#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
XRCC3	7517	broad.mit.edu	37	14	104165200	104165201	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-3882-01	TCGA-AG-3882-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr14:104165200_104165201insG	ENST00000553264.1	-	8	1771_1772	c.975_976insC	c.(973-978)ccctccfs	p.S326fs	KLC1_ENST00000348520.6_Intron|XRCC3_ENST00000554913.1_Frame_Shift_Ins_p.S326fs|KLC1_ENST00000555836.1_Intron|KLC1_ENST00000452929.2_Intron|KLC1_ENST00000554280.1_Intron|XRCC3_ENST00000445556.1_Frame_Shift_Ins_p.S326fs|XRCC3_ENST00000555055.1_Frame_Shift_Ins_p.S326fs|XRCC3_ENST00000352127.7_Frame_Shift_Ins_p.S326fs|XRCC3_ENST00000554974.1_Frame_Shift_Ins_p.S121fs|KLC1_ENST00000557450.1_Intron|KLC1_ENST00000334553.6_Intron|RP11-73M18.8_ENST00000602422.1_RNA			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	326					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|response to organic substance (GO:0010033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)	p.S326fs*>22(1)		endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		GAACAGGAGGAGGGGGGCAGGT	0.688								Direct reversal of damage;Homologous recombination																													p.S326fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.976_977insC	14						.																																			103234954	SO:0001589	frameshift_variant	7517	exon9			AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215			12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675				7603995	Standard	NM_001100118		Approved		uc001ynz.4	O43542		ENST00000553264.1:c.976dupC	14.37:g.104165206_104165206dupG	ENSP00000451974:p.Ser326fs		103234953	NM_001100118	O43568|Q9BU18	Frame_Shift_Ins	INS	ENST00000553264.1	37	CCDS9984.1																																																																																				0.688	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414631.1	NM_005432	
SPTB	6710	broad.mit.edu	37	14	65220274	65220275	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-3882-01	TCGA-AG-3882-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr14:65220274_65220275insG	ENST00000556626.1	-	33	6724_6725	c.6582_6583insC	c.(6580-6585)cccaacfs	p.N2195fs	SPTB_ENST00000389722.3_Frame_Shift_Ins_p.N2195fs|SPTB_ENST00000342835.4_5'UTR			P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	0					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCCTTCTTGTTGGGCCCCTCCA	0.639																																					p.N2195fs												.	.	0			c.6583_6584insC	14						.																																			64290028	SO:0001589	frameshift_variant	6710	exon32				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000556626.1:c.6583dupC	14.37:g.65220277_65220277dupG	ENSP00000451752:p.Asn2195fs		64290027	NM_001024858	Q15510|Q15519	Frame_Shift_Ins	INS	ENST00000556626.1	37	CCDS32099.1																																																																																				0.639	SPTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414076.1		
AKT1S1	84335	broad.mit.edu	37	19	50374935	50374936	+	Frame_Shift_Ins	INS	-	-	G	rs368386866		TCGA-AG-3882-01	TCGA-AG-3882-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:50374935_50374936insG	ENST00000391833.1	-	3	2484_2485	c.495_496insC	c.(493-498)cccaccfs	p.T166fs	AKT1S1_ENST00000344175.5_Frame_Shift_Ins_p.T166fs|AKT1S1_ENST00000391831.1_Frame_Shift_Ins_p.T166fs|AKT1S1_ENST00000391832.3_Frame_Shift_Ins_p.T166fs|AKT1S1_ENST00000391834.2_Frame_Shift_Ins_p.T166fs|AKT1S1_ENST00000391835.1_Frame_Shift_Ins_p.T186fs	NM_001278160.1	NP_001265089.1			AKT1 substrate 1 (proline-rich)									p.P165P(1)		kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		ACTGAGCAGGTGGGGGGGCCGG	0.649																																					p.T166fs												.	.	1	Substitution - coding silent(1)	kidney(1)	c.496_497insC	19						.																																			55066748	SO:0001589	frameshift_variant	84335	exon4			BC022241	CCDS12784.1, CCDS59410.1	19q13.33	2008-02-05			ENSG00000204673	ENSG00000204673			28426	protein-coding gene	gene with protein product	"""proline-rich Akt substrate, 40 kDa"""	610221				12524439	Standard	NM_032375		Approved	PRAS40, MGC2865, Lobe	uc031rmg.1	Q96B36	OTTHUMG00000150246	ENST00000391833.1:c.496dupC	19.37:g.50374942_50374942dupG	ENSP00000375709:p.Thr166fs		55066747	NM_001098632		Frame_Shift_Ins	INS	ENST00000391833.1	37	CCDS12784.1																																																																																				0.649	AKT1S1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317073.1	NM_032375	
MEN1	4221	broad.mit.edu	37	11	64572092	64572093	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-3882-01	TCGA-AG-3882-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr11:64572092_64572093insG	ENST00000337652.1	-	10	2064_2065	c.1561_1562insC	c.(1561-1563)cggfs	p.R521fs	MEN1_ENST00000377313.1_Frame_Shift_Ins_p.R521fs|MEN1_ENST00000377321.1_Frame_Shift_Ins_p.R481fs|MEN1_ENST00000394374.2_Frame_Shift_Ins_p.R521fs|MAP4K2_ENST00000468062.1_5'Flank|MEN1_ENST00000443283.1_Frame_Shift_Ins_p.R521fs|MEN1_ENST00000312049.6_Frame_Shift_Ins_p.R516fs|MEN1_ENST00000377316.2_Frame_Shift_Ins_p.R461fs|MAP4K2_ENST00000294066.2_5'Flank|MEN1_ENST00000377326.3_Frame_Shift_Ins_p.R516fs|MEN1_ENST00000315422.4_Frame_Shift_Ins_p.R516fs|MAP4K2_ENST00000377350.3_5'Flank|MEN1_ENST00000394376.1_Frame_Shift_Ins_p.R521fs|MEN1_ENST00000478548.1_5'UTR	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	521					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.R516fs*15(3)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						AGGAGGCTTCCGGGGGGGTCCT	0.713			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.R521fs	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	.	3	Insertion - Frameshift(3)	parathyroid(2)|large_intestine(1)	c.1562_1563insC	11	GRCh37	CD972318|CI972640|CM080439	MEN1	D|I|M		.																																			64328669	SO:0001589	frameshift_variant	4221	exon10	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.1562dupC	11.37:g.64572099_64572099dupG	ENSP00000337088:p.Arg521fs		64328668	NM_130800	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Frame_Shift_Ins	INS	ENST00000337652.1	37	CCDS8083.1																																																																																				0.713	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
APC	324	broad.mit.edu	37	5	112164663	112164664	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-3882-01	TCGA-AG-3882-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr5:112164663_112164664insA	ENST00000457016.1	+	14	2117_2118	c.1737_1738insA	c.(1738-1740)aaafs	p.K580fs	APC_ENST00000257430.4_Frame_Shift_Ins_p.K580fs|CTC-554D6.1_ENST00000520401.1_Frame_Shift_Ins_p.LK75fs|APC_ENST00000508376.2_Frame_Shift_Ins_p.K580fs			P25054	APC_HUMAN	adenomatous polyposis coli	580	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E582fs*20(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTTTAGAAGTTAAAAAGGTACC	0.342		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.V579fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)	c.1737_1738insA	5						.																																			112192563	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1742dupA	5.37:g.112164668_112164668dupA	ENSP00000413133:p.Lys580fs		112192562	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.342	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CCZ1	51622	broad.mit.edu	37	7	5940194	5940194	+	Silent	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr7:5940194C>T	ENST00000325974.6	+	3	375	c.309C>T	c.(307-309)gtC>gtT	p.V103V	CCZ1_ENST00000537980.1_Intron	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	103						lysosome (GO:0005764)|membrane (GO:0016020)		p.V103V(1)		large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						TCTGGATGGTCATGGTATTTA	0.363																																					p.V103V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C309T	7						.						12.0	13.0	13.0					7																	5940194		2063	4194	6257	5906720	SO:0001819	synonymous_variant	51622	exon3			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.309C>T	7.37:g.5940194C>T			5906720	NM_015622	A2RU45|O95766|Q9UG65|Q9Y359	Silent	SNP	ENST00000325974.6	37	CCDS34597.1																																																																																				0.363	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340391.1	NM_015622	
WNT2	7472	broad.mit.edu	37	7	116918295	116918295	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr7:116918295C>T	ENST00000265441.3	-	5	1296	c.997G>A	c.(997-999)Gcc>Acc	p.A333T		NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	333					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)	p.A333T(1)		breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CAGCGCACGGCGCAGCACCAG	0.602																																					p.A333T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G997A	7						.						154.0	109.0	124.0					7																	116918295		2203	4300	6503	116705531	SO:0001583	missense	7472	exon5			X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.997G>A	7.37:g.116918295C>T	ENSP00000265441:p.Ala333Thr		116705531	NM_003391	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	37	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770547	0.49680	.	.	ENSG00000105989	ENST00000265441	T	0.75477	-0.94	5.87	5.87	0.94306	.	0.051249	0.85682	D	0.000000	T	0.60261	0.2255	N	0.20328	0.56	0.50813	D	0.999896	B;B	0.32573	0.376;0.376	B;B	0.31101	0.124;0.124	T	0.59820	-0.7382	10	0.34782	T	0.22	.	14.0901	0.64984	0.1502:0.8498:0.0:0.0	.	333;333	A4D0V1;P09544	.;WNT2_HUMAN	T	333	ENSP00000265441:A333T	ENSP00000265441:A333T	A	-	1	0	WNT2	116705531	1.000000	0.71417	0.979000	0.43373	0.982000	0.71751	4.676000	0.61627	2.780000	0.95670	0.655000	0.94253	GCC		0.602	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
PTPRT	11122	broad.mit.edu	37	20	40727112	40727112	+	Silent	SNP	G	G	A	rs376065743		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr20:40727112G>A	ENST00000373187.1	-	27	3794	c.3795C>T	c.(3793-3795)ttC>ttT	p.F1265F	PTPRT_ENST00000373184.1_Silent_p.F1275F|PTPRT_ENST00000373193.3_Silent_p.F1268F|PTPRT_ENST00000356100.2_Silent_p.F1274F|PTPRT_ENST00000373190.1_Silent_p.F1264F|PTPRT_ENST00000373201.1_Silent_p.F1255F|PTPRT_ENST00000373198.4_Silent_p.F1284F			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1265	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.F1287F(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGTTGTAATCGAACACCAGCC	0.592																																					p.F1284F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3852T	20						.						73.0	78.0	77.0					20																	40727112		2103	4240	6343	40160526	SO:0001819	synonymous_variant	11122	exon28			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3795C>T	20.37:g.40727112G>A			40160526	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	ENST00000373187.1	37	CCDS42874.1																																																																																				0.592	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
SYT16	83851	broad.mit.edu	37	14	62536483	62536483	+	Missense_Mutation	SNP	G	G	T	rs190756776	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr14:62536483G>T	ENST00000430451.2	+	2	883	c.686G>T	c.(685-687)cGt>cTt	p.R229L	RP11-355I22.5_ENST00000553990.1_lincRNA|SYT16_ENST00000446982.2_Missense_Mutation_p.R229L	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	229					exocytosis (GO:0006887)			p.R229L(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		AAATTCAGCCGTTCGTTGTTG	0.473																																					p.R229L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G686T	14						.						117.0	119.0	118.0					14																	62536483		1975	4150	6125	61606236	SO:0001583	missense	83851	exon2			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.686G>T	14.37:g.62536483G>T	ENSP00000394700:p.Arg229Leu		61606236	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	37	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.591064	0.46214	.	.	ENSG00000139973	ENST00000446982;ENST00000430451	T;T	0.39406	1.08;3.5	5.4	-5.3	0.02738	.	1.577760	0.03166	N	0.170079	T	0.37019	0.0988	L	0.43152	1.355	0.09310	N	0.999998	P;B	0.43352	0.804;0.037	B;B	0.38264	0.269;0.009	T	0.52675	-0.8544	10	0.48119	T	0.1	-0.3326	15.5637	0.76273	0.6632:0.0:0.3368:0.0	.	229;229	B4DZH2;Q17RD7	.;SYT16_HUMAN	L	229	ENSP00000388023:R229L;ENSP00000394700:R229L	ENSP00000394700:R229L	R	+	2	0	SYT16	61606236	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-1.154000	0.03166	-0.937000	0.03719	0.655000	0.94253	CGT		0.473	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
MTHFD1	4522	broad.mit.edu	37	14	64920543	64920543	+	Silent	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr14:64920543C>T	ENST00000545908.1	+	25	2926	c.2697C>T	c.(2695-2697)ccC>ccT	p.P899P	MTHFD1_ENST00000216605.8_Silent_p.P843P|ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000555220.1_Intron|MTHFD1_ENST00000556284.1_3'UTR			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	843	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)	p.P843P(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	AATTACTTCCCGAAGCTCAAC	0.433																																					p.P843P	Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2529T	14						.						169.0	134.0	146.0					14																	64920543		2203	4300	6503	63990296	SO:0001819	synonymous_variant	4522	exon25			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.2697C>T	14.37:g.64920543C>T			63990296	NM_005956	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Silent	SNP	ENST00000545908.1	37																																																																																					0.433	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000412167.1		
