#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SCARA5	286133	broad.mit.edu	37	8	27779538	27779539	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-3887-01	TCGA-AG-3887-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr8:27779538_27779539insC	ENST00000354914.3	-	4	950_951	c.465_466insG	c.(463-468)gggctgfs	p.L156fs	SCARA5_ENST00000380385.2_Intron|SCARA5_ENST00000301906.4_Frame_Shift_Ins_p.L113fs|SCARA5_ENST00000524352.1_Frame_Shift_Ins_p.L156fs|SCARA5_ENST00000518030.1_Frame_Shift_Ins_p.L113fs	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	156					cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)	p.L156fs*40(1)		central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TGCGCCTGCAGCCCCCACAGCG	0.723																																					p.L156fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.466_467insG	8						.																																			27835458	SO:0001589	frameshift_variant	286133	exon4			AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.466dupG	8.37:g.27779543_27779543dupC	ENSP00000346990:p.Leu156fs		27835457	NM_173833	Q6UXZ1|Q7Z4A1|Q8N4Z7	Frame_Shift_Ins	INS	ENST00000354914.3	37	CCDS6064.1																																																																																				0.723	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255223.2	NM_173833	
FAT4	79633	broad.mit.edu	37	4	126402756	126402757	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-3887-01	TCGA-AG-3887-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr4:126402756_126402757insA	ENST00000394329.3	+	15	12692_12693	c.12679_12680insA	c.(12679-12681)tatfs	p.Y4227fs	FAT4_ENST00000335110.5_Frame_Shift_Ins_p.Y2468fs	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4227	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y4227fs*1(1)|p.Y4170fs*1(1)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GAAGCGGGAATATTTGTTAAGG	0.441																																					p.Y4227_L4228delinsX												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.12679_12680insA	4						.																																			126622207	SO:0001589	frameshift_variant	79633	exon15			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12680dupA	4.37:g.126402757_126402757dupA	ENSP00000377862:p.Tyr4227fs		126622206	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Frame_Shift_Ins	INS	ENST00000394329.3	37	CCDS3732.3																																																																																				0.441	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FIS1	51024	broad.mit.edu	37	7	100884117	100884117	+	Silent	SNP	C	C	A			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr7:100884117C>A	ENST00000223136.4	-	3	329	c.249G>T	c.(247-249)cgG>cgT	p.R83R	FIS1_ENST00000442303.1_Missense_Mutation_p.A60S|FIS1_ENST00000482199.1_5'UTR|CLDN15_ENST00000401528.1_5'Flank|CLDN15_ENST00000308344.5_5'Flank|FIS1_ENST00000474120.1_Missense_Mutation_p.A29S	NM_016068.2	NP_057152.2	Q9Y3D6	FIS1_HUMAN	fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae)	83					calcium-mediated signaling using intracellular calcium source (GO:0035584)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|mitochondrion morphogenesis (GO:0070584)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|peroxisome fission (GO:0016559)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|release of cytochrome c from mitochondria (GO:0001836)	integral component of mitochondrial outer membrane (GO:0031307)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|protein complex (GO:0043234)	receptor binding (GO:0005102)	p.R83R(1)		kidney(1)|large_intestine(2)|lung(1)	4	Lung NSC(181;0.168)|all_lung(186;0.215)					TCACCTTGAGCCGGTAGTTCC	0.627																																					p.R83R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G249T	7						.						92.0	99.0	97.0					7																	100884117		2025	4152	6177	100670837	SO:0001819	synonymous_variant	51024	exon3			AF151893	CCDS43626.1	7q22.1	2012-10-01	2006-04-04	2006-01-24	ENSG00000214253	ENSG00000214253			21689	protein-coding gene	gene with protein product	"""CGI-135 protein"""	609003	"""tetratricopeptide repeat domain 11"", ""fission 1 (mitochondrial outer membrane) homolog (yeast)"""	TTC11		14996942, 16010987	Standard	NM_016068		Approved	CGI-135, H_NH0132A01.6, Fis1	uc003uyj.4	Q9Y3D6	OTTHUMG00000157106	ENST00000223136.4:c.249G>T	7.37:g.100884117C>A			100670837	NM_016068	Q9BTP3	Silent	SNP	ENST00000223136.4	37	CCDS43626.