#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCDC88C	440193	broad.mit.edu	37	14	91739502	91739503	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr14:91739502_91739503insG	ENST00000389857.6	-	30	5639_5640	c.5553_5554insC	c.(5551-5556)cccagcfs	p.S1852fs	CCDC88C_ENST00000331194.7_Frame_Shift_Ins_p.S376fs	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1852					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CTATGGGAGCTGGGGGGTGCGG	0.698																																					p.S1852fs												.	.	0			c.5554_5555insC	14						.																																			90809256	SO:0001589	frameshift_variant	440193	exon30				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.5554dupC	14.37:g.91739508_91739508dupG	ENSP00000374507:p.Ser1852fs		90809255	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Frame_Shift_Ins	INS	ENST00000389857.6	37	CCDS45151.1																																																																																				0.698	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
TGIF1	7050	broad.mit.edu	37	18	3457365	3457366	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr18:3457365_3457366insT	ENST00000330513.5	+	3	936_937	c.633_634insT	c.(634-636)tgtfs	p.C212fs	TGIF1_ENST00000577543.1_Intron|TGIF1_ENST00000405385.3_Frame_Shift_Ins_p.C63fs|TGIF1_ENST00000407501.2_Frame_Shift_Ins_p.C83fs|TGIF1_ENST00000472042.1_Frame_Shift_Ins_p.C63fs|TGIF1_ENST00000548489.2_Frame_Shift_Ins_p.C97fs|TGIF1_ENST00000343820.5_Frame_Shift_Ins_p.C83fs|TGIF1_ENST00000345133.5_Frame_Shift_Ins_p.C63fs|TGIF1_ENST00000551541.1_Frame_Shift_Ins_p.C63fs|TGIF1_ENST00000400167.2_Frame_Shift_Ins_p.C63fs|TGIF1_ENST00000401449.1_Frame_Shift_Ins_p.C63fs	NM_170695.2	NP_733796.2	Q15583	TGIF1_HUMAN	TGFB-induced factor homeobox 1	212					determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nodal signaling pathway (GO:0038092)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neuron differentiation (GO:0045666)|regulation of gastrulation (GO:0010470)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.C212fs*2(1)		cervix(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13	Esophageal squamous(4;0.0859)	Colorectal(8;0.0104)				GATTTCAGGTCTGTAACTGGTT	0.485																																					p.V82fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.246_247insT	18						.																																			3447366	SO:0001589	frameshift_variant	7050	exon4			X89750	CCDS11832.1, CCDS11833.1, CCDS11834.1, CCDS11835.1	18p11.31	2011-06-20	2007-01-30	2007-01-30	ENSG00000177426	ENSG00000177426		"""Homeoboxes / TALE class"""	11776	protein-coding gene	gene with protein product		602630	"""TGFB-induced factor (TALE family homeobox)"""	HPE4, TGIF		8537382, 10835638	Standard	NM_173211		Approved		uc002klz.3	Q15583	OTTHUMG00000131511	ENST00000330513.5:c.634dupT	18.37:g.3457366_3457366dupT	ENSP00000327959:p.Cys212fs		3447365	NM_173208	A6NE42|A6NLU7|F8VZB6|Q6ICR0|Q8N5X9|Q9NRS0	Frame_Shift_Ins	INS	ENST00000330513.5	37	CCDS11834.1																																																																																				0.485	TGIF1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254368.4	NM_170695	
FGD3	89846	broad.mit.edu	37	9	95738899	95738900	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr9:95738899_95738900insC	ENST00000375482.3	+	3	857_858	c.361_362insC	c.(361-363)accfs	p.T121fs	FGD3_ENST00000416701.2_Frame_Shift_Ins_p.T121fs|FGD3_ENST00000337352.6_Frame_Shift_Ins_p.T121fs|FGD3_ENST00000468206.1_3'UTR	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	121					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.Q123fs*10(2)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CCCGAAGGTCACCCCCCAGGAG	0.658																																					p.T121fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.361_362insC	9						.																																			94778721	SO:0001589	frameshift_variant	89846	exon3			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.367dupC	9.37:g.95738905_95738905dupC	ENSP00000364631:p.Thr121fs		94778720	NM_033086	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Frame_Shift_Ins	INS	ENST00000375482.3	37	CCDS43849.1																																																																																				0.658	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
IGHD1-20	28507	broad.mit.edu	37	14	106354495	106354496	+	RNA	INS	-	-	G	rs200584328		TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr14:106354495_106354496insG	ENST00000450276.1	-	0	17				IGHD2-21_ENST00000390572.1_RNA|IGHD3-22_ENST00000390571.1_RNA					immunoglobulin heavy diversity 1-20																		GGTGTCACCGAGTCTCCTCTTG	0.554																																					.												.	.	0			.	14						.			764,2778		200,364,1207						0.4	0.0			63	815,6753		106,603,3075	no	intergenic				306,967,4282	A1A1,A1R,RR		10.769,21.5697,14.2124				1579,9531				105425541			8755	.			X97051		14q32.33	2012-02-08			ENSG00000237020	ENSG00000237020		"""Immunoglobulins / IGH locus"""	5484	other	immunoglobulin gene						3138112	Standard	NG_001019		Approved	IGHD120			OTTHUMG00000152432		14.37:g.106354496_106354496dupG			105425540	.		Splice_Site	INS	ENST00000450276.1	37																																																																																					0.554	IGHD1-20-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_D_gene	IG_D_gene	OTTHUMT00000326210.1	NG_001019	
DAGLB	221955	broad.mit.edu	37	7	6476076	6476076	+	Silent	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr7:6476076G>A	ENST00000297056.6	-	3	505	c.336C>T	c.(334-336)gcC>gcT	p.A112A	DAGLB_ENST00000479922.2_5'UTR|DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000436575.1_Silent_p.A71A|DAGLB_ENST00000425398.2_Silent_p.A112A|DAGLB_ENST00000428902.2_Intron	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	112					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.A112A(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CCCCCAGAGAGGCCCAGACCA	0.532																																					p.A112A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C336T	7						.						100.0	100.0	100.0					7																	6476076		2203	4300	6503	6442601	SO:0001819	synonymous_variant	221955	exon3			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.336C>T	7.37:g.6476076G>A			6442601	NM_139179	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Silent	SNP	ENST00000297056.6	37	CCDS5350.1																																																																																				0.532	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
GNAI1	2770	broad.mit.edu	37	7	79840384	79840384	+	Silent	SNP	C	C	T	rs71555062	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr7:79840384C>T	ENST00000351004.3	+	6	1063	c.690C>T	c.(688-690)taC>taT	p.Y230Y	GNAI1_ENST00000457358.2_Silent_p.Y178Y	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	230					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.Y230Y(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						TGAGTGACTACGACCTGGTTC	0.443													C|||	2	0.000399361	0.0	0.0014	5008	,	,		16716	0.0		0.001	False		,,,				2504	0.0				p.Y230Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C690T	7						.	C		0,4406		0,0,2203	133.0	109.0	117.0		690	1.7	1.0	7	dbSNP_130	117	19,8581	14.0+/-48.4	0,19,4281	no	coding-synonymous	GNAI1	NM_002069.5		0,19,6484	TT,TC,CC		0.2209,0.0,0.1461		230/355	79840384	19,12987	2203	4300	6503	79678320	SO:0001819	synonymous_variant	2770	exon6			AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.690C>T	7.37:g.79840384C>T			79678320	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Silent	SNP	ENST00000351004.3	37	CCDS5595.1																																																																																				0.443	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
ZKSCAN1	7586	broad.mit.edu	37	7	99631011	99631011	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr7:99631011G>A	ENST00000324306.6	+	6	1117	c.883G>A	c.(883-885)Gga>Aga	p.G295R	ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.G82R|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.G259R	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	295	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G295R(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GGAGACAACAGGAAGATCCCA	0.463																																					p.G295R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G883A	7						.						68.0	71.0	70.0					7																	99631011		2203	4300	6503	99468947	SO:0001583	missense	7586	exon6			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.883G>A	7.37:g.99631011G>A	ENSP00000323148:p.Gly295Arg		99468947	NM_003439	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	ENST00000324306.6	37	CCDS34698.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835130	0.32421	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.07908	3.27;3.23;3.15	5.64	3.8	0.43715	Krueppel-associated box (1);	0.123556	0.37095	N	0.002246	T	0.06188	0.0160	N	0.22421	0.69	0.40536	D	0.980974	B	0.24533	0.105	B	0.23150	0.044	T	0.30475	-0.9977	10	0.51188	T	0.08	.	8.9863	0.35997	0.0805:0.1502:0.7693:0.0	.	295	P17029	ZKSC1_HUMAN	R	295;259;82	ENSP00000323148:G295R;ENSP00000409172:G259R;ENSP00000443508:G82R	ENSP00000323148:G295R	G	+	1	0	ZKSCAN1	99468947	0.000000	0.05858	0.289000	0.24876	0.042000	0.13812	0.744000	0.26245	0.894000	0.36317	0.650000	0.86243	GGA		0.463	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344550.2	NM_003439	
OR9A4	130075	broad.mit.edu	37	7	141619594	141619594	+	Missense_Mutation	SNP	C	C	T	rs540557231		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr7:141619594C>T	ENST00000548136.1	+	1	978	c.919C>T	c.(919-921)Cgc>Tgc	p.R307C	MGAM_ENST00000497554.1_Intron	NM_001001656.1	NP_001001656.1	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A, member 4	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R307C(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(7)|prostate(1)|skin(2)	22	Melanoma(164;0.0171)					TGGGGTGAAACGCTGCTGTCA	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		20070	0.0		0.0	False		,,,				2504	0.001				p.R307C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C919T	7						.						95.0	96.0	96.0					7																	141619594		2051	4235	6286	141266063	SO:0001583	missense	130075	exon1				CCDS43661.1	7q34	2012-10-03			ENSG00000258083	ENSG00000258083		"""GPCR / Class A : Olfactory receptors"""	15095	protein-coding gene	gene with protein product							Standard	NM_001001656		Approved		uc003vwu.1	Q8NGU2	OTTHUMG00000158370	ENST00000548136.1:c.919C>T	7.37:g.141619594C>T	ENSP00000448789:p.Arg307Cys		141266063	NM_001001656	B9EGV6|Q6IFI4	Missense_Mutation	SNP	ENST00000548136.1	37	CCDS43661.1	.	.	.	.	.	.	.	.	.	.	C	7.805	0.714374	0.15306	.	.	ENSG00000258083	ENST00000548136	T	0.35048	1.33	3.71	0.723	0.18231	.	.	.	.	.	T	0.27384	0.0672	L	0.42008	1.315	0.09310	N	1	B	0.16603	0.018	B	0.15870	0.014	T	0.27262	-1.0079	9	0.72032	D	0.01	-0.0715	5.0256	0.14383	0.2739:0.543:0.0:0.1831	.	307	Q8NGU2	OR9A4_HUMAN	C	307	ENSP00000448789:R307C	ENSP00000386148:R307C	R	+	1	0	OR9A4	141266063	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.007000	0.12810	-0.207000	0.10187	-1.094000	0.02160	CGC		0.423	OR9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350806.3	NM_001001656	
SULF2	55959	broad.mit.edu	37	20	46290537	46290537	+	Missense_Mutation	SNP	C	C	T	rs533810544		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr20:46290537C>T	ENST00000359930.4	-	18	3325	c.2474G>A	c.(2473-2475)cGg>cAg	p.R825Q	SULF2_ENST00000484875.1_Missense_Mutation_p.R825Q|SULF2_ENST00000361612.4_Missense_Mutation_p.R825Q|SULF2_ENST00000467815.1_Missense_Mutation_p.R825Q	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	825					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.R825Q(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						GTTTCGAGTCCGGGGGTTACA	0.562													C|||	1	0.000199681	0.0	0.0	5008	,	,		21083	0.0		0.0	False		,,,				2504	0.001				p.R825Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2474A	20						.						151.0	124.0	133.0					20																	46290537		2203	4300	6503	45723944	SO:0001583	missense	55959	exon18			AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.2474G>A	20.37:g.46290537C>T	ENSP00000353007:p.Arg825Gln		45723944	NM_198596	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.2|26.2	4.717761|4.717761	0.89205|0.89205	.|.	.|.	ENSG00000196562|ENSG00000196562	ENST00000495544|ENST00000359930;ENST00000484875;ENST00000361612;ENST00000371978;ENST00000467815	.|T;T;T;T	.|0.22945	.|1.93;1.93;1.93;1.93	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.168662	.|0.47455	.|D	.|0.000232	T|T	0.29061|0.29061	0.0722|0.0722	L|L	0.49778|0.49778	1.585|1.585	0.52501|0.52501	D|D	0.999958|0.999958	.|B;B	.|0.22746	.|0.074;0.009	.|B;B	.|0.17433	.|0.018;0.006	T|T	0.04281|0.04281	-1.0963|-1.0963	5|10	.|0.54805	.|T	.|0.06	-23.6604|-23.6604	19.0961|19.0961	0.93251|0.93251	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|825;825	.|Q8IWU5-2;Q8IWU5	.|.;SULF2_HUMAN	R|Q	180|825;825;825;244;825	.|ENSP00000353007:R825Q;ENSP00000418290:R825Q;ENSP00000354662:R825Q;ENSP00000418442:R825Q	.|ENSP00000353007:R825Q	G|R	-|-	1|2	0|0	SULF2|SULF2	45723944|45723944	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.759000|5.759000	0.68785|0.68785	2.506000|2.506000	0.84524|0.84524	0.462000|0.462000	0.41574|0.41574	GGA|CGG		0.562	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
DYNC1H1	1778	broad.mit.edu	37	14	102461408	102461408	+	Missense_Mutation	SNP	C	C	T	rs587780331		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr14:102461408C>T	ENST00000360184.4	+	14	3583	c.3419C>T	c.(3418-3420)aCg>aTg	p.T1140M		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1140	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.T1140M(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCAAACATGACGGAATTCCAT	0.453																																					p.T1140M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3419T	14						.						116.0	105.0	109.0					14																	102461408		2203	4300	6503	101531161	SO:0001583	missense	1778	exon14			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.3419C>T	14.37:g.102461408C>T	ENSP00000348965:p.Thr1140Met		101531161	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	C	18.20	3.570587	0.65765	.	.	ENSG00000197102	ENST00000360184	T	0.77489	-1.1	5.84	5.84	0.93424	.	0.158283	0.56097	D	0.000021	T	0.68504	0.3008	L	0.36672	1.1	0.58432	D	0.999992	P	0.42556	0.783	B	0.30401	0.115	T	0.71530	-0.4565	10	0.46703	T	0.11	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	1140	Q14204	DYHC1_HUMAN	M	1140	ENSP00000348965:T1140M	ENSP00000348965:T1140M	T	+	2	0	DYNC1H1	101531161	1.000000	0.71417	0.966000	0.40874	0.979000	0.70002	4.877000	0.63086	2.763000	0.94921	0.557000	0.71058	ACG		0.453	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
KCNH5	27133	broad.mit.edu	37	14	63473091	63473091	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr14:63473091C>A	ENST00000322893.7	-	3	565	c.297G>T	c.(295-297)aaG>aaT	p.K99N	KCNH5_ENST00000420622.2_Missense_Mutation_p.K99N|KCNH5_ENST00000394964.2_Missense_Mutation_p.K41N|KCNH5_ENST00000394968.1_Missense_Mutation_p.K41N	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	99	PAC. {ECO:0000255|PROSITE- ProRule:PRU00141}.				potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.K99N(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TACTGTTTTTCTTGTACAGAA	0.338																																					p.K41N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G123T	14						.						87.0	85.0	86.0					14																	63473091		2202	4299	6501	62542844	SO:0001583	missense	27133	exon3			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.297G>T	14.37:g.63473091C>A	ENSP00000321427:p.Lys99Asn		62542844	NM_172376	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463220	0.63513	.	.	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.99652	-6.3;-6.3;-6.3;-6.3	5.35	2.26	0.28386	PAS-associated, C-terminal (1);PAS (1);PAS fold (1);	0.097389	0.64402	D	0.000001	D	0.99441	0.9802	M	0.86178	2.8	0.80722	D	1	P;D;D;D	0.57257	0.604;0.958;0.958;0.979	P;P;P;D	0.64410	0.524;0.682;0.682;0.925	D	0.99790	1.1031	10	0.87932	D	0	.	8.1947	0.31389	0.0:0.7192:0.0:0.2808	.	41;41;99;99	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	N	99;99;41;41	ENSP00000321427:K99N;ENSP00000395439:K99N;ENSP00000378419:K41N;ENSP00000378415:K41N	ENSP00000321427:K99N	K	-	3	2	KCNH5	62542844	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	0.596000	0.24044	0.197000	0.20387	0.655000	0.94253	AAG		0.338	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
