144	T	0.21724	-1.0237	10	0.46703	T	0.11	.	18.3984	0.90507	0.0:1.0:0.0:0.0	.	273	Q16602	CALRL_HUMAN	S	273	ENSP00000376177:A273S;ENSP00000386972:A273S;ENSP00000387190:A273S	ENSP00000376177:A273S	A	-	1	0	CALCRL	187932209	1.000000	0.71417	0.997000	0.53966	0.831000	0.47069	5.865000	0.69583	2.599000	0.87857	0.655000	0.94253	GCT		0.239	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334648.1	NM_005795	
CARF	79800	broad.mit.edu	37	2	203846818	203846818	+	Silent	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:203846818C>T	ENST00000402905.3	+	15	2034	c.1713C>T	c.(1711-1713)taC>taT	p.Y571Y	CARF_ENST00000414439.1_Silent_p.Y469Y|WDR12_ENST00000477723.1_Intron|CARF_ENST00000428585.1_Silent_p.Y495Y|CARF_ENST00000545262.1_Silent_p.Y495Y|CARF_ENST00000438828.2_Silent_p.Y571Y|CARF_ENST00000320443.8_Silent_p.Y571Y|CARF_ENST00000545253.1_Silent_p.Y483Y	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	571					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y571Y(1)									AACCAAGGTACACCTCTCCTG	0.368																																					p.Y571Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1713T	2						.						60.0	55.0	57.0					2																	203846818		1844	4107	5951	203555063	SO:0001819	synonymous_variant	79800	exon15			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.1713C>T	2.37:g.203846818C>T			203555063	NM_001104586	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Silent	SNP	ENST00000402905.3	37	CCDS42801.1																																																																																				0.368	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
NRP2	8828	broad.mit.edu	37	2	206610611	206610611	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3726-01	TCGA-AG-3726-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:206610611A>G	ENST00000357785.5	+	10	1814	c.1783A>G	c.(1783-1785)Aca>Gca	p.T595A	NRP2_ENST00000272849.3_Missense_Mutation_p.T595A|NRP2_ENST00000412873.2_Missense_Mutation_p.T595A|NRP2_ENST00000540841.1_Missense_Mutation_p.T595A|NRP2_ENST00000357118.4_Missense_Mutation_p.T595A|NRP2_ENST00000540178.1_Missense_Mutation_p.T595A|NRP2_ENST00000360409.3_Missense_Mutation_p.T595A			Q99435	NELL2_HUMAN	neuropilin 2	288	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T595A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CTGTGACTGGACAGGTAAGAT	0.617																																					p.T595A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1783G	2						.						100.0	94.0	96.0					2																	206610611		2203	4300	6503	206318856	SO:0001583	missense	8828	exon10			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1783A>G	2.37:g.206610611A>G	ENSP00000350432:p.Thr595Ala		206318856	NM_201266	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	37	CCDS46496.1	.	.	.	.	.	.	.	.	.	.	A	11.46	1.643941	0.29246	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000540841;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	D;D;D;D;D;D;D	0.98889	-5.21;-5.21;-5.21;-5.21;-5.21;-5.21;-5.21	5.62	4.47	0.54385	.	0.097167	0.64402	D	0.000001	D	0.95771	0.8624	L	0.43152	1.355	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	D	0.91694	0.5368	10	0.15952	T	0.53	-5.5747	7.4701	0.27344	0.7852:0.1428:0.072:0.0	.	595;595;595;595;595	O60462-2;O60462-3;O60462;O60462-4;O60462-5	.;.;NRP2_HUMAN;.;.	A	595	ENSP00000353582:T595A;ENSP00000439658:T595A;ENSP00000439261:T595A;ENSP00000349632:T595A;ENSP00000350432:T595A;ENSP00000407626:T595A;ENSP00000272849:T595A	ENSP00000272849:T595A	T	+	1	0	NRP2	206318856	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	3.672000	0.54583	0.962000	0.38057	-0.250000	0.11733	ACA		0.617	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1		
INPP5D	3635	broad.mit.edu	37	2	234078674	234078674	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:234078674G>A	ENST00000359570.5	+	17	1619	c.1619G>A	c.(1618-1620)cGa>cAa	p.R540Q	INPP5D_ENST00000538935.1_Missense_Mutation_p.R539Q|INPP5D_ENST00000455936.2_Missense_Mutation_p.R304Q|INPP5D_ENST00000450745.1_Missense_Mutation_p.R304Q			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	552					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)	p.R552Q(2)		central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TGCATTAGGCGAAACCAAAAC	0.547																																					p.E394K	NSCLC(82;1215 1426 16163 20348 41018)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1180A	2						.						138.0	144.0	142.0					2																	234078674		2058	4184	6242	233742738	SO:0001583	missense	3635	exon10			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.1619G>A	2.37:g.234078674G>A	ENSP00000352575:p.Arg540Gln		233742738	NM_005541	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	ENST00000359570.5	37		.	.	.	.	.	.	.	.	.	.	G	31	5.076865	0.94000	.	.	ENSG00000168918	ENST00000359570;ENST00000538935;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964	D;D;D;D;D;D;D	0.98747	-5.11;-5.11;-5.11;-5.11;-5.11;-5.11;-5.11	4.75	4.75	0.60458	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.134765	0.48767	D	0.000178	D	0.99127	0.9699	.	.	.	0.51767	D	0.999932	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.943	D	0.99698	1.1003	9	0.87932	D	0	.	17.7644	0.88473	0.0:0.0:1.0:0.0	.	551;552	Q92835-2;Q92835	.;SHIP1_HUMAN	Q	540;539;304;304;173;173;173	ENSP00000352575:R540Q;ENSP00000441010:R539Q;ENSP00000407916:R304Q;ENSP00000404610:R304Q;ENSP00000400151:R173Q;ENSP00000397421:R173Q;ENSP00000405338:R173Q	ENSP00000352575:R540Q	R	+	2	0	INPP5D	233742738	1.000000	0.71417	0.904000	0.35570	0.790000	0.44656	9.356000	0.97091	2.192000	0.70111	0.561000	0.74099	CGA		0.547	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001017915	