DNMT1	1786	broad.mit.edu	37	19	10248656	10248656	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:10248656G>A	ENST00000340748.4	-	35	4332	c.4097C>T	c.(4096-4098)aCg>aTg	p.T1366M	DNMT1_ENST00000540357.1_Missense_Mutation_p.T1366M|DNMT1_ENST00000589538.1_5'Flank|DNMT1_ENST00000359526.4_Missense_Mutation_p.T1382M			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1366	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.T1366M(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GTCTCGCACCGTGATGGTCCG	0.622																																					p.T1382M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4145T	19						.						41.0	34.0	36.0					19																	10248656		2203	4300	6503	10109656	SO:0001583	missense	1786	exon36			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.4097C>T	19.37:g.10248656G>A	ENSP00000345739:p.Thr1366Met		10109656	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	ENST00000340748.4	37	CCDS12228.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152228	0.78001	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	T;T;T	0.53640	0.61;0.61;0.61	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.81123	0.4757	H	0.98133	4.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.996;0.998	D	0.88505	0.3085	10	0.87932	D	0	-31.4871	17.6482	0.88154	0.0:0.0:1.0:0.0	.	1366;1382;1366	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	M	1382;1366;1366;1234	ENSP00000352516:T1382M;ENSP00000440457:T1366M;ENSP00000345739:T1366M	ENSP00000345739:T1366M	T	-	2	0	DNMT1	10109656	1.000000	0.71417	0.984000	0.44739	0.450000	0.32258	9.416000	0.97383	2.446000	0.82766	0.655000	0.94253	ACG		0.622	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
ZNF382	84911	broad.mit.edu	37	19	37100906	37100906	+	Silent	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:37100906G>A	ENST00000292928.2	+	3	203	c.90G>A	c.(88-90)gcG>gcA	p.A30A	ZNF382_ENST00000439428.1_Silent_p.A29A|ZNF382_ENST00000423582.1_Intron|ZNF382_ENST00000435416.1_Silent_p.A30A	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	30	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.|Mediates interaction with TRIM28. {ECO:0000250}.|Represses transcription. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A30A(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CTCAGAAGGCGCTTTACAGGG	0.463																																					p.A30A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G90A	19						.						161.0	146.0	151.0					19																	37100906		2203	4300	6503	41792746	SO:0001819	synonymous_variant	84911	exon3			AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.90G>A	19.37:g.37100906G>A			41792746	NM_032825	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Silent	SNP	ENST00000292928.2	37	CCDS33004.1																																																																																				0.463	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825	
LIPE	3991	broad.mit.edu	37	19	42914515	42914515	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:42914515G>A	ENST00000244289.4	-	2	1639	c.1363C>T	c.(1363-1365)Cgg>Tgg	p.R455W	LIPE-AS1_ENST00000594624.2_RNA|LIPE_ENST00000602000.1_Intron|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	455					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)	p.R455W(1)		breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				ACATACTCCCGGAGGAAGTCG	0.652																																					p.R455W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1363T	19						.						29.0	29.0	29.0					19																	42914515		2202	4300	6502	47606355	SO:0001583	missense	3991	exon2			L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1363C>T	19.37:g.42914515G>A	ENSP00000244289:p.Arg455Trp		47606355	NM_005357	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.998092	0.35226	.	.	ENSG00000079435	ENST00000244289	T	0.32988	1.43	4.2	0.417	0.16421	Hormone-sensitive lipase, N-terminal (1);	0.376195	0.23752	N	0.044913	T	0.46229	0.1382	L	0.60455	1.87	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.68621	0.959;0.938	T	0.36648	-0.9739	10	0.72032	D	0.01	-3.5008	12.0114	0.53289	0.0:0.0:0.4296:0.5704	.	455;455	A8K8W7;Q05469	.;LIPS_HUMAN	W	455	ENSP00000244289:R455W	ENSP00000244289:R455W	R	-	1	2	LIPE	47606355	0.043000	0.20138	0.371000	0.25978	0.243000	0.25628	0.543000	0.23237	0.465000	0.27167	0.455000	0.32223	CGG		0.652	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
ZNF235	9310	broad.mit.edu	37	19	44792182	44792182	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:44792182C>G	ENST00000291182.4	-	5	1508	c.1406G>C	c.(1405-1407)aGt>aCt	p.S469T	ZNF235_ENST00000589248.1_Intron|ZNF235_ENST00000589799.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S469T(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				AAAGCTCAAACTAAAGCACTT	0.388																																					p.S469T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1406C	19						.						113.0	110.0	111.0					19																	44792182		2203	4300	6503	49484022	SO:0001583	missense	9310	exon5			X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.1406G>C	19.37:g.44792182C>G	ENSP00000291182:p.Ser469Thr		49484022	NM_004234	B4DTQ7|O14898|O14899|Q17RR8	Missense_Mutation	SNP	ENST00000291182.4	37	CCDS33048.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892935	0.33442	.	.	ENSG00000159917	ENST00000391957;ENST00000291182	T	0.17854	2.25	4.8	3.74	0.42951	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000129	T	0.15305	0.0369	N	0.10809	0.05	0.09310	N	0.999991	D;D	0.57899	0.977;0.981	P;P	0.59424	0.776;0.857	T	0.13845	-1.0494	10	0.21540	T	0.41	.	8.7209	0.34441	0.0:0.7556:0.1557:0.0887	.	465;469	Q14590-2;Q14590	.;ZN235_HUMAN	T	469	ENSP00000291182:S469T	ENSP00000291182:S469T	S	-	2	0	ZNF235	49484022	0.000000	0.05858	0.900000	0.35374	0.972000	0.66771	-0.619000	0.05572	2.385000	0.81259	0.462000	0.41574	AGT		0.388	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1		
EXOC3L2	90332	broad.mit.edu	37	19	45730933	45730933	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:45730933C>T	ENST00000252482.3	-	4	418	c.391G>A	c.(391-393)Ggc>Agc	p.G131S	EXOC3L2_ENST00000413988.1_Missense_Mutation_p.G131S			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	131					exocytosis (GO:0006887)	exocyst (GO:0000145)		p.G131S(1)		endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		AGTGGGGGGCCGCAGTTGACC	0.602																																					p.G131S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G391A	19						.						77.0	73.0	74.0					19																	45730933		2203	4300	6503	50422773	SO:0001583	missense	90332	exon5			AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.391G>A	19.37:g.45730933C>T	ENSP00000252482:p.Gly131Ser		50422773	NM_138568	Q8N9W2|Q96GV2	Missense_Mutation	SNP	ENST00000252482.3	37	CCDS12657.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722239	0.48728	.	.	ENSG00000130201	ENST00000252482;ENST00000413988	T;T	0.05925	3.37;3.37	5.07	3.97	0.46021	.	0.060613	0.64402	D	0.000004	T	0.15565	0.0375	L	0.57536	1.79	0.33107	D	0.540038	D	0.89917	1.0	D	0.67103	0.949	T	0.05500	-1.0881	10	0.19590	T	0.45	.	9.9665	0.41727	0.2023:0.7977:0.0:0.0	.	131	Q2M3D2	EX3L2_HUMAN	S	131	ENSP00000252482:G131S;ENSP00000400713:G131S	ENSP00000252482:G131S	G	-	1	0	EXOC3L2	50422773	0.998000	0.40836	0.986000	0.45419	0.803000	0.45373	4.482000	0.60257	2.376000	0.81061	0.491000	0.48974	GGC		0.602	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
PRKCG	5582	broad.mit.edu	37	19	54395022	54395022	+	Silent	SNP	G	G	A	rs553245210		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr19:54395022G>A	ENST00000263431.3	+	6	906	c.624G>A	c.(622-624)acG>acA	p.T208T	PRKCG_ENST00000536044.1_Silent_p.T208T|PRKCG_ENST00000540413.1_Silent_p.T208T|PRKCG_ENST00000542049.1_Silent_p.T95T	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	208	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.T208T(2)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	GGAACCTGACGAAACAGAAGA	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17926	0.0		0.0	False		,,,				2504	0.0				p.T208T												PRKCG,large_intestine,NS,Substitution - coding silent,0	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G624A	19						.						142.0	115.0	124.0					19																	54395022		2203	4300	6503	59086834	SO:0001819	synonymous_variant	5582	exon6			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.624G>A	19.37:g.54395022G>A			59086834	NM_002739	B7Z8Q0	Silent	SNP	ENST00000263431.3	37	CCDS12867.1																																																																																				0.522	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
AADACL4	343066	broad.mit.edu	37	1	12726161	12726161	+	Silent	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:12726161C>T	ENST00000376221.1	+	4	639	c.639C>T	c.(637-639)ccC>ccT	p.P213P		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	213						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.P213P(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CAGATCTTCCCCGGATCCGGG	0.567																																					p.P213P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C639T	1						.						80.0	84.0	83.0					1																	12726161		2203	4300	6503	12648748	SO:0001819	synonymous_variant	343066	exon4				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.639C>T	1.37:g.12726161C>T			12648748	NM_001013630		Silent	SNP	ENST00000376221.1	37	CCDS30590.1																																																																																				0.567	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005328.1	NM_001013630	
IGSF3	3321	broad.mit.edu	37	1	117159024	117159024	+	Silent	SNP	C	C	T	rs201692914		TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:117159024C>T	ENST00000369486.3	-	3	864	c.99G>A	c.(97-99)acG>acA	p.T33T	IGSF3_ENST00000318837.6_Silent_p.T33T|IGSF3_ENST00000369483.1_Silent_p.T33T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	33	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T33T(6)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GGGAGCCCTCCGTGCGGTACA	0.547																																					p.T33T												.	.	6	Substitution - coding silent(6)	large_intestine(6)	c.G99A	1						.						18.0	19.0	18.0					1																	117159024		1976	3928	5904	116960547	SO:0001819	synonymous_variant	3321	exon3			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.99G>A	1.37:g.117159024C>T			116960547	NM_001542	A6NJZ6|A6NMC7	Silent	SNP	ENST00000369486.3	37	CCDS30813.1																																																																																				0.547	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
CD5L	922	broad.mit.edu	37	1	157804386	157804386	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:157804386G>A	ENST00000368174.4	-	4	625	c.529C>T	c.(529-531)Cgg>Tgg	p.R177W	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	177	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)	p.R177W(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCAGCTGCCGGCACACCACC	0.597																																					p.R177W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C529T	1						.						88.0	83.0	84.0					1																	157804386		2203	4300	6503	156071010	SO:0001583	missense	922	exon4			U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.529C>T	1.37:g.157804386G>A	ENSP00000357156:p.Arg177Trp		156071010	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	37	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258210	0.59321	.	.	ENSG00000073754	ENST00000368174	T	0.44482	0.92	5.13	4.19	0.49359	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.552418	0.15335	N	0.267793	T	0.62624	0.2443	H	0.94808	3.585	0.28548	N	0.911747	D	0.89917	1.0	D	0.80764	0.994	T	0.62969	-0.6741	10	0.87932	D	0	.	10.3736	0.44068	0.0:0.0:0.6292:0.3708	.	177	O43866	CD5L_HUMAN	W	177	ENSP00000357156:R177W	ENSP00000357156:R177W	R	-	1	2	CD5L	156071010	0.017000	0.18338	1.000000	0.80357	0.630000	0.37929	0.105000	0.15333	1.324000	0.45282	0.655000	0.94253	CGG		0.597	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
CD1B	910	broad.mit.edu	37	1	158300707	158300707	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:158300707C>A	ENST00000368168.3	-	2	314	c.207G>T	c.(205-207)aaG>aaT	p.K69N		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	69					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)		p.K69N(1)		breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					TAGACCAAGGCTTCAGGAATA	0.458																																					p.K69N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G207T	1						.						258.0	251.0	253.0					1																	158300707		2203	4300	6503	156567331	SO:0001583	missense	910	exon2			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.207G>T	1.37:g.158300707C>A	ENSP00000357150:p.Lys69Asn		156567331	NM_001764	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	ENST00000368168.3	37	CCDS1176.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.99|13.99	2.402338|2.402338	0.42613|0.42613	.|.	.|.	ENSG00000158485|ENSG00000158485	ENST00000451207|ENST00000368168	.|T	.|0.06933	.|3.24	4.01|4.01	2.01|2.01	0.26516|0.26516	.|MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.159685	.|0.29501	.|N	.|0.011966	T|T	0.11665|0.11665	0.0284|0.0284	M|M	0.88979|0.88979	2.995|2.995	0.24533|0.24533	N|N	0.994108|0.994108	.|P;P	.|0.49783	.|0.928;0.872	.|P;P	.|0.57846	.|0.828;0.46	T|T	0.06197|0.06197	-1.0840|-1.0840	5|10	.|0.40728	.|T	.|0.16	-19.1782|-19.1782	5.5834|5.5834	0.17262|0.17262	0.0:0.7269:0.0:0.2731|0.0:0.7269:0.0:0.2731	.|.	.|69;69	.|B4E0D2;P29016	.|.;CD1B_HUMAN	S|N	37|69	.|ENSP00000357150:K69N	.|ENSP00000357150:K69N	A|K	-|-	1|3	0|2	CD1B|CD1B	156567331|156567331	0.854000|0.854000	0.29725|0.29725	0.995000|0.995000	0.50966|0.50966	0.444000|0.444000	0.32077|0.32077	0.126000|0.126000	0.15769|0.15769	0.390000|0.390000	0.25115|0.25115	0.655000|0.655000	0.94253|0.94253	GCC|AAG		0.458	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046350.2	NM_001764	