KLC1	3831	broad.mit.edu	37	14	104136612	104136612	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr14:104136612C>T	ENST00000348520.6	+	7	1298	c.979C>T	c.(979-981)Cga>Tga	p.R327*	KLC1_ENST00000246489.7_Nonsense_Mutation_p.R327*|KLC1_ENST00000380038.3_Nonsense_Mutation_p.R327*|KLC1_ENST00000553286.1_Nonsense_Mutation_p.R327*|KLC1_ENST00000452929.2_Nonsense_Mutation_p.R327*|KLC1_ENST00000557450.1_Nonsense_Mutation_p.R327*|KLC1_ENST00000557575.1_Nonsense_Mutation_p.R327*|KLC1_ENST00000347839.6_Nonsense_Mutation_p.R327*|KLC1_ENST00000445352.4_Nonsense_Mutation_p.R325*|KLC1_ENST00000554280.1_Nonsense_Mutation_p.R327*|KLC1_ENST00000334553.6_Nonsense_Mutation_p.R327*|RP11-73M18.2_ENST00000472726.2_Nonsense_Mutation_p.R499*|KLC1_ENST00000555836.1_Nonsense_Mutation_p.R327*|KLC1_ENST00000389744.4_Nonsense_Mutation_p.R327*	NM_182923.3	NP_891553.2	Q07866	KLC1_HUMAN	kinesin light chain 1	327					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|stress granule disassembly (GO:0035617)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|growth cone (GO:0030426)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R327*(2)	KLC1/ALK(2)	NS(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	12		Melanoma(154;0.155)|all_epithelial(191;0.19)				TCTGGAAATCCGAGAAAAGGT	0.408																																					p.R327X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|NS(1)	c.C979T	14						.						77.0	86.0	83.0					14																	104136612		2203	4300	6503	103206365	SO:0001587	stop_gained	3831	exon7			AF267530	CCDS32165.1, CCDS41996.1, CCDS45168.1	14q32.3	2013-01-10	2007-03-09	2007-03-09	ENSG00000126214	ENSG00000126214		"""Tetratricopeptide (TTC) repeat domain containing"""	6387	protein-coding gene	gene with protein product		600025	"""kinesin 2 60/70kDa"", ""kinesin 2"""	KNS2		8274221, 11106729	Standard	NM_005552		Approved	KNS2A, KLC, hKLC1S, hKLC1N, hKLC1P, hKLC1G, hKLC1R, hKLC1J, hKLC1B	uc010tyf.2	Q07866	OTTHUMG00000169227	ENST00000348520.6:c.979C>T	14.37:g.104136612C>T	ENSP00000341154:p.Arg327*		103206365	NM_001130107	A6NF62|F8VTM4|Q7RTM2|Q7RTM3|Q7RTM5|Q7RTP9|Q7RTQ3|Q7RTQ5|Q7RTQ6|Q86SF5|Q86TF5|Q86V74|Q86V75|Q86V76|Q86V77|Q86V78|Q86V79|Q96H62	Nonsense_Mutation	SNP	ENST00000348520.6	37	CCDS41996.1	.	.	.	.	.	.	.	.	.	.	C	36	5.794577	0.96952	.	.	ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000256500	ENST00000348520;ENST00000443396;ENST00000380038;ENST00000389744;ENST00000557575;ENST00000553286;ENST00000347839;ENST00000555836;ENST00000334553;ENST00000246489;ENST00000557450;ENST00000554280;ENST00000452929;ENST00000445352;ENST00000472726	.	.	.	5.44	-6.85	0.01681	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.0588	23.2919	0.99981	0.2014:0.7986:0.0:0.0	.	.	.	.	X	327;327;327;327;327;327;327;327;327;327;327;327;327;325;499	.	ENSP00000246489:R327X	R	+	1	2	KLC1;RP11-73M18.2	103206365	0.040000	0.19996	0.794000	0.32065	0.731000	0.41821	-0.497000	0.06428	-1.409000	0.02038	-0.485000	0.04761	CGA		0.408	KLC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402947.2	NM_005552	
SIN3B	23309	broad.mit.edu	37	19	16973225	16973225	+	Missense_Mutation	SNP	C	C	T	rs369206489		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr19:16973225C>T	ENST00000248054.5	+	9	1142	c.1121C>T	c.(1120-1122)gCg>gTg	p.A374V	SIN3B_ENST00000595541.1_5'Flank|SIN3B_ENST00000379803.1_Missense_Mutation_p.A374V					SIN3 transcription regulator family member B									p.A374V(1)		endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						CTGTCCTTCGCGCCACCCATG	0.517																																					p.A374V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1121T	19						.	C	VAL/ALA	3,4403	6.2+/-15.9	0,3,2200	74.0	75.0	75.0		1121	4.6	0.2	19		75	0,8600		0,0,4300	no	missense	SIN3B	NM_015260.2	64	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	374/1163	16973225	3,13003	2203	4300	6503	16834225	SO:0001583	missense	23309	exon9			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.1121C>T	19.37:g.16973225C>T	ENSP00000248054:p.Ala374Val		16834225	NM_015260		Missense_Mutation	SNP	ENST00000248054.5	37		.	.	.	.	.	.	.	.	.	.	C	8.633	0.894193	0.17613	6.81E-4	0.0	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.46063	0.88;0.9	4.63	4.63	0.57726	.	0.166715	0.52532	D	0.000068	T	0.18467	0.0443	N	0.03608	-0.345	0.30721	N	0.748263	B;B	0.27286	0.174;0.024	B;B	0.22152	0.038;0.006	T	0.12192	-1.0557	10	0.13108	T	0.6	-4.7297	12.0059	0.53259	0.0:0.915:0.0:0.085	.	374;374	O75182-2;O75182	.;SIN3B_HUMAN	V	374	ENSP00000369131:A374V;ENSP00000248054:A374V	ENSP00000248054:A374V	A	+	2	0	SIN3B	16834225	0.477000	0.25909	0.248000	0.24265	0.187000	0.23431	1.451000	0.35145	2.121000	0.65114	0.561000	0.74099	GCG		0.517	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000462846.1	NM_015260	
KIAA1683	80726	broad.mit.edu	37	19	18377810	18377811	+	Missense_Mutation	DNP	GC	GC	AT	rs201565974		TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr19:18377810_18377811GC>AT	ENST00000600328.3	-	3	732_733	c.539_540GC>AT	c.(538-540)cGC>cAT	p.R180H	KIAA1683_ENST00000392413.4_Missense_Mutation_p.R180H|KIAA1683_ENST00000600359.3_Missense_Mutation_p.R134H			Q9H0B3	K1683_HUMAN	KIAA1683	180						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.R180>?(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GGGACAGAAGGCGGTTCTCTTC	0.604																																					.												.	.	1	Complex(1)	large_intestine(1)	c.539_540AT	19						.																																			18238811	SO:0001583	missense	80726	exon3			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.539_540delinsAT	19.37:g.18377810_18377811delinsAT	ENSP00000470780:p.Arg180His		18238810	NM_025249	B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	DNP	ENST00000600328.3	37	CCDS32958.1																																																																																				0.604	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466312.3		
CYP2F1	1572	broad.mit.edu	37	19	41633883	41633883	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T	T	T	T	T	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr19:41633883T>G	ENST00000331105.2	+	10	1444	c.1372T>G	c.(1372-1374)Tcg>Gcg	p.S458A		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	458					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						GCAGAGCTTTTCGCTGCAGCC	0.667																																					p.S458A												.	.	0			c.T1372G	19						.						17.0	19.0	18.0					19																	41633883		2201	4288	6489	46325723	SO:0001583	missense	1572	exon10			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.1372T>G	19.37:g.41633883T>G	ENSP00000333534:p.Ser458Ala		46325723	NM_000774	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	ENST00000331105.2	37	CCDS12572.1	.	.	.	.	.	.	.	.	.	.	t	8.340	0.828381	0.16749	.	.	ENSG00000197446	ENST00000331105	T	0.12879	2.64	3.1	-0.433	0.12287	.	0.222616	0.34178	U	0.004182	T	0.12050	0.0293	L	0.53780	1.695	0.09310	N	1	B	0.31125	0.309	B	0.31946	0.138	T	0.16158	-1.0412	10	0.52906	T	0.07	.	7.4368	0.27160	0.7184:0.0:0.0:0.2816	.	458	P24903	CP2F1_HUMAN	A	458	ENSP00000333534:S458A	ENSP00000333534:S458A	S	+	1	0	CYP2F1	46325723	0.029000	0.19370	0.929000	0.37066	0.226000	0.24999	0.275000	0.18698	0.045000	0.15804	0.076000	0.15429	TCG		0.667	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
HRC	3270	broad.mit.edu	37	19	49658072	49658072	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr19:49658072G>T	ENST00000252825.4	-	1	609	c.423C>A	c.(421-423)gaC>gaA	p.D141E	HRC_ENST00000595625.1_Missense_Mutation_p.D141E|TRPM4_ENST00000427978.2_5'Flank|TRPM4_ENST00000252826.5_5'Flank	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	141	4 X tandem repeats, acidic.|6 X approximate tandem repeats.				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.D141E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		AGTCTTCCGTGTCTTCACTCC	0.597																																					p.D141E	Melanoma(37;75 1097 24567 25669 30645)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C423A	19						.						181.0	131.0	148.0					19																	49658072		2203	4300	6503	54349884	SO:0001583	missense	3270	exon1				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.423C>A	19.37:g.49658072G>T	ENSP00000252825:p.Asp141Glu		54349884	NM_002152	Q504Y6	Missense_Mutation	SNP	ENST00000252825.4	37	CCDS12759.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.237427	0.22711	.	.	ENSG00000130528	ENST00000252825;ENST00000434964	T	0.06068	3.35	2.6	-5.2	0.02823	.	.	.	.	.	T	0.03477	0.0100	N	0.26130	0.795	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.41484	-0.9506	9	0.27082	T	0.32	-0.3231	3.3907	0.07287	0.6102:0.1271:0.1354:0.1272	.	141	P23327	SRCH_HUMAN	E	141;111	ENSP00000252825:D141E	ENSP00000252825:D141E	D	-	3	2	HRC	54349884	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.296000	0.02762	-1.880000	0.01125	0.462000	0.41574	GAC		0.597	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
MYH14	79784	broad.mit.edu	37	19	50764793	50764793	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr19:50764793G>A	ENST00000596571.1	+	18	2363	c.2363G>A	c.(2362-2364)cGg>cAg	p.R788Q	MYH14_ENST00000440075.2_Missense_Mutation_p.R829Q|MYH14_ENST00000262269.8_Missense_Mutation_p.R829Q|MYH14_ENST00000425460.1_Missense_Mutation_p.R796Q|MYH14_ENST00000376970.2_Missense_Mutation_p.R821Q|MYH14_ENST00000601313.1_Missense_Mutation_p.R829Q|MYH14_ENST00000598205.1_Missense_Mutation_p.R796Q			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	788	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R788Q(1)|p.R829Q(1)		central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ATCTTCTTCCGGGCTGGGGTC	0.642																																					p.R796Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2387A	19						.						37.0	42.0	40.0					19																	50764793		2063	4222	6285	55456605	SO:0001583	missense	79784	exon20			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.2363G>A	19.37:g.50764793G>A	ENSP00000472819:p.Arg788Gln		55456605	NM_001077186	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	33	5.209325	0.95069	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	4.48	4.48	0.54585	Myosin head, motor domain (2);	.	.	.	.	D	0.86556	0.5961	H	0.96111	3.77	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	P;P;P	0.57679	0.825;0.76;0.775	D	0.90828	0.4714	9	0.72032	D	0.01	.	15.0404	0.71785	0.0:0.0:1.0:0.0	.	829;788;796	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	Q	788;829;821;796;788;829	ENSP00000406273:R829Q;ENSP00000366169:R821Q;ENSP00000407879:R796Q;ENSP00000262269:R829Q	ENSP00000262269:R829Q	R	+	2	0	MYH14	55456605	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.327000	0.96396	2.508000	0.84585	0.555000	0.69702	CGG		0.642	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
CSMD1	64478	broad.mit.edu	37	8	2823354	2823354	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr8:2823354C>T	ENST00000520002.1	-	60	9781	c.9226G>A	c.(9226-9228)Gcc>Acc	p.A3076T	CSMD1_ENST00000537824.1_Missense_Mutation_p.A3075T|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Missense_Mutation_p.A3076T			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3076	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.A3075T(1)|p.A2804T(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGAATAGTGGCGGATGTGACT	0.473																																					p.R3075H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G9224A	8						.						64.0	75.0	72.0					8																	2823354		2061	4207	6268	2810761	SO:0001583	missense	64478	exon59					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9226G>A	8.37:g.2823354C>T	ENSP00000430733:p.Ala3076Thr		2810761	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.331|2.331	-0.353339|-0.353339	0.05173|0.05173	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000520002;ENST00000318252;ENST00000537824|ENST00000335551	T;T|.	0.65916|.	-0.18;-0.18|.	5.42|5.42	-10.8|-10.8	0.00216|0.00216	Complement control module (2);Sushi/SCR/CCP (3);|.	1.204620|.	0.05789|.	N|.	0.609964|.	T|T	0.17704|0.17704	0.0425|0.0425	L|L	0.28556|0.28556	0.865|0.865	0.09310|0.09310	N|N	1|1	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.13407|.	0.001;0.009|.	T|T	0.07121|0.07121	-1.0789|-1.0789	10|5	0.14252|.	T|.	0.57|.	.|.	3.0968|3.0968	0.06312|0.06312	0.563:0.0925:0.2293:0.1152|0.563:0.0925:0.2293:0.1152	.|.	3076;3076|.	E5RIG2;Q96PZ7|.	.;CSMD1_HUMAN|.	T|H	3076;2937;3075|2492	ENSP00000430733:A3076T;ENSP00000441462:A3075T|.	ENSP00000320445:A2937T|.	A|R	-|-	1|2	0|0	CSMD1|CSMD1	2810761|2810761	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.021000|-0.021000	0.12504|0.12504	-3.028000|-3.028000	0.00267|0.00267	-0.181000|-0.181000	0.13052|0.13052	GCC|CGC		0.473	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CRISPLD1	83690	broad.mit.edu	37	8	75928888	75928888	+	Silent	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr8:75928888G>A	ENST00000262207.4	+	7	1284	c.816G>A	c.(814-816)cgG>cgA	p.R272R	CRISPLD1_ENST00000523524.1_Silent_p.R84R|CRISPLD1_ENST00000517786.1_Silent_p.R86R	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	272					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.R272R(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CCCATGTCCGGACAAGATCAG	0.393																																					p.R272R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G816A	8						.						167.0	176.0	173.0					8																	75928888		2203	4300	6503	76091443	SO:0001819	synonymous_variant	83690	exon7			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.816G>A	8.37:g.75928888G>A			76091443	NM_031461	B2RA60|B7Z929	Silent	SNP	ENST00000262207.4	37	CCDS6219.1																																																																																				0.393	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
NIPAL2	79815	broad.mit.edu	37	8	99217377	99217377	+	Missense_Mutation	SNP	C	C	A	rs148824821		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr8:99217377C>A	ENST00000341166.3	-	7	1008	c.753G>T	c.(751-753)atG>atT	p.M251I	NIPAL2_ENST00000430223.2_Missense_Mutation_p.M251I|NIPAL2_ENST00000520545.1_5'UTR	NM_024759.1	NP_079035.1	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	251						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)	p.M251I(1)		cervix(3)|kidney(1)|large_intestine(2)|lung(5)|stomach(1)	12						TGATGATAAACATGATATAGA	0.378																																					p.M251I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G753T	8						.						101.0	97.0	98.0					8																	99217377		2203	4300	6503	99286553	SO:0001583	missense	79815	exon7			AK024017	CCDS6278.1	8q22.2	2009-03-24		2009-03-24	ENSG00000104361	ENSG00000104361			25854	protein-coding gene	gene with protein product				NPAL2		14702039	Standard	NM_024759		Approved	FLJ13955	uc003yil.1	Q9H841	OTTHUMG00000164668	ENST00000341166.3:c.753G>T	8.37:g.99217377C>A	ENSP00000339256:p.Met251Ile		99286553	NM_024759	A2RTY8	Missense_Mutation	SNP	ENST00000341166.3	37	CCDS6278.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049608	0.75846	.	.	ENSG00000104361	ENST00000430223;ENST00000341166	D;D	0.90069	-2.61;-2.61	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.91690	0.7373	M	0.82056	2.57	0.47547	D	0.999451	B;P	0.47191	0.1;0.891	B;P	0.48952	0.11;0.596	D	0.92923	0.6357	10	0.62326	D	0.03	-13.5324	15.5035	0.75719	0.0:1.0:0.0:0.0	.	251;251	A2RTY8;Q9H841	.;NPAL2_HUMAN	I	251	ENSP00000407087:M251I;ENSP00000339256:M251I	ENSP00000339256:M251I	M	-	3	0	NIPAL2	99286553	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.411000	0.80078	2.058000	0.61347	0.462000	0.41574	ATG		0.378	NIPAL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000379677.1	NM_024759	
ABRA	137735	broad.mit.edu	37	8	107782168	107782168	+	Missense_Mutation	SNP	C	C	T	rs140322632		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr8:107782168C>T	ENST00000311955.3	-	1	305	c.251G>A	c.(250-252)cGc>cAc	p.R84H		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.R84H(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TTCTGGCAGGCGGGGTGGCGA	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		18664	0.001		0.0	False		,,,				2504	0.0				p.R84H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G251A	8						.	C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	96.0	96.0	96.0		251	-10.2	0.0	8	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	missense	ABRA	NM_139166.4	29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	84/382	107782168	3,13003	2203	4300	6503	107851344	SO:0001583	missense	137735	exon1			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.251G>A	8.37:g.107782168C>T	ENSP00000311436:p.Arg84His		107851344	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	2.433	-0.330347	0.05314	4.54E-4	1.16E-4	ENSG00000174429	ENST00000311955	D	0.92858	-3.12	5.12	-10.2	0.00374	.	1.154450	0.06089	N	0.663379	T	0.74321	0.3701	N	0.08118	0	0.09310	N	1	P	0.44344	0.833	B	0.32289	0.143	T	0.76299	-0.3010	10	0.45353	T	0.12	.	5.6274	0.17490	0.1249:0.2087:0.0866:0.5798	.	84	Q8N0Z2	ABRA_HUMAN	H	84	ENSP00000311436:R84H	ENSP00000311436:R84H	R	-	2	0	ABRA	107851344	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.530000	0.06179	-3.777000	0.00108	-0.910000	0.02820	CGC		0.547	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
C1orf43	25912	broad.mit.edu	37	1	154184827	154184827	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3878-01	TCGA-AG-3878-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:154184827A>T	ENST00000368521.5	-	6	733	c.535T>A	c.(535-537)Tat>Aat	p.Y179N	C1orf43_ENST00000350592.3_Missense_Mutation_p.Y145N|C1orf43_ENST00000362076.4_Missense_Mutation_p.Y127N|C1orf43_ENST00000368518.1_Missense_Mutation_p.Y179N|C1orf43_ENST00000368516.1_Missense_Mutation_p.Y145N|C1orf43_ENST00000368519.1_Missense_Mutation_p.Y161N	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	179						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)	p.Y145N(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					GCCTCCTGATAGCGTAGGTAC	0.522																																					p.Y145N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T433A	1						.						150.0	143.0	145.0					1																	154184827		2203	4300	6503	152451451	SO:0001583	missense	25912	exon5			AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.535T>A	1.37:g.154184827A>T	ENSP00000357507:p.Tyr179Asn		152451451	NM_015449	A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Missense_Mutation	SNP	ENST00000368521.5	37	CCDS41404.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.974469	0.74246	.	.	ENSG00000143612	ENST00000350592;ENST00000368521;ENST00000362076;ENST00000368519;ENST00000368518;ENST00000368516	.	.	.	5.39	5.39	0.77823	Dehydrogenase, multihelical (1);	0.057471	0.64402	D	0.000001	T	0.73377	0.3579	M	0.76838	2.35	0.80722	D	1	P;D;P;P	0.60575	0.919;0.988;0.904;0.934	P;D;B;P	0.65773	0.504;0.938;0.364;0.637	T	0.78094	-0.2338	9	0.87932	D	0	-27.3306	14.7453	0.69485	1.0:0.0:0.0:0.0	.	145;179;127;145	Q9BWL3-2;Q9BWL3;Q9BWL3-4;Q09GN0	.;CA043_HUMAN;.;.	N	145;179;127;161;179;145	.	ENSP00000271925:Y145N	Y	-	1	0	C1orf43	152451451	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.091000	0.76923	2.270000	0.75569	0.477000	0.44152	TAT		0.522	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087664.2	NM_015449	