DRC1	92749	broad.mit.edu	37	2	26624929	26624929	+	Silent	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:26624929G>A	ENST00000288710.2	+	1	146	c.72G>A	c.(70-72)gcG>gcA	p.A24A		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	24					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.A24A(1)									AGATTCTCGCGCCCTCGGTCC	0.701																																					p.A24A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G72A	2						.						34.0	30.0	31.0					2																	26624929		2203	4300	6503	26478433	SO:0001819	synonymous_variant	92749	exon1			AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.72G>A	2.37:g.26624929G>A			26478433	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Silent	SNP	ENST00000288710.2	37	CCDS1723.1																																																																																				0.701	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
PRKCE	5581	broad.mit.edu	37	2	45879362	45879363	+	Nonsense_Mutation	DNP	CA	CA	AG			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:45879362_45879363CA>AG	ENST00000306156.3	+	1	450_451	c.123_124CA>AG	c.(121-126)taCAtt>taAGtt	p.41_42YI>*V		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	41	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)	p.Y41>?(1)	MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	TCGACCCCTACATTGCCCTCAA	0.609																																					.												.	.	1	Complex(1)	large_intestine(1)	c.123_124AG	2						.																																			45732867	SO:0001587	stop_gained	5581	exon1				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	Exception_encountered	2.37:g.45879362_45879363delinsAG	ENSP00000306124:p.Y41_I42delins*V		45732866	NM_005400	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Nonsense_Mutation	DNP	ENST00000306156.3	37	CCDS1824.1																																																																																				0.609	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250751.2		
CYP26B1	56603	broad.mit.edu	37	2	72359497	72359497	+	Silent	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:72359497C>T	ENST00000001146.2	-	6	1601	c.1398G>A	c.(1396-1398)ctG>ctA	p.L466L	CYP26B1_ENST00000546307.1_Silent_p.L391L|CYP26B1_ENST00000412253.1_Silent_p.L275L	NM_001277742.1|NM_019885.2	NP_001264671.1|NP_063938.1	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily B, polypeptide 1	466					bone morphogenesis (GO:0060349)|cell fate determination (GO:0001709)|cellular response to retinoic acid (GO:0071300)|cornification (GO:0070268)|embryonic limb morphogenesis (GO:0030326)|establishment of skin barrier (GO:0061436)|male meiosis (GO:0007140)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of tongue muscle cell differentiation (GO:2001037)|proximal/distal pattern formation (GO:0009954)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|tongue morphogenesis (GO:0043587)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)	p.L466L(1)		breast(1)|kidney(3)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)	28						TCCGTGTGGCCAGCTCAAAGC	0.647																																					p.L466L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1398A	2						.						48.0	42.0	44.0					2																	72359497		2203	4300	6503	72213005	SO:0001819	synonymous_variant	56603	exon6				CCDS1919.1, CCDS62934.1	2p12	2006-11-24			ENSG00000003137	ENSG00000003137		"""Cytochrome P450s"""	20581	protein-coding gene	gene with protein product		605207				10545224	Standard	NM_019885		Approved	P450RAI-2	uc002sih.2	Q9NR63	OTTHUMG00000129756	ENST00000001146.2:c.1398G>A	2.37:g.72359497C>T			72213005	NM_019885	B2R8M7|B7Z2K6|B7Z2P4|B7Z3B8|E4W5W7|Q32MC0|Q53TW1|Q9NP41	Silent	SNP	ENST00000001146.2	37	CCDS1919.1																																																																																				0.647	CYP26B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251969.1	NM_019885	
DGKD	8527	broad.mit.edu	37	2	234372907	234372907	+	Missense_Mutation	SNP	C	C	A	rs575794923		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr2:234372907C>A	ENST00000264057.2	+	27	3296	c.3284C>A	c.(3283-3285)tCc>tAc	p.S1095Y	DGKD_ENST00000409813.3_Missense_Mutation_p.S1051Y	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	1095					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.S1095Y(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CTCTGCCAGTCCGCAGAGCCC	0.642																																					p.S1095Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3284A	2						.						39.0	47.0	44.0					2																	234372907		2203	4300	6503	234037646	SO:0001583	missense	8527	exon27			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.3284C>A	2.37:g.234372907C>A	ENSP00000264057:p.Ser1095Tyr		234037646	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	37	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	C	0.073	-1.197712	0.01594	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	T;T	0.79940	-1.15;-1.32	4.92	0.965	0.19661	.	0.953100	0.08685	N	0.908918	T	0.66458	0.2791	N	0.19112	0.55	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.12156	0.002;0.007	T	0.55623	-0.8112	10	0.54805	T	0.06	.	6.5207	0.22272	0.0:0.4576:0.0:0.5424	.	1051;1095	Q16760-2;Q16760	.;DGKD_HUMAN	Y	1095;1051	ENSP00000264057:S1095Y;ENSP00000386455:S1051Y	ENSP00000264057:S1095Y	S	+	2	0	DGKD	234037646	0.335000	0.24748	0.052000	0.19188	0.016000	0.09150	2.148000	0.42235	0.328000	0.23435	-0.312000	0.09012	TCC		0.642	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
COL27A1	85301	broad.mit.edu	37	9	117063736	117063736	+	Silent	SNP	T	T	A			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr9:117063736T>A	ENST00000356083.3	+	54	5194	c.4803T>A	c.(4801-4803)ggT>ggA	p.G1601G		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1601	Collagen-like 16.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)	p.G1601G(1)		central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GATTGCAAGGTCCGAGGGTGA	0.682																																					p.G1601G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T4803A	9						.						39.0	42.0	41.0					9																	117063736		2203	4300	6503	116103557	SO:0001819	synonymous_variant	85301	exon54			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4803T>A	9.37:g.117063736T>A			116103557	NM_032888	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																				0.682	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