SPTA1	6708	broad.mit.edu	37	1	158619701	158619701	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:158619701C>A	ENST00000368147.4	-	25	3694	c.3514G>T	c.(3514-3516)Gca>Tca	p.A1172S		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1172					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.A1172S(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGTTCATCTGCAAGCCTCTGC	0.463																																					p.A1172S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3514T	1						.						29.0	29.0	29.0					1																	158619701		1839	4097	5936	156886325	SO:0001583	missense	6708	exon25			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3514G>T	1.37:g.158619701C>A	ENSP00000357129:p.Ala1172Ser		156886325	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507713	0.85282	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54479	0.57;0.57	5.08	5.08	0.68730	.	0.000000	0.32120	N	0.006560	T	0.54334	0.1852	M	0.66506	2.035	0.48185	D	0.999601	P	0.45474	0.859	P	0.52646	0.705	T	0.48614	-0.9020	10	0.27082	T	0.32	.	17.2337	0.86992	0.0:1.0:0.0:0.0	.	1172	P02549	SPTA1_HUMAN	S	1172	ENSP00000357130:A1172S;ENSP00000357129:A1172S	ENSP00000357129:A1172S	A	-	1	0	SPTA1	156886325	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	6.743000	0.74848	2.621000	0.88768	0.650000	0.86243	GCA		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
DUSP27	92235	broad.mit.edu	37	1	167096368	167096368	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:167096368C>T	ENST00000361200.2	+	6	2166	c.2000C>T	c.(1999-2001)cCc>cTc	p.P667L	DUSP27_ENST00000443333.1_Missense_Mutation_p.P667L|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.P667L			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	667					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.P667L(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TCTGCAGACCCCTCAGTCAGC	0.637																																					p.P667L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2000T	1						.						45.0	43.0	43.0					1																	167096368		2203	4300	6503	165362992	SO:0001583	missense	92235	exon5			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2000C>T	1.37:g.167096368C>T	ENSP00000354483:p.Pro667Leu		165362992	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	37	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	C	5.657	0.305801	0.10733	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03860	3.78;3.78;3.78	5.1	2.17	0.27698	.	0.994205	0.08162	N	0.988299	T	0.01940	0.0061	L	0.59436	1.845	0.18873	N	0.999988	B	0.31680	0.335	B	0.22386	0.039	T	0.44802	-0.9304	10	0.87932	D	0	-2.4805	6.5076	0.22204	0.0:0.6483:0.1349:0.2168	.	667	Q5VZP5	DUS27_HUMAN	L	667	ENSP00000354483:P667L;ENSP00000271385:P667L;ENSP00000404874:P667L	ENSP00000271385:P667L	P	+	2	0	DUSP27	165362992	0.277000	0.24220	0.015000	0.15790	0.231000	0.25187	2.294000	0.43567	0.527000	0.28560	-0.163000	0.13421	CCC		0.637	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
BRINP3	339479	broad.mit.edu	37	1	190068184	190068184	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3882-01	TCGA-AG-3882-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:190068184T>A	ENST00000367462.3	-	8	1496	c.1265A>T	c.(1264-1266)gAg>gTg	p.E422V	BRINP3_ENST00000534846.1_Missense_Mutation_p.E320V	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	422				E -> K (in Ref. 3; AAD09521). {ECO:0000305}.	cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.E422V(1)									CGAGTGCGTCTCTTCTGAAAA	0.547																																					p.E422V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1265T	1						.						49.0	39.0	43.0					1																	190068184		2203	4300	6503	188334807	SO:0001583	missense	339479	exon8			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1265A>T	1.37:g.190068184T>A	ENSP00000356432:p.Glu422Val		188334807	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	37	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.300141	0.60195	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	D;D	0.87729	-2.29;-2.29	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.89329	0.6684	L	0.58101	1.795	0.58432	D	0.999997	D;P	0.54964	0.969;0.948	P;P	0.53185	0.72;0.529	D	0.90300	0.4329	10	0.72032	D	0.01	.	13.8296	0.63373	0.0:0.0:0.0:1.0	.	320;422	B7Z260;Q76B58	.;FAM5C_HUMAN	V	422;320	ENSP00000356432:E422V;ENSP00000438022:E320V	ENSP00000356432:E422V	E	-	2	0	FAM5C	188334807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.104000	0.71498	2.146000	0.66826	0.482000	0.46254	GAG		0.547	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
HIST3H2BB	128312	broad.mit.edu	37	1	228645872	228645872	+	Silent	SNP	T	T	C			TCGA-AG-3882-01	TCGA-AG-3882-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:228645872T>C	ENST00000369160.2	+	1	65	c.42T>C	c.(40-42)ggT>ggC	p.G14G	HIST3H2A_ENST00000366695.2_5'Flank	NM_175055.2	NP_778225.1	Q8N257	H2B3B_HUMAN	histone cluster 3, H2bb	14					chromatin organization (GO:0006325)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G14G(1)		skin(1)	1		Prostate(94;0.183)				CCAAGAAGGGTTCTAAAAAGG	0.547																																					p.G14G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T42C	1						.						74.0	76.0	75.0					1																	228645872		2203	4300	6503	226712495	SO:0001819	synonymous_variant	128312	exon1			AY131981	CCDS1574.1	1q42.13	2011-01-27	2006-10-11		ENSG00000196890	ENSG00000196890		"""Histones / Replication-dependent"""	20514	protein-coding gene	gene with protein product		615046	"""histone 3, H2bb"""			12408966	Standard	NM_175055		Approved		uc001hsz.3	Q8N257	OTTHUMG00000040045	ENST00000369160.2:c.42T>C	1.37:g.228645872T>C			226712495	NM_175055	A4FU05|Q3ZCP6|Q5TA30	Silent	SNP	ENST00000369160.2	37	CCDS1574.1																																																																																				0.547	HIST3H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096597.1	NM_175055	
FMN2	56776	broad.mit.edu	37	1	240371836	240371836	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr1:240371836G>T	ENST00000319653.9	+	5	3954	c.3724G>T	c.(3724-3726)Ggc>Tgc	p.G1242C		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1242	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G1385C(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCCTGTATCAGGCCCTCCACT	0.582																																					p.G1242C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3724T	1						.						46.0	43.0	44.0					1																	240371836		2203	4300	6503	238438459	SO:0001583	missense	56776	exon5			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3724G>T	1.37:g.240371836G>T	ENSP00000318884:p.Gly1242Cys		238438459	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	g	4.743	0.138141	0.09083	.	.	ENSG00000155816	ENST00000319653	T	0.59364	0.27	4.26	4.26	0.50523	Actin-binding FH2 (1);Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (1);	0.412914	0.19399	U	0.115222	T	0.70736	0.3258	M	0.61703	1.905	0.54753	D	0.999986	D	0.89917	1.0	D	0.68943	0.961	T	0.70392	-0.4884	9	.	.	.	.	13.4923	0.61402	0.0:0.1577:0.8423:0.0	.	1242	Q9NZ56	FMN2_HUMAN	C	1242	ENSP00000318884:G1242C	.	G	+	1	0	FMN2	238438459	0.001000	0.12720	0.115000	0.21578	0.395000	0.30598	0.434000	0.21494	2.203000	0.70933	0.472000	0.43445	GGC		0.582	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
MUC2	4583	broad.mit.edu	37	11	1092884	1092884	+	Missense_Mutation	SNP	C	C	T	rs201415503		TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr11:1092884C>T	ENST00000441003.2	+	30	4730	c.4703C>T	c.(4702-4704)aCg>aTg	p.T1568M	MUC2_ENST00000359061.5_Missense_Mutation_p.T1569M|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1569M(2)|p.T1568M(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCACCACCACGGTGacccca	0.637																																					p.T1568M												.	.	4	Substitution - Missense(4)	large_intestine(2)|skin(2)	c.C4703T	11						.						129.0	172.0	157.0					11																	1092884		1964	3669	5633	1082884	SO:0001583	missense	4583	exon30			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4703C>T	11.37:g.1092884C>T	ENSP00000415183:p.Thr1568Met		1082884	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.409	-0.335727	0.05278	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14893	2.5;2.47	1.63	0.367	0.16140	.	25.055600	0.00797	U	0.001394	T	0.21841	0.0526	.	.	.	0.09310	N	1	D	0.76494	0.999	P	0.48425	0.577	T	0.35301	-0.9794	9	0.45353	T	0.12	.	8.9064	0.35526	0.0:0.7681:0.2319:0.0	.	1568	E7EUV1	.	M	1568;1569	ENSP00000415183:T1568M;ENSP00000351956:T1569M	ENSP00000351956:T1569M	T	+	2	0	MUC2	1082884	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.878000	0.28126	0.945000	0.37605	0.121000	0.15741	ACG		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SLC1A2	6506	broad.mit.edu	37	11	35333789	35333789	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr11:35333789G>A	ENST00000278379.3	-	4	799	c.517C>T	c.(517-519)Cga>Tga	p.R173*	SLC1A2_ENST00000395750.1_Nonsense_Mutation_p.R164*|SLC1A2_ENST00000606205.1_Nonsense_Mutation_p.R173*|SLC1A2_ENST00000395753.1_Nonsense_Mutation_p.R164*	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	173					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.R173*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			AAGAGATTTCGAATAAGGTCC	0.493																																					p.R173X	NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C517T	11						.						211.0	204.0	207.0					11																	35333789		2202	4298	6500	35290365	SO:0001587	stop_gained	6506	exon4			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.517C>T	11.37:g.35333789G>A	ENSP00000278379:p.Arg173*		35290365	NM_004171	B4DQE9|Q14417|Q541G6|U3KQQ4	Nonsense_Mutation	SNP	ENST00000278379.3	37	CCDS31459.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722963	0.89298	.	.	ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753;ENST00000449068	.	.	.	5.66	3.68	0.42216	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7246	14.0878	0.64971	0.0:0.0:0.5567:0.4433	.	.	.	.	X	173;164;164;169	.	ENSP00000278379:R173X	R	-	1	2	SLC1A2	35290365	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	3.084000	0.50143	0.631000	0.30412	0.462000	0.41574	CGA		0.493	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258181.1	NM_004171	
NXF1	10482	broad.mit.edu	37	11	62571337	62571337	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr11:62571337G>A	ENST00000532297.1	-	3	771	c.142C>T	c.(142-144)Cgg>Tgg	p.R48W	NXF1_ENST00000439713.2_Missense_Mutation_p.R48W|NXF1_ENST00000294172.2_Missense_Mutation_p.R48W|NXF1_ENST00000531131.1_Intron|NXF1_ENST00000531709.2_Missense_Mutation_p.R48W			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	48	Interaction with ALYREF/THOC4.|Minor non-specific RNA-binding.|RNA-binding (RBD).				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R48W(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGGGAAGACCGAATACCAGAA	0.517																																					p.R48W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C142T	11						.						131.0	128.0	129.0					11																	62571337		2201	4299	6500	62327913	SO:0001583	missense	10482	exon2			AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.142C>T	11.37:g.62571337G>A	ENSP00000436679:p.Arg48Trp		62327913	NM_006362	B4E269|Q99799|Q9UQL2	Missense_Mutation	SNP	ENST00000532297.1	37	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089437	0.55968	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875;ENST00000439713	T;T;T;T	0.49720	0.83;0.83;0.79;0.77	4.82	4.82	0.62117	.	0.417675	0.25991	N	0.027002	T	0.49575	0.1565	L	0.47716	1.5	0.09310	N	0.999996	D;D;D	0.64830	0.994;0.988;0.99	B;P;P	0.49387	0.431;0.513;0.609	T	0.45338	-0.9268	10	0.36615	T	0.2	-10.6249	15.4751	0.75471	0.0:0.0:1.0:0.0	.	91;61;48	E9PIN3;Q59E96;Q9UBU9	.;.;NXF1_HUMAN	W	48;48;91;48	ENSP00000294172:R48W;ENSP00000436679:R48W;ENSP00000435742:R91W;ENSP00000408864:R48W	ENSP00000294172:R48W	R	-	1	2	NXF1	62327913	0.995000	0.38212	0.662000	0.29724	0.994000	0.84299	3.629000	0.54266	2.503000	0.84419	0.655000	0.94253	CGG		0.517	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