UBR4	23352	broad.mit.edu	37	1	19499450	19499450	+	Silent	SNP	A	A	T			TCGA-AG-3878-01	TCGA-AG-3878-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:19499450A>T	ENST00000375254.3	-	25	3456	c.3429T>A	c.(3427-3429)gcT>gcA	p.A1143A	UBR4_ENST00000375267.2_Silent_p.A1143A|UBR4_ENST00000375217.2_Silent_p.A1143A|UBR4_ENST00000375226.2_Silent_p.A1143A	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1143					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A1143A(1)		breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAGTCTCAGCAGCCATCTTAG	0.498																																					p.A1143A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T3429A	1						.						89.0	83.0	85.0					1																	19499450		2203	4300	6503	19372037	SO:0001819	synonymous_variant	23352	exon25			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3429T>A	1.37:g.19499450A>T			19372037	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	37	CCDS189.1																																																																																				0.498	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
USP48	84196	broad.mit.edu	37	1	22021580	22021580	+	Silent	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:22021580C>T	ENST00000308271.9	-	23	3510	c.2862G>A	c.(2860-2862)acG>acA	p.T954T	USP48_ENST00000529637.1_Silent_p.T966T|USP48_ENST00000400301.1_Intron|USP48_ENST00000374732.3_Intron	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	954	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.T954T(1)		NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATTCTTTTAACGTCTGATTAG	0.368																																					p.T954T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2862A	1						.						114.0	112.0	113.0					1																	22021580		2203	4299	6502	21894167	SO:0001819	synonymous_variant	84196	exon23			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2862G>A	1.37:g.22021580C>T			21894167	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000308271.9	37	CCDS30623.1																																																																																				0.368	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
HMCN1	83872	broad.mit.edu	37	1	186092153	186092153	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:186092153T>G	ENST00000271588.4	+	81	12529	c.12300T>G	c.(12298-12300)tgT>tgG	p.C4100W	HMCN1_ENST00000367492.2_Missense_Mutation_p.C4100W	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4100	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C4100W(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CGTTATCCTGTGAAGCAGATG	0.458																																					p.C4100W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T12300G	1						.						114.0	93.0	100.0					1																	186092153		2203	4300	6503	184358776	SO:0001583	missense	83872	exon81			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12300T>G	1.37:g.186092153T>G	ENSP00000271588:p.Cys4100Trp		184358776	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.861640	0.32884	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.85484	-1.99;-1.99	5.85	0.931	0.19460	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94922	0.8358	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93543	0.6879	10	0.72032	D	0.01	.	10.757	0.46243	0.0:0.4004:0.0:0.5996	.	4100	Q96RW7	HMCN1_HUMAN	W	4100	ENSP00000271588:C4100W;ENSP00000356462:C4100W	ENSP00000271588:C4100W	C	+	3	2	HMCN1	184358776	1.000000	0.71417	0.310000	0.25168	0.001000	0.01503	1.332000	0.33805	-0.079000	0.12707	-0.256000	0.11100	TGT		0.458	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
ARID1A	8289	broad.mit.edu	37	1	27087880	27087880	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:27087880C>T	ENST00000324856.7	+	6	2538	c.2167C>T	c.(2167-2169)Cag>Tag	p.Q723*	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q340*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q723*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	723					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q723*(2)|p.N722fs*18(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGCAGGCAACCAGATGCCACC	0.498			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q723X			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	3	Substitution - Nonsense(2)|Deletion - Frameshift(1)	ovary(1)|large_intestine(1)|breast(1)	c.C2167T	1						.						78.0	73.0	75.0					1																	27087880		2203	4300	6503	26960467	SO:0001587	stop_gained	8289	exon6			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2167C>T	1.37:g.27087880C>T	ENSP00000320485:p.Gln723*		26960467	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	39	7.398777	0.98258	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.33	5.33	0.75918	.	0.247263	0.42294	D	0.000725	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-6.6748	19.2079	0.93742	0.0:1.0:0.0:0.0	.	.	.	.	X	723;723;340	.	ENSP00000320485:Q723X	Q	+	1	0	ARID1A	26960467	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.586000	0.67503	2.768000	0.95171	0.655000	0.94253	CAG		0.498	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
TRNAU1AP	54952	broad.mit.edu	37	1	28887240	28887240	+	Missense_Mutation	SNP	C	C	A	rs370368589		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:28887240C>A	ENST00000373830.3	+	3	247	c.221C>A	c.(220-222)aCa>aAa	p.T74K	TRNAU1AP_ENST00000495995.1_3'UTR	NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1	74	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T74K(1)		breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						CCAGGAGCCACACCTGTAAGG	0.388																																					p.T74K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C221A	1						.						61.0	59.0	60.0					1																	28887240		2203	4300	6503	28759827	SO:0001583	missense	54952	exon3				CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653	ENST00000373830.3:c.221C>A	1.37:g.28887240C>A	ENSP00000362936:p.Thr74Lys		28759827	NM_017846	Q86SU7	Missense_Mutation	SNP	ENST00000373830.3	37	CCDS324.1	.	.	.	.	.	.	.	.	.	.	c	15.02	2.709305	0.48517	.	.	ENSG00000180098	ENST00000373830	T	0.05513	3.43	5.46	4.53	0.55603	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.209732	0.48767	D	0.000169	T	0.12817	0.0311	L	0.31207	0.915	0.43408	D	0.99554	D	0.64830	0.994	P	0.61592	0.891	T	0.03068	-1.1076	10	0.51188	T	0.08	.	13.1987	0.59754	0.0:0.8396:0.1604:0.0	.	74	Q9NX07	TSAP1_HUMAN	K	74	ENSP00000362936:T74K	ENSP00000362936:T74K	T	+	2	0	TRNAU1AP	28759827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.030000	0.49720	1.277000	0.44412	0.552000	0.68991	ACA		0.388	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010346.1	NM_017846	
PABPC4	8761	broad.mit.edu	37	1	40034517	40034517	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:40034517C>T	ENST00000372857.3	-	6	1625	c.833G>A	c.(832-834)cGg>cAg	p.R278Q	SNORA55_ENST00000364587.1_RNA|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000529216.1_5'Flank|PABPC4_ENST00000372862.3_Missense_Mutation_p.R278Q|PABPC4_ENST00000372856.3_Missense_Mutation_p.R278Q|PABPC4_ENST00000372858.3_Missense_Mutation_p.R278Q	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	278					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)	p.R278Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TTCAAATTTCCGTTTTAACTC	0.413																																					p.R278Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G833A	1						.						225.0	207.0	213.0					1																	40034517		2203	4300	6503	39807104	SO:0001583	missense	8761	exon6			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.833G>A	1.37:g.40034517C>T	ENSP00000361948:p.Arg278Gln		39807104	NM_001135653	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	ENST00000372857.3	37	CCDS438.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.279888|6.279888	0.97440|0.97440	.|.	.|.	ENSG00000090621|ENSG00000090621	ENST00000421687;ENST00000527718;ENST00000474378|ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856	.|T;T;T;T	.|0.06142	.|3.34;3.34;3.34;3.34	6.04|6.04	6.04|6.04	0.98038|0.98038	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.21468|0.21468	0.0517|0.0517	M|M	0.64630|0.64630	1.985|1.985	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P;P	.|0.69078	.|0.997;0.942;0.922	.|P;B;B	.|0.58172	.|0.834;0.328;0.409	T|T	0.00004|0.00004	-1.2562|-1.2562	5|10	.|0.62326	.|D	.|0.03	.|.	20.5948|20.5948	0.99439|0.99439	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|278;278;278	.|Q13310;Q13310-2;Q4VC03	.|PABP4_HUMAN;.;.	R|Q	180;5;191|278	.|ENSP00000361953:R278Q;ENSP00000361949:R278Q;ENSP00000361948:R278Q;ENSP00000361947:R278Q	.|ENSP00000361947:R278Q	G|R	-|-	1|2	0|0	PABPC4|PABPC4	39807104|39807104	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.818000|7.818000	0.86416|0.86416	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GGA|CGG		0.413	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025220.1	NM_001135653	
OR14C36	127066	broad.mit.edu	37	1	248512497	248512497	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr1:248512497C>T	ENST00000317861.1	+	1	421	c.421C>T	c.(421-423)Cag>Tag	p.Q141*		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	141			Q -> R (in dbSNP:rs28448343).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q141*(1)		central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						AATCTGCATCCAGATGACACT	0.522																																					p.Q141X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C421T	1						.						107.0	93.0	98.0					1																	248512497		2203	4300	6503	246579120	SO:0001587	stop_gained	127066	exon1			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.421C>T	1.37:g.248512497C>T	ENSP00000324534:p.Gln141*		246579120	NM_001001918	Q6IEZ6	Nonsense_Mutation	SNP	ENST00000317861.1	37	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313507	0.40996	.	.	ENSG00000177174	ENST00000317861	.	.	.	4.05	3.14	0.36123	.	0.581781	0.14757	N	0.300211	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	3.7756	0.08659	0.2463:0.5513:0.0:0.2024	.	.	.	.	X	141	.	ENSP00000324534:Q141X	Q	+	1	0	OR14C36	246579120	0.000000	0.05858	0.001000	0.08648	0.399000	0.30720	-0.403000	0.07214	0.947000	0.37659	-0.531000	0.04308	CAG		0.522	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
MS4A14	84689	broad.mit.edu	37	11	60183412	60183412	+	Missense_Mutation	SNP	C	C	A	rs139364741	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr11:60183412C>A	ENST00000300187.6	+	5	1248	c.971C>A	c.(970-972)gCt>gAt	p.A324D	MS4A14_ENST00000531787.1_Missense_Mutation_p.A212D|MS4A14_ENST00000531783.1_Missense_Mutation_p.A357D|MS4A14_ENST00000395005.2_Missense_Mutation_p.A307D|MS4A14_ENST00000395001.1_3'UTR	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	324						integral component of membrane (GO:0016021)		p.A324D(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						CCATCCCAAGCTCTACCAGTA	0.468																																					p.A324D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C971A	11						.						102.0	94.0	97.0					11																	60183412		2203	4300	6503	59939988	SO:0001583	missense	84689	exon5			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.971C>A	11.37:g.60183412C>A	ENSP00000300187:p.Ala324Asp		59939988	NM_032597	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000300187.6	37	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.281727	0.40394	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.33216	1.42;2.64;1.43;3.01	3.74	-0.28	0.12886	.	4.640210	0.00465	N	0.000117	T	0.37919	0.1021	L	0.27053	0.805	0.09310	N	1	D;D	0.65815	0.995;0.991	D;P	0.63877	0.919;0.831	T	0.19418	-1.0306	10	0.66056	D	0.02	-0.7115	3.6017	0.08027	0.0:0.4773:0.1912:0.3315	.	307;324	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	D	212;324;307;357	ENSP00000437222:A212D;ENSP00000300187:A324D;ENSP00000378453:A307D;ENSP00000433761:A357D	ENSP00000300187:A324D	A	+	2	0	MS4A14	59939988	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.274000	0.08537	-0.042000	0.13535	-0.182000	0.12963	GCT		0.468	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
TMEM216	51259	broad.mit.edu	37	11	61161436	61161436	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr11:61161436C>A	ENST00000515837.2	+	3	1162	c.217C>A	c.(217-219)Cgc>Agc	p.R73S	TMEM216_ENST00000398979.3_Missense_Mutation_p.R12S|TMEM216_ENST00000334888.5_Missense_Mutation_p.R73S			Q9P0N5	TM216_HUMAN	transmembrane protein 216	73			R -> C (in JBTS2). {ECO:0000269|PubMed:20512146, ECO:0000269|PubMed:22282472}.|R -> H (in JBTS2 and MKS2). {ECO:0000269|PubMed:20512146, ECO:0000269|PubMed:22282472}.|R -> L (in JBTS2). {ECO:0000269|PubMed:20036350, ECO:0000269|PubMed:20512146, ECO:0000269|PubMed:22282472}.		cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)		p.R73S(1)		endometrium(1)|large_intestine(2)|lung(1)|prostate(2)	6						TGAAGTAATTCGCCTGTTTTT	0.403																																					p.R12S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C34A	11						.						204.0	198.0	200.0					11																	61161436		1928	4130	6058	60918012	SO:0001583	missense	51259	exon3				CCDS53640.1	11q13.1	2014-09-17			ENSG00000187049	ENSG00000187049			25018	protein-coding gene	gene with protein product		613277	"""cerebello-oculo-renal syndrome 2"", ""Meckel syndrome, type 2"""	CORS2, MKS2		11042152, 20036350, 20512146	Standard	NM_016499		Approved	MGC13379, HSPC244, JBTS2	uc021qkf.1	Q9P0N5		ENST00000515837.2:c.217C>A	11.37:g.61161436C>A	ENSP00000440638:p.Arg73Ser		60918012	NM_016499	A8MZ23|B7Z8N1	Missense_Mutation	SNP	ENST00000515837.2	37	CCDS53640.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985216	0.74474	.	.	ENSG00000187049	ENST00000515837;ENST00000334888;ENST00000398979	D;D;D	0.94184	-3.37;-3.37;-3.37	5.95	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.96380	0.8819	M	0.86864	2.845	0.51767	D	0.999939	D;P	0.67145	0.996;0.924	D;P	0.66602	0.945;0.593	D	0.96215	0.9156	10	0.87932	D	0	-7.3836	11.5558	0.50748	0.2579:0.7421:0.0:0.0	.	66;12	Q9P0N5;Q9P0N5-2	TM216_HUMAN;.	S	73;73;12	ENSP00000440638:R73S;ENSP00000334844:R73S;ENSP00000381950:R12S	ENSP00000334844:R73S	R	+	1	0	TMEM216	60918012	0.579000	0.26725	0.185000	0.23176	0.881000	0.50899	0.878000	0.28126	2.824000	0.97209	0.655000	0.94253	CGC		0.403	TMEM216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000398430.1	NM_016499	
NTM	50863	broad.mit.edu	37	11	132177693	132177693	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr11:132177693C>T	ENST00000374786.1	+	4	1116	c.637C>T	c.(637-639)Cgg>Tgg	p.R213W	NTM_ENST00000427481.2_Missense_Mutation_p.R204W|NTM_ENST00000539799.1_Missense_Mutation_p.R213W|NTM_ENST00000425719.2_Missense_Mutation_p.R213W|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374784.1_Missense_Mutation_p.R213W|NTM_ENST00000374791.3_Missense_Mutation_p.R213W	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	213	Ig-like C2-type 2.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.R213W(2)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GCCCGTGGTACGGAGAGTAAA	0.582																																					p.R213W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C637T	11						.						83.0	72.0	76.0					11																	132177693		2201	4297	6498	131682903	SO:0001583	missense	50863	exon4			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.637C>T	11.37:g.132177693C>T	ENSP00000363918:p.Arg213Trp		131682903	NM_001144058	A0MTT2|Q6UXJ3|Q86VJ9	De_novo_Start_OutOfFrame	SNP	ENST00000374786.1	37	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547537	0.65311	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.78	4.82	0.62117	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.046634	0.85682	D	0.000000	D	0.82852	0.5127	M	0.82433	2.59	0.49582	D	0.999802	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.81914	0.995;0.995;0.995;0.993;0.988;0.988	D	0.85003	0.0901	10	0.87932	D	0	-20.1674	16.8142	0.85729	0.1289:0.8711:0.0:0.0	.	213;204;213;213;213;213	B7Z1Z5;B7Z1I4;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;NTRI_HUMAN;.;.	W	213;213;204;213;213;213	ENSP00000363923:R213W;ENSP00000437668:R213W;ENSP00000416320:R204W;ENSP00000363918:R213W;ENSP00000396722:R213W;ENSP00000363916:R213W	ENSP00000363916:R213W	R	+	1	2	NTM	131682903	0.991000	0.36638	0.969000	0.41365	0.207000	0.24258	2.989000	0.49393	2.894000	0.99253	0.591000	0.81541	CGG		0.582	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
PGBD1	84547	broad.mit.edu	37	6	28269508	28269508	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr6:28269508T>G	ENST00000405948.2	+	7	2297	c.1877T>G	c.(1876-1878)tTt>tGt	p.F626C	PGBD1_ENST00000259883.3_Missense_Mutation_p.F626C	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	626						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F626C(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						CACCTGTGTTTTGATAGCTTC	0.433																																					p.F626C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1877G	6						.						151.0	148.0	149.0					6																	28269508		2203	4300	6503	28377487	SO:0001583	missense	84547	exon7			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1877T>G	6.37:g.28269508T>G	ENSP00000385213:p.Phe626Cys		28377487	NM_001184743	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	ENST00000405948.2	37	CCDS4648.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.879874	0.51801	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.19669	2.13;2.13	4.66	4.66	0.58398	.	0.000000	0.37761	N	0.001945	T	0.31575	0.0801	M	0.73962	2.25	0.33197	D	0.551638	D	0.56035	0.974	D	0.67548	0.952	T	0.19484	-1.0304	10	0.54805	T	0.06	-15.7673	10.6791	0.45804	0.0:0.0:0.0:1.0	.	626	Q96JS3	PGBD1_HUMAN	C	626	ENSP00000385213:F626C;ENSP00000259883:F626C	ENSP00000259883:F626C	F	+	2	0	PGBD1	28377487	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.339000	0.59322	2.087000	0.62958	0.533000	0.62120	TTT		0.433	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040188.2		