BNC2	54796	broad.mit.edu	37	9	16436676	16436676	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr9:16436676G>A	ENST00000380672.4	-	6	1573	c.1516C>T	c.(1516-1518)Cga>Tga	p.R506*	BNC2_ENST00000545497.1_Nonsense_Mutation_p.R411*|BNC2_ENST00000380667.2_Nonsense_Mutation_p.R439*|BNC2_ENST00000380666.2_Nonsense_Mutation_p.R506*	NM_017637.5	NP_060107.3			basonuclin 2									p.R506*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TCTTTATCTCGGTTATTCCTT	0.502																																					p.R506X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1516T	9						.						97.0	96.0	97.0					9																	16436676		2203	4300	6503	16426676	SO:0001587	stop_gained	54796	exon6			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1516C>T	9.37:g.16436676G>A	ENSP00000370047:p.Arg506*		16426676	NM_017637		Nonsense_Mutation	SNP	ENST00000380672.4	37	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	G	37	6.344417	0.97489	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	.	.	.	5.88	3.99	0.46301	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.566	13.9861	0.64337	0.0:0.0:0.6027:0.3973	.	.	.	.	X	506;463;439;411;332;506;506	.	ENSP00000370041:R506X	R	-	1	2	BNC2	16426676	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.822000	0.55708	0.768000	0.33290	-0.169000	0.13324	CGA		0.502	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
PRUNE2	158471	broad.mit.edu	37	9	79325167	79325167	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr9:79325167C>A	ENST00000376718.3	-	8	2146	c.2023G>T	c.(2023-2025)Gaa>Taa	p.E675*	PRUNE2_ENST00000428286.1_Nonsense_Mutation_p.E316*	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	675					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GATTCCTGTTCACTGGAACTC	0.493																																					p.E675X												.	.	0			c.G2023T	9						.						56.0	52.0	53.0					9																	79325167		1568	3582	5150	78514987	SO:0001587	stop_gained	158471	exon8			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2023G>T	9.37:g.79325167C>A	ENSP00000365908:p.Glu675*		78514987	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Nonsense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	40	8.326988	0.98762	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	.	.	.	5.86	3.98	0.46160	.	0.244999	0.28958	N	0.013589	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.5758	7.889	0.29667	0.0:0.728:0.1333:0.1387	.	.	.	.	X	675;316;674	.	ENSP00000365908:E675X	E	-	1	0	PRUNE2	78514987	1.000000	0.71417	0.985000	0.45067	0.677000	0.39632	2.130000	0.42064	0.782000	0.33613	0.655000	0.94253	GAA		0.493	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PRUNE2	158471	broad.mit.edu	37	9	79325540	79325541	+	Missense_Mutation	DNP	TG	TG	AC			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr9:79325540_79325541TG>AC	ENST00000376718.3	-	8	1772_1773	c.1649_1650CA>GT	c.(1648-1650)tCA>tGT	p.S550C	PRUNE2_ENST00000428286.1_Missense_Mutation_p.S191C	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	550	Poly-Ser.				apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)	p.S550>?(1)		endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GTGAACTGGATGAATAATTAGA	0.49																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1649_1650GT	9						.																																			78515361	SO:0001583	missense	158471	exon8			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1649_1650delinsAC	9.37:g.79325540_79325541delinsAC	ENSP00000365908:p.Ser550Cys		78515360	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	DNP	ENST00000376718.3	37	CCDS47982.1																																																																																				0.490	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TNC	3371	broad.mit.edu	37	9	117849445	117849445	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr9:117849445C>T	ENST00000350763.4	-	3	976	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K	TNC_ENST00000423613.2_Missense_Mutation_p.E189K|TNC_ENST00000537320.1_Missense_Mutation_p.E189K|TNC_ENST00000340094.3_Missense_Mutation_p.E189K|TNC_ENST00000345230.3_Missense_Mutation_p.E189K|TNC_ENST00000341037.4_Missense_Mutation_p.E189K|TNC_ENST00000346706.3_Missense_Mutation_p.E189K|TNC_ENST00000542877.1_Missense_Mutation_p.E189K|TNC_ENST00000535648.1_Missense_Mutation_p.E189K	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	189	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.E189K(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CCTGGACATTCGGGCTCAGAG	0.622																																					p.E189K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G565A	9						.						103.0	92.0	96.0					9																	117849445		2203	4300	6503	116889266	SO:0001583	missense	3371	exon3				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.565G>A	9.37:g.117849445C>T	ENSP00000265131:p.Glu189Lys		116889266	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244052	0.39697	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81;2.81;2.81;2.81;2.81	5.19	5.19	0.71726	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.432977	0.26931	N	0.021778	T	0.06234	0.0161	N	0.20304	0.555	0.09310	N	1	P;B	0.46656	0.882;0.149	B;B	0.37888	0.26;0.03	T	0.37384	-0.9708	10	0.27785	T	0.31	.	8.9179	0.35592	0.0:0.7689:0.1507:0.0805	.	189;189	E9PC84;P24821	.;TENA_HUMAN	K	189	ENSP00000344400:E189K;ENSP00000438152:E189K;ENSP00000344555:E189K;ENSP00000345861:E189K;ENSP00000265131:E189K;ENSP00000339553:E189K;ENSP00000411406:E189K;ENSP00000443478:E189K;ENSP00000442242:E189K	ENSP00000344400:E189K	E	-	1	0	TNC	116889266	0.563000	0.26594	0.253000	0.24343	0.931000	0.56810	2.652000	0.46682	2.586000	0.87340	0.467000	0.42956	GAA		0.622	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