PRDM1	639	broad.mit.edu	37	6	106553539	106553539	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr6:106553539G>A	ENST00000369096.4	+	5	1738	c.1504G>A	c.(1504-1506)Gcc>Acc	p.A502T	PRDM1_ENST00000369089.3_Missense_Mutation_p.A368T|PRDM1_ENST00000369091.2_Missense_Mutation_p.A466T	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	502					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A466T(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		TACCGGGGCCGCCGCCAGCAT	0.672			"""D, N, Mis, F, S"""		DLBCL																																p.A502T			Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1504A	6						.						23.0	29.0	27.0					6																	106553539		2201	4294	6495	106660232	SO:0001583	missense	639	exon5				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.1504G>A	6.37:g.106553539G>A	ENSP00000358092:p.Ala502Thr		106660232	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005472	0.74932	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278;ENST00000369089	T;T;T	0.08634	3.09;3.08;3.07	5.74	5.74	0.90152	.	0.191274	0.56097	N	0.000030	T	0.16811	0.0404	L	0.52364	1.645	0.45330	D	0.998326	D;D	0.89917	1.0;0.999	D;P	0.74348	0.983;0.851	T	0.01245	-1.1407	10	0.32370	T	0.25	-23.5711	19.9279	0.97110	0.0:0.0:1.0:0.0	.	368;502	Q86WM7;O75626	.;PRDM1_HUMAN	T	466;502;465;368	ENSP00000358087:A466T;ENSP00000358092:A502T;ENSP00000358085:A368T	ENSP00000358085:A368T	A	+	1	0	PRDM1	106660232	1.000000	0.71417	0.194000	0.23346	0.823000	0.46562	6.291000	0.72719	2.715000	0.92844	0.655000	0.94253	GCC		0.672	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
CCDC170	80129	broad.mit.edu	37	6	151914317	151914317	+	Missense_Mutation	SNP	C	C	T	rs550166524		TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr6:151914317C>T	ENST00000239374.7	+	8	1468	c.1369C>T	c.(1369-1371)Cgg>Tgg	p.R457W	CCDC170_ENST00000367290.5_Missense_Mutation_p.R457W	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	457								p.R457W(1)									CTTTGACATGCGGCTGGACGT	0.443																																					p.R457W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1369T	6						.						105.0	97.0	99.0					6																	151914317		1915	4139	6054	151956010	SO:0001583	missense	80129	exon8			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1369C>T	6.37:g.151914317C>T	ENSP00000239374:p.Arg457Trp		151956010	NM_025059	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	ENST00000239374.7	37	CCDS43515.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262719	0.59431	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.09350	2.99;2.99	5.87	4.09	0.47781	.	0.277720	0.34777	N	0.003697	T	0.15262	0.0368	M	0.75447	2.3	0.42436	D	0.992693	D	0.76494	0.999	P	0.59221	0.854	T	0.01195	-1.1422	10	0.48119	T	0.1	-1.4138	9.9802	0.41809	0.29:0.643:0.0:0.0671	.	457	Q8IYT3	CF097_HUMAN	W	457	ENSP00000239374:R457W;ENSP00000356259:R457W	ENSP00000239374:R457W	R	+	1	2	C6orf97	151956010	1.000000	0.71417	1.000000	0.80357	0.448000	0.32197	1.863000	0.39459	0.927000	0.37143	-0.127000	0.14921	CGG		0.443	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059	
TP53	7157	broad.mit.edu	37	17	7577106	7577106	+	Missense_Mutation	SNP	G	G	C	rs17849781		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr17:7577106G>C	ENST00000269305.4	-	8	1021	c.832C>G	c.(832-834)Cct>Gct	p.P278A	TP53_ENST00000359597.4_Missense_Mutation_p.P278A|TP53_ENST00000455263.2_Missense_Mutation_p.P278A|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.P278A|TP53_ENST00000445888.2_Missense_Mutation_p.P278A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	278	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation; dbSNP:rs17849781). {ECO:0000269|PubMed:15489334}.|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.|P -> R (in sporadic cancers; somatic mutation).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:9450901}.|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.P278S(55)|p.P278A(24)|p.P278T(23)|p.0?(8)|p.P278F(3)|p.P278fs*67(3)|p.?(2)|p.P278fs*28(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.C275fs*67(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C277_P278insXXXXXXX(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCTCCCAGGACAGGCACAA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P278A	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,0	.	131	Substitution - Missense(105)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Insertion - Frameshift(2)|Unknown(2)|Insertion - In frame(1)	upper_aerodigestive_tract(19)|breast(18)|skin(16)|large_intestine(14)|oesophagus(11)|lung(11)|central_nervous_system(7)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|ovary(4)|bone(4)|kidney(3)|endometrium(3)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|eye(1)|biliary_tract(1)|liver(1)|prostate(1)	c.C832G	17	GRCh37	CM011015|CM052927	TP53	M	rs17849781	.						72.0	62.0	65.0					17																	7577106		2203	4300	6503	7517831	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.832C>G	17.37:g.7577106G>C	ENSP00000269305:p.Pro278Ala		7517831	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954842	0.92726	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99880	-7.46;-7.46;-7.46;-7.46;-7.46;-7.46	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050655	0.85682	D	0.000000	D	0.99894	0.9949	M	0.88570	2.965	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.97110	0.992;1.0;0.991;0.988	D	0.96234	0.9170	10	0.72032	D	0.01	-13.7877	16.1198	0.81342	0.0:0.0:1.0:0.0	rs17849781	278;278;278;278	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	A	278;278;278;278;278;267;146	ENSP00000352610:P278A;ENSP00000269305:P278A;ENSP00000398846:P278A;ENSP00000391127:P278A;ENSP00000391478:P278A;ENSP00000425104:P146A	ENSP00000269305:P278A	P	-	1	0	TP53	7517831	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.573000	0.98181	2.667000	0.90743	0.462000	0.41574	CCT		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MRC2	9902	broad.mit.edu	37	17	60742200	60742200	+	Missense_Mutation	SNP	G	G	A	rs370889422		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr17:60742200G>A	ENST00000303375.5	+	2	812	c.410G>A	c.(409-411)cGc>cAc	p.R137H		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	137	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.R137H(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CTGGGGGCCCGCACCAGCAAC	0.617																																					p.R137H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G410A	17						.	G	HIS/ARG	0,4406		0,0,2203	59.0	55.0	57.0		410	3.7	0.9	17		57	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRC2	NM_006039.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	137/1480	60742200	1,13005	2203	4300	6503	58095932	SO:0001583	missense	9902	exon2			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.410G>A	17.37:g.60742200G>A	ENSP00000307513:p.Arg137His		58095932	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	37	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856718	0.32791	0.0	1.16E-4	ENSG00000011028	ENST00000303375	T	0.29917	1.55	4.7	3.66	0.41972	Ricin B-related lectin (1);Ricin B lectin (1);	0.389653	0.27172	N	0.020593	T	0.22704	0.0548	L	0.36672	1.1	0.58432	D	0.999996	D	0.53151	0.958	B	0.42214	0.38	T	0.01081	-1.1458	10	0.33141	T	0.24	-11.1172	9.8054	0.40791	0.1694:0.0:0.8306:0.0	.	137	Q9UBG0	MRC2_HUMAN	H	137	ENSP00000307513:R137H	ENSP00000307513:R137H	R	+	2	0	MRC2	58095932	0.986000	0.35501	0.928000	0.36995	0.282000	0.26991	2.048000	0.41278	2.450000	0.82876	0.561000	0.74099	CGC		0.617	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
COL18A1	80781	broad.mit.edu	37	21	46901899	46901899	+	Missense_Mutation	SNP	G	G	A	rs373536407		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr21:46901899G>A	ENST00000359759.4	+	13	2900	c.2879G>A	c.(2878-2880)aGa>aAa	p.R960K	COL18A1_ENST00000355480.5_Missense_Mutation_p.R725K|COL18A1_ENST00000400337.2_Missense_Mutation_p.R545K			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	960	Triple-helical region 3 (COL3).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)	p.R725K(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCTCCGGGAAGAGAGGGGCCC	0.607																																					p.R725K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2174A	21						.						31.0	38.0	35.0					21																	46901899		1867	4092	5959	45726327	SO:0001583	missense	80781	exon13				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2879G>A	21.37:g.46901899G>A	ENSP00000352798:p.Arg960Lys		45726327	NM_030582	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	G	0.077	-1.189983	0.01607	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	D;D;D	0.93366	-3.13;-3.21;-3.21	3.83	-4.57	0.03421	.	1.360120	0.04823	N	0.437224	T	0.80358	0.4608	N	0.02960	-0.455	0.09310	N	0.999993	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.74247	-0.3727	10	0.05959	T	0.93	.	11.4664	0.50241	0.7423:0.0:0.2577:0.0	.	960;725;545	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	K	545;545;725;960;960	ENSP00000383191:R545K;ENSP00000347665:R725K;ENSP00000352798:R960K	ENSP00000347665:R725K	R	+	2	0	COL18A1	45726327	0.000000	0.05858	0.297000	0.24988	0.407000	0.30961	-0.624000	0.05540	-1.536000	0.01738	-1.626000	0.00786	AGA		0.607	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
ITGAL	3683	broad.mit.edu	37	16	30521753	30521753	+	Silent	SNP	T	T	A			TCGA-AG-3882-01	TCGA-AG-3882-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr16:30521753T>A	ENST00000356798.6	+	22	2760	c.2580T>A	c.(2578-2580)tcT>tcA	p.S860S	ITGAL_ENST00000358164.5_Silent_p.S776S|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	860					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)	p.S860S(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GGGCATTATCTTGCAATGTGA	0.562																																					p.S776S	NSCLC(110;1462 1641 3311 33990 49495)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2328A	16						.						130.0	116.0	120.0					16																	30521753		2197	4300	6497	30429254	SO:0001819	synonymous_variant	3683	exon20				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2580T>A	16.37:g.30521753T>A			30429254	NM_001114380	O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	ENST00000356798.6	37	CCDS32433.1																																																																																				0.562	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
CLEC18C	283971	broad.mit.edu	37	16	70211370	70211370	+	Missense_Mutation	SNP	C	C	G	rs3869428	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr16:70211370C>G	ENST00000569347.2	+	3	697	c.443C>G	c.(442-444)aCc>aGc	p.T148S	CLEC18C_ENST00000536907.2_Missense_Mutation_p.T148S|CLEC18C_ENST00000561612.1_Intron|CLEC18C_ENST00000314151.8_Missense_Mutation_p.T148S|CLEC18C_ENST00000541793.2_Missense_Mutation_p.T148S	NM_173619.2	NP_775890.2	Q8NCF0	CL18C_HUMAN	C-type lectin domain family 18, member C	148	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)	p.T148S(1)		endometrium(3)|large_intestine(6)|lung(1)	10						GCCACCTGCACCCACTACACG	0.602																																					p.T148S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C443G	16						.						12.0	11.0	11.0					16																	70211370		2072	4009	6081	68768871	SO:0001583	missense	283971	exon3			AL833339	CCDS32473.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157335		"""C-type lectin domain containing"""	28538	protein-coding gene	gene with protein product						12477932	Standard	XM_005255906		Approved	MGC34761		Q8NCF0		ENST00000569347.2:c.443C>G	16.37:g.70211370C>G	ENSP00000455920:p.Thr148Ser		68768871	NM_173619	Q8IUW8	Missense_Mutation	SNP	ENST00000569347.2	37	CCDS32473.1	.	.	.	.	.	.	.	.	.	.	c	6.117	0.389845	0.11581	.	.	ENSG00000157335	ENST00000541793;ENST00000314151;ENST00000433156;ENST00000539438;ENST00000536907	T;T;T	0.07688	3.17;3.17;3.17	4.32	2.09	0.27110	CAP domain (3);	0.557277	0.19650	N	0.109248	T	0.06508	0.0167	L	0.28344	0.845	0.21802	N	0.999531	B	0.10296	0.003	B	0.12837	0.008	T	0.30851	-0.9964	10	0.51188	T	0.08	.	10.1296	0.42672	0.0:0.6029:0.3971:0.0	.	148	Q8NCF0	CL18C_HUMAN	S	148;148;148;144;148	ENSP00000444875:T148S;ENSP00000326538:T148S;ENSP00000444726:T148S	ENSP00000326538:T148S	T	+	2	0	CLEC18C	68768871	0.141000	0.22595	1.000000	0.80357	0.135000	0.20990	1.141000	0.31528	0.903000	0.36546	0.298000	0.19748	ACC		0.602	CLEC18C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434588.2	NM_173619	
EMILIN2	84034	broad.mit.edu	37	18	2885079	2885079	+	Silent	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr18:2885079C>T	ENST00000254528.3	+	3	534	c.375C>T	c.(373-375)ccC>ccT	p.P125P		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	125					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)	p.P125P(1)		breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		CCAAAGACCCCGTGAAGACCC	0.502																																					p.P125P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C375T	18						.						87.0	82.0	84.0					18																	2885079		2203	4300	6503	2875079	SO:0001819	synonymous_variant	84034	exon3			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.375C>T	18.37:g.2885079C>T			2875079	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Silent	SNP	ENST00000254528.3	37	CCDS11828.1																																																																																				0.502	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