PTK7	5754	broad.mit.edu	37	6	43111358	43111358	+	Splice_Site	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr6:43111358G>A	ENST00000230419.4	+	14	2472	c.2251G>A	c.(2251-2253)Ggt>Agt	p.G751S	PTK7_ENST00000349241.2_Splice_Site_p.G621S|PTK7_ENST00000352931.2_Splice_Site_p.G695S|PTK7_ENST00000481273.1_Splice_Site_p.G759S|PTK7_ENST00000345201.2_Splice_Site_p.G711S	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	751					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G751S(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			ATGCCTCAACGGTGAGGGGCC	0.682											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G711S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2131A	6						.						21.0	20.0	20.0					6																	43111358		2203	4300	6503	43219336	SO:0001630	splice_region_variant	5754	exon13			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2251+1G>A	6.37:g.43111358G>A		913	43219336	NM_152880	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	ENST00000230419.4	37	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	G	35	5.544043	0.96488	.	.	ENSG00000112655	ENST00000230419;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273	T;T;T;T;T	0.73897	-0.69;-0.79;-0.66;-0.71;-0.71	5.51	5.51	0.81932	.	0.051101	0.85682	D	0.000000	D	0.82692	0.5092	M	0.70595	2.14	0.80722	D	1	P;D;D;D;D	0.89917	0.883;0.984;1.0;0.992;1.0	B;P;D;P;D	0.76575	0.195;0.864;0.988;0.864;0.984	T	0.83146	-0.0106	10	0.52906	T	0.07	.	16.607	0.84832	0.0:0.0:1.0:0.0	.	759;621;711;695;751	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308	.;.;.;.;PTK7_HUMAN	S	751;621;695;711;759	ENSP00000230419:G751S;ENSP00000325462:G621S;ENSP00000326029:G695S;ENSP00000325992:G711S;ENSP00000418754:G759S	ENSP00000230418:G751S	G	+	1	0	PTK7	43219336	1.000000	0.71417	0.991000	0.47740	0.808000	0.45660	9.317000	0.96327	2.593000	0.87608	0.655000	0.94253	GGT		0.682	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		Missense_Mutation
UTRN	7402	broad.mit.edu	37	6	144780475	144780475	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr6:144780475C>G	ENST00000367545.3	+	20	2692	c.2692C>G	c.(2692-2694)Caa>Gaa	p.Q898E		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	898	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.Q898E(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GGATCGTCAACAACATCTAGA	0.453																																					p.Q898E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2692G	6						.						68.0	67.0	67.0					6																	144780475		2203	4300	6503	144822168	SO:0001583	missense	7402	exon20			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2692C>G	6.37:g.144780475C>G	ENSP00000356515:p.Gln898Glu		144822168	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	4.939	0.174366	0.09391	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.34472	1.36	5.44	1.16	0.20824	.	0.448236	0.18750	N	0.132209	T	0.11836	0.0288	L	0.32530	0.975	0.25797	N	0.984556	B	0.24882	0.113	B	0.20767	0.031	T	0.23583	-1.0184	10	0.62326	D	0.03	.	11.4709	0.50268	0.4481:0.4424:0.1096:0.0	.	898	P46939	UTRO_HUMAN	E	898	ENSP00000356515:Q898E	ENSP00000356499:Q898E	Q	+	1	0	UTRN	144822168	0.100000	0.21855	0.014000	0.15608	0.010000	0.07245	0.480000	0.22244	0.291000	0.22468	-0.188000	0.12872	CAA		0.453	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
HSPA13	6782	broad.mit.edu	37	21	15750652	15750652	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr21:15750652G>A	ENST00000285667.3	-	3	515	c.448C>T	c.(448-450)Cga>Tga	p.R150*	HSPA13_ENST00000544452.1_Intron|HSPA13_ENST00000478035.1_5'Flank	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	150						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)	p.R150*(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						AACAATAGTCGAGAGCCAACA	0.393																																					p.R150X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C448T	21						.						99.0	89.0	93.0					21																	15750652		2203	4300	6503	14672523	SO:0001587	stop_gained	6782	exon3				CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.448C>T	21.37:g.15750652G>A	ENSP00000285667:p.Arg150*		14672523	NM_006948	B2R616|Q8NE40	Nonsense_Mutation	SNP	ENST00000285667.3	37	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881422	0.91740	.	.	ENSG00000155304	ENST00000285667	.	.	.	5.88	4.94	0.65067	.	0.111621	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-15.6822	13.9143	0.63887	0.0:0.0:0.6495:0.3505	.	.	.	.	X	150	.	ENSP00000285667:R150X	R	-	1	2	HSPA13	14672523	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.218000	0.51192	1.337000	0.45525	0.655000	0.94253	CGA		0.393	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
TIAM1	7074	broad.mit.edu	37	21	32502559	32502559	+	Silent	SNP	C	C	T	rs145341566		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr21:32502559C>T	ENST00000286827.3	-	26	4488	c.4017G>A	c.(4015-4017)gcG>gcA	p.A1339A	TIAM1_ENST00000541036.1_Silent_p.A1279A	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1339	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.		A -> V (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1339A(5)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GAACCTGCAGCGCTTCCGTGG	0.488																																					p.A1339A												TIAM1,large_intestine,rectum,Substitution - Missense,-1	.	5	Substitution - coding silent(5)	large_intestine(4)|breast(1)	c.G4017A	21						.	C		0,4406		0,0,2203	180.0	178.0	179.0		4017	-10.5	0.4	21	dbSNP_134	179	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TIAM1	NM_003253.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1339/1592	32502559	1,13005	2203	4300	6503	31424430	SO:0001819	synonymous_variant	7074	exon26				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.4017G>A	21.37:g.32502559C>T			31424430	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																				0.488	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
HLCS	3141	broad.mit.edu	37	21	38269293	38269293	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr21:38269293C>T	ENST00000399120.1	-	7	2548	c.1318G>A	c.(1318-1320)Gtg>Atg	p.V440M	HLCS_ENST00000336648.4_Missense_Mutation_p.V440M|HLCS_ENST00000482273.1_5'UTR	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	440					biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)	p.V440M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	ATGTTGGTCACCACAGGTATA	0.438																																					p.V440M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1318A	21						.						112.0	103.0	106.0					21																	38269293		2203	4300	6503	37191163	SO:0001583	missense	3141	exon7				CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1318G>A	21.37:g.38269293C>T	ENSP00000382071:p.Val440Met		37191163	NM_000411	B2RAH1|D3DSG6|Q99451	Missense_Mutation	SNP	ENST00000399120.1	37	CCDS13647.1	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647433	0.29246	.	.	ENSG00000159267	ENST00000399120;ENST00000336648	D;D	0.98329	-4.87;-4.87	5.12	0.129	0.14739	.	0.503651	0.21429	N	0.074698	D	0.96993	0.9018	M	0.72118	2.19	0.41747	D	0.989645	P	0.52170	0.951	P	0.50537	0.643	D	0.93469	0.6817	10	0.34782	T	0.22	.	5.5661	0.17170	0.1248:0.4675:0.0:0.4077	.	440	P50747	BPL1_HUMAN	M	440	ENSP00000382071:V440M;ENSP00000338387:V440M	ENSP00000338387:V440M	V	-	1	0	HLCS	37191163	0.515000	0.26210	0.048000	0.18961	0.055000	0.15305	-0.038000	0.12144	-0.183000	0.10585	-0.251000	0.11542	GTG		0.438	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
PHKG2	5261	broad.mit.edu	37	16	30762584	30762584	+	Missense_Mutation	SNP	G	G	A	rs535265672		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr16:30762584G>A	ENST00000563588.1	+	3	492	c.253G>A	c.(253-255)Gcc>Acc	p.A85T	PHKG2_ENST00000328273.7_Missense_Mutation_p.A85T|PHKG2_ENST00000424889.3_Missense_Mutation_p.A85T|RP11-2C24.4_ENST00000483578.1_lincRNA	NM_000294.2	NP_000285.1	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	85	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|positive regulation of glycogen catabolic process (GO:0045819)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.A85T(1)		ovary(1)|skin(1)	2			Colorectal(24;0.198)			TCGCCAGGTCGCCGGCCACCC	0.622													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18015	0.0		0.0	False		,,,				2504	0.0				p.A85T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G253A	16						.						69.0	69.0	69.0					16																	30762584		2197	4300	6497	30670085	SO:0001583	missense	5261	exon3			S73483, M31606	CCDS10690.1, CCDS54002.1	16p11.2	2008-02-05			ENSG00000156873	ENSG00000156873			8931	protein-coding gene	gene with protein product		172471				2915644, 8020963	Standard	NM_000294		Approved		uc021tgo.1	P15735	OTTHUMG00000132400	ENST00000563588.1:c.253G>A	16.37:g.30762584G>A	ENSP00000455607:p.Ala85Thr		30670085	NM_001172432	A8K0C7|B4DEB7|E9PEU3|P11800	Missense_Mutation	SNP	ENST00000563588.1	37	CCDS10690.1	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249464	0.59212	.	.	ENSG00000156873	ENST00000328273;ENST00000424889	T;T	0.71579	-0.12;-0.58	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44285	D	0.000471	T	0.59459	0.2195	N	0.21448	0.665	0.38093	D	0.937014	D;P;P	0.59767	0.986;0.556;0.647	P;B;B	0.48738	0.588;0.175;0.075	T	0.57516	-0.7798	10	0.17369	T	0.5	-11.0908	10.5423	0.45039	0.0:0.0:0.6978:0.3022	.	77;85;85	Q16221;P15735;P15735-2	.;PHKG2_HUMAN;.	T	85	ENSP00000329968:A85T;ENSP00000388571:A85T	ENSP00000329968:A85T	A	+	1	0	PHKG2	30670085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.068000	0.41471	2.514000	0.84764	0.655000	0.94253	GCC		0.622	PHKG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255531.2	NM_000294	
ZFHX3	463	broad.mit.edu	37	16	72831260	72831260	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr16:72831260G>T	ENST00000268489.5	-	9	5993	c.5321C>A	c.(5320-5322)cCc>cAc	p.P1774H	ZFHX3_ENST00000397992.5_Missense_Mutation_p.P860H	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	1774					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.P1774H(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AAGGAGGGTGGGGTTAAACAG	0.577																																					p.P1774H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5321A	16						.						91.0	93.0	92.0					16																	72831260		2198	4300	6498	71388761	SO:0001583	missense	463	exon9			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.5321C>A	16.37:g.72831260G>T	ENSP00000268489:p.Pro1774His		71388761	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554492	0.27739	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	D;D	0.92099	-2.97;-2.85	6.17	5.22	0.72569	.	0.000000	0.49916	D	0.000134	D	0.94338	0.8180	L	0.49778	1.585	0.80722	D	1	D	0.89917	1.0	D	0.67231	0.95	D	0.94932	0.8083	10	0.87932	D	0	.	15.565	0.76284	0.0655:0.0:0.9345:0.0	.	1774	Q15911	ZFHX3_HUMAN	H	1774;860	ENSP00000268489:P1774H;ENSP00000438926:P860H	ENSP00000268489:P1774H	P	-	2	0	ZFHX3	71388761	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	9.858000	0.99539	1.636000	0.50526	-0.136000	0.14681	CCC		0.577	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
TLDC1	57707	broad.mit.edu	37	16	84529306	84529306	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr16:84529306C>A	ENST00000343629.6	-	3	549	c.367G>T	c.(367-369)Gcc>Tcc	p.A123S	RP11-517C16.4_ENST00000568771.1_RNA|TLDC1_ENST00000561807.1_5'UTR|TLDC1_ENST00000535580.1_Missense_Mutation_p.A96S	NM_020947.3	NP_065998.3	Q6P9B6	TLDC1_HUMAN	TBC/LysM-associated domain containing 1	123						lysosomal membrane (GO:0005765)		p.A123S(1)									ACTTCTCTGGCCTTCACGGGA	0.532																																					p.A123S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G367T	16						.						95.0	91.0	93.0					16																	84529306		2200	4300	6500	83086807	SO:0001583	missense	57707	exon3			AB046829	CCDS32498.1	16q24.1	2013-03-14	2013-03-14	2013-03-14	ENSG00000140950	ENSG00000140950			29325	protein-coding gene	gene with protein product	"""TLD domain containing 1"""		"""KIAA1609"""	KIAA1609		10997877	Standard	NM_020947		Approved		uc002fib.3	Q6P9B6	OTTHUMG00000176739	ENST00000343629.6:c.367G>T	16.37:g.84529306C>A	ENSP00000343635:p.Ala123Ser		83086807	NM_020947	Q8IZ64|Q9HCG3|Q9NTE8	Missense_Mutation	SNP	ENST00000343629.6	37	CCDS32498.1	.	.	.	.	.	.	.	.	.	.	C	4.413	0.076422	0.08485	.	.	ENSG00000140950	ENST00000343629;ENST00000535580	T;T	0.15487	2.42;2.42	4.46	3.5	0.40072	.	0.692235	0.14112	N	0.340675	T	0.16642	0.0400	M	0.63428	1.95	0.09310	N	1	P;B	0.34587	0.458;0.083	B;B	0.31869	0.137;0.02	T	0.13818	-1.0495	10	0.18276	T	0.48	-11.456	9.7275	0.40342	0.0:0.8987:0.0:0.1013	.	96;123	F5GWS3;Q6P9B6	.;K1609_HUMAN	S	123;96	ENSP00000343635:A123S;ENSP00000441997:A96S	ENSP00000343635:A123S	A	-	1	0	KIAA1609	83086807	0.456000	0.25744	0.021000	0.16686	0.064000	0.16182	3.104000	0.50306	1.141000	0.42275	0.563000	0.77884	GCC		0.532	TLDC1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433421.1	NM_020947	
MOCOS	55034	broad.mit.edu	37	18	33780275	33780275	+	Missense_Mutation	SNP	C	C	T	rs77940522	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr18:33780275C>T	ENST00000261326.5	+	4	950	c.929C>T	c.(928-930)tCg>tTg	p.S310L		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase									p.S310L(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CCGAGGCAGTCGGTAGCTCAG	0.567													C|||	2	0.000399361	0.0	0.0	5008	,	,		19961	0.002		0.0	False		,,,				2504	0.0				p.S310L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C929T	18						.						39.0	36.0	37.0					18																	33780275		2203	4300	6503	32034273	SO:0001583	missense	55034	exon4			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.929C>T	18.37:g.33780275C>T	ENSP00000261326:p.Ser310Leu		32034273	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.50	1.367718	0.24771	.	.	ENSG00000075643	ENST00000261326	D	0.87029	-2.2	5.34	5.34	0.76211	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.312643	0.34959	N	0.003557	D	0.87943	0.6305	M	0.80746	2.51	0.09310	N	1	P	0.39116	0.66	B	0.38428	0.273	T	0.82440	-0.0456	10	0.37606	T	0.19	-1.9638	16.5317	0.84362	0.0:1.0:0.0:0.0	.	310	Q96EN8	MOCOS_HUMAN	L	310	ENSP00000261326:S310L	ENSP00000261326:S310L	S	+	2	0	MOCOS	32034273	0.843000	0.29541	0.302000	0.25058	0.023000	0.10783	4.093000	0.57714	2.509000	0.84616	0.561000	0.74099	TCG		0.567	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
POLI	11201	broad.mit.edu	37	18	51795958	51795960	+	In_Frame_Del	DEL	CGA	CGA	-	rs78943519|rs10584411|rs3729509	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr18:51795958_51795960delCGA	ENST00000579534.1	+	1	185_187	c.42_44delCGA	c.(40-45)ggcgac>ggc	p.D17del	POLI_ENST00000217800.5_5'Flank|POLI_ENST00000406285.3_In_Frame_Del_p.D17del|POLI_ENST00000579434.1_5'UTR	NM_007195.2	NP_009126.2	Q9UNA4	POLI_HUMAN	polymerase (DNA directed) iota	17					DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)	intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.D17delD(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(5)|ovary(3)|urinary_tract(1)	26				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AAGGCGGCGGCGACGACGACGAG	0.729								DNA polymerases (catalytic subunits)						3926	0.783946	0.9705	0.6427	5008	,	,		12312	0.7054		0.7078	False		,,,				2504	0.7914				p.14_15del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.42_44del	18						.			3523,343		1644,235,54						1.5	0.0		dbSNP_119	14	5235,2405		1985,1265,570	no	coding	POLI	NM_007195.2		3629,1500,624	A1A1,A1R,RR		31.4791,8.8722,23.8832				8758,2748				50049958	SO:0001651	inframe_deletion	11201	exon1				CCDS11954.2	18q21.1	2012-05-18			ENSG00000101751	ENSG00000101751		"""DNA polymerases"""	9182	protein-coding gene	gene with protein product		605252		RAD3OB, RAD30B		17609217	Standard	NM_007195		Approved		uc002lfj.4	Q9UNA4	OTTHUMG00000132704	ENST00000579534.1:c.42_44delCGA	18.37:g.51795967_51795969delCGA	ENSP00000462664:p.Asp17del		50049956	NM_007195	Q8N590|Q9H0S1|Q9NYH6	In_Frame_Del	DEL	ENST00000579534.1	37	CCDS11954.2																																																																																				0.729	POLI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256002.3	NM_007195	
LMAN1	3998	broad.mit.edu	37	18	57013171	57013171	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr18:57013171G>A	ENST00000251047.5	-	8	1652	c.935C>T	c.(934-936)cCc>cTc	p.P312L	LMAN1_ENST00000587940.1_5'Flank	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	312					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)	p.P312L(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TTGGAGGTCGGGGTGGCCCTT	0.468																																					p.P312L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C935T	18						.						130.0	129.0	130.0					18																	57013171		2203	4300	6503	55164151	SO:0001583	missense	3998	exon8			X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.935C>T	18.37:g.57013171G>A	ENSP00000251047:p.Pro312Leu		55164151	NM_005570	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Missense_Mutation	SNP	ENST00000251047.5	37	CCDS11974.1	.	.	.	.	.	.	.	.	.	.	G	32	5.125831	0.94429	.	.	ENSG00000074695	ENST00000251047	D	0.99259	-5.64	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.99432	0.9799	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99226	1.0880	10	0.72032	D	0.01	-13.2985	19.4527	0.94873	0.0:0.0:1.0:0.0	.	312	P49257	LMAN1_HUMAN	L	312	ENSP00000251047:P312L	ENSP00000251047:P312L	P	-	2	0	LMAN1	55164151	1.000000	0.71417	0.980000	0.43619	0.988000	0.76386	9.434000	0.97515	2.696000	0.92011	0.655000	0.94253	CCC		0.468	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2	NM_005570	