CARD9	64170	broad.mit.edu	37	9	139264271	139264272	+	Frame_Shift_Del	DEL	GG	GG	-	rs189645633		TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr9:139264271_139264272delGG	ENST00000371732.5	-	7	1172_1173	c.1007_1008delCC	c.(1006-1008)tccfs	p.S336fs	CARD9_ENST00000371734.3_Frame_Shift_Del_p.S336fs|CARD9_ENST00000460290.1_5'Flank|CARD9_ENST00000315908.7_Frame_Shift_Del_p.S336fs	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	336					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)	p.S336fs*1(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		TGTACATCTTGGAGTCCTTACG	0.639																																					p.336_336del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.1007_1008del	9						.																																			138384093	SO:0001589	frameshift_variant	64170	exon7			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1007_1008delCC	9.37:g.139264271_139264272delGG	ENSP00000360797:p.Ser336fs		138384092	NM_052813	Q5SXM5|Q5SXM6|Q9H854	Frame_Shift_Del	DEL	ENST00000371732.5	37	CCDS6997.1																																																																																				0.639	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055053.1	NM_052813	
LRCH1	23143	broad.mit.edu	37	13	47315969	47315969	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr13:47315969G>T	ENST00000389798.3	+	19	2370	c.2173G>T	c.(2173-2175)Gct>Tct	p.A725S	LRCH1_ENST00000389797.3_Missense_Mutation_p.A760S|LRCH1_ENST00000311191.6_Intron	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	725										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		CCACTGGAATGCTCTGTCCGC	0.512																																					p.A760S												.	.	0			c.G2278T	13						.						201.0	201.0	201.0					13																	47315969		2203	4300	6503	46213970	SO:0001583	missense	23143	exon20			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.2173G>T	13.37:g.47315969G>T	ENSP00000374448:p.Ala725Ser		46213970	NM_001164211	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	37	CCDS31972.1	.	.	.	.	.	.	.	.	.	.	G	15.96	2.985551	0.53934	.	.	ENSG00000136141	ENST00000389798;ENST00000389797	T;T	0.52526	0.72;0.66	5.62	4.76	0.60689	.	0.294940	0.28082	N	0.016663	T	0.31979	0.0814	N	0.14661	0.345	0.25553	N	0.987069	B;B	0.26809	0.16;0.099	B;B	0.31337	0.128;0.06	T	0.26643	-1.0097	10	0.66056	D	0.02	-17.4504	9.9139	0.41423	0.074:0.0:0.7857:0.1403	.	760;725	F8W6F0;Q9Y2L9	.;LRCH1_HUMAN	S	725;760	ENSP00000374448:A725S;ENSP00000374447:A760S	ENSP00000374447:A760S	A	+	1	0	LRCH1	46213970	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	4.625000	0.61262	2.810000	0.96702	0.650000	0.86243	GCT		0.512	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116	
SORCS3	22986	broad.mit.edu	37	10	106974307	106974307	+	Missense_Mutation	SNP	C	C	T	rs201415126		TCGA-AG-3726-01	TCGA-AG-3726-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr10:106974307C>T	ENST00000369701.3	+	18	2710	c.2483C>T	c.(2482-2484)aCg>aTg	p.T828M	SORCS3_ENST00000369699.4_Missense_Mutation_p.T114M	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	828	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.T828M(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CATGTGGTGACGACCGATGGG	0.587																																					p.T828M	NSCLC(116;1497 1690 7108 13108 14106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2483T	10						.		MET/THR	0,4406		0,0,2203	58.0	53.0	55.0		2483	5.0	0.9	10		55	1,8599	1.2+/-3.3	0,1,4299	no	missense	SORCS3	NM_014978.1	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	828/1223	106974307	1,13005	2203	4300	6503	106964297	SO:0001583	missense	22986	exon18			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2483C>T	10.37:g.106974307C>T	ENSP00000358715:p.Thr828Met		106964297	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	c	19.42	3.823419	0.71143	0.0	1.16E-4	ENSG00000156395	ENST00000369701;ENST00000369699	T;T	0.69561	-0.41;-0.41	5.89	4.99	0.66335	PKD domain (1);	0.000000	0.85682	D	0.000000	T	0.79179	0.4402	M	0.62723	1.935	0.49915	D	0.999836	D	0.89917	1.0	D	0.87578	0.998	T	0.79179	-0.1910	9	.	.	.	.	15.1529	0.72717	0.0:0.9324:0.0:0.0676	.	828	Q9UPU3	SORC3_HUMAN	M	828;114	ENSP00000358715:T828M;ENSP00000358713:T114M	.	T	+	2	0	SORCS3	106964297	1.000000	0.71417	0.900000	0.35374	0.992000	0.81027	5.768000	0.68858	1.500000	0.48636	0.558000	0.71614	ACG		0.587	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
TCF7L2	6934	broad.mit.edu	37	10	114901010	114901011	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr10:114901010_114901011GC>TT	ENST00000355995.4	+	6	1127_1128	c.620_621GC>TT	c.(619-621)aGC>aTT	p.S207I	TCF7L2_ENST00000538897.1_Missense_Mutation_p.S207I|TCF7L2_ENST00000369389.1_5'Flank|TCF7L2_ENST00000543371.1_Missense_Mutation_p.S207I|TCF7L2_ENST00000369395.1_Missense_Mutation_p.S232I|TCF7L2_ENST00000534894.1_Missense_Mutation_p.S207I|TCF7L2_ENST00000355717.4_Missense_Mutation_p.S231I|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000349937.2_Missense_Mutation_p.S207I|TCF7L2_ENST00000352065.5_Missense_Mutation_p.S184I|TCF7L2_ENST00000536810.1_Missense_Mutation_p.S207I|TCF7L2_ENST00000369397.4_Missense_Mutation_p.S184I|TCF7L2_ENST00000545257.1_Missense_Mutation_p.S207I			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	207	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S231>?(1)|p.S207>?(1)|p.S184>?(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		ATCACGTACAGCAATGAACACT	0.564			T	VTI1A	colorectal																																.			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	3	Complex(3)	large_intestine(3)	c.551_552TT	10						.																																			114891001	SO:0001583	missense	6934	exon5			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	Exception_encountered	10.37:g.114901010_114901011delinsTT	ENSP00000348274:p.Ser207Ile		114891000	NM_001146284	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	DNP	ENST00000355995.4	37																																																																																					0.564	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