VGLL4	9686	broad.mit.edu	37	3	11684941	11684941	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3882-01	TCGA-AG-3882-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr3:11684941T>G	ENST00000430365.2	-	1	457	c.52A>C	c.(52-54)Aac>Cac	p.N18H	VGLL4_ENST00000404339.1_Intron|VGLL4_ENST00000273038.3_Intron	NM_001128219.1	NP_001121691.1	Q14135	VGLL4_HUMAN	vestigial-like family member 4	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.N18H(1)		NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ATATTGTTGTTCATCTTGTCC	0.473																																					p.N18H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A52C	3						.						203.0	194.0	197.0					3																	11684941		1568	3582	5150	11659941	SO:0001583	missense	9686	exon1			D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000430365.2:c.52A>C	3.37:g.11684941T>G	ENSP00000404251:p.Asn18His		11659941	NM_001128219	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Missense_Mutation	SNP	ENST00000430365.2	37	CCDS46754.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.549815	0.86127	.	.	ENSG00000144560	ENST00000430365	T	0.50813	0.73	5.63	5.63	0.86233	.	.	.	.	.	T	0.62986	0.2473	L	0.59436	1.845	0.80722	D	1	D	0.67145	0.996	D	0.63877	0.919	T	0.66060	-0.6017	9	0.72032	D	0.01	.	14.441	0.67318	0.0:0.0:0.0:1.0	.	18	G5E9M7	.	H	18	ENSP00000404251:N18H	ENSP00000404251:N18H	N	-	1	0	VGLL4	11659941	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.131000	0.77243	2.145000	0.66743	0.533000	0.62120	AAC		0.473	VGLL4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339133.1	NM_014667	
PHLDB2	90102	broad.mit.edu	37	3	111681012	111681012	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr3:111681012G>A	ENST00000431670.2	+	13	3341	c.2930G>A	c.(2929-2931)cGc>cAc	p.R977H	PHLDB2_ENST00000481953.1_Missense_Mutation_p.R934H|PHLDB2_ENST00000412622.1_Missense_Mutation_p.R934H|PHLDB2_ENST00000393925.3_Missense_Mutation_p.R977H|PHLDB2_ENST00000393923.3_Missense_Mutation_p.R961H|PHLDB2_ENST00000495180.1_Missense_Mutation_p.R468H|PHLDB2_ENST00000470699.2_3'UTR	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	977						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.R934H(1)|p.R977H(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TTTTATAACCGCACAGCATCT	0.398																																					p.R977H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2930A	3						.						125.0	122.0	123.0					3																	111681012		2203	4300	6503	113163702	SO:0001583	missense	90102	exon13				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.2930G>A	3.37:g.111681012G>A	ENSP00000405405:p.Arg977His		113163702	NM_001134439	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085975	0.94100	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.55930	0.49;0.49;0.49;0.49;0.49;0.49;0.49	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.69106	0.3074	L	0.55743	1.74	0.58432	D	0.999999	P;D;D;D;D	0.89917	0.95;1.0;1.0;1.0;1.0	B;D;D;D;D	0.74674	0.313;0.962;0.972;0.984;0.984	T	0.69277	-0.5187	10	0.72032	D	0.01	.	17.3945	0.87441	0.0:0.0:1.0:0.0	.	96;468;977;934;961	Q658P8;E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;.;PHLB2_HUMAN;.;.	H	961;977;934;934;977;934;468	ENSP00000377500:R961H;ENSP00000405405:R977H;ENSP00000405292:R934H;ENSP00000418296:R934H;ENSP00000377502:R977H;ENSP00000418319:R934H;ENSP00000420303:R468H	ENSP00000377500:R961H	R	+	2	0	PHLDB2	113163702	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.802000	0.91910	2.840000	0.97914	0.655000	0.94253	CGC		0.398	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
GSK3B	2932	broad.mit.edu	37	3	119582401	119582401	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr3:119582401G>T	ENST00000264235.8	-	9	1943	c.961C>A	c.(961-963)Ctg>Atg	p.L321M	GSK3B_ENST00000473886.1_5'UTR|GSK3B_ENST00000316626.5_Missense_Mutation_p.L334M	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	321	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)	p.L334M(2)		endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	GTATACTCCAGCAGACGGCTA	0.443																																					p.L334M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1000A	3						.						95.0	87.0	90.0					3																	119582401		2203	4300	6503	121065091	SO:0001583	missense	2932	exon10			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.961C>A	3.37:g.119582401G>T	ENSP00000264235:p.Leu321Met		121065091	NM_002093	D3DN89|Q9BWH3|Q9UL47	Missense_Mutation	SNP	ENST00000264235.8	37	CCDS54628.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862379	0.71949	.	.	ENSG00000082701	ENST00000264235;ENST00000316626;ENST00000539838	T;T	0.73575	-0.76;-0.76	5.03	3.25	0.37280	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84606	0.5509	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.85517	0.1201	10	0.87932	D	0	-5.8294	11.72	0.51677	0.1407:0.0:0.8593:0.0	.	321;334	P49841;P49841-2	GSK3B_HUMAN;.	M	321;334;38	ENSP00000264235:L321M;ENSP00000324806:L334M	ENSP00000264235:L321M	L	-	1	2	GSK3B	121065091	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.462000	0.45049	0.830000	0.34757	0.650000	0.86243	CTG		0.443	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258240.2		
MASP1	5648	broad.mit.edu	37	3	186978589	186978589	+	Missense_Mutation	SNP	C	C	T	rs115241263	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr3:186978589C>T	ENST00000337774.5	-	4	876	c.487G>A	c.(487-489)Ggc>Agc	p.G163S	MASP1_ENST00000392470.2_Missense_Mutation_p.G137S|MASP1_ENST00000296280.6_Missense_Mutation_p.G163S|MASP1_ENST00000392472.2_Missense_Mutation_p.G50S|MASP1_ENST00000169293.6_Missense_Mutation_p.G163S|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	163	EGF-like; calcium-binding.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.G163S(2)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CAGTAGTAGCCGCCAATGTAG	0.547													C|||	3	0.000599042	0.0023	0.0	5008	,	,		17272	0.0		0.0	False		,,,				2504	0.0				p.G163S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G487A	3						.						156.0	112.0	127.0					3																	186978589		2203	4300	6503	188461283	SO:0001583	missense	5648	exon4			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.487G>A	3.37:g.186978589C>T	ENSP00000336792:p.Gly163Ser		188461283	NM_001031849	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	33	5.270470	0.95429	.	.	ENSG00000127241	ENST00000337774;ENST00000296280;ENST00000392472;ENST00000541896;ENST00000169293;ENST00000392470;ENST00000392475	D;D;D;D;D;D	0.97016	-2.48;-2.48;-2.48;-2.48;-2.48;-4.21	5.57	5.57	0.84162	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);	0.000000	0.85682	D	0.000000	D	0.93680	0.7981	N	0.11341	0.13	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;P;D;D;D	0.97110	0.993;0.902;1.0;0.996;0.994	D	0.92089	0.5679	10	0.15952	T	0.53	.	18.9138	0.92496	0.0:1.0:0.0:0.0	.	137;163;50;163;163	F8W876;P48740-3;P48740-4;P48740-2;P48740	.;.;.;.;MASP1_HUMAN	S	163;163;50;50;163;137;170	ENSP00000336792:G163S;ENSP00000296280:G163S;ENSP00000376264:G50S;ENSP00000169293:G163S;ENSP00000376262:G137S;ENSP00000376267:G170S	ENSP00000169293:G163S	G	-	1	0	MASP1	188461283	1.000000	0.71417	0.953000	0.39169	0.814000	0.46013	5.869000	0.69613	2.778000	0.95560	0.650000	0.86243	GGC		0.547	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
RNFT2	84900	broad.mit.edu	37	12	117287165	117287165	+	Missense_Mutation	SNP	G	G	A	rs571206253	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr12:117287165G>A	ENST00000257575.4	+	11	1480	c.1247G>A	c.(1246-1248)cGc>cAc	p.R416H	RNFT2_ENST00000551251.1_Intron|RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000392549.2_Missense_Mutation_p.R416H|RNFT2_ENST00000319176.7_Intron			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	416						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.R416H(1)		endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		GACCGTGAGCGCACCTGCCCG	0.652													G|||	4	0.000798722	0.0008	0.0	5008	,	,		14831	0.0		0.0	False		,,,				2504	0.0031				p.R416H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1247A	12						.						18.0	22.0	21.0					12																	117287165		2111	4111	6222	115771548	SO:0001583	missense	84900	exon11			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.1247G>A	12.37:g.117287165G>A	ENSP00000257575:p.Arg416His		115771548	NM_001109903	E9PAM7|Q96SU5	Missense_Mutation	SNP	ENST00000257575.4	37	CCDS44987.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258200	0.80246	.	.	ENSG00000135119	ENST00000257575;ENST00000392549	T;T	0.44482	0.92;0.92	5.19	4.19	0.49359	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.28234	0.0697	N	0.21240	0.645	0.44946	D	0.997961	B	0.13594	0.008	B	0.12837	0.008	T	0.05599	-1.0875	9	0.45353	T	0.12	-5.2798	9.0244	0.36220	0.2367:0.0:0.7633:0.0	.	416	Q96EX2	RNFT2_HUMAN	H	416	ENSP00000257575:R416H;ENSP00000376332:R416H	ENSP00000257575:R416H	R	+	2	0	RNFT2	115771548	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.485000	0.53208	1.010000	0.39314	0.549000	0.68633	CGC		0.652	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320417.1	NM_032814	
LRRK2	120892	broad.mit.edu	37	12	40716270	40716270	+	Missense_Mutation	SNP	C	C	A	rs72547980	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr12:40716270C>A	ENST00000298910.7	+	37	5525	c.5467C>A	c.(5467-5469)Caa>Aaa	p.Q1823K		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1823					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.Q1786K(1)|p.Q1823K(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGAAGAACATCAAAAAATCTT	0.343																																					p.Q1823K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5467A	12						.	C	LYS/GLN	2,4404	4.2+/-10.8	0,2,2201	116.0	116.0	116.0		5467	3.7	1.0	12	dbSNP_130	116	0,8600		0,0,4300	no	missense	LRRK2	NM_198578.3	53	0,2,6501	AA,AC,CC		0.0,0.0454,0.0154	benign	1823/2528	40716270	2,13004	2203	4300	6503	39002537	SO:0001583	missense	120892	exon37			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5467C>A	12.37:g.40716270C>A	ENSP00000298910:p.Gln1823Lys		39002537	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539342	0.27475	4.54E-4	0.0	ENSG00000188906	ENST00000298910	T	0.72051	-0.62	5.58	3.73	0.42828	.	0.151473	0.49916	D	0.000124	T	0.45236	0.1332	N	0.08118	0	0.34446	D	0.700174	B;B	0.14012	0.004;0.009	B;B	0.08055	0.002;0.003	T	0.48139	-0.9061	10	0.15499	T	0.54	.	8.8358	0.35111	0.2622:0.669:0.0:0.0687	.	1823;1823	Q17RV3;Q5S007	.;LRRK2_HUMAN	K	1823	ENSP00000298910:Q1823K	ENSP00000298910:Q1823K	Q	+	1	0	LRRK2	39002537	0.998000	0.40836	0.999000	0.59377	0.748000	0.42578	0.608000	0.24223	1.334000	0.45468	-0.158000	0.13435	CAA		0.343	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
NELL2	4753	broad.mit.edu	37	12	44913930	44913930	+	Missense_Mutation	SNP	G	G	A	rs141156235		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr12:44913930G>A	ENST00000429094.2	-	19	2762	c.2258C>T	c.(2257-2259)cCg>cTg	p.P753L	NELL2_ENST00000549027.1_Missense_Mutation_p.P752L|NELL2_ENST00000452445.2_Missense_Mutation_p.P753L|NELL2_ENST00000395487.2_Missense_Mutation_p.P752L|NELL2_ENST00000333837.4_Missense_Mutation_p.P776L|NELL2_ENST00000437801.2_Missense_Mutation_p.P803L|NELL2_ENST00000551601.1_Missense_Mutation_p.P705L	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	753	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.P753L(1)|p.P803L(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GACACAGCGCGGGCAGCACTC	0.542																																					p.P753L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2258T	12						.	G	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	93.0	77.0	82.0		2408,2258,2255,2327,2258	3.3	0.7	12	dbSNP_134	82	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	NELL2	NM_001145107.1,NM_001145108.1,NM_001145109.1,NM_001145110.1,NM_006159.2	98,98,98,98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	803/867,753/817,752/816,776/840,753/817	44913930	1,13005	2203	4300	6503	43200197	SO:0001583	missense	4753	exon19			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2258C>T	12.37:g.44913930G>A	ENSP00000390680:p.Pro753Leu		43200197	NM_001145108	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319157	0.81469	0.0	1.16E-4	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801	T;T;T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71;-0.71;-0.71	5.21	3.34	0.38264	von Willebrand factor, type C (4);	0.238554	0.43416	D	0.000580	D	0.85401	0.5688	H	0.94734	3.575	0.80722	D	1	P;D;D;D;D	0.76494	0.727;0.998;0.999;0.973;0.994	B;P;P;P;P	0.60117	0.212;0.869;0.766;0.463;0.869	D	0.87160	0.2214	10	0.59425	D	0.04	0.2169	12.0246	0.53362	0.0:0.1316:0.7313:0.1371	.	776;803;705;753;752	B7Z2U7;B7Z9U3;F8VVB6;Q99435;Q96JS2	.;.;.;NELL2_HUMAN;.	L	752;753;705;753;752;776;803	ENSP00000378866:P752L;ENSP00000390680:P753L;ENSP00000449332:P705L;ENSP00000394612:P753L;ENSP00000447927:P752L;ENSP00000327988:P776L;ENSP00000416341:P803L	ENSP00000327988:P776L	P	-	2	0	NELL2	43200197	1.000000	0.71417	0.655000	0.29622	0.899000	0.52679	4.861000	0.62969	0.545000	0.28902	0.650000	0.86243	CCG		0.542	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
PIWIL1	9271	broad.mit.edu	37	12	130840103	130840103	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3882-01	TCGA-AG-3882-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr12:130840103A>G	ENST00000245255.3	+	12	1567	c.1295A>G	c.(1294-1296)gAt>gGt	p.D432G		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	432					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.D432G(1)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TACAGAAACGATAATGTTCAA	0.408																																					p.D432G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1295G	12						.						184.0	190.0	188.0					12																	130840103		2203	4300	6503	129406056	SO:0001583	missense	9271	exon12			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1295A>G	12.37:g.130840103A>G	ENSP00000245255:p.Asp432Gly		129406056	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.720974	0.30503	.	.	ENSG00000125207	ENST00000245255	T	0.11495	2.77	5.39	5.39	0.77823	Ribonuclease H-like (1);	0.321079	0.37906	N	0.001898	T	0.10895	0.0266	L	0.40543	1.245	0.34477	D	0.703455	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.10989	-1.0606	10	0.27785	T	0.31	-27.1637	14.6233	0.68602	1.0:0.0:0.0:0.0	.	432;432	Q96J94;Q96J94-2	PIWL1_HUMAN;.	G	432	ENSP00000245255:D432G	ENSP00000245255:D432G	D	+	2	0	PIWIL1	129406056	0.996000	0.38824	0.768000	0.31515	0.902000	0.53008	2.972000	0.49256	2.046000	0.60703	0.529000	0.55759	GAT		0.408	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