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.97|11.97	1.796766|1.796766	0.31777|0.31777	.|.	.|.	ENSG00000214253|ENSG00000214253	ENST00000474120;ENST00000442303|ENST00000435848	.|.	.|.	.|.	5.1|5.1	2.08|2.08	0.27032|0.27032	.|.	.|.	.|.	.|.	.|.	T|T	0.63153|0.63153	0.2487|0.2487	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.65331|0.65331	-0.6194|-0.6194	5|5	0.87932|0.87932	D|D	0|0	.|.	7.7333|7.7333	0.28799|0.28799	0.0:0.6968:0.1407:0.1625|0.0:0.6968:0.1407:0.1625	.|.	.|.	.|.	.|.	S|V	29;60|73	.|.	ENSP00000395964:A60S|ENSP00000413500:G73V	A|G	-|-	1|2	0|0	FIS1|FIS1	100670837|100670837	0.963000|0.963000	0.33076|0.33076	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	0.019000|0.019000	0.13444|0.13444	1.136000|1.136000	0.42199|0.42199	0.561000|0.561000	0.74099|0.74099	GCT|GGC		0.627	FIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347449.1	NM_016068	
MAD1L1	8379	broad.mit.edu	37	7	2265091	2265091	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr7:2265091C>G	ENST00000406869.1	-	4	802	c.245G>C	c.(244-246)cGa>cCa	p.R82P	MAD1L1_ENST00000399654.2_Missense_Mutation_p.R82P|MAD1L1_ENST00000265854.7_Missense_Mutation_p.R82P|MAD1L1_ENST00000402746.1_Intron			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	82					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)		p.R82P(1)		central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CAGCTCCACTCGAGCCCTCTT	0.627																																					p.R82P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G245C	7						.						105.0	112.0	109.0					7																	2265091		2100	4232	6332	2231617	SO:0001583	missense	8379	exon4			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.245G>C	7.37:g.2265091C>G	ENSP00000385334:p.Arg82Pro		2231617	NM_001013836	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	ENST00000406869.1	37	CCDS43539.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375109	0.82682	.	.	ENSG00000002822	ENST00000399654;ENST00000406869;ENST00000265854;ENST00000429625;ENST00000429779	T;T;T;T;T	0.25912	1.77;1.77;1.77;1.77;1.77	4.96	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.47673	0.1458	M	0.68952	2.095	0.51233	D	0.999911	D;D	0.89917	1.0;1.0	D;D	0.85130	0.995;0.997	T	0.48186	-0.9057	10	0.66056	D	0.02	-9.5157	12.444	0.55641	0.0:0.919:0.0:0.081	.	11;82	C9K086;Q9Y6D9	.;MD1L1_HUMAN	P	82;82;82;11;82	ENSP00000382562:R82P;ENSP00000385334:R82P;ENSP00000265854:R82P;ENSP00000413139:R11P;ENSP00000395457:R82P	ENSP00000265854:R82P	R	-	2	0	MAD1L1	2231617	1.000000	0.71417	0.190000	0.23270	0.998000	0.95712	6.904000	0.75708	1.101000	0.41535	0.650000	0.86243	CGA		0.627	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322871.1	NM_003550	
ZBED6CL	113763	broad.mit.edu	37	7	150027608	150027608	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr7:150027608G>A	ENST00000343855.4	+	1	671	c.115G>A	c.(115-117)Gtc>Atc	p.V39I	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	39								p.V39I(1)									GGAGCAGAGTGTCGGGGAGAG	0.632																																					p.V39I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G115A	7						.						97.0	105.0	102.0					7																	150027608		2203	4300	6503	149658541	SO:0001583	missense	113763	exon1			BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.115G>A	7.37:g.150027608G>A	ENSP00000343242:p.Val39Ile		149658541	NM_138434		Missense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.621910	0.00118	.	.	ENSG00000188707	ENST00000343855	.	.	.	3.93	-1.68	0.08212	.	911.360000	0.00792	N	0.001348	T	0.16300	0.0392	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.11966	-1.0566	9	0.02654	T	1	.	1.3466	0.02165	0.3557:0.1413:0.3596:0.1434	.	39	Q96FA7	CG029_HUMAN	I	39	.	ENSP00000343242:V39I	V	+	1	0	C7orf29	149658541	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.152000	0.16302	-0.308000	0.08792	-1.109000	0.02080	GTC		0.632	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434	