DNAJC1	64215	broad.mit.edu	37	10	22292227	22292227	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr10:22292227C>T	ENST00000376980.3	-	1	427	c.137G>A	c.(136-138)cGc>cAc	p.R46H	DNAJC1_ENST00000376946.1_Missense_Mutation_p.R46H	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	46					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.R46H(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				CTCCCAgccgcgcgccggcgc	0.706																																					p.R46H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G137A	10						.						18.0	15.0	16.0					10																	22292227		2112	4147	6259	22332233	SO:0001583	missense	64215	exon1			AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.137G>A	10.37:g.22292227C>T	ENSP00000366179:p.Arg46His		22332233	NM_022365	B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	ENST00000376980.3	37	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304801	0.40795	.	.	ENSG00000136770	ENST00000376980;ENST00000376946	T;T	0.63417	-0.04;1.49	4.12	2.17	0.27698	.	0.724746	0.13468	N	0.385657	T	0.37625	0.1010	N	0.11927	0.2	0.25771	N	0.984839	B	0.06786	0.001	B	0.01281	0.0	T	0.19582	-1.0301	10	0.18710	T	0.47	.	6.3115	0.21166	0.0:0.7639:0.0:0.2361	.	46	Q96KC8	DNJC1_HUMAN	H	46	ENSP00000366179:R46H;ENSP00000366145:R46H	ENSP00000366145:R46H	R	-	2	0	DNAJC1	22332233	0.951000	0.32395	0.994000	0.49952	0.958000	0.62258	0.307000	0.19296	0.435000	0.26365	0.585000	0.79938	CGC		0.706	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365	
DCLRE1A	9937	broad.mit.edu	37	10	115612743	115612743	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr10:115612743G>A	ENST00000361384.2	-	1	1116	c.199C>T	c.(199-201)Ctt>Ttt	p.L67F	DCLRE1A_ENST00000476112.1_5'Flank|NHLRC2_ENST00000369301.3_5'Flank|DCLRE1A_ENST00000369305.1_Missense_Mutation_p.L67F	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	67	Nuclear localization region.				mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)		p.L67F(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		GCATTTCCAAGGGGCACTTCA	0.433								Other identified genes with known or suspected DNA repair function																													p.L67F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C199T	10						.						201.0	196.0	198.0					10																	115612743		2203	4300	6503	115602733	SO:0001583	missense	9937	exon1				CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.199C>T	10.37:g.115612743G>A	ENSP00000355185:p.Leu67Phe		115602733	NM_014881	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	G	6.728	0.503078	0.12822	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	D;D	0.96365	-3.99;-3.99	5.59	1.0	0.19881	.	0.925721	0.08862	N	0.882918	D	0.92577	0.7642	L	0.46157	1.445	0.09310	N	1	B	0.25048	0.117	B	0.20184	0.028	D	0.83970	0.0326	10	0.39692	T	0.17	-0.697	5.287	0.15706	0.2852:0.1554:0.5594:0.0	.	67	Q6PJP8	DCR1A_HUMAN	F	67	ENSP00000355185:L67F;ENSP00000358311:L67F	ENSP00000355185:L67F	L	-	1	0	DCLRE1A	115602733	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.093000	0.15086	0.291000	0.22468	0.557000	0.71058	CTT		0.433	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
EPB41L4A	64097	broad.mit.edu	37	5	111575392	111575392	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:111575392G>T	ENST00000261486.5	-	11	1206	c.930C>A	c.(928-930)agC>agA	p.S310R	RP11-526F3.1_ENST00000504004.1_RNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	310						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)		p.S310R(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		ATCCAAACTTGCTGAGTTTTC	0.353																																					p.S310R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C930A	5						.						135.0	119.0	124.0					5																	111575392		1823	4070	5893	111603291	SO:0001583	missense	64097	exon11			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.930C>A	5.37:g.111575392G>T	ENSP00000261486:p.Ser310Arg		111603291	NM_022140	A4FUI6	Missense_Mutation	SNP	ENST00000261486.5	37	CCDS43350.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441477	0.63067	.	.	ENSG00000129595	ENST00000261486	D	0.87334	-2.24	5.59	4.72	0.59763	FERM adjacent (FA) (1);	0.103551	0.64402	D	0.000002	T	0.80954	0.4723	N	0.19112	0.55	0.41165	D	0.986127	B	0.32010	0.351	B	0.36534	0.227	T	0.81754	-0.0788	10	0.72032	D	0.01	.	13.7115	0.62672	0.076:0.0:0.924:0.0	.	310	Q9HCS5	E41LA_HUMAN	R	310	ENSP00000261486:S310R	ENSP00000261486:S310R	S	-	3	2	EPB41L4A	111603291	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.281000	0.65609	1.495000	0.48549	0.655000	0.94253	AGC		0.353	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