LACTB	114294	broad.mit.edu	37	15	63433525	63433525	+	Missense_Mutation	SNP	G	G	A	rs566925626		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr15:63433525G>A	ENST00000261893.4	+	6	1237	c.1165G>A	c.(1165-1167)Gtg>Atg	p.V389M	RPS27L_ENST00000559763.1_Intron	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	389						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)	p.V389M(1)		NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						CACACCTTACGTGGATAACTC	0.373													G|||	1	0.000199681	0.0	0.0	5008	,	,		19972	0.001		0.0	False		,,,				2504	0.0				p.V389M	Melanoma(85;443 1381 6215 27308 35583)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1165A	15						.						141.0	135.0	137.0					15																	63433525		2203	4300	6503	61220578	SO:0001583	missense	114294	exon6			AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.1165G>A	15.37:g.63433525G>A	ENSP00000261893:p.Val389Met		61220578	NM_032857	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401993	0.83120	.	.	ENSG00000103642	ENST00000261893	T	0.45276	0.9	5.64	5.64	0.86602	Beta-lactamase/transpeptidase-like (2);Beta-lactamase-related (1);	0.000000	0.85682	D	0.000000	T	0.64204	0.2577	M	0.76002	2.32	0.80722	D	1	D	0.71674	0.998	D	0.63033	0.91	T	0.63166	-0.6698	10	0.48119	T	0.1	-16.2437	19.0467	0.93022	0.0:0.0:1.0:0.0	.	389	P83111	LACTB_HUMAN	M	389	ENSP00000261893:V389M	ENSP00000261893:V389M	V	+	1	0	LACTB	61220578	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.498000	0.97972	2.817000	0.96982	0.563000	0.77884	GTG		0.373	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
TACR3	6870	broad.mit.edu	37	4	104510948	104510948	+	Missense_Mutation	SNP	G	G	A	rs200736098		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr4:104510948G>A	ENST00000304883.2	-	5	1429	c.1289C>T	c.(1288-1290)aCg>aTg	p.T430M	RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	430					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)	p.T430M(2)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		GTCTCTTGGCGTTGCTCTTTT	0.502																																					p.T430M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C1289T	4						.						221.0	206.0	211.0					4																	104510948		2203	4300	6503	104730397	SO:0001583	missense	6870	exon5			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1289C>T	4.37:g.104510948G>A	ENSP00000303325:p.Thr430Met		104730397	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	G	4.907	0.168570	0.09339	.	.	ENSG00000169836	ENST00000304883	T	0.64260	-0.09	5.54	0.22	0.15279	.	0.953048	0.08759	N	0.898048	T	0.48519	0.1504	L	0.44542	1.39	0.09310	N	1	P	0.36027	0.533	B	0.26310	0.068	T	0.20806	-1.0264	10	0.46703	T	0.11	.	9.2084	0.37304	0.4127:0.0:0.5873:0.0	.	430	P29371	NK3R_HUMAN	M	430	ENSP00000303325:T430M	ENSP00000303325:T430M	T	-	2	0	TACR3	104730397	0.740000	0.28207	0.000000	0.03702	0.010000	0.07245	4.451000	0.60047	-0.305000	0.08831	-0.469000	0.05056	ACG		0.502	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
CPZ	8532	broad.mit.edu	37	4	8603130	8603130	+	Silent	SNP	C	C	T	rs143569240		TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr4:8603130C>T	ENST00000360986.4	+	3	576	c.402C>T	c.(400-402)gaC>gaT	p.D134D	CPZ_ENST00000315782.6_Silent_p.D123D|CPZ_ENST00000506287.1_3'UTR|CPZ_ENST00000429646.2_5'Flank|CPZ_ENST00000382480.2_5'UTR	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	134	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.D134D(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CCGCCTTCGACGCCATTGACA	0.672																																					p.D123D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369T	4						.	C	,,	0,4400		0,0,2200	26.0	30.0	29.0		402,,369	-1.2	1.0	4	dbSNP_134	29	1,8589		0,1,4294	no	coding-synonymous,utr-5,coding-synonymous	CPZ	NM_001014447.2,NM_001014448.2,NM_003652.3	,,	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	,,	134/653,,123/642	8603130	1,12989	2200	4295	6495	8654030	SO:0001819	synonymous_variant	8532	exon2			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.402C>T	4.37:g.8603130C>T			8654030	NM_003652	O00520|Q96MX2	De_novo_Start_OutOfFrame	SNP	ENST00000360986.4	37	CCDS33953.1																																																																																				0.672	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
GK2	2712	broad.mit.edu	37	4	80328567	80328567	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr4:80328567G>T	ENST00000358842.3	-	1	805	c.788C>A	c.(787-789)gCa>gAa	p.A263E		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.A263E(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						TCCTACTAATGCAGCACATTG	0.448																																					p.A263E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C788A	4						.						107.0	99.0	102.0					4																	80328567		2203	4300	6503	80547591	SO:0001583	missense	2712	exon1			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.788C>A	4.37:g.80328567G>T	ENSP00000351706:p.Ala263Glu		80547591	NM_033214	Q7Z4Q4	Missense_Mutation	SNP	ENST00000358842.3	37	CCDS3585.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885668	0.72410	.	.	ENSG00000196475	ENST00000358842	T	0.58358	0.34	3.92	3.92	0.45320	Carbohydrate kinase, FGGY, N-terminal (1);	0.115696	0.64402	D	0.000020	T	0.79587	0.4471	H	0.95745	3.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85688	0.1305	10	0.87932	D	0	-17.8303	14.2359	0.65927	0.0:0.0:1.0:0.0	.	263	Q14410	GLPK2_HUMAN	E	263	ENSP00000351706:A263E	ENSP00000351706:A263E	A	-	2	0	GK2	80547591	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	6.976000	0.76135	2.496000	0.84212	0.585000	0.79938	GCA		0.448	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252517.2	NM_033214	
TTC29	83894	broad.mit.edu	37	4	147724621	147724621	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr4:147724621C>T	ENST00000325106.4	-	11	1544	c.1318G>A	c.(1318-1320)Gat>Aat	p.D440N	TTC29_ENST00000513335.1_Missense_Mutation_p.D466N|TTC29_ENST00000398886.4_Missense_Mutation_p.D466N|TTC29_ENST00000506019.1_5'Flank	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	440								p.D440N(1)		breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GTAACTGGATCAGGTTCAATG	0.383																																					p.D440N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1318A	4						.						99.0	96.0	97.0					4																	147724621		1913	4138	6051	147944071	SO:0001583	missense	83894	exon11			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.1318G>A	4.37:g.147724621C>T	ENSP00000316740:p.Asp440Asn		147944071	NM_031956	A4GU95|Q9BXB6	Missense_Mutation	SNP	ENST00000325106.4	37	CCDS47141.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.875882	0.33162	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000504425	T;T;T;T	0.26067	1.76;1.76;1.79;1.79	5.84	3.17	0.36434	.	0.548979	0.19903	N	0.103472	T	0.40743	0.1129	L	0.58101	1.795	0.09310	N	1	B;D;B	0.63046	0.441;0.992;0.441	B;P;B	0.59357	0.087;0.856;0.087	T	0.21314	-1.0249	10	0.72032	D	0.01	-7.9086	11.1844	0.48646	0.0:0.6762:0.2585:0.0653	.	440;466;440	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	N	466;466;440;440	ENSP00000423505:D466N;ENSP00000381861:D466N;ENSP00000316740:D440N;ENSP00000425778:D440N	ENSP00000316740:D440N	D	-	1	0	TTC29	147944071	0.972000	0.33761	0.001000	0.08648	0.059000	0.15707	2.342000	0.43992	0.362000	0.24319	-0.211000	0.12701	GAT		0.383	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_031956	
TLR8	51311	broad.mit.edu	37	X	12939149	12939149	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chrX:12939149G>A	ENST00000218032.6	+	2	2077	c.1990G>A	c.(1990-1992)Gcg>Acg	p.A664T	TLR8_ENST00000311912.5_Missense_Mutation_p.A682T	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	664					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.A682T(1)		breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TAATTTGCCAGCGAGTCTCAC	0.388																																					p.A664T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1990A	X						.						53.0	54.0	54.0					X																	12939149		2203	4298	6501	12849070	SO:0001583	missense	51311	exon2			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1990G>A	X.37:g.12939149G>A	ENSP00000218032:p.Ala664Thr		12849070	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	37	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	G	0.507	-0.868246	0.02590	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.56611	0.45;0.45	5.82	-0.669	0.11388	.	2.781830	0.01516	N	0.018171	T	0.35682	0.0940	N	0.20986	0.625	0.09310	N	1	B;B	0.28584	0.216;0.216	B;B	0.31390	0.129;0.129	T	0.09952	-1.0651	10	0.29301	T	0.29	.	0.4773	0.00542	0.219:0.3007:0.2226:0.2576	.	664;682	Q9NR97;D1CS70	TLR8_HUMAN;.	T	664;682	ENSP00000218032:A664T;ENSP00000312082:A682T	ENSP00000218032:A664T	A	+	1	0	TLR8	12849070	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.066000	0.01385	-0.015000	0.14150	-0.216000	0.12614	GCG		0.388	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
MCF2	4168	broad.mit.edu	37	X	138708853	138708853	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chrX:138708853G>T	ENST00000370576.4	-	5	710	c.501C>A	c.(499-501)gaC>gaA	p.D167E	MCF2_ENST00000370573.4_Missense_Mutation_p.D167E|MCF2_ENST00000370578.4_Missense_Mutation_p.D312E|MCF2_ENST00000536274.1_Missense_Mutation_p.D128E|MCF2_ENST00000338585.6_Missense_Mutation_p.D167E|MCF2_ENST00000520602.1_Missense_Mutation_p.D227E|MCF2_ENST00000414978.1_Missense_Mutation_p.D227E|MCF2_ENST00000519895.1_Missense_Mutation_p.D227E	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	167					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D227E(1)|p.D167E(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					CTCCTTCAGTGTCAGGCACTT	0.373																																					p.D227E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C681A	X						.						155.0	141.0	146.0					X																	138708853		2203	4300	6503	138536519	SO:0001583	missense	4168	exon8				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.501C>A	X.37:g.138708853G>T	ENSP00000359608:p.Asp167Glu		138536519	NM_001099855	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	g	0.268	-0.994677	0.02145	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02;1.02;1.02;1.02	4.56	2.65	0.31530	.	0.719811	0.14022	N	0.346734	T	0.30008	0.0751	L	0.54323	1.7	0.09310	N	1	B;B;B;B;B;B;B;B	0.26002	0.004;0.139;0.001;0.001;0.008;0.002;0.082;0.005	B;B;B;B;B;B;B;B	0.23574	0.017;0.021;0.016;0.007;0.039;0.011;0.047;0.017	T	0.35871	-0.9771	10	0.02654	T	1	.	6.518	0.22258	0.3485:0.0:0.6515:0.0	.	227;312;128;167;167;312;167;167	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	E	227;167;128;312;227;227;167;167	ENSP00000427745:D227E;ENSP00000359608:D167E;ENSP00000438155:D128E;ENSP00000359610:D312E;ENSP00000397055:D227E;ENSP00000430276:D227E;ENSP00000359605:D167E;ENSP00000342204:D167E	ENSP00000342204:D167E	D	-	3	2	MCF2	138536519	0.000000	0.05858	0.000000	0.03702	0.258000	0.26162	-0.070000	0.11523	0.261000	0.21753	0.597000	0.82753	GAC		0.373	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369	
CNKSR2	22866	broad.mit.edu	37	X	21627280	21627280	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chrX:21627280G>A	ENST00000379510.3	+	20	2273	c.2237G>A	c.(2236-2238)cGc>cAc	p.R746H	CNKSR2_ENST00000279451.4_Missense_Mutation_p.R746H|CNKSR2_ENST00000425654.2_Missense_Mutation_p.R716H|CNKSR2_ENST00000543067.1_Missense_Mutation_p.R697H	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	746					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.R746H(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						GAGGAGTTTCGCCAGGAAGTA	0.512																																					p.R697H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2090A	X						.						74.0	73.0	73.0					X																	21627280		2203	4300	6503	21537201	SO:0001583	missense	22866	exon19			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2237G>A	X.37:g.21627280G>A	ENSP00000368824:p.Arg746His		21537201	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336613	0.41398	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.21191	2.34;2.02;2.04;2.37	5.28	5.28	0.74379	.	0.049583	0.85682	D	0.000000	T	0.29126	0.0724	L	0.33485	1.01	0.51482	D	0.999926	P;B;D;D	0.60160	0.564;0.163;0.979;0.987	B;B;B;P	0.52856	0.097;0.027;0.363;0.711	T	0.01920	-1.1247	10	0.51188	T	0.08	-13.6897	17.9342	0.89007	0.0:0.0:1.0:0.0	.	716;697;338;746	B7ZLJ1;B4DGR4;B3KPN2;Q8WXI2	.;.;.;CNKR2_HUMAN	H	716;697;746;746	ENSP00000397906:R716H;ENSP00000444633:R697H;ENSP00000279451:R746H;ENSP00000368824:R746H	ENSP00000279451:R746H	R	+	2	0	CNKSR2	21537201	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.339000	0.65953	2.168000	0.68352	0.506000	0.49869	CGC		0.512	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