PAX1	5075	broad.mit.edu	37	20	21687619	21687619	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr20:21687619C>T	ENST00000398485.2	+	2	884	c.830C>T	c.(829-831)gCg>gTg	p.A277V	PAX1_ENST00000460221.1_3'UTR|PAX1_ENST00000444366.2_Missense_Mutation_p.A253V	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	277					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A183V(1)		autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CCGGGCACGGCGGGCCACGTC	0.667																																					p.A277V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C830T	20						.						19.0	22.0	21.0					20																	21687619		2194	4288	6482	21635619	SO:0001583	missense	5075	exon2				CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.830C>T	20.37:g.21687619C>T	ENSP00000381499:p.Ala277Val		21635619	NM_006192	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	17.69	3.450913	0.63290	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.98381	-4.39;-4.9	5.11	5.11	0.69529	.	0.428000	0.27406	N	0.019511	D	0.97523	0.9189	L	0.43152	1.355	0.40725	D	0.982694	P;B;D	0.67145	0.589;0.123;0.996	B;B;P	0.52909	0.065;0.009;0.713	D	0.97461	1.0034	10	0.33940	T	0.23	.	18.1665	0.89729	0.0:1.0:0.0:0.0	.	253;183;277	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	V	277;253	ENSP00000381499:A277V;ENSP00000410355:A253V	ENSP00000381499:A277V	A	+	2	0	PAX1	21635619	0.991000	0.36638	0.449000	0.26957	0.992000	0.81027	3.037000	0.49775	2.381000	0.81170	0.561000	0.74099	GCG		0.667	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
JPH2	57158	broad.mit.edu	37	20	42788287	42788287	+	Silent	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr20:42788287C>T	ENST00000372980.3	-	2	2012	c.1140G>A	c.(1138-1140)gcG>gcA	p.A380A		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	380	Ala-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)	p.A380A(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCTTCTGGCGCGCGATAGCAG	0.667																																					p.A380A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1140A	20						.						25.0	23.0	24.0					20																	42788287		2203	4296	6499	42221701	SO:0001819	synonymous_variant	57158	exon2			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.1140G>A	20.37:g.42788287C>T			42221701	NM_020433	E1P5X1|O95913|Q5JY74|Q9UJN4	Silent	SNP	ENST00000372980.3	37	CCDS13325.1																																																																																				0.667	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1		
ARHGAP5	394	broad.mit.edu	37	14	32562544	32562544	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3887-01	TCGA-AG-3887-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr14:32562544A>T	ENST00000345122.3	+	2	2984	c.2669A>T	c.(2668-2670)gAt>gTt	p.D890V	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.D890V|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.D890V|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.D890V	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	890					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.D890V(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCCAAGCAGATTTTTTTGAA	0.408																																					p.D890V	NSCLC(9;77 350 3443 29227 41353)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2669T	14						.						55.0	53.0	54.0					14																	32562544		2203	4298	6501	31632295	SO:0001583	missense	394	exon2			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.2669A>T	14.37:g.32562544A>T	ENSP00000371897:p.Asp890Val		31632295	NM_001030055	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	ENST00000345122.3	37	CCDS32062.1	.	.	.	.	.	.	.	.	.	.	A	15.38	2.817800	0.50633	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.66	4.52	0.55395	.	0.041485	0.85682	D	0.000000	T	0.54854	0.1884	L	0.46157	1.445	0.80722	D	1	D;D	0.65815	0.995;0.992	D;D	0.69142	0.962;0.916	T	0.56019	-0.8048	10	0.66056	D	0.02	.	11.8736	0.52534	0.9315:0.0:0.0685:0.0	.	890;890	Q13017-2;Q13017	.;RHG05_HUMAN	V	890	ENSP00000452222:D890V;ENSP00000441692:D890V;ENSP00000371897:D890V;ENSP00000393307:D890V	ENSP00000371897:D890V	D	+	2	0	ARHGAP5	31632295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.456000	0.80751	1.076000	0.40961	0.528000	0.53228	GAT		0.408	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409735.1	NM_001030055	