APC	324	broad.mit.edu	37	5	112173290	112173290	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:112173290C>T	ENST00000457016.1	+	16	2379	c.1999C>T	c.(1999-2001)Caa>Taa	p.Q667*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q667*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q667*			P25054	APC_HUMAN	adenomatous polyposis coli	667	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)|p.Q667*(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AACTTTATTACAACACTTAAA	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q649X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Nonsense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.C1945T	5	GRCh37	HM060574	APC	M		.						67.0	69.0	69.0					5																	112173290		2202	4300	6502	112201189	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1999C>T	5.37:g.112173290C>T	ENSP00000413133:p.Gln667*		112201189	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.807428	0.96967	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.99	5.99	0.97316	.	0.051053	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-13.6268	20.4777	0.99188	0.0:1.0:0.0:0.0	.	.	.	.	X	667;649;667;667;667	.	ENSP00000257430:Q667X	Q	+	1	0	APC	112201189	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.840000	0.97914	0.655000	0.94253	CAA		0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175136	112175136	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-3726-01	TCGA-AG-3726-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:112175136C>G	ENST00000457016.1	+	16	4225	c.3845C>G	c.(3844-3846)tCa>tGa	p.S1282*	APC_ENST00000508376.2_Nonsense_Mutation_p.S1282*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.S1282*			P25054	APC_HUMAN	adenomatous polyposis coli	1282	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1282*(4)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCTTTGTCATCAGCTGAAGAT	0.338		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1264X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	6	Substitution - Nonsense(4)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(4)|soft_tissue(1)|skin(1)	c.C3791G	5						.						54.0	56.0	55.0					5																	112175136		2202	4300	6502	112203035	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3845C>G	5.37:g.112175136C>G	ENSP00000413133:p.Ser1282*		112203035	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	7.998517	0.98602	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.03	6.03	0.97812	.	0.056000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.6145	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1282	.	.	S	+	2	0	APC	112203035	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	TCA		0.338	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB11	56125	broad.mit.edu	37	5	140580521	140580521	+	Missense_Mutation	SNP	G	G	A	rs201835076		TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:140580521G>A	ENST00000354757.3	+	1	1174	c.1174G>A	c.(1174-1176)Gtg>Atg	p.V392M	PCDHB11_ENST00000536699.1_Missense_Mutation_p.V27M	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	392	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V392M(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTCCCATTCGTGCTAAAATC	0.453																																					p.V392M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1174A	5						.						115.0	115.0	115.0					5																	140580521		2203	4300	6503	140560705	SO:0001583	missense	56125	exon1			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.1174G>A	5.37:g.140580521G>A	ENSP00000346802:p.Val392Met		140560705	NM_018931	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	37	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.853054	0.32699	.	.	ENSG00000197479	ENST00000536699;ENST00000354757;ENST00000536825	T;T	0.60672	0.17;4.64	2.52	-5.04	0.02964	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.48554	0.1506	L	0.53617	1.68	0.09310	N	1	P	0.39940	0.696	B	0.42343	0.384	T	0.46843	-0.9162	9	0.51188	T	0.08	.	6.0648	0.19858	0.2939:0.3788:0.3273:0.0	.	392	Q9Y5F2	PCDBB_HUMAN	M	27;392;80	ENSP00000440344:V27M;ENSP00000346802:V392M	ENSP00000346802:V392M	V	+	1	0	PCDHB11	140560705	0.000000	0.05858	0.000000	0.03702	0.942000	0.58702	-6.600000	0.00060	-1.295000	0.02357	0.306000	0.20318	GTG		0.453	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
JAKMIP2	9832	broad.mit.edu	37	5	147040726	147040726	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:147040726G>A	ENST00000265272.5	-	3	879	c.412C>T	c.(412-414)Cgg>Tgg	p.R138W	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R138W|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R96W	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	138						Golgi apparatus (GO:0005794)		p.R138W(1)		NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCCTCCCGGGCCTCAATG	0.567																																					p.R138W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C412T	5						.						107.0	110.0	109.0					5																	147040726		2203	4300	6503	147020919	SO:0001583	missense	9832	exon3			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.412C>T	5.37:g.147040726G>A	ENSP00000265272:p.Arg138Trp		147020919	NM_014790	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	37	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327169	0.81690	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.46451	0.87;0.87;0.87	4.67	4.67	0.58626	.	0.112717	0.64402	D	0.000016	T	0.61400	0.2344	M	0.69823	2.125	0.50313	D	0.99986	D;D;D;D	0.71674	0.997;0.998;0.998;0.998	P;P;P;P	0.59643	0.807;0.861;0.861;0.861	T	0.66712	-0.5854	10	0.72032	D	0.01	.	18.4503	0.90702	0.0:0.0:1.0:0.0	.	96;138;138;138	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	W	138;138;96;138	ENSP00000421398:R138W;ENSP00000265272:R138W;ENSP00000328989:R96W	ENSP00000265272:R138W	R	-	1	2	JAKMIP2	147020919	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.068000	0.57534	2.529000	0.85273	0.563000	0.77884	CGG		0.567	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
SPINK7	84651	broad.mit.edu	37	5	147693673	147693674	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:147693673_147693674GC>TA	ENST00000274565.4	+	3	159_160	c.98_99GC>TA	c.(97-99)aGC>aTA	p.S33I	SPINK7_ENST00000514394.1_3'UTR|SPINK7_ENST00000523535.1_Missense_Mutation_p.S7I|RP11-373N22.3_ENST00000501695.3_RNA	NM_032566.2	NP_115955.1	P58062	ISK7_HUMAN	serine peptidase inhibitor, Kazal type 7 (putative)	33	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S33>?(1)		large_intestine(2)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGACTGCAGCATTTACAAGA	0.475																																					.												.	.	1	Complex(1)	large_intestine(1)	c.98_99TA	5						.																																			147673867	SO:0001583	missense	84651	exon3				CCDS4289.1	5q32	2011-08-31			ENSG00000145879	ENSG00000145879		"""Serine peptidase inhibitors, Kazal type"""	24643	protein-coding gene	gene with protein product	"""esophagus cancer related gene 2"""					12646258, 12970870	Standard	NM_032566		Approved	ECG2, ECRG2	uc003lpd.3	P58062	OTTHUMG00000163522	Exception_encountered	5.37:g.147693673_147693674delinsTA	ENSP00000274565:p.Ser33Ile		147673866	NM_032566	Q32LY0	Missense_Mutation	DNP	ENST00000274565.4	37	CCDS4289.1																																																																																				0.475	SPINK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251944.5	NM_032566	