FGD5	152273	broad.mit.edu	37	3	14863039	14863039	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:14863039G>A	ENST00000285046.5	+	1	2571	c.2461G>A	c.(2461-2463)Gtg>Atg	p.V821M	FGD5_ENST00000543601.1_Missense_Mutation_p.V580M	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	821					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TGATGGCTACGTGGACATGAG	0.537																																					p.V821M												.	.	0			c.G2461A	3						.						45.0	48.0	47.0					3																	14863039		2197	4294	6491	14838043	SO:0001583	missense	152273	exon1			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.2461G>A	3.37:g.14863039G>A	ENSP00000285046:p.Val821Met		14838043	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	37	CCDS46767.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.422405|4.422405	0.83559|0.83559	.|.	.|.	ENSG00000154783|ENSG00000154783	ENST00000457774|ENST00000285046;ENST00000543601	.|T;T	.|0.80653	.|-1.4;-1.2	5.03|5.03	5.03|5.03	0.67393|0.67393	.|.	.|0.000000	.|0.52532	.|D	.|0.000074	D|D	0.89715|0.89715	0.6795|0.6795	M|M	0.76002|0.76002	2.32|2.32	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.90717|0.90717	0.4632|0.4632	5|10	.|0.72032	.|D	.|0.01	-34.8096|-34.8096	18.7482|18.7482	0.91802|0.91802	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|580;821	.|B7ZM68;Q6ZNL6	.|.;FGD5_HUMAN	H|M	34|821;580	.|ENSP00000285046:V821M;ENSP00000445949:V580M	.|ENSP00000285046:V821M	R|V	+|+	2|1	0|0	FGD5|FGD5	14838043|14838043	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.986000|0.986000	0.74619|0.74619	9.235000|9.235000	0.95353|0.95353	2.495000|2.495000	0.84180|0.84180	0.591000|0.591000	0.81541|0.81541	CGT|GTG		0.537	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
MYLK	4638	broad.mit.edu	37	3	123366087	123366087	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:123366087C>T	ENST00000475616.1	-	24	4602	c.4603G>A	c.(4603-4605)Gtc>Atc	p.V1535I	MYLK_ENST00000346322.5_Missense_Mutation_p.V1466I|MYLK_ENST00000360304.3_Missense_Mutation_p.V1535I|MYLK_ENST00000360772.3_Missense_Mutation_p.V1535I|MYLK_ENST00000354792.5_Missense_Mutation_p.V335I|MYLK-AS1_ENST00000485162.1_RNA|MYLK_ENST00000359169.1_Missense_Mutation_p.V1535I			Q15746	MYLK_HUMAN	myosin light chain kinase	1535	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.V1535I(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		AGGACCATGACGATGTTGGCC	0.572																																					p.V1535I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4603A	3						.						115.0	96.0	102.0					3																	123366087		2203	4300	6503	124848777	SO:0001583	missense	4638	exon27			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4603G>A	3.37:g.123366087C>T	ENSP00000418335:p.Val1535Ile		124848777	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.859367	0.91433	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000354792;ENST00000475616	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.40767	0.1130	N	0.11341	0.13	0.53688	D	0.999972	P;D;D;D;P	0.60575	0.76;0.988;0.972;0.96;0.89	B;P;B;P;P	0.53912	0.364;0.593;0.309;0.737;0.705	T	0.45264	-0.9273	9	0.49607	T	0.09	.	19.3887	0.94570	0.0:1.0:0.0:0.0	.	1535;1466;1535;1466;1535	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	I	1535;1535;1535;1466;335;1535	ENSP00000354004:V1535I;ENSP00000353452:V1535I;ENSP00000352088:V1535I;ENSP00000320622:V1466I;ENSP00000346846:V335I;ENSP00000418335:V1535I	ENSP00000320622:V1466I	V	-	1	0	MYLK	124848777	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.071000	0.71229	2.571000	0.86741	0.655000	0.94253	GTC		0.572	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
HPS3	84343	broad.mit.edu	37	3	148894089	148894089	+	IGR	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:148894089G>A	ENST00000296051.2	+	0	4665				CP_ENST00000264613.6_Silent_p.T1043T	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3						organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)		p.T1043T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			GAATGTGGTCGGTCACATGGC	0.383									Hermansky-Pudlak syndrome																												p.T1043T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3129T	3						.						125.0	115.0	118.0					3																	148894089		2203	4299	6502	150376779	SO:0001628	intergenic_variant	1356	exon18	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548		3.37:g.148894089G>A			150376779	NM_000096	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Silent	SNP	ENST00000296051.2	37	CCDS3140.1																																																																																				0.383	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
TTC21A	199223	broad.mit.edu	37	3	39162536	39162536	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:39162536C>T	ENST00000431162.2	+	9	1107	c.973C>T	c.(973-975)Cgc>Tgc	p.R325C	TTC21A_ENST00000440121.1_Missense_Mutation_p.R276C|TTC21A_ENST00000301819.6_Missense_Mutation_p.R325C			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	325								p.R325C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TTTCATCGAGCGCACCTTCAT	0.517																																					p.R276C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C826T	3						.						148.0	141.0	144.0					3																	39162536		1997	4168	6165	39137540	SO:0001583	missense	199223	exon8			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.973C>T	3.37:g.39162536C>T	ENSP00000398211:p.Arg325Cys		39137540	NM_001105513	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	ENST00000431162.2	37	CCDS46800.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898155	0.52227	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.55930	1.26;0.49;0.49	5.95	5.95	0.96441	.	0.155263	0.46442	D	0.000293	T	0.73544	0.3600	M	0.79926	2.475	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.984;0.965	T	0.76203	-0.3045	10	0.87932	D	0	-19.2157	14.6398	0.68714	0.1462:0.8538:0.0:0.0	.	276;325;325	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	C	325;317;325;276	ENSP00000301819:R325C;ENSP00000398211:R325C;ENSP00000410882:R276C	ENSP00000301819:R325C	R	+	1	0	TTC21A	39137540	1.000000	0.71417	0.998000	0.56505	0.140000	0.21249	1.908000	0.39907	2.825000	0.97269	0.655000	0.94253	CGC		0.517	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377829.1	NM_145755	
VPRBP	9730	broad.mit.edu	37	3	51450463	51450463	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:51450463T>C	ENST00000335891.5	-	14	2756	c.2747A>G	c.(2746-2748)tAt>tGt	p.Y916C				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1365					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)	p.Y1369C(1)		breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		GACAGCAAGATAGCAGTCTTT	0.408																																					p.Y1311C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3932G	3						.						109.0	104.0	106.0					3																	51450463		1870	4109	5979	51425503	SO:0001583	missense	9730	exon20			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2747A>G	3.37:g.51450463T>C	ENSP00000338857:p.Tyr916Cys		51425503	NM_001171904	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	T	20.9	4.067177	0.76301	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.01406	4.93;4.93	5.58	5.58	0.84498	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.06050	0.0157	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.35126	-0.9801	10	0.59425	D	0.04	-15.0477	15.7584	0.78054	0.0:0.0:0.0:1.0	.	1365	Q9Y4B6	VPRBP_HUMAN	C	936;916	ENSP00000393183:Y936C;ENSP00000338857:Y916C	ENSP00000338857:Y916C	Y	-	2	0	VPRBP	51425503	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.135000	0.66039	0.533000	0.62120	TAT		0.408	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
PIK3CA	5290	broad.mit.edu	37	3	178936092	178936092	+	Missense_Mutation	SNP	A	A	G	rs121913274		TCGA-AG-3878-01	TCGA-AG-3878-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:178936092A>G	ENST00000263967.3	+	10	1791	c.1634A>G	c.(1633-1635)gAg>gGg	p.E545G		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545A(96)|p.E545G(78)|p.E545V(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAATCACTGAGCAGGAGAAA	0.353	E545A(AGS_STOMACH)|E545G(KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545G	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,urinary_tract,bladder,Substitution - Missense,+1	.	178	Substitution - Missense(178)	breast(40)|large_intestine(39)|ovary(30)|endometrium(17)|skin(9)|urinary_tract(8)|upper_aerodigestive_tract(4)|central_nervous_system(4)|oesophagus(4)|stomach(4)|liver(4)|thyroid(3)|soft_tissue(3)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|NS(1)|eye(1)|pancreas(1)|prostate(1)|pituitary(1)	c.A1634G	3						.						61.0	61.0	61.0					3																	178936092		1813	4072	5885	180418786	SO:0001583	missense	5290	exon10				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1634A>G	3.37:g.178936092A>G	ENSP00000263967:p.Glu545Gly		180418786	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.704887	0.88924	.	.	ENSG00000121879	ENST00000263967	T	0.64438	-0.1	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77046	0.4073	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.76675	-0.2872	10	0.41790	T	0.15	-25.7963	16.1026	0.81194	1.0:0.0:0.0:0.0	.	545	P42336	PK3CA_HUMAN	G	545	ENSP00000263967:E545G	ENSP00000263967:E545G	E	+	2	0	PIK3CA	180418786	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	GAG		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
LRP6	4040	broad.mit.edu	37	12	12397416	12397416	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:12397416G>A	ENST00000261349.4	-	2	305	c.229C>T	c.(229-231)Cga>Tga	p.R77*	LRP6_ENST00000543091.1_Nonsense_Mutation_p.R77*	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	77	Beta-propeller 1.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R77*(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AATTCTGTTCGTTTAATGGCT	0.438																																					p.R77X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C229T	12						.						113.0	98.0	103.0					12																	12397416		2203	4300	6503	12288683	SO:0001587	stop_gained	4040	exon2			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.229C>T	12.37:g.12397416G>A	ENSP00000261349:p.Arg77*		12288683	NM_002336	Q17RZ2	Nonsense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	G	37	6.195739	0.97367	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	.	.	.	5.04	5.04	0.67666	.	0.000000	0.43110	U	0.000609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1892	0.59700	0.0:0.0:0.7209:0.2791	.	.	.	.	X	77	.	ENSP00000261349:R77X	R	-	1	2	LRP6	12288683	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.068000	0.50018	2.627000	0.88993	0.460000	0.39030	CGA		0.438	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
SCAF11	9169	broad.mit.edu	37	12	46315944	46315944	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:46315944T>C	ENST00000369367.3	-	15	4512	c.4279A>G	c.(4279-4281)Act>Gct	p.T1427A	SCAF11_ENST00000550629.1_Intron|SCAF11_ENST00000465950.1_Missense_Mutation_p.T1112A|SCAF11_ENST00000419565.2_Missense_Mutation_p.T1427A|SCAF11_ENST00000549162.1_Missense_Mutation_p.T1235A	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	1427					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.T1427A(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GCCACTTTAGTAGAATTTACT	0.373																																					p.T1427A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4279G	12						.						84.0	80.0	81.0					12																	46315944		2203	4300	6503	44602211	SO:0001583	missense	9169	exon15			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.4279A>G	12.37:g.46315944T>C	ENSP00000358374:p.Thr1427Ala		44602211	NM_004719	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	37	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	T	6.998	0.554372	0.13374	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565	T;T;T;T	0.60424	0.19;2.36;0.19;2.36	5.12	-0.315	0.12746	.	0.331079	0.25344	N	0.031353	T	0.26484	0.0647	N	0.11560	0.145	0.23043	N	0.998386	B	0.17268	0.021	B	0.12156	0.007	T	0.19679	-1.0298	10	0.07030	T	0.85	-6.5488	5.1434	0.14971	0.1846:0.522:0.0:0.2933	.	1427	Q99590	SCAFB_HUMAN	A	1112;1427;1235;1427	ENSP00000449812:T1112A;ENSP00000358374:T1427A;ENSP00000448864:T1235A;ENSP00000413036:T1427A	ENSP00000358374:T1427A	T	-	1	0	SCAF11	44602211	0.764000	0.28473	0.997000	0.53966	0.999000	0.98932	0.469000	0.22067	0.065000	0.16485	0.533000	0.62120	ACT		0.373	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
KRT85	3891	broad.mit.edu	37	12	52754662	52754662	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:52754662C>A	ENST00000257901.3	-	9	1574	c.1499G>T	c.(1498-1500)aGt>aTt	p.S500I	KRT85_ENST00000544265.1_Missense_Mutation_p.S288I	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	500	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)	p.S500I(1)		NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CGACCGGCTACTCCCGCAGCT	0.622																																					p.S500I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1499T	12						.						40.0	48.0	45.0					12																	52754662		2200	4291	6491	51040929	SO:0001583	missense	3891	exon9			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1499G>T	12.37:g.52754662C>A	ENSP00000257901:p.Ser500Ile		51040929	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363560	0.41902	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	D;T	0.82167	-1.58;-1.46	4.89	4.89	0.63831	.	0.264540	0.33515	N	0.004837	D	0.88366	0.6417	L	0.59436	1.845	0.29915	N	0.823221	D	0.61697	0.99	D	0.69142	0.962	D	0.85234	0.1034	10	0.72032	D	0.01	.	13.7708	0.63023	0.0:1.0:0.0:0.0	.	500	P78386	KRT85_HUMAN	I	500;288	ENSP00000257901:S500I;ENSP00000440240:S288I	ENSP00000257901:S500I	S	-	2	0	KRT85	51040929	1.000000	0.71417	1.000000	0.80357	0.323000	0.28346	4.070000	0.57548	2.711000	0.92665	0.609000	0.83330	AGT		0.622	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
KRT84	3890	broad.mit.edu	37	12	52775176	52775176	+	Missense_Mutation	SNP	C	C	T	rs113837792	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:52775176C>T	ENST00000257951.3	-	5	1112	c.1046G>A	c.(1045-1047)cGg>cAg	p.R349Q	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	349	Coil 2.|Rod.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)	p.R349Q(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCATCAGCCCGGCTGCGCCT	0.572													C|||	2	0.000399361	0.0015	0.0	5008	,	,		19649	0.0		0.0	False		,,,				2504	0.0				p.R349Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1046A	12						.	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	128.0	125.0	126.0		1046	4.5	1.0	12	dbSNP_132	126	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT84	NM_033045.3	43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	349/601	52775176	2,13004	2203	4300	6503	51061443	SO:0001583	missense	3890	exon5			Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.1046G>A	12.37:g.52775176C>T	ENSP00000257951:p.Arg349Gln		51061443	NM_033045	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	37	CCDS8825.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	32	5.141118	0.94560	2.27E-4	1.16E-4	ENSG00000161849	ENST00000257951	T	0.75154	-0.91	5.41	4.51	0.55191	Filament (1);	0.000000	0.44285	D	0.000469	T	0.79845	0.4516	L	0.58101	1.795	0.30864	N	0.733259	D	0.69078	0.997	P	0.59012	0.85	T	0.79860	-0.1625	10	0.59425	D	0.04	.	11.8705	0.52517	0.0:0.8612:0.0:0.1388	.	349	Q9NSB2	KRT84_HUMAN	Q	349	ENSP00000257951:R349Q	ENSP00000257951:R349Q	R	-	2	0	KRT84	51061443	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	3.345000	0.52182	2.537000	0.85549	0.563000	0.77884	CGG		0.572	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
KRT74	121391	broad.mit.edu	37	12	52967420	52967420	+	Missense_Mutation	SNP	G	G	A	rs569075312		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:52967420G>A	ENST00000305620.2	-	1	189	c.142C>T	c.(142-144)Cgg>Tgg	p.R48W	KRT74_ENST00000549343.1_Missense_Mutation_p.R48W	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	48	Gly-rich.|Head.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)	p.R48W(1)		kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		TAGAGGCTCCGACTGCCAAAG	0.597																																					p.R48W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C142T	12						.						51.0	56.0	54.0					12																	52967420		2203	4300	6503	51253687	SO:0001583	missense	121391	exon1			BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.142C>T	12.37:g.52967420G>A	ENSP00000307240:p.Arg48Trp		51253687	NM_175053	B5MD61|Q86Y45	Missense_Mutation	SNP	ENST00000305620.2	37	CCDS8832.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.244369	0.22796	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	T;T	0.44482	0.92;0.92	4.51	2.53	0.30540	.	0.551628	0.13621	N	0.374428	T	0.49064	0.1535	M	0.88704	2.975	0.09310	N	1	B	0.22983	0.078	B	0.20184	0.028	T	0.50406	-0.8832	10	0.87932	D	0	.	9.7644	0.40552	0.0:0.1141:0.4203:0.4655	.	48	Q7RTS7	K2C74_HUMAN	W	48	ENSP00000447447:R48W;ENSP00000307240:R48W	ENSP00000307240:R48W	R	-	1	2	KRT74	51253687	0.000000	0.05858	0.070000	0.20053	0.687000	0.40016	-0.184000	0.09698	0.515000	0.28320	0.561000	0.74099	CGG		0.597	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405324.1	NM_175053	