AKAP6	9472	broad.mit.edu	37	14	33201708	33201708	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr14:33201708C>T	ENST00000280979.4	+	10	3219	c.3049C>T	c.(3049-3051)Ctt>Ttt	p.L1017F	AKAP6_ENST00000557272.1_Missense_Mutation_p.L1017F|AKAP6_ENST00000557354.1_Missense_Mutation_p.L1017F	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1017					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)	p.L1017F(1)		NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GACGGAGCTGCTTAGTAAGGT	0.388																																					p.L1017F	Melanoma(49;821 1200 7288 13647 42351)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3049T	14						.						131.0	133.0	132.0					14																	33201708		2203	4299	6502	32271459	SO:0001583	missense	9472	exon10			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3049C>T	14.37:g.33201708C>T	ENSP00000280979:p.Leu1017Phe		32271459	NM_004274	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	ENST00000280979.4	37	CCDS9644.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093622	0.76756	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.23147	3.3;1.92;2.07	5.49	4.61	0.57282	.	0.000000	0.64402	D	0.000017	T	0.37073	0.0990	N	0.24115	0.695	0.48040	D	0.99957	D;D	0.89917	1.0;0.999	D;D	0.85130	0.994;0.997	T	0.28170	-1.0052	10	0.66056	D	0.02	-3.4835	14.3844	0.66934	0.0:0.9284:0.0:0.0716	.	1017;1017	A7E242;Q13023	.;AKAP6_HUMAN	F	1017	ENSP00000280979:L1017F;ENSP00000450531:L1017F;ENSP00000451247:L1017F	ENSP00000280979:L1017F	L	+	1	0	AKAP6	32271459	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.593000	0.61034	1.308000	0.44962	0.585000	0.79938	CTT		0.388	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
POLE2	5427	broad.mit.edu	37	14	50120781	50120781	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr14:50120781G>A	ENST00000216367.5	-	15	1237	c.1138C>T	c.(1138-1140)Cca>Tca	p.P380S	POLE2_ENST00000556584.1_5'UTR|POLE2_ENST00000554396.1_Missense_Mutation_p.P380S|POLE2_ENST00000539565.2_Missense_Mutation_p.P354S	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	380					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)	p.P380S(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	TCAGCAAGTGGTGGCCTATAA	0.299																																					p.P354S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1060T	14						.						70.0	72.0	71.0					14																	50120781		2203	4300	6503	49190531	SO:0001583	missense	5427	exon14			AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1138C>T	14.37:g.50120781G>A	ENSP00000216367:p.Pro380Ser		49190531	NM_001197330	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	ENST00000216367.5	37	CCDS32073.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873276	0.91664	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.50813	0.73;0.73;0.73	6.16	6.16	0.99307	DNA polymerase alpha/epsilon, subunit B (1);	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	M	0.62154	1.92	0.80722	D	1	D;D;D	0.89917	0.976;1.0;1.0	P;D;D	0.73708	0.883;0.974;0.981	T	0.64896	-0.6299	10	0.51188	T	0.08	-15.3232	20.8598	0.99761	0.0:0.0:1.0:0.0	.	380;354;380	A4FU92;B4DDE6;P56282	.;.;DPOE2_HUMAN	S	380;354;380	ENSP00000216367:P380S;ENSP00000446313:P354S;ENSP00000451621:P380S	ENSP00000216367:P380S	P	-	1	0	POLE2	49190531	1.000000	0.71417	0.997000	0.53966	0.731000	0.41821	9.808000	0.99193	2.937000	0.99478	0.650000	0.86243	CCA		0.299	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	
L2HGDH	79944	broad.mit.edu	37	14	50734557	50734557	+	Silent	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr14:50734557C>T	ENST00000267436.4	-	8	1375	c.978G>A	c.(976-978)ggG>ggA	p.G326G	L2HGDH_ENST00000421284.3_Silent_p.G326G|L2HGDH_ENST00000261699.4_Silent_p.G326G			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	326					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)	p.G326G(1)		kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					CTGCATTAGGCCCTAGCCAAA	0.398																																					p.G326G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G978A	14						.						113.0	101.0	105.0					14																	50734557		2203	4300	6503	49804307	SO:0001819	synonymous_variant	79944	exon8				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.978G>A	14.37:g.50734557C>T			49804307	NM_024884	Q9BRR1	Silent	SNP	ENST00000267436.4	37	CCDS9698.1																																																																																				0.398	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276870.2	NM_024884	