CHDC2	286464	broad.mit.edu	37	X	36116960	36116960	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chrX:36116960C>T	ENST00000313548.4	+	6	878	c.692C>T	c.(691-693)cCa>cTa	p.P231L		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	231						integral component of membrane (GO:0016021)		p.P231L(1)									TTGCTTGAACCAGAAGATTAT	0.294																																					p.P231L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C692T	X						.						41.0	38.0	39.0					X																	36116960		2201	4291	6492	36026881	SO:0001583	missense	286464	exon6			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.692C>T	X.37:g.36116960C>T	ENSP00000324767:p.Pro231Leu		36026881	NM_173695		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	c	1.277	-0.611496	0.03690	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.52	3.76	0.43208	.	0.328640	0.25305	N	0.031629	T	0.43456	0.1248	L	0.52364	1.645	0.32586	N	0.52778	B	0.31077	0.307	B	0.28385	0.089	T	0.51052	-0.8754	9	0.34782	T	0.22	-3.2584	9.5525	0.39319	0.0:0.8238:0.0:0.1762	.	231	Q8N9S7	CX059_HUMAN	L	231	.	ENSP00000324767:P231L	P	+	2	0	CXorf59	36026881	0.807000	0.29009	0.553000	0.28255	0.071000	0.16799	0.818000	0.27295	0.622000	0.30249	0.579000	0.79373	CCA		0.294	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
PASD1	139135	broad.mit.edu	37	X	150840874	150840874	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3882-01	TCGA-AG-3882-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chrX:150840874A>G	ENST00000370357.4	+	14	1902	c.1657A>G	c.(1657-1659)Atg>Gtg	p.M553V		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	553						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.M553V(2)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					gcaggggcagatgctacagaa	0.537																																					p.M553V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1657G	X						.						63.0	58.0	60.0					X																	150840874		2203	4300	6503	150591530	SO:0001583	missense	139135	exon14			AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1657A>G	X.37:g.150840874A>G	ENSP00000359382:p.Met553Val		150591530	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	37	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	A	2.704	-0.270300	0.05716	.	.	ENSG00000166049	ENST00000370357	T	0.17213	2.29	1.14	-2.29	0.06805	.	.	.	.	.	T	0.07052	0.0179	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.11329	0.006	T	0.30060	-0.9991	9	0.66056	D	0.02	.	2.75	0.05277	0.3687:0.3895:0.2418:0.0	.	553	Q8IV76	PASD1_HUMAN	V	553	ENSP00000359382:M553V	ENSP00000359382:M553V	M	+	1	0	PASD1	150591530	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.827000	0.04424	-1.165000	0.02786	-0.461000	0.05368	ATG		0.537	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
CNTNAP5	129684	broad.mit.edu	37	2	125521251	125521251	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr2:125521251C>T	ENST00000431078.1	+	15	2598	c.2234C>T	c.(2233-2235)aCa>aTa	p.T745I		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	745	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T745I(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TTTTGCAGGACAAATGATACT	0.398																																					p.T745I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2234T	2						.						76.0	67.0	69.0					2																	125521251		1839	4081	5920	125237721	SO:0001583	missense	129684	exon15			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2234C>T	2.37:g.125521251C>T	ENSP00000399013:p.Thr745Ile		125237721	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066256	0.36470	.	.	ENSG00000155052	ENST00000431078	T	0.13420	2.59	5.24	4.36	0.52297	.	0.281428	0.24599	N	0.037153	T	0.14743	0.0356	L	0.51422	1.61	0.33902	D	0.638687	B	0.09022	0.002	B	0.10450	0.005	T	0.07597	-1.0764	10	0.36615	T	0.2	.	13.1459	0.59461	0.0:0.9225:0.0:0.0775	.	745	Q8WYK1	CNTP5_HUMAN	I	745	ENSP00000399013:T745I	ENSP00000399013:T745I	T	+	2	0	CNTNAP5	125237721	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.751000	0.62169	1.364000	0.46038	0.655000	0.94253	ACA		0.398	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
SSB	6741	broad.mit.edu	37	2	170667734	170667734	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr2:170667734C>A	ENST00000409333.1	+	11	1286	c.1039C>A	c.(1039-1041)Cag>Aag	p.Q347K	SSB_ENST00000260956.4_Missense_Mutation_p.Q347K|METTL5_ENST00000409837.1_Intron			P05455	LA_HUMAN	Sjogren syndrome antigen B (autoantigen La)	347					histone mRNA metabolic process (GO:0008334)|tRNA modification (GO:0006400)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)	p.Q347K(1)		endometrium(3)|large_intestine(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						TAAAGCTGCCCAGCCTGGGTC	0.388																																					p.Q347K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1039A	2						.						70.0	70.0	70.0					2																	170667734		2203	4300	6503	170375980	SO:0001583	missense	6741	exon11				CCDS2237.1	2q31.1	2014-02-14		2005-06-16	ENSG00000138385	ENSG00000138385		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	11316	protein-coding gene	gene with protein product	"""La ribonucleoprotein domain family, member 3"""	109090					Standard	NM_003142		Approved	LARP3, La, La/SSB	uc002ufk.3	P05455	OTTHUMG00000132212	ENST00000409333.1:c.1039C>A	2.37:g.170667734C>A	ENSP00000386636:p.Gln347Lys		170375980	NM_003142	Q15367|Q53XJ4	Missense_Mutation	SNP	ENST00000409333.1	37	CCDS2237.1	.	.	.	.	.	.	.	.	.	.	C	4.173	0.030736	0.08101	.	.	ENSG00000138385	ENST00000260956;ENST00000409333	T;T	0.40476	1.03;1.03	4.67	3.78	0.43462	.	0.405138	0.26514	N	0.023958	T	0.29850	0.0746	L	0.44542	1.39	0.80722	D	1	B	0.13145	0.007	B	0.12837	0.008	T	0.07481	-1.0770	10	0.06494	T	0.89	1.0372	10.496	0.44777	0.0:0.9072:0.0:0.0928	.	347	P05455	LA_HUMAN	K	347	ENSP00000260956:Q347K;ENSP00000386636:Q347K	ENSP00000260956:Q347K	Q	+	1	0	SSB	170375980	0.797000	0.28877	0.770000	0.31555	0.993000	0.82548	1.394000	0.34509	1.073000	0.40885	0.460000	0.39030	CAG		0.388	SSB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333316.1	NM_003142	
TTN	7273	broad.mit.edu	37	2	179470279	179470279	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr2:179470279G>A	ENST00000591111.1	-	229	49044	c.48820C>T	c.(48820-48822)Cga>Tga	p.R16274*	TTN_ENST00000342175.6_Nonsense_Mutation_p.R9042*|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.R17915*|TTN_ENST00000342992.6_Nonsense_Mutation_p.R15347*|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.R8975*|TTN_ENST00000460472.2_Nonsense_Mutation_p.R8850*|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16274	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R15347*(1)|p.R9042*(1)|p.R8850*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGCAGAGTCGCTTGTTAACT	0.433																																					p.R8850X												.	.	3	Substitution - Nonsense(3)	large_intestine(3)	c.C26548T	2						.						151.0	145.0	147.0					2																	179470279		1918	4118	6036	179178524	SO:0001587	stop_gained	7273	exon107			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48820C>T	2.37:g.179470279G>A	ENSP00000465570:p.Arg16274*		179178524	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	59	38.396451	0.99984	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.87	-3.6	0.04570	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	22.2861	0.99969	0.0:0.0:0.1325:0.8675	.	.	.	.	X	15347;8850;9042;8975;8850	.	ENSP00000340554:R9042X	R	-	1	2	TTN	179178524	0.005000	0.15991	0.269000	0.24586	0.007000	0.05969	-0.004000	0.12878	-0.650000	0.05423	-0.182000	0.12963	CGA		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DYSF	8291	broad.mit.edu	37	2	71883368	71883368	+	Missense_Mutation	SNP	G	G	A	rs191383034	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr2:71883368G>A	ENST00000258104.3	+	42	4863	c.4586G>A	c.(4585-4587)cGg>cAg	p.R1529Q	DYSF_ENST00000429174.2_Missense_Mutation_p.R1550Q|DYSF_ENST00000409762.1_Missense_Mutation_p.R1546Q|DYSF_ENST00000409582.3_Missense_Mutation_p.R1567Q|DYSF_ENST00000394120.2_Missense_Mutation_p.R1530Q|DYSF_ENST00000413539.2_Missense_Mutation_p.R1560Q|DYSF_ENST00000409366.1_Missense_Mutation_p.R1551Q|DYSF_ENST00000409744.1_Missense_Mutation_p.R1537Q|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409651.1_Missense_Mutation_p.R1561Q|DYSF_ENST00000410020.3_Missense_Mutation_p.R1568Q|DYSF_ENST00000410041.1_Missense_Mutation_p.R1547Q	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1529					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.R1529Q(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AAGCTGTACCGGGGCAAGACG	0.512													G|||	3	0.000599042	0.0	0.0	5008	,	,		21952	0.0		0.001	False		,,,				2504	0.002				p.R1561Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4682A	2						.						273.0	269.0	271.0					2																	71883368		2203	4300	6503	71736876	SO:0001583	missense	8291	exon43			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4586G>A	2.37:g.71883368G>A	ENSP00000258104:p.Arg1529Gln		71736876	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	31	5.064173	0.93898	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.85955	-2.05;-2.04;-2.01;-2.02;-2.05;-2.04;-2.05;-2.02;-2.02;-2.01;-2.04	5.39	4.52	0.55395	.	0.178183	0.47852	N	0.000210	D	0.90007	0.6880	M	0.62154	1.92	0.48087	D	0.999582	B;D;D;D;D;D;D;D;P;D;D;D;D;D;D	0.89917	0.044;1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.884;1.0;0.998;0.998;0.999;1.0;0.999	B;D;D;D;D;D;D;D;P;D;D;P;D;D;D	0.77004	0.084;0.964;0.964;0.964;0.964;0.976;0.985;0.976;0.541;0.964;0.989;0.868;0.964;0.964;0.922	D	0.89631	0.3855	10	0.46703	T	0.11	-35.0765	12.1972	0.54305	0.0823:0.0:0.9177:0.0	.	293;1561;1568;1551;1516;1547;1537;1546;1536;1560;1567;1550;1515;1530;1529	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	Q	1560;1546;1567;1550;1529;1561;1530;1537;1551;1568;1547	ENSP00000407046:R1560Q;ENSP00000387137:R1546Q;ENSP00000386547:R1567Q;ENSP00000398305:R1550Q;ENSP00000258104:R1529Q;ENSP00000386683:R1561Q;ENSP00000377678:R1530Q;ENSP00000386285:R1537Q;ENSP00000386512:R1551Q;ENSP00000386881:R1568Q;ENSP00000386617:R1547Q	ENSP00000258104:R1529Q	R	+	2	0	DYSF	71736876	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.699000	0.84547	1.509000	0.48786	0.655000	0.94253	CGG		0.512	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
TTN	7273	broad.mit.edu	37	2	179579278	179579278	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr2:179579278C>A	ENST00000591111.1	-	89	25496	c.25272G>T	c.(25270-25272)aaG>aaT	p.K8424N	TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K8741N|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K7497N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12595	Ig-like 67.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K7497N(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTCACTGAGCTTCTTCACAA	0.443																																					p.K7497N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G22491T	2						.						46.0	41.0	43.0					2																	179579278		1843	4106	5949	179287523	SO:0001583	missense	7273	exon88			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25272G>T	2.37:g.179579278C>A	ENSP00000465570:p.Lys8424Asn		179287523	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.44	1.938775	0.34189	.	.	ENSG00000155657	ENST00000342992	T	0.68765	-0.35	5.96	0.826	0.18829	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69079	0.3071	M	0.77313	2.365	0.80722	D	1	P	0.37573	0.6	P	0.45610	0.487	T	0.65709	-0.6102	9	0.87932	D	0	.	6.1298	0.20199	0.0:0.4533:0.1226:0.4241	.	8424	Q8WZ42	TITIN_HUMAN	N	7497	ENSP00000343764:K7497N	ENSP00000343764:K7497N	K	-	3	2	TTN	179287523	0.988000	0.35896	0.991000	0.47740	0.966000	0.64601	0.256000	0.18351	-0.127000	0.11661	0.655000	0.94253	AAG		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
HIATL1	84641	broad.mit.edu	37	9	97221572	97221572	+	Missense_Mutation	SNP	G	G	A	rs199783937		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr9:97221572G>A	ENST00000375344.3	+	12	1668	c.1399G>A	c.(1399-1401)Ggc>Agc	p.G467S	HIATL1_ENST00000428393.2_3'UTR	NM_032558.2	NP_115947.2	Q5SR56	HIAL1_HUMAN	hippocampus abundant transcript-like 1	467					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.G467S(1)		endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	11		Acute lymphoblastic leukemia(62;0.136)				CAGCAGCAGCGGCAGCCTGAC	0.493																																					p.G467S	Pancreas(77;1260 1915 1973 10423)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1399A	9						.	G	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	72.0	68.0	69.0		1399	3.5	0.7	9		69	0,8600		0,0,4300	yes	missense	HIATL1	NM_032558.2	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	467/507	97221572	1,13005	2203	4300	6503	96261393	SO:0001583	missense	84641	exon12			AK027659	CCDS6710.2	9q22.32	2009-12-04			ENSG00000148110	ENSG00000148110			23376	protein-coding gene	gene with protein product							Standard	XM_005252277		Approved	FLJ14753	uc004aur.3	Q5SR56	OTTHUMG00000020265	ENST00000375344.3:c.1399G>A	9.37:g.97221572G>A	ENSP00000364493:p.Gly467Ser		96261393	NM_032558	B4DUE6|E9PD58|Q3KQT4|Q53GU5|Q8WU95|Q96SM4	Missense_Mutation	SNP	ENST00000375344.3	37	CCDS6710.2	.	.	.	.	.	.	.	.	.	.	G	8.392	0.840045	0.16891	2.27E-4	0.0	ENSG00000148110	ENST00000375344	T	0.29397	1.57	4.4	3.5	0.40072	.	0.000000	0.49916	D	0.000129	T	0.15176	0.0366	N	0.20530	0.585	0.80722	D	1	B	0.17465	0.022	B	0.13407	0.009	T	0.06698	-1.0812	10	0.08599	T	0.76	-1.2896	6.9161	0.24361	0.206:0.0:0.794:0.0	.	467	Q5SR56	HIAL1_HUMAN	S	467	ENSP00000364493:G467S	ENSP00000364493:G467S	G	+	1	0	HIATL1	96261393	1.000000	0.71417	0.657000	0.29651	0.488000	0.33401	3.803000	0.55560	1.211000	0.43351	0.609000	0.83330	GGC		0.493	HIATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053184.1	NM_032558	