SRGAP1	57522	broad.mit.edu	37	12	64383725	64383725	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr12:64383725G>A	ENST00000355086.3	+	3	823	c.299G>A	c.(298-300)tGg>tAg	p.W100*	SRGAP1_ENST00000543397.1_Nonsense_Mutation_p.W60*|SRGAP1_ENST00000357825.3_Nonsense_Mutation_p.W100*	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	100	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.W100*(1)		breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GTGAACTGCTGGTATTTGCTC	0.423																																					p.W100X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G299A	12						.						162.0	142.0	149.0					12																	64383725		2203	4300	6503	62669992	SO:0001587	stop_gained	57522	exon3			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.299G>A	12.37:g.64383725G>A	ENSP00000347198:p.Trp100*		62669992	NM_020762	Q9H8A3|Q9P2P2	Nonsense_Mutation	SNP	ENST00000355086.3	37	CCDS8967.1	.	.	.	.	.	.	.	.	.	.	G	50	16.970259	0.99876	.	.	ENSG00000196935	ENST00000355086;ENST00000357825;ENST00000543397	.	.	.	5.61	5.61	0.85477	.	0.000000	0.33875	U	0.004466	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0269	0.97525	0.0:0.0:1.0:0.0	.	.	.	.	X	100;100;60	.	.	W	+	2	0	SRGAP1	62669992	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.694000	0.98686	2.816000	0.96949	0.561000	0.74099	TGG		0.423	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400896.1		
NPAP1	23742	broad.mit.edu	37	15	24921536	24921536	+	Silent	SNP	C	C	T	rs368120585		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr15:24921536C>T	ENST00000329468.2	+	1	996	c.522C>T	c.(520-522)gaC>gaT	p.D174D		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	174					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.D174D(2)									GGGAGGATGACGAGAAAAGGA	0.622																																					p.D174D												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.C522T	15						.	C		1,4405		0,1,2202	48.0	41.0	43.0		522	-5.4	0.0	15		43	0,8600		0,0,4300	no	coding-synonymous	C15orf2	NM_018958.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		174/1157	24921536	1,13005	2203	4300	6503	22472629	SO:0001819	synonymous_variant	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.522C>T	15.37:g.24921536C>T			22472629	NM_018958		Silent	SNP	ENST00000329468.2	37	CCDS10015.1																																																																																				0.622	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
DMXL2	23312	broad.mit.edu	37	15	51839564	51839564	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr15:51839564C>T	ENST00000251076.5	-	7	896	c.609G>A	c.(607-609)tgG>tgA	p.W203*	DMXL2_ENST00000560421.1_5'UTR|DMXL2_ENST00000449909.3_Nonsense_Mutation_p.W203*|DMXL2_ENST00000543779.2_Nonsense_Mutation_p.W203*	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	203						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.W203*(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TTGAAGACTTCCAACCAGTCA	0.343																																					p.W203X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G609A	15						.						87.0	86.0	86.0					15																	51839564		2195	4292	6487	49626856	SO:0001587	stop_gained	23312	exon7			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.609G>A	15.37:g.51839564C>T	ENSP00000251076:p.Trp203*		49626856	NM_015263	B2RTR3|B7ZMH3|F5GWF1|O94938	Nonsense_Mutation	SNP	ENST00000251076.5	37	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428615	0.83667	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3281	0.94270	0.0:1.0:0.0:0.0	.	.	.	.	X	203	.	ENSP00000251076:W203X	W	-	3	0	DMXL2	49626856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.398000	0.79919	2.588000	0.87417	0.585000	0.79938	TGG		0.343	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
ANPEP	290	broad.mit.edu	37	15	90344715	90344715	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr15:90344715G>T	ENST00000300060.6	-	11	2006	c.1693C>A	c.(1693-1695)Cac>Aac	p.H565N	ANPEP_ENST00000558177.1_5'UTR	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	565	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)	p.H565N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	AGGAGGAAGTGCTCCTGGGAA	0.607																																					p.H565N	NSCLC(30;827 977 2459 19669 26125)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1693A	15						.						108.0	101.0	103.0					15																	90344715		2200	4299	6499	88145719	SO:0001583	missense	290	exon11			M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.1693C>A	15.37:g.90344715G>T	ENSP00000300060:p.His565Asn		88145719	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Missense_Mutation	SNP	ENST00000300060.6	37	CCDS10356.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.860715	0.91433	.	.	ENSG00000166825	ENST00000300060	T	0.01258	5.09	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.12987	0.0315	H	0.94658	3.565	0.54753	D	0.999983	D	0.67145	0.996	D	0.67900	0.954	T	0.01225	-1.1413	10	0.62326	D	0.03	.	16.374	0.83379	0.0:0.0:1.0:0.0	.	565	P15144	AMPN_HUMAN	N	565	ENSP00000300060:H565N	ENSP00000300060:H565N	H	-	1	0	ANPEP	88145719	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	9.411000	0.97342	2.474000	0.83562	0.655000	0.94253	CAC		0.607	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
ADH1A	124	broad.mit.edu	37	4	100208722	100208722	+	Splice_Site	SNP	T	T	A			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:100208722T>A	ENST00000209668.2	-	2	232	c.119A>T	c.(118-120)aAg>aTg	p.K40M	RP11-696N14.1_ENST00000500358.2_RNA|ADH1A_ENST00000511656.1_5'UTR	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	40					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)	p.K40M(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	GTATTTCACCTTAATACGAAC	0.343																																					p.K40M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A119T	4						.						56.0	55.0	55.0					4																	100208722		2203	4300	6503	100427745	SO:0001630	splice_region_variant	124	exon2			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.120+1A>T	4.37:g.100208722T>A			100427745	NM_000667	A8K3E3|Q17R68	Missense_Mutation	SNP	ENST00000209668.2	37	CCDS3648.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941830	0.73557	.	.	ENSG00000187758	ENST00000209668	T	0.04360	3.64	4.25	4.25	0.50352	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.35913	0.0948	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59573	-0.7429	10	0.87932	D	0	-13.7977	13.3387	0.60533	0.0:0.0:0.0:1.0	.	40	P07327	ADH1A_HUMAN	M	40	ENSP00000209668:K40M	ENSP00000209668:K40M	K	-	2	0	ADH1A	100427745	1.000000	0.71417	0.997000	0.53966	0.797000	0.45037	7.162000	0.77515	1.532000	0.49169	0.377000	0.23210	AAG		0.343	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	Missense_Mutation
TET2	54790	broad.mit.edu	37	4	106157490	106157490	+	Silent	SNP	C	C	T	rs144220888		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:106157490C>T	ENST00000540549.1	+	3	3251	c.2391C>T	c.(2389-2391)ttC>ttT	p.F797F	TET2_ENST00000394764.1_Silent_p.F797F|TET2_ENST00000305737.2_Silent_p.F797F|TET2_ENST00000380013.4_Silent_p.F797F|TET2_ENST00000413648.2_Silent_p.F797F|TET2_ENST00000545826.1_Silent_p.F797F|TET2_ENST00000513237.1_Silent_p.F818F			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	797	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.F797F(2)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CAAGCGAGTTCGAGACTCATA	0.373			"""Mis N, F"""		MDS																																p.F797F			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C2391T	4						.	C	,	4,4400	8.1+/-20.4	0,4,2198	57.0	61.0	60.0		2391,2391	4.1	1.0	4	dbSNP_134	60	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	TET2	NM_001127208.2,NM_017628.4	,	0,4,6497	TT,TC,CC		0.0,0.0908,0.0308	,	797/2003,797/1166	106157490	4,12998	2202	4299	6501	106376939	SO:0001819	synonymous_variant	54790	exon3			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2391C>T	4.37:g.106157490C>T			106376939	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Silent	SNP	ENST00000540549.1	37	CCDS47120.1																																																																																				0.373	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
SEC24B	10427	broad.mit.edu	37	4	110384789	110384789	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:110384789C>T	ENST00000265175.5	+	2	921	c.866C>T	c.(865-867)cCa>cTa	p.P289L	SEC24B_ENST00000504968.2_Missense_Mutation_p.P320L|SEC24B_ENST00000399100.2_Missense_Mutation_p.P289L	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	289					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.P289L(2)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		AACAACAACCCAACCATTACT	0.418																																					p.P289L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C866T	4						.						65.0	64.0	64.0					4																	110384789		2013	4196	6209	110604238	SO:0001583	missense	10427	exon2			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.866C>T	4.37:g.110384789C>T	ENSP00000265175:p.Pro289Leu		110604238	NM_006323	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	ENST00000265175.5	37	CCDS47124.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799620	0.31869	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.79247	-1.07;-1.25;-1.24	5.57	4.73	0.59995	.	2.527880	0.01230	N	0.008326	T	0.70919	0.3279	N	0.24115	0.695	0.34675	D	0.724115	B;B;B;B	0.34290	0.0;0.0;0.447;0.0	B;B;B;B	0.32533	0.0;0.0;0.147;0.0	T	0.57376	-0.7822	10	0.46703	T	0.11	-5.5693	11.9041	0.52701	0.3344:0.6655:0.0:0.0	.	239;320;289;289	B4DTM6;B7ZKM8;O95487-2;O95487	.;.;.;SC24B_HUMAN	L	320;289;289	ENSP00000428564:P320L;ENSP00000382051:P289L;ENSP00000265175:P289L	ENSP00000265175:P289L	P	+	2	0	SEC24B	110604238	0.868000	0.29978	0.084000	0.20598	0.067000	0.16453	1.674000	0.37544	1.346000	0.45694	0.591000	0.81541	CCA		0.418	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364693.2		
AP1AR	55435	broad.mit.edu	37	4	113186912	113186912	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:113186912G>A	ENST00000274000.5	+	8	818	c.463G>A	c.(463-465)Gaa>Aaa	p.E155K	AP1AR_ENST00000309703.6_Missense_Mutation_p.E122K	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein	155					cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)	p.E155K(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						AGATGACTTCGAATCTTGTTT	0.289																																					p.E155K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G463A	4						.						74.0	76.0	75.0					4																	113186912		2202	4295	6497	113406361	SO:0001583	missense	55435	exon8			AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.463G>A	4.37:g.113186912G>A	ENSP00000274000:p.Glu155Lys		113406361	NM_018569	B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Missense_Mutation	SNP	ENST00000274000.5	37	CCDS3696.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.412879	0.83340	.	.	ENSG00000138660	ENST00000274000;ENST00000309703	T;T	0.56776	0.44;0.57	5.99	5.99	0.97316	.	0.146987	0.64402	D	0.000010	T	0.51398	0.1672	L	0.50333	1.59	0.49798	D	0.999821	P;P	0.52577	0.954;0.954	B;B	0.39840	0.311;0.311	T	0.57843	-0.7741	10	0.72032	D	0.01	-11.418	20.4777	0.99188	0.0:0.0:1.0:0.0	.	122;155	Q63HQ0-2;Q63HQ0	.;AP1AR_HUMAN	K	155;122	ENSP00000274000:E155K;ENSP00000309023:E122K	ENSP00000274000:E155K	E	+	1	0	AP1AR	113406361	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.689000	0.61723	2.840000	0.97914	0.655000	0.94253	GAA		0.289	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256323.2	NM_018569	
LYAR	55646	broad.mit.edu	37	4	4285362	4285362	+	Silent	SNP	G	G	A	rs528236112		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:4285362G>A	ENST00000343470.4	-	3	348	c.108C>T	c.(106-108)tgC>tgT	p.C36C	LYAR_ENST00000452476.1_Silent_p.C36C	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	36						nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.C36C(1)		endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AATCTTTACCGCAGTCAATGC	0.393													G|||	1	0.000199681	0.0	0.0	5008	,	,		19333	0.0		0.0	False		,,,				2504	0.001				p.C36C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C108T	4						.						91.0	82.0	85.0					4																	4285362		2203	4300	6503	4336263	SO:0001819	synonymous_variant	55646	exon3			AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.108C>T	4.37:g.4285362G>A			4336263	NM_001145725	D3DVS4|Q6FI78|Q9NYS1	Silent	SNP	ENST00000343470.4	37	CCDS3374.1																																																																																				0.393	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	
CEP135	9662	broad.mit.edu	37	4	56830455	56830455	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:56830455C>T	ENST00000257287.4	+	7	839	c.715C>T	c.(715-717)Cga>Tga	p.R239*		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	239					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.R239*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					GCTAAGAGAACGAGAGATAGA	0.363																																					p.R239X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C715T	4						.						143.0	142.0	142.0					4																	56830455		2203	4300	6503	56525212	SO:0001587	stop_gained	9662	exon7			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.715C>T	4.37:g.56830455C>T	ENSP00000257287:p.Arg239*		56525212	NM_025009	B2RMY0|O75130|Q58F25|Q9H8H7	Nonsense_Mutation	SNP	ENST00000257287.4	37	CCDS33986.1	.	.	.	.	.	.	.	.	.	.	C	38	6.869953	0.97901	.	.	ENSG00000174799	ENST00000257287	.	.	.	5.36	4.51	0.55191	.	0.505809	0.20650	N	0.088222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	14.3209	0.66487	0.2835:0.7165:0.0:0.0	.	.	.	.	X	239	.	ENSP00000257287:R239X	R	+	1	2	CEP135	56525212	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	1.291000	0.33330	1.368000	0.46115	0.655000	0.94253	CGA		0.363	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362092.2	NM_025009	
ENAM	10117	broad.mit.edu	37	4	71508261	71508261	+	Missense_Mutation	SNP	G	G	A	rs143134915		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:71508261G>A	ENST00000396073.3	+	9	1399	c.1118G>A	c.(1117-1119)cGt>cAt	p.R373H	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	373					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.R373H(2)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			CAAGTAGCTCGTCCAGGAAAT	0.443																																					p.R373H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1118A	4						.	G	HIS/ARG	0,4406		0,0,2203	110.0	115.0	113.0		1118	-1.5	0.0	4	dbSNP_134	113	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ENAM	NM_031889.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	373/1143	71508261	1,13005	2203	4300	6503	71727125	SO:0001583	missense	10117	exon9			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1118G>A	4.37:g.71508261G>A	ENSP00000379383:p.Arg373His		71727125	NM_031889	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	6.130	0.392297	0.11638	0.0	1.16E-4	ENSG00000132464	ENST00000396073	T	0.33216	1.42	5.83	-1.46	0.08800	.	0.946121	0.08814	N	0.889824	T	0.17789	0.0427	L	0.31752	0.955	0.09310	N	1	B	0.21753	0.06	B	0.20384	0.029	T	0.28364	-1.0046	10	0.41790	T	0.15	0.5722	1.9369	0.03339	0.3596:0.1205:0.3964:0.1236	.	373	Q9NRM1	ENAM_HUMAN	H	373	ENSP00000379383:R373H	ENSP00000379383:R373H	R	+	2	0	ENAM	71727125	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.433000	0.06948	-0.336000	0.08438	0.655000	0.94253	CGT		0.443	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
FAT4	79633	broad.mit.edu	37	4	126411514	126411514	+	Missense_Mutation	SNP	G	G	A	rs369929089		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr4:126411514G>A	ENST00000394329.3	+	17	13550	c.13537G>A	c.(13537-13539)Gca>Aca	p.A4513T	FAT4_ENST00000335110.5_Missense_Mutation_p.A2754T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4513					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A4456T(1)|p.A4513T(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGGCAGCTGCGCAACCGTCTT	0.567																																					p.A4513T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G13537A	4						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	63.0	62.0	63.0		13537	5.2	0.2	4		63	0,8600		0,0,4300	no	missense	FAT4	NM_024582.4	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	4513/4982	126411514	1,13005	2203	4300	6503	126630964	SO:0001583	missense	79633	exon17			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13537G>A	4.37:g.126411514G>A	ENSP00000377862:p.Ala4513Thr		126630964	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419827	0.83559	2.27E-4	0.0	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.78816	-0.98;-1.21	5.17	5.17	0.71159	.	0.000000	0.34110	U	0.004259	D	0.86301	0.5900	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	D	0.84986	0.0891	10	0.35671	T	0.21	.	17.6678	0.88208	0.0:0.0:1.0:0.0	.	2754;4513;4512	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	T	4513;2754	ENSP00000377862:A4513T;ENSP00000335169:A2754T	ENSP00000335169:A2754T	A	+	1	0	FAT4	126630964	1.000000	0.71417	0.156000	0.22583	0.945000	0.59286	9.502000	0.97981	2.395000	0.81488	0.561000	0.74099	GCA		0.567	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