SGPP1	81537	broad.mit.edu	37	14	64153110	64153110	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr14:64153110G>C	ENST00000247225.6	-	3	1133	c.1039C>G	c.(1039-1041)Cta>Gta	p.L347V		NM_030791.2	NP_110418.1	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1	347					extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway (GO:0097193)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate metabolic process (GO:0006668)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	sphingosine-1-phosphate phosphatase activity (GO:0042392)	p.L347V(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	10				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)		AATGTATCTAGAGAAGGATCT	0.438																																					p.L347V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1039G	14						.						86.0	77.0	80.0					14																	64153110		2203	4300	6503	63222863	SO:0001583	missense	81537	exon3			AJ293294	CCDS9760.1	14q23.1	2003-09-17			ENSG00000126821	ENSG00000126821			17720	protein-coding gene	gene with protein product		612826				10859351	Standard	NM_030791		Approved		uc001xgj.3	Q9BX95	OTTHUMG00000029080	ENST00000247225.6:c.1039C>G	14.37:g.64153110G>C	ENSP00000247225:p.Leu347Val		63222863	NM_030791	B2RAH0|Q9H189	Missense_Mutation	SNP	ENST00000247225.6	37	CCDS9760.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.806504	0.00606	.	.	ENSG00000126821	ENST00000247225	.	.	.	5.99	1.84	0.25277	.	0.327305	0.28815	N	0.014053	T	0.24005	0.0581	L	0.57536	1.79	0.09310	N	0.999997	P	0.41080	0.737	B	0.31946	0.138	T	0.18681	-1.0329	9	0.17369	T	0.5	-19.5421	6.3905	0.21583	0.2634:0.0:0.6206:0.116	.	347	Q9BX95	SGPP1_HUMAN	V	347	.	ENSP00000247225:L347V	L	-	1	2	SGPP1	63222863	0.997000	0.39634	0.120000	0.21714	0.070000	0.16714	2.362000	0.44169	0.075000	0.16796	-0.150000	0.13652	CTA		0.438	SGPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072626.3	NM_030791	
RBX1	9978	broad.mit.edu	37	22	41363831	41363831	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr22:41363831G>A	ENST00000216225.8	+	4	297	c.257G>A	c.(256-258)cGc>cAc	p.R86H	XPNPEP3_ENST00000544094.1_3'UTR	NM_014248.3	NP_055063.1	P62877	RBX1_HUMAN	ring-box 1, E3 ubiquitin protein ligase	86					cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|Notch signaling pathway (GO:0007219)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul3-RING ubiquitin ligase complex (GO:0031463)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|Cul5-RING ubiquitin ligase complex (GO:0031466)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)|VCB complex (GO:0030891)	NEDD8 ligase activity (GO:0019788)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R86H(1)		large_intestine(1)|lung(3)|skin(1)	5						TGCATCTCTCGCTGGCTCAAA	0.438																																					p.R86H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G257A	22						.						99.0	96.0	97.0					22																	41363831		2203	4300	6503	39693777	SO:0001583	missense	9978	exon4			AF140598	CCDS14009.1	22q13.2	2010-09-17	2010-09-17		ENSG00000100387	ENSG00000100387		"""RING-type (C3HC4) zinc fingers"""	9928	protein-coding gene	gene with protein product	"""regulator of cullins 1"""	603814	"""ring-box 1"""			10213691, 10230407	Standard	NM_014248		Approved	ROC1, RNF75, BA554C12.1	uc003azk.3	P62877	OTTHUMG00000151298	ENST00000216225.8:c.257G>A	22.37:g.41363831G>A	ENSP00000216225:p.Arg86His		39693777	NM_014248	B2RDY1|Q8N6Z8|Q9D1S2|Q9WUK9|Q9Y254	Missense_Mutation	SNP	ENST00000216225.8	37	CCDS14009.1	.	.	.	.	.	.	.	.	.	.	G	35	5.529633	0.96446	.	.	ENSG00000100387	ENST00000216225	.	.	.	5.79	5.79	0.91817	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.000000	0.85682	D	0.000000	T	0.77274	0.4106	M	0.78637	2.42	0.80722	D	1	D	0.53885	0.963	P	0.56648	0.803	T	0.79342	-0.1843	9	0.72032	D	0.01	.	18.7997	0.92011	0.0:0.0:1.0:0.0	.	86	P62877	RBX1_HUMAN	H	86	.	ENSP00000216225:R86H	R	+	2	0	RBX1	39693777	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.282000	0.95840	2.739000	0.93911	0.462000	0.41574	CGC		0.438	RBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322149.1	NM_014248	