COL5A1	1289	broad.mit.edu	37	9	137716501	137716501	+	Missense_Mutation	SNP	G	G	A	rs531431738		TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr9:137716501G>A	ENST00000371817.3	+	62	5168	c.4754G>A	c.(4753-4755)cGg>cAg	p.R1585Q		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1585	Nonhelical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.R1585Q(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGGACGCGGCGGAACATCGAC	0.637																																					p.R1585Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4754A	9						.						59.0	50.0	53.0					9																	137716501		2203	4300	6503	136856322	SO:0001583	missense	1289	exon62			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4754G>A	9.37:g.137716501G>A	ENSP00000360882:p.Arg1585Gln		136856322	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.594917	0.66219	.	.	ENSG00000130635	ENST00000371817;ENST00000355306	D	0.90004	-2.6	4.34	4.34	0.51931	.	0.000000	0.64402	U	0.000003	D	0.91586	0.7342	M	0.85197	2.74	0.37805	D	0.927828	D	0.63880	0.993	P	0.47299	0.543	D	0.93986	0.7262	10	0.51188	T	0.08	.	17.2645	0.87083	0.0:0.0:1.0:0.0	.	1585	P20908	CO5A1_HUMAN	Q	1585;122	ENSP00000360882:R1585Q	ENSP00000347458:R122Q	R	+	2	0	COL5A1	136856322	1.000000	0.71417	0.927000	0.36925	0.713000	0.41058	9.671000	0.98627	2.129000	0.65627	0.545000	0.68477	CGG		0.637	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
ZMYM2	7750	broad.mit.edu	37	13	20660013	20660013	+	Silent	SNP	C	C	T	rs370286795		TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr13:20660013C>T	ENST00000382874.2	+	26	4183	c.3993C>T	c.(3991-3993)tgC>tgT	p.C1331C	ZMYM2_ENST00000382871.2_Silent_p.C1331C|ZMYM2_ENST00000382869.3_Silent_p.C1331C	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.C1331C(1)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AACCAGAATGCTCTAGTTCTA	0.388																																					p.C1331C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3993T	13						.	C	,,,	1,3667		0,1,1833	92.0	86.0	88.0		3993,3993,3993,3993	1.9	1.0	13		88	0,8164		0,0,4082	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ZMYM2	NM_001190964.1,NM_001190965.1,NM_003453.3,NM_197968.2	,,,	0,1,5915	TT,TC,CC		0.0,0.0273,0.0085	,,,	1331/1378,1331/1378,1331/1378,1331/1378	20660013	1,11831	1834	4082	5916	19558013	SO:0001819	synonymous_variant	7750	exon25			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3993C>T	13.37:g.20660013C>T			19558013	NM_197968	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Silent	SNP	ENST00000382874.2	37	CCDS45016.1																																																																																				0.388	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
FREM2	341640	broad.mit.edu	37	13	39271918	39271918	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr13:39271918G>A	ENST00000280481.7	+	2	5473	c.5257G>A	c.(5257-5259)Gat>Aat	p.D1753N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1753					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1753N(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGCAGTTGAAGATGGTGGTAA	0.393																																					p.D1753N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5257A	13						.						172.0	151.0	158.0					13																	39271918		2203	4300	6503	38169918	SO:0001583	missense	341640	exon2			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5257G>A	13.37:g.39271918G>A	ENSP00000280481:p.Asp1753Asn		38169918	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	35	5.583019	0.96578	.	.	ENSG00000150893	ENST00000280481	T	0.35973	1.28	6.06	6.06	0.98353	.	0.044558	0.85682	D	0.000000	T	0.74673	0.3747	H	0.97186	3.955	0.80722	D	1	D	0.71674	0.998	D	0.69307	0.963	T	0.82502	-0.0425	10	0.87932	D	0	.	20.6282	0.99521	0.0:0.0:1.0:0.0	.	1753	Q5SZK8	FREM2_HUMAN	N	1753	ENSP00000280481:D1753N	ENSP00000280481:D1753N	D	+	1	0	FREM2	38169918	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.439000	0.97543	2.871000	0.98454	0.655000	0.94253	GAT		0.393	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
KLF12	11278	broad.mit.edu	37	13	74420000	74420000	+	Missense_Mutation	SNP	C	C	T	rs375091947	byFrequency	TCGA-AG-3882-01	TCGA-AG-3882-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr13:74420000C>T	ENST00000377669.2	-	3	660	c.634G>A	c.(634-636)Gtg>Atg	p.V212M	KLF12_ENST00000377666.4_Missense_Mutation_p.V212M|KLF12_ENST00000472022.1_5'UTR	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	212					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.V212M(1)		central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		AAAAGCGGCACGACAATAGTG	0.473													C|||	2	0.000399361	0.0	0.0	5008	,	,		21075	0.0		0.0	False		,,,				2504	0.002				p.V212M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G634A	13						.	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	124.0	105.0	111.0		634	6.0	1.0	13		111	0,8600		0,0,4300	no	missense	KLF12	NM_007249.4	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	212/403	74420000	1,13005	2203	4300	6503	73318001	SO:0001583	missense	11278	exon4			AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.634G>A	13.37:g.74420000C>T	ENSP00000366897:p.Val212Met		73318001	NM_007249	A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	ENST00000377669.2	37	CCDS9449.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380842	0.42207	2.27E-4	0.0	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.01548	4.78;4.78	6.02	6.02	0.97574	.	0.061548	0.64402	D	0.000003	T	0.02533	0.0077	L	0.51914	1.62	0.49299	D	0.999774	P	0.50443	0.935	B	0.34242	0.178	T	0.61941	-0.6959	10	0.38643	T	0.18	.	19.1188	0.93353	0.0:1.0:0.0:0.0	.	212	Q9Y4X4	KLF12_HUMAN	M	212	ENSP00000366897:V212M;ENSP00000366894:V212M	ENSP00000344057:V212M	V	-	1	0	KLF12	73318001	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	4.632000	0.61311	2.865000	0.98341	0.655000	0.94253	GTG		0.473	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045271.2	NM_007249	
FBXW4	6468	broad.mit.edu	37	10	103427654	103427655	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-AG-3882-01	TCGA-AG-3882-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr10:103427654_103427655GC>AT	ENST00000331272.7	-	5	1376_1377	c.758_759GC>AT	c.(757-759)aGC>aAT	p.S253N		NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4	253					cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)		p.S253>?(1)		breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		TGAGTAATGGGCTGATAGCAAT	0.47																																					.												.	.	1	Complex(1)	large_intestine(1)	c.758_759AT	10						.																																			103417645	SO:0001583	missense	6468	exon5			AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.758_759delinsAT	10.37:g.103427654_103427655delinsAT	ENSP00000359149:p.Ser253Asn		103417644	NM_022039	Q5SVS1|Q96IM6	Missense_Mutation	DNP	ENST00000331272.7	37	CCDS31271.1																																																																																				0.470	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049979.2	NM_022039	
SORCS3	22986	broad.mit.edu	37	10	107007076	107007076	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3882-01	TCGA-AG-3882-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr10:107007076G>A	ENST00000369701.3	+	22	3319	c.3092G>A	c.(3091-3093)cGa>cAa	p.R1031Q	SORCS3_ENST00000369699.4_3'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1031					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)	p.R1031Q(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GTCATCAAGCGAGCTCTGGTT	0.378																																					p.R1031Q	NSCLC(116;1497 1690 7108 13108 14106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3092A	10						.						121.0	119.0	120.0					10																	107007076		2203	4300	6503	106997066	SO:0001583	missense	22986	exon22			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3092G>A	10.37:g.107007076G>A	ENSP00000358715:p.Arg1031Gln		106997066	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826145	0.50739	.	.	ENSG00000156395	ENST00000369701	T	0.15139	2.45	5.5	1.19	0.21007	.	0.516807	0.19807	N	0.105624	T	0.13200	0.0320	L	0.48642	1.525	0.30356	N	0.784259	B	0.21381	0.055	B	0.11329	0.006	T	0.15065	-1.0450	9	.	.	.	.	8.6496	0.34027	0.348:0.0:0.652:0.0	.	1031	Q9UPU3	SORC3_HUMAN	Q	1031	ENSP00000358715:R1031Q	.	R	+	2	0	SORCS3	106997066	0.999000	0.42202	0.951000	0.38953	0.996000	0.88848	1.597000	0.36729	0.265000	0.21872	0.650000	0.86243	CGA		0.378	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
TCF7L2	6934	broad.mit.edu	37	10	114925333	114925333	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3882-01	TCGA-AG-3882-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr10:114925333C>T	ENST00000355995.4	+	15	1969	c.1462C>T	c.(1462-1464)Cgc>Tgc	p.R488C	TCF7L2_ENST00000542695.1_Missense_Mutation_p.R204C|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000369397.4_Missense_Mutation_p.R465C|TCF7L2_ENST00000369389.1_Silent_p.F157F|TCF7L2_ENST00000369386.1_3'UTR|TCF7L2_ENST00000545257.1_Missense_Mutation_p.R488C|TCF7L2_ENST00000355717.4_Silent_p.F470F|TCF7L2_ENST00000536810.1_Missense_Mutation_p.R471C|TCF7L2_ENST00000538897.1_Silent_p.F463F|TCF7L2_ENST00000352065.5_3'UTR|TCF7L2_ENST00000543371.1_Missense_Mutation_p.R471C			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	488	Promoter-specific activation domain.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.R465C(3)|p.R471C(2)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		AAAGTGCGTTCGCTACATACA	0.532			T	VTI1A	colorectal																																p.R448C			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	TCF7L2,large_intestine,colon,Substitution - Missense,0	.	5	Substitution - Missense(5)	large_intestine(5)	c.C1342T	10						.						100.0	107.0	105.0					10																	114925333		2203	4300	6503	114915323	SO:0001583	missense	6934	exon13			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1462C>T	10.37:g.114925333C>T	ENSP00000348274:p.Arg488Cys		114915323	NM_001146285	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	C	31	5.096063	0.94197	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000369397;ENST00000542695;ENST00000277945	D;D;D;D;D;D;D	0.99329	-5.21;-5.21;-5.2;-5.19;-5.21;-5.24;-5.75	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000001	D	0.99375	0.9780	M	0.74647	2.275	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.998;1.0;0.997;0.999;0.999;0.999;0.983	P;D;P;P;P;P;B	0.85130	0.8;0.997;0.634;0.791;0.77;0.857;0.405	D	0.99457	1.0942	10	0.87932	D	0	-33.6256	19.3381	0.94329	0.0:1.0:0.0:0.0	.	488;359;403;448;448;471;465	Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ8;C6ZRK5;Q9NQB0-7;Q6FHW4	TF7L2_HUMAN;.;.;.;.;.;.	C	488;488;471;471;465;204;188	ENSP00000348274:R488C;ENSP00000440547:R488C;ENSP00000444972:R471C;ENSP00000446238:R471C;ENSP00000358404:R465C;ENSP00000443883:R204C;ENSP00000277945:R188C	ENSP00000277945:R188C	R	+	1	0	TCF7L2	114915323	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.558000	0.86282	0.655000	0.94253	CGC		0.532	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
MRPS36	92259	broad.mit.edu	37	5	68513666	68513666	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3882-01	TCGA-AG-3882-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3882-01	TCGA-AG-3882-01	g.chr5:68513666A>G	ENST00000256441.4	+	1	80	c.10A>G	c.(10-12)Agc>Ggc	p.S4G	MRPS36_ENST00000602380.1_5'UTR|MRPS36_ENST00000512880.1_5'UTR|MRPS36_ENST00000507022.1_3'UTR	NM_033281.5	NP_150597.1	P82909	RT36_HUMAN	mitochondrial ribosomal protein S36	4					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)	p.S4G(1)		NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(1)|urinary_tract(1)	7		Lung NSC(167;5.51e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.04e-56)|Epithelial(20;8.79e-53)|all cancers(19;2.01e-48)|Lung(70;0.0176)		CATGATGGGCAGCAAGATGGC	0.647																																					p.S4G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A10G	5						.						117.0	100.0	106.0					5																	68513666		2203	4300	6503	68549422	SO:0001583	missense	92259	exon1				CCDS34174.1	5q13.2	2013-09-20			ENSG00000134056	ENSG00000134056		"""Mitochondrial ribosomal proteins / small subunits"""	16631	protein-coding gene	gene with protein product		611996				11279123	Standard	NM_033281		Approved	DC47, MRP-S36	uc003jvq.3	P82909	OTTHUMG00000162443	ENST00000256441.4:c.10A>G	5.37:g.68513666A>G	ENSP00000256441:p.Ser4Gly		68549422	NM_033281	Q9H2H4	Missense_Mutation	SNP	ENST00000256441.4	37	CCDS34174.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.757962	0.89843	.	.	ENSG00000134056	ENST00000256441	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.53481	0.1799	N	0.11756	0.17	0.80722	D	1	D	0.67145	0.996	D	0.73380	0.98	T	0.58668	-0.7596	9	0.49607	T	0.09	-4.3697	12.8836	0.58030	1.0:0.0:0.0:0.0	.	4	P82909	RT36_HUMAN	G	4	.	ENSP00000256441:S4G	S	+	1	0	MRPS36	68549422	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.429000	0.59901	2.293000	0.77203	0.528000	0.53228	AGC		0.647	MRPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368940.1	NM_033281	