BCOR	54880	broad.mit.edu	37	X	39932209	39932210	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AG-3878-01	TCGA-AG-3878-01			AC	-	AC	AC	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chrX:39932209_39932210delAC	ENST00000378444.4	-	4	2617_2618	c.2389_2390delGT	c.(2389-2391)gttfs	p.V798fs	BCOR_ENST00000378455.4_Frame_Shift_Del_p.V798fs|BCOR_ENST00000342274.4_Frame_Shift_Del_p.V798fs|BCOR_ENST00000397354.3_Frame_Shift_Del_p.V798fs	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	798					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.V797fs*19(1)		breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GCTTTTGACAACAGTCTTCCCT	0.475			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.797_797del			Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.2389_2390del	X						.																																			39817154	SO:0001589	frameshift_variant	54880	exon4			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2389_2390delGT	X.37:g.39932209_39932210delAC	ENSP00000367705:p.Val798fs		39817153	NM_001123383	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Frame_Shift_Del	DEL	ENST00000378444.4	37	CCDS48093.1																																																																																				0.475	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
PJA1	64219	broad.mit.edu	37	X	68382248	68382248	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3878-01	TCGA-AG-3878-01	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chrX:68382248A>T	ENST00000361478.1	-	2	1211	c.834T>A	c.(832-834)gaT>gaA	p.D278E	PJA1_ENST00000374571.4_Missense_Mutation_p.D223E|PJA1_ENST00000374583.1_Missense_Mutation_p.D278E|PJA1_ENST00000374584.3_Intron|PJA1_ENST00000477231.1_5'UTR	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	278	Poly-Asp.				protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						CGTCATCATCATCAGTATCAA	0.488																																					p.D223E												.	.	0			c.T669A	X						.						79.0	69.0	72.0					X																	68382248		2203	4300	6503	68298973	SO:0001583	missense	64219	exon2			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.834T>A	X.37:g.68382248A>T	ENSP00000355014:p.Asp278Glu		68298973	NM_001032396	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	ENST00000361478.1	37	CCDS14393.1	.	.	.	.	.	.	.	.	.	.	a	14.91	2.676303	0.47886	.	.	ENSG00000181191	ENST00000396010;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T	0.05382	3.45;3.45;3.45	3.07	3.07	0.35406	.	0.530450	0.14591	U	0.310261	T	0.08935	0.0221	L	0.31664	0.95	0.23487	N	0.997573	D	0.67145	0.996	P	0.55260	0.772	T	0.25117	-1.0141	10	0.37606	T	0.19	-8.1877	7.0462	0.25046	1.0:0.0:0.0:0.0	.	278	Q8NG27	PJA1_HUMAN	E	193;278;278;223	ENSP00000363711:D278E;ENSP00000355014:D278E;ENSP00000363699:D223E	ENSP00000355014:D278E	D	-	3	2	PJA1	68298973	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	4.994000	0.63901	1.470000	0.48102	0.299000	0.19835	GAT		0.488	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057031.2	NM_145119	
GAD1	2571	broad.mit.edu	37	2	171686107	171686107	+	Missense_Mutation	SNP	C	C	T	rs373042715	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr2:171686107C>T	ENST00000358196.3	+	4	818	c.268C>T	c.(268-270)Cgc>Tgc	p.R90C	GAD1_ENST00000344257.5_Missense_Mutation_p.R90C|GAD1_ENST00000429023.1_3'UTR|GAD1_ENST00000375272.1_Missense_Mutation_p.R90C	NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	90					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.R90C(3)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						CCGCTTCCGGCGCACAGAGAC	0.532													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		11741	0.001		0.0	False		,,,				2504	0.0				p.R90C												.	.	3	Substitution - Missense(3)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	c.C268T	2						.	C	CYS/ARG,CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	62.0	71.0	68.0		268,268	5.4	1.0	2		68	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GAD1	NM_000817.2,NM_013445.3	180,180	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	possibly-damaging,possibly-damaging	90/595,90/225	171686107	3,13003	2203	4300	6503	171394353	SO:0001583	missense	2571	exon4				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.268C>T	2.37:g.171686107C>T	ENSP00000350928:p.Arg90Cys		171394353	NM_000817	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	ENST00000358196.3	37	CCDS2239.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954013	0.92660	4.54E-4	1.16E-4	ENSG00000128683	ENST00000358196;ENST00000375272;ENST00000344257;ENST00000455008;ENST00000456864	T;T;T;D;T	0.82526	2.15;0.22;0.22;-1.62;-1.47	5.37	5.37	0.77165	.	0.093423	0.85682	D	0.000000	D	0.86314	0.5903	M	0.61703	1.905	0.80722	D	1	P;D	0.67145	0.927;0.996	P;P	0.53185	0.485;0.72	D	0.87932	0.2711	10	0.87932	D	0	-3.9982	14.7874	0.69813	0.1449:0.8551:0.0:0.0	.	90;90	Q99259;Q99259-3	DCE1_HUMAN;.	C	90	ENSP00000350928:R90C;ENSP00000364421:R90C;ENSP00000341167:R90C;ENSP00000405917:R90C;ENSP00000394255:R90C	ENSP00000341167:R90C	R	+	1	0	GAD1	171394353	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.448000	0.60027	2.483000	0.83821	0.542000	0.68232	CGC		0.532	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102664.2		
HIBCH	26275	broad.mit.edu	37	2	191077702	191077702	+	Missense_Mutation	SNP	G	G	A	rs569593420		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr2:191077702G>A	ENST00000359678.5	-	12	1285	c.991C>T	c.(991-993)Cgg>Tgg	p.R331W	HIBCH_ENST00000392332.3_Missense_Mutation_p.R331W|HIBCH_ENST00000486981.1_5'UTR|HIBCH_ENST00000410045.1_Missense_Mutation_p.R108W	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	331					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)	p.R331W(1)		NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			TGACTTAGCCGATACTCCATA	0.318													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18131	0.0		0.0	False		,,,				2504	0.0				p.R331W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C991T	2						.						87.0	89.0	88.0					2																	191077702		2202	4300	6502	190785947	SO:0001583	missense	26275	exon12			U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.991C>T	2.37:g.191077702G>A	ENSP00000352706:p.Arg331Trp		190785947	NM_014362	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	37	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.612291	0.66672	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000410045;ENST00000416732;ENST00000409820	T;T;T;T;T	0.77098	-0.72;-0.72;-1.07;-1.07;-1.07	5.01	4.06	0.47325	.	0.167565	0.51477	D	0.000093	D	0.89343	0.6688	M	0.91818	3.245	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90910	0.4775	10	0.87932	D	0	-7.4197	12.3873	0.55338	0.0:0.0:0.8217:0.1783	.	331;331	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	W	331;331;108;82;111	ENSP00000376144:R331W;ENSP00000352706:R331W;ENSP00000386274:R108W;ENSP00000399263:R82W;ENSP00000387098:R111W	ENSP00000352706:R331W	R	-	1	2	HIBCH	190785947	1.000000	0.71417	0.974000	0.42286	0.987000	0.75469	1.689000	0.37700	2.594000	0.87642	0.563000	0.77884	CGG		0.318	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
RBM44	375316	broad.mit.edu	37	2	238726684	238726684	+	Silent	SNP	T	T	C			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr2:238726684T>C	ENST00000409864.1	+	3	1379	c.1125T>C	c.(1123-1125)tgT>tgC	p.C375C	RBM44_ENST00000316997.4_Silent_p.C375C|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	374						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)	p.C375C(2)		breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		TCCAACCCTGTAAAGATTGTC	0.368																																					p.C375C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1125C	2						.						61.0	62.0	62.0					2																	238726684		1845	4097	5942	238391423	SO:0001819	synonymous_variant	375316	exon3			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1125T>C	2.37:g.238726684T>C			238391423	NM_001080504	A0AUW3	Silent	SNP	ENST00000409864.1	37	CCDS46554.1																																																																																				0.368	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504	
ZNF638	27332	broad.mit.edu	37	2	71661885	71661885	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3878-01	TCGA-AG-3878-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr2:71661885A>G	ENST00000409544.1	+	28	6515	c.5885A>G	c.(5884-5886)aAg>aGg	p.K1962R	ZNF638_ENST00000355812.3_3'UTR|ZNF638_ENST00000409407.1_Missense_Mutation_p.K902R|ZNF638_ENST00000264447.4_Missense_Mutation_p.K1962R	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1962					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.K1962R(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						TTCATGGCCAAGCAAAGAAAG	0.333																																					p.K1962R												.	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.A5885G	2						.						66.0	77.0	73.0					2																	71661885		2203	4300	6503	71515393	SO:0001583	missense	27332	exon28			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5885A>G	2.37:g.71661885A>G	ENSP00000386433:p.Lys1962Arg		71515393	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	37	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	A	14.81	2.647161	0.47258	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.35605	1.3;1.3;1.74	6.08	4.75	0.60458	.	0.100063	0.44483	D	0.000441	T	0.39436	0.1078	N	0.17631	0.505	0.80722	D	1	D;B	0.71674	0.998;0.06	D;B	0.78314	0.991;0.018	T	0.13019	-1.0525	10	0.30078	T	0.28	-13.5376	8.7169	0.34416	0.905:0.0:0.095:0.0	.	1941;1962	Q14966-3;Q14966	.;ZN638_HUMAN	R	1962;1962;902	ENSP00000264447:K1962R;ENSP00000386433:K1962R;ENSP00000386813:K902R	ENSP00000264447:K1962R	K	+	2	0	ZNF638	71515393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.990000	0.40717	2.333000	0.79357	0.482000	0.46254	AAG		0.333	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
FARP2	9855	broad.mit.edu	37	2	242407703	242407703	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr2:242407703C>A	ENST00000264042.3	+	18	2212	c.2042C>A	c.(2041-2043)cCc>cAc	p.P681H		NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	681	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CTGCTGAAGCCCATCCAGCGG	0.577																																					p.P681H												.	.	0			c.C2042A	2						.						88.0	74.0	79.0					2																	242407703		2203	4300	6503	242056376	SO:0001583	missense	9855	exon18			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.2042C>A	2.37:g.242407703C>A	ENSP00000264042:p.Pro681His		242056376	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	ENST00000264042.3	37	CCDS33424.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002385	0.93227	.	.	ENSG00000006607	ENST00000264042	D	0.90620	-2.7	4.96	4.96	0.65561	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.97142	0.9066	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98732	1.0713	10	0.87932	D	0	.	18.2382	0.89957	0.0:1.0:0.0:0.0	.	681	O94887	FARP2_HUMAN	H	681	ENSP00000264042:P681H	ENSP00000264042:P681H	P	+	2	0	FARP2	242056376	1.000000	0.71417	0.976000	0.42696	0.991000	0.79684	7.105000	0.77031	2.290000	0.77057	0.655000	0.94253	CCC		0.577	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
BRINP1	1620	broad.mit.edu	37	9	121971143	121971143	+	Silent	SNP	G	G	T			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr9:121971143G>T	ENST00000265922.3	-	7	1460	c.999C>A	c.(997-999)ggC>ggA	p.G333G	BRINP1_ENST00000482797.1_5'UTR	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	333					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.G333G(1)									CCCAGTCATTGCCCCAGTGCT	0.542																																					p.G333G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C999A	9						.						138.0	119.0	126.0					9																	121971143		2203	4300	6503	121010964	SO:0001819	synonymous_variant	1620	exon7			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.999C>A	9.37:g.121971143G>T			121010964	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	ENST00000265922.3	37	CCDS6822.1																																																																																				0.542	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
MAMDC2	256691	broad.mit.edu	37	9	72659528	72659528	+	Silent	SNP	G	G	T			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr9:72659528G>T	ENST00000377182.4	+	2	680	c.63G>T	c.(61-63)ctG>ctT	p.L21L		NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	21					peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)	p.L21L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						CCCTCGACCTGCCCGCTGGGT	0.617																																					p.L21L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G63T	9						.						44.0	39.0	41.0					9																	72659528		2032	3907	5939	71849348	SO:0001819	synonymous_variant	256691	exon2			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.63G>T	9.37:g.72659528G>T			71849348	NM_153267	Q5VW47|Q8WX43|Q96BM4	Silent	SNP	ENST00000377182.4	37	CCDS6631.1																																																																																				0.617	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267	
SPATA31D1	389763	broad.mit.edu	37	9	84606147	84606147	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr9:84606147G>T	ENST00000344803.2	+	4	809	c.762G>T	c.(760-762)gaG>gaT	p.E254D		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	254					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.E254D(1)									ATCACATTGAGAGAGTGGAGT	0.517																																					p.E254D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G762T	9						.						261.0	241.0	247.0					9																	84606147		1927	4125	6052	83795967	SO:0001583	missense	389763	exon4				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.762G>T	9.37:g.84606147G>T	ENSP00000341988:p.Glu254Asp		83795967	NM_001001670		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	7.851	0.724002	0.15439	.	.	ENSG00000214929	ENST00000344803	T	0.04758	3.56	2.96	1.06	0.20224	.	1.877400	0.02681	N	0.109670	T	0.02267	0.0070	N	0.02539	-0.55	0.09310	N	1	B	0.18610	0.029	B	0.14023	0.01	T	0.40720	-0.9548	10	0.13853	T	0.58	-0.0634	5.2593	0.15563	0.2836:0.0:0.7164:0.0	.	254	Q6ZQQ2	F75D1_HUMAN	D	254	ENSP00000341988:E254D	ENSP00000341988:E254D	E	+	3	2	FAM75D1	83795967	0.008000	0.16893	0.001000	0.08648	0.001000	0.01503	0.368000	0.20399	0.302000	0.22762	-0.145000	0.13849	GAG		0.517	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
STRBP	55342	broad.mit.edu	37	9	125909188	125909188	+	Silent	SNP	T	T	G			TCGA-AG-3878-01	TCGA-AG-3878-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr9:125909188T>G	ENST00000348403.5	-	13	1713	c.1284A>C	c.(1282-1284)acA>acC	p.T428T	STRBP_ENST00000360998.3_Silent_p.T414T|STRBP_ENST00000447404.2_Silent_p.T428T	NM_018387.4	NP_060857.2	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	428	DRBM 1. {ECO:0000255|PROSITE- ProRule:PRU00266}.				cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.T428T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						AGGCTTCATATGTTGTGCCAT	0.438																																					p.T414T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1242C	9						.						154.0	140.0	145.0					9																	125909188		2203	4300	6503	124949009	SO:0001819	synonymous_variant	55342	exon13			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000348403.5:c.1284A>C	9.37:g.125909188T>G			124949009	NM_001171137	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	Silent	SNP	ENST00000348403.5	37	CCDS6851.1																																																																																				0.438	STRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053982.1		
FLT1	2321	broad.mit.edu	37	13	29041214	29041214	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr13:29041214C>T	ENST00000282397.4	-	3	465	c.214G>A	c.(214-216)Gaa>Aaa	p.E72K	FLT1_ENST00000539099.1_Missense_Mutation_p.E72K|FLT1_ENST00000541932.1_Missense_Mutation_p.E72K	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	72	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.E72K(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCAGCCTTTCGCTTTCCTTA	0.438																																					p.E72K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A	13						.						206.0	190.0	196.0					13																	29041214		2203	4300	6503	27939214	SO:0001583	missense	2321	exon3			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.214G>A	13.37:g.29041214C>T	ENSP00000282397:p.Glu72Lys		27939214	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	ENST00000282397.4	37	CCDS9330.1	.	.	.	.	.	.	.	.	.	.	C	4.041	0.005280	0.07866	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000450836;ENST00000539099	T;T;T	0.63580	-0.05;-0.05;-0.05	5.7	-1.01	0.10169	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.477149	0.23690	N	0.045526	T	0.16342	0.0393	N	0.00230	-1.795	0.20926	N	0.999827	B;B;B;B;B	0.06786	0.001;0.001;0.0;0.001;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0	T	0.39941	-0.9589	10	0.05525	T	0.97	.	5.517	0.16912	0.0:0.2063:0.2704:0.5233	.	72;72;72;72;72	P17948-4;P17948-3;B5A924;P17948-2;P17948	.;.;.;.;VGFR1_HUMAN	K	72	ENSP00000282397:E72K;ENSP00000437631:E72K;ENSP00000442630:E72K	ENSP00000282397:E72K	E	-	1	0	FLT1	27939214	0.512000	0.26186	0.231000	0.23993	0.880000	0.50808	0.141000	0.16076	-0.369000	0.08028	-1.027000	0.02421	GAA		0.438	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