PPARGC1B	133522	broad.mit.edu	37	5	149200080	149200080	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:149200080G>A	ENST00000309241.5	+	2	195	c.163G>A	c.(163-165)Gcc>Acc	p.A55T	PPARGC1B_ENST00000394320.3_Missense_Mutation_p.A55T|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.A55T|PPARGC1B_ENST00000403750.1_Missense_Mutation_p.A30T	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	55	Abolishes DNA transcriptional activity when missing.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.A55T(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CTTTGACTCGGCCACCTGCTT	0.582																																					p.A30T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G88A	5						.						104.0	99.0	101.0					5																	149200080		2203	4300	6503	149180273	SO:0001583	missense	133522	exon2			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.163G>A	5.37:g.149200080G>A	ENSP00000312649:p.Ala55Thr		149180273	NM_001172699	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	ENST00000309241.5	37	CCDS4298.1	.	.	.	.	.	.	.	.	.	.	g	14.75	2.628494	0.46944	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.08984	3.05;3.03;3.04;3.07	5.76	4.88	0.63580	.	0.212561	0.49916	D	0.000134	T	0.16557	0.0398	L	0.47716	1.5	0.34487	D	0.70454	D;B;B;D;P	0.89917	1.0;0.208;0.208;1.0;0.851	D;B;B;D;P	0.87578	0.998;0.068;0.068;0.996;0.493	T	0.07328	-1.0778	10	0.10902	T	0.67	-26.6019	8.7486	0.34602	0.2112:0.0:0.7888:0.0	.	34;34;55;55;55	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	T	55;55;55;30	ENSP00000353638:A55T;ENSP00000377855:A55T;ENSP00000312649:A55T;ENSP00000384403:A30T	ENSP00000312649:A55T	A	+	1	0	PPARGC1B	149180273	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	4.496000	0.60360	2.724000	0.93272	0.651000	0.88453	GCC		0.582	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263	
TCOF1	6949	broad.mit.edu	37	5	149771711	149771712	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-AG-3726-01	TCGA-AG-3726-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:149771711_149771712CC>TA	ENST00000504761.2	+	21	3489_3490	c.3489_3490CC>TA	c.(3487-3492)ccCCag>ccTAag	p.Q1164K	TCOF1_ENST00000377797.3_Missense_Mutation_p.Q1164K|TCOF1_ENST00000439160.2_Missense_Mutation_p.Q1126K|TCOF1_ENST00000323668.7_Missense_Mutation_p.Q1087K|TCOF1_ENST00000451292.1_Missense_Mutation_p.Q1201K|TCOF1_ENST00000513346.1_Missense_Mutation_p.Q1163K|TCOF1_ENST00000445265.2_Missense_Mutation_p.Q1087K			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1164					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)	p.P1086>?(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTGAAGGGCCCCAGGGGGCCAA	0.619																																					.												.	.	1	Complex(1)	large_intestine(1)	c.3489_3490TA	5	GRCh37	CM023461	TCOF1	M		.																																			149751905	SO:0001583	missense	6949	exon21				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	Exception_encountered	5.37:g.149771711_149771712delinsTA	ENSP00000421655:p.Gln1164Lys		149751904	NM_001135243	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	DNP	ENST00000504761.2	37	CCDS54936.1																																																																																				0.619	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
NDST1	3340	broad.mit.edu	37	5	149919654	149919654	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3726-01	TCGA-AG-3726-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:149919654T>G	ENST00000261797.6	+	8	2079	c.1577T>G	c.(1576-1578)tTc>tGc	p.F526C	NDST1_ENST00000523767.1_Missense_Mutation_p.F526C	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	526	Heparan sulfate N-deacetylase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.F526C(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATCAGCATCTTCATGACGCAC	0.612																																					p.F526C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1577G	5						.						105.0	85.0	92.0					5																	149919654		2203	4300	6503	149899847	SO:0001583	missense	3340	exon8			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1577T>G	5.37:g.149919654T>G	ENSP00000261797:p.Phe526Cys		149899847	NM_001543	Q96E57	Missense_Mutation	SNP	ENST00000261797.6	37	CCDS34277.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.497782	0.85069	.	.	ENSG00000070614	ENST00000523767;ENST00000261797	T;T	0.61859	0.07;0.48	5.37	5.37	0.77165	.	0.042255	0.85682	D	0.000000	T	0.79598	0.4473	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.74674	0.984;0.927	D	0.84098	0.0394	10	0.87932	D	0	.	15.6753	0.77311	0.0:0.0:0.0:1.0	.	526;526	E7EVJ3;P52848	.;NDST1_HUMAN	C	526	ENSP00000428604:F526C;ENSP00000261797:F526C	ENSP00000261797:F526C	F	+	2	0	NDST1	149899847	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.991000	0.88244	2.155000	0.67459	0.460000	0.39030	TTC		0.612	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374314.2	NM_001543	