NBEA	26960	broad.mit.edu	37	13	36006464	36006464	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr13:36006464C>T	ENST00000400445.3	+	39	6772	c.6238C>T	c.(6238-6240)Cga>Tga	p.R2080*	NBEA_ENST00000310336.4_Nonsense_Mutation_p.R2080*|NBEA_ENST00000540320.1_Nonsense_Mutation_p.R2080*|NBEA_ENST00000379939.2_Nonsense_Mutation_p.R2077*	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2080					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.R2080*(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TCGAAGGAGACGATTTGTTCG	0.393																																					p.R2080X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C6238T	13						.						121.0	108.0	112.0					13																	36006464		1904	4111	6015	34904464	SO:0001587	stop_gained	26960	exon39			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6238C>T	13.37:g.36006464C>T	ENSP00000383295:p.Arg2080*		34904464	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Nonsense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	50	16.923632	0.99875	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	.	.	.	5.72	1.37	0.22104	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.3795	0.87401	0.5126:0.4874:0.0:0.0	.	.	.	.	X	2080;2080;2077;2080;707	.	ENSP00000308534:R2080X	R	+	1	2	NBEA	34904464	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	1.084000	0.30828	0.289000	0.22422	-0.181000	0.13052	CGA		0.393	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NRG3	10718	broad.mit.edu	37	10	84738833	84738833	+	Missense_Mutation	SNP	G	G	A	rs564020344		TCGA-AG-3878-01	TCGA-AG-3878-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr10:84738833G>A	ENST00000404547.1	+	8	1540	c.1540G>A	c.(1540-1542)Gaa>Aaa	p.E514K	NRG3_ENST00000372142.2_Missense_Mutation_p.E293K|NRG3_ENST00000372141.2_Missense_Mutation_p.E514K|NRG3_ENST00000404576.2_Missense_Mutation_p.E318K|NRG3_ENST00000556918.1_Missense_Mutation_p.E344K|NRG3_ENST00000537893.1_Missense_Mutation_p.E164K|NRG3_ENST00000545131.1_Missense_Mutation_p.E164K			P56975	NRG3_HUMAN	neuregulin 3	514					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.E514K(2)|p.E293K(2)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TCAGCAACTCGAAGAATCAAG	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		18551	0.0		0.0	False		,,,				2504	0.001				p.E293K												.	.	4	Substitution - Missense(4)	urinary_tract(2)|large_intestine(2)	c.G877A	10						.						109.0	91.0	97.0					10																	84738833		2203	4300	6503	84728813	SO:0001583	missense	10718	exon9			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1540G>A	10.37:g.84738833G>A	ENSP00000384796:p.Glu514Lys		84728813	NM_001165973	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	37	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.768186	0.90020	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.52295	1.44;1.27;1.28;0.67;0.67;0.67;0.67	5.79	5.79	0.91817	.	0.153130	0.44902	D	0.000403	T	0.64649	0.2617	L	0.50333	1.59	0.50313	D	0.999864	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.992;0.913;0.994;0.992	T	0.63875	-0.6538	10	0.59425	D	0.04	-0.0016	17.6117	0.88055	0.0:0.0:1.0:0.0	.	513;514;293;514	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	K	514;514;513;293;318;344;164;164	ENSP00000361214:E514K;ENSP00000384796:E514K;ENSP00000361215:E293K;ENSP00000385804:E318K;ENSP00000451376:E344K;ENSP00000441201:E164K;ENSP00000440377:E164K	ENSP00000361214:E514K	E	+	1	0	NRG3	84728813	0.998000	0.40836	0.960000	0.40013	0.761000	0.43186	2.977000	0.49297	2.759000	0.94783	0.558000	0.71614	GAA		0.493	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
TLX1	3195	broad.mit.edu	37	10	102893975	102893975	+	Silent	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr10:102893975G>A	ENST00000370196.6	+	2	2654	c.612G>A	c.(610-612)ccG>ccA	p.P204P	RP11-31L23.3_ENST00000411459.1_RNA|TLX1_ENST00000467928.2_Silent_p.P204P			P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	204					cell fate commitment (GO:0045165)|central nervous system development (GO:0007417)|neuron differentiation (GO:0030182)|organ formation (GO:0048645)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spleen development (GO:0048536)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.P204P(2)		breast(1)|upper_aerodigestive_tract(1)	2				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AGAAGAAGCCGCGCACGTCCT	0.647			T	"""TRB@, TRD@"""	T-ALL																																p.P204P			Dom	yes		10	10q24	3195	""" T-cell leukemia, homeobox 1 (HOX11)"""		L	.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.G612A	10						.						49.0	51.0	50.0					10																	102893975		2199	4297	6496	102883965	SO:0001819	synonymous_variant	3195	exon2			M62626	CCDS7510.1, CCDS55725.1	10q24.32	2011-06-20	2005-12-22	2002-05-31	ENSG00000107807	ENSG00000107807		"""Homeoboxes / ANTP class : NKL subclass"""	5056	protein-coding gene	gene with protein product	"""Homeo box-11 (T-cell leukemia-3 associated breakpoint, homologous to Drosophila Notch)"", ""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"""	186770	"""homeo box 11 (T-cell lymphoma 3-associated breakpoint)"", ""T-cell leukemia, homeobox 1"""	TCL3, HOX11		1676542, 1973146	Standard	NM_005521		Approved		uc001ksw.3	P31314	OTTHUMG00000019341	ENST00000370196.6:c.612G>A	10.37:g.102893975G>A			102883965	NM_001195517	A1L4G3|O75699|Q5VXP2|Q9HCA0|Q9UD59	Silent	SNP	ENST00000370196.6	37	CCDS7510.1																																																																																				0.647	TLX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051193.3	NM_005521	
APC	324	broad.mit.edu	37	5	112170691	112170691	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr5:112170691C>G	ENST00000457016.1	+	15	2167	c.1787C>G	c.(1786-1788)tCa>tGa	p.S596*	APC_ENST00000257430.4_Nonsense_Mutation_p.S596*|APC_ENST00000508376.2_Nonsense_Mutation_p.S596*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	596	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S596*(3)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGGAATTTGTCAGCACATTGC	0.388		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S578X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	4	Substitution - Nonsense(3)|Unknown(1)	large_intestine(3)|skin(1)	c.C1733G	5	GRCh37	CM056295	APC	M		.						194.0	160.0	172.0					5																	112170691		2202	4300	6502	112198590	SO:0001587	stop_gained	324	exon13	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1787C>G	5.37:g.112170691C>G	ENSP00000413133:p.Ser596*		112198590	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	7.218231	0.98143	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-13.4015	20.3409	0.98764	0.0:1.0:0.0:0.0	.	.	.	.	X	596;578;596;596;596	.	ENSP00000257430:S596X	S	+	2	0	APC	112198590	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.814000	0.96858	0.655000	0.94253	TCA		0.388	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175273	112175273	+	Nonsense_Mutation	SNP	C	C	T	rs398123121		TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr5:112175273C>T	ENST00000457016.1	+	16	4362	c.3982C>T	c.(3982-3984)Cag>Tag	p.Q1328*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1328*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1328*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1328	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.			AVSQHPR -> SSVHSTLE (in Ref. 1; AAA60353/ AAA60354). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1328*(12)|p.Q1328fs*3(2)|p.?(1)|p.?fs(1)|p.K1192fs*3(1)|p.V1326fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCAGTGTCACAGCACCCTAG	0.448		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1310X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	18	Substitution - Nonsense(12)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(15)|soft_tissue(1)|endometrium(1)|skin(1)	c.C3928T	5	GRCh37	CM930028	APC	M		.						61.0	63.0	63.0					5																	112175273		2202	4300	6502	112203172	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3982C>T	5.37:g.112175273C>T	ENSP00000413133:p.Gln1328*		112203172	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.920796	0.97105	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.03	6.03	0.97812	.	0.360425	0.32258	N	0.006349	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.017	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1328	.	.	Q	+	1	0	APC	112203172	1.000000	0.71417	0.958000	0.39756	0.198000	0.23893	4.377000	0.59562	2.861000	0.98227	0.655000	0.94253	CAG		0.448	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DMXL1	1657	broad.mit.edu	37	5	118468902	118468902	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3878-01	TCGA-AG-3878-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr5:118468902A>C	ENST00000311085.8	+	11	1471	c.1391A>C	c.(1390-1392)aAc>aCc	p.N464T	DMXL1_ENST00000539542.1_Missense_Mutation_p.N464T	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	464								p.N464T(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATGGTACCAAACTCAAGTTTT	0.343																																					p.N464T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1391C	5						.						137.0	131.0	133.0					5																	118468902		2202	4300	6502	118496801	SO:0001583	missense	1657	exon11			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1391A>C	5.37:g.118468902A>C	ENSP00000309690:p.Asn464Thr		118496801	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.597909	0.00857	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.44482	0.92;0.92;2.67	5.32	-0.886	0.10590	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.652897	0.16636	N	0.205876	T	0.16727	0.0402	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.003	B;B	0.13407	0.009;0.001	T	0.29212	-1.0019	10	0.09843	T	0.71	-0.7233	7.1146	0.25409	0.5407:0.1159:0.3434:0.0	.	464;464	F5H269;Q9Y485	.;DMXL1_HUMAN	T	464	ENSP00000427692:N464T;ENSP00000309690:N464T;ENSP00000439479:N464T	ENSP00000309690:N464T	N	+	2	0	DMXL1	118496801	0.795000	0.28851	0.727000	0.30756	0.085000	0.17905	1.782000	0.38654	0.060000	0.16281	0.482000	0.46254	AAC		0.343	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
KIAA0141	9812	broad.mit.edu	37	5	141318178	141318178	+	Missense_Mutation	SNP	C	C	T	rs10056676	byFrequency	TCGA-AG-3878-01	TCGA-AG-3878-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr5:141318178C>T	ENST00000432126.2	+	12	1536	c.1402C>T	c.(1402-1404)Cgc>Tgc	p.R468C	KIAA0141_ENST00000194118.4_Missense_Mutation_p.R468C	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	468			R -> C (in dbSNP:rs10056676).		extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)		p.R468C(1)		endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAACCTCACGCCTACCACA	0.612													C|||	18	0.00359425	0.0121	0.0029	5008	,	,		18657	0.0		0.0	False		,,,				2504	0.0				p.R468C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1402T	5						.	C	CYS/ARG,CYS/ARG	71,4335	64.7+/-102.0	0,71,2132	117.0	112.0	114.0		1402,1402	-4.0	0.0	5	dbSNP_119	114	0,8600		0,0,4300	yes	missense,missense	KIAA0141	NM_001142603.1,NM_014773.3	180,180	0,71,6432	TT,TC,CC		0.0,1.6114,0.5459	benign,benign	468/516,468/516	141318178	71,12935	2203	4300	6503	141298362	SO:0001583	missense	9812	exon12			BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.1402C>T	5.37:g.141318178C>T	ENSP00000396225:p.Arg468Cys		141298362	NM_001142603	Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	37	CCDS4268.1	10	0.004578754578754579	10	0.02032520325203252	0	0.0	0	0.0	0	0.0	C	5.470	0.271844	0.10349	0.016114	0.0	ENSG00000081791	ENST00000432126;ENST00000194118	T;T	0.12361	2.69;2.69	5.11	-4.02	0.04034	.	1.226240	0.05604	N	0.576815	T	0.01905	0.0060	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35649	-0.9780	10	0.51188	T	0.08	2.1945	2.346	0.04271	0.1049:0.1918:0.271:0.4323	rs10056676;rs52806441;rs10056676	468	Q14154	DELE_HUMAN	C	468	ENSP00000396225:R468C;ENSP00000194118:R468C	ENSP00000194118:R468C	R	+	1	0	KIAA0141	141298362	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-2.209000	0.01228	-1.244000	0.02516	-0.140000	0.14226	CGC		0.612	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
RIOK2	55781	broad.mit.edu	37	5	96498917	96498917	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3878-01	TCGA-AG-3878-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr5:96498917G>A	ENST00000283109.3	-	10	1575	c.1507C>T	c.(1507-1509)Cag>Tag	p.Q503*	CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	503	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q503*(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TTCACCTTCTGTTTCACCAGT	0.343																																					p.Q503X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1507T	5						.						106.0	94.0	98.0					5																	96498917		2202	4299	6501	96524673	SO:0001587	stop_gained	55781	exon10			AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.1507C>T	5.37:g.96498917G>A	ENSP00000283109:p.Gln503*		96524673	NM_018343	D6RDI3|Q9NUT0	Nonsense_Mutation	SNP	ENST00000283109.3	37	CCDS4089.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.1|22.1	4.240904|4.240904	0.79912|0.79912	.|.	.|.	ENSG00000058729|ENSG00000058729	ENST00000283109|ENST00000511293	.|.	.|.	.|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.116786|.	0.64402|.	D|.	0.000014|.	.|T	.|0.71350	.|0.3329	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69691	.|-0.5077	.|4	0.09843|.	T|.	0.71|.	-10.1184|-10.1184	15.0797|15.0797	0.72106|0.72106	0.0:0.0:0.8576:0.1424|0.0:0.0:0.8576:0.1424	.|.	.|.	.|.	.|.	X|I	503|109	.|.	ENSP00000283109:Q503X|.	Q|T	-|-	1|2	0|0	RIOK2|RIOK2	96524673|96524673	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.491000|4.491000	0.60326|0.60326	2.605000|2.605000	0.88082|0.88082	0.655000|0.655000	0.94253|0.94253	CAG|ACA		0.343	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250628.1	NM_018343	
GABRB2	2561	broad.mit.edu	37	5	160757890	160757890	+	Splice_Site	SNP	C	C	A			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr5:160757890C>A	ENST00000393959.1	-	8	1076	c.1077G>T	c.(1075-1077)aaG>aaT	p.K359N	GABRB2_ENST00000520240.1_Splice_Site_p.K359N|GABRB2_ENST00000517547.1_Splice_Site_p.K199N|GABRB2_ENST00000274547.2_Splice_Site_p.K359N|GABRB2_ENST00000353437.6_Splice_Site_p.K359N|GABRB2_ENST00000517901.1_Splice_Site_p.K296N			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	359					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)	p.K359N(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGAATTTACCTTGTTGACAT	0.488																																					p.K359N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1077T	5						.						111.0	112.0	112.0					5																	160757890		2203	4300	6503	160690468	SO:0001630	splice_region_variant	2561	exon9				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.1077+1G>T	5.37:g.160757890C>A			160690468	NM_000813	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	37	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.829802	0.91036	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	D;D;D;D;D;D	0.87029	-2.2;-2.2;-1.81;-1.81;-1.81;-1.81	5.26	5.26	0.73747	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.64402	D	0.000008	D	0.83266	0.5217	N	0.17248	0.465	0.80722	D	1	P;P;B;P	0.41008	0.642;0.607;0.254;0.735	B;B;B;P	0.46585	0.258;0.41;0.201;0.521	T	0.81682	-0.0822	9	.	.	.	.	18.8686	0.92303	0.0:1.0:0.0:0.0	.	199;296;359;359	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	N	359;359;359;359;296;199	ENSP00000377531:K359N;ENSP00000274547:K359N;ENSP00000274546:K359N;ENSP00000429320:K359N;ENSP00000430532:K296N;ENSP00000429750:K199N	.	K	-	3	2	GABRB2	160690468	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.524000	0.81866	2.451000	0.82905	0.563000	0.77884	AAG		0.488	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		Missense_Mutation
IGHD1-20	28507	broad.mit.edu	37	14	106354475	106354481	+	RNA	DEL	ACAGGAG	ACAGGAG	-	rs375389988|rs199550558		TCGA-AG-3878-01	TCGA-AG-3878-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr14:106354475_106354481delACAGGAG	ENST00000450276.1	-	0	17				IGHD2-21_ENST00000390572.1_RNA|IGHD3-22_ENST00000390571.1_RNA					immunoglobulin heavy diversity 1-20																		TCCTGTCCCTACAGGAGACTGGTGTCA	0.541																																					.												.	.	0			.	14						.			886,2760		256,374,1193						0.7	0.1			41	1031,6695		171,689,3003	no	intergenic				427,1063,4196	A1A1,A1R,RR		13.3446,24.3006,16.8572				1917,9455				105425526			8755	.			X97051		14q32.33	2012-02-08			ENSG00000237020	ENSG00000237020		"""Immunoglobulins / IGH locus"""	5484	other	immunoglobulin gene						3138112	Standard	NG_001019		Approved	IGHD120			OTTHUMG00000152432		14.37:g.106354475_106354481delACAGGAG			105425520	.		Splice_Site	DEL	ENST00000450276.1	37																																																																																					0.541	IGHD1-20-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_start_NF|cds_end_NF|basic|appris_principal	IG_D_gene	IG_D_gene	OTTHUMT00000326210.1	NG_001019	
CRYBG3	131544	broad.mit.edu	37	3	97611727	97611727	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3878-01	TCGA-AG-3878-01	C	C	C	C	C	C	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3878-01	TCGA-AG-3878-01	g.chr3:97611727C>G	ENST00000182096.4	+	8	1684	c.1620C>G	c.(1618-1620)caC>caG	p.H540Q		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2488							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						AAAAACCTCACTTCCATGGAC	0.279																																					.												.	.	0			.	3						.						45.0	42.0	42.0					3																	97611727		1787	4056	5843	99094417	SO:0001583	missense	131544	.					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.1620C>G	3.37:g.97611727C>G	ENSP00000182096:p.His540Gln		99094417	.	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	37		.	.	.	.	.	.	.	.	.	.	C	10.47	1.359801	0.24598	.	.	ENSG00000080200	ENST00000182096	T	0.74526	-0.85	5.72	0.0308	0.14168	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.590193	0.17452	N	0.173757	T	0.75095	0.3803	L	0.46885	1.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.70226	-0.4930	10	0.45353	T	0.12	.	1.7521	0.02974	0.1362:0.4084:0.1341:0.3212	.	540	Q68DQ2	CRBG3_HUMAN	Q	540	ENSP00000182096:H540Q	ENSP00000182096:H540Q	H	+	3	2	CRYBG3	99094417	0.995000	0.38212	0.967000	0.41034	0.199000	0.23934	0.234000	0.17930	0.064000	0.16427	-0.942000	0.02676	CAC		0.279	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