RARS	5917	broad.mit.edu	37	5	167943865	167943865	+	Missense_Mutation	SNP	G	G	T	rs369398935		TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:167943865G>T	ENST00000231572.3	+	13	1589	c.1535G>T	c.(1534-1536)cGg>cTg	p.R512L	RARS_ENST00000538719.1_Missense_Mutation_p.R306L	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	512					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.R512L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		TCCCATAACCGGTTGAATGAC	0.418																																					p.R512L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1535T	5						.						211.0	200.0	204.0					5																	167943865		2203	4300	6503	167876443	SO:0001583	missense	5917	exon13			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1535G>T	5.37:g.167943865G>T	ENSP00000231572:p.Arg512Leu		167876443	NM_002887	B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	ENST00000231572.3	37	CCDS4367.1	.	.	.	.	.	.	.	.	.	.	g	24.0	4.476577	0.84640	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	T;T	0.67865	-0.06;-0.29	5.97	5.09	0.68999	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.85691	0.5755	M	0.91920	3.255	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.89426	0.3713	10	0.87932	D	0	-15.6789	17.243	0.87019	0.0:0.1258:0.8742:0.0	.	512	P54136	SYRC_HUMAN	L	512;306	ENSP00000231572:R512L;ENSP00000439108:R306L	ENSP00000231572:R512L	R	+	2	0	RARS	167876443	1.000000	0.71417	0.899000	0.35326	0.744000	0.42396	9.452000	0.97615	1.514000	0.48869	-0.181000	0.13052	CGG		0.418	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887	
PIK3R1	5295	broad.mit.edu	37	5	67589586	67589591	+	In_Frame_Del	DEL	ATGAAT	ATGAAT	-	rs17852841		TCGA-AG-3726-01	TCGA-AG-3726-01			ATGAAT	-	ATGAAT	ATGAAT	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:67589586_67589591delATGAAT	ENST00000521381.1	+	11	1965_1970	c.1349_1354delATGAAT	c.(1348-1356)catgaatat>cat	p.EY451del	PIK3R1_ENST00000320694.8_In_Frame_Del_p.EY151del|PIK3R1_ENST00000523872.1_In_Frame_Del_p.EY88del|PIK3R1_ENST00000336483.5_In_Frame_Del_p.EY181del|PIK3R1_ENST00000274335.5_In_Frame_Del_p.EY451del|PIK3R1_ENST00000396611.1_In_Frame_Del_p.EY451del|PIK3R1_ENST00000521657.1_In_Frame_Del_p.EY451del	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	451			E -> K (in dbSNP:rs17852841). {ECO:0000269|PubMed:15489334}.		B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.H450_E451del(2)|p.G446_Y452>VI(1)|p.Y152N(1)|p.0?(1)|p.?(1)|p.Y452N(1)|p.Y182N(1)|p.E451_Y452del(1)|p.N453_T454insN(1)|p.E451_Y452delEY(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AAAAAATTACATGAATATAACACTCA	0.277			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.450_452del			Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	.	11	Deletion - In frame(4)|Substitution - Missense(3)|Insertion - In frame(1)|Unknown(1)|Whole gene deletion(1)|Complex - deletion inframe(1)	endometrium(5)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|lung(1)	c.1349_1354del	5						.																																			67625347	SO:0001651	inframe_deletion	5295	exon10			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1349_1354delATGAAT	5.37:g.67589586_67589591delATGAAT	ENSP00000428056:p.Glu451_Tyr452del		67625342	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	In_Frame_Del	DEL	ENST00000521381.1	37	CCDS3993.1																																																																																				0.277	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
VCAN	1462	broad.mit.edu	37	5	82818043	82818043	+	Silent	SNP	G	G	A			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:82818043G>A	ENST00000265077.3	+	7	4483	c.3918G>A	c.(3916-3918)gcG>gcA	p.A1306A	VCAN_ENST00000512590.2_Silent_p.A1258A|VCAN_ENST00000342785.4_Silent_p.A1306A|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1306	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.A1306A(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GACCTCAGGCGCTTTCTACGC	0.448																																					p.A1306A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3918A	5						.						60.0	61.0	61.0					5																	82818043		2203	4300	6503	82853799	SO:0001819	synonymous_variant	1462	exon7			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3918G>A	5.37:g.82818043G>A			82853799	NM_001164098	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	37	CCDS4060.1																																																																																				0.448	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
FBXW11	23291	broad.mit.edu	37	5	171299933	171299933	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3726-01	TCGA-AG-3726-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3726-01	TCGA-AG-3726-01	g.chr5:171299933G>T	ENST00000265094.5	-	9	1357	c.1220C>A	c.(1219-1221)gCc>gAc	p.A407D	FBXW11_ENST00000393802.2_Missense_Mutation_p.A373D|FBXW11_ENST00000296933.6_Missense_Mutation_p.A394D|FBXW11_ENST00000425623.2_Missense_Mutation_p.A375D	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	407					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTGGAGACAGGCAATGCCCCG	0.453																																					p.A373D												.	.	0			c.C1118A	5						.						104.0	90.0	95.0					5																	171299933		2203	4300	6503	171232538	SO:0001583	missense	23291	exon8			AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.1220C>A	5.37:g.171299933G>T	ENSP00000265094:p.Ala407Asp		171232538	NM_033645	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	37	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	G	34	5.389014	0.95988	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58637	0.2136	L	0.41632	1.29	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.81914	0.995;0.991;0.992;0.994	T	0.59495	-0.7444	10	0.72032	D	0.01	-14.1716	19.3046	0.94155	0.0:0.0:1.0:0.0	.	375;373;407;394	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	D	394;407;373;375	ENSP00000296933:A394D;ENSP00000265094:A407D;ENSP00000377391:A373D;ENSP00000444929:A375D	ENSP00000265094:A407D	A	-	2	0	FBXW11	171232538	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.652000	0.90054	0.655000	0.94253	GCC		0.453	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