CILP2	148113	broad.mit.edu	37	19	19655854	19655854	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr19:19655854G>A	ENST00000291495.5	+	8	2585	c.2500G>A	c.(2500-2502)Gtc>Atc	p.V834I	CILP2_ENST00000586018.1_Missense_Mutation_p.V840I	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	834						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)		p.V834I(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CACCGTGGGCGTCACCCAGCC	0.711																																					p.V834I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2500A	19						.						15.0	15.0	15.0					19																	19655854		2083	4088	6171	19516854	SO:0001583	missense	148113	exon8			AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2500G>A	19.37:g.19655854G>A	ENSP00000291495:p.Val834Ile		19516854	NM_153221	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366199	0.82463	.	.	ENSG00000160161	ENST00000291495	T	0.10763	2.84	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	L	0.53249	1.67	0.52501	D	0.99995	D;D	0.71674	0.996;0.998	P;P	0.58520	0.762;0.84	T	0.00241	-1.1886	10	0.48119	T	0.1	-41.2155	16.2965	0.82776	0.0:0.0:1.0:0.0	.	834;834	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	I	834	ENSP00000291495:V834I	ENSP00000291495:V834I	V	+	1	0	CILP2	19516854	1.000000	0.71417	0.827000	0.32855	0.850000	0.48378	9.533000	0.98059	2.446000	0.82766	0.555000	0.69702	GTC		0.711	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
CHST8	64377	broad.mit.edu	37	19	34180193	34180193	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr19:34180193G>A	ENST00000262622.4	+	2	784	c.26G>A	c.(25-27)cGg>cAg	p.R9Q	CHST8_ENST00000438847.3_Missense_Mutation_p.R9Q|CHST8_ENST00000604556.1_3'UTR|CHST8_ENST00000434302.1_Missense_Mutation_p.R9Q	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	9					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.R9Q(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					GGAACAATGCGGCTGGCCTGC	0.642																																					p.R9Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G26A	19						.						98.0	90.0	93.0					19																	34180193		2203	4300	6503	38872033	SO:0001583	missense	64377	exon3			AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.26G>A	19.37:g.34180193G>A	ENSP00000262622:p.Arg9Gln		38872033	NM_001127895	Q9H3N2	Missense_Mutation	SNP	ENST00000262622.4	37	CCDS12433.1	.	.	.	.	.	.	.	.	.	.	G	33	5.196322	0.94960	.	.	ENSG00000124302	ENST00000434302;ENST00000438847;ENST00000262622	T;T;T	0.80393	-1.37;-1.37;-1.37	5.39	5.39	0.77823	.	0.000000	0.41500	D	0.000865	T	0.81945	0.4930	L	0.27053	0.805	0.37588	D	0.920068	D	0.76494	0.999	P	0.61275	0.886	T	0.81200	-0.1041	10	0.25106	T	0.35	-23.9943	18.1353	0.89617	0.0:0.0:1.0:0.0	.	9	Q9H2A9	CHST8_HUMAN	Q	9	ENSP00000392604:R9Q;ENSP00000393879:R9Q;ENSP00000262622:R9Q	ENSP00000262622:R9Q	R	+	2	0	CHST8	38872033	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.967000	0.49216	2.507000	0.84556	0.591000	0.81541	CGG		0.642	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451453.1	NM_022467	
GPI	2821	broad.mit.edu	37	19	34857731	34857731	+	Missense_Mutation	SNP	A	A	G	rs370578920		TCGA-AG-3887-01	TCGA-AG-3887-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr19:34857731A>G	ENST00000356487.5	+	3	498	c.257A>G	c.(256-258)aAt>aGt	p.N86S	GPI_ENST00000586425.1_Missense_Mutation_p.N86S|GPI_ENST00000415930.3_Missense_Mutation_p.N125S	NM_000175.3	NP_000166.2	P06744	G6PI_HUMAN	glucose-6-phosphate isomerase	86					aldehyde catabolic process (GO:0046185)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|hemostasis (GO:0007599)|humoral immune response (GO:0006959)|learning or memory (GO:0007611)|methylglyoxal biosynthetic process (GO:0019242)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glucose-6-phosphate isomerase activity (GO:0004347)|intramolecular transferase activity (GO:0016866)|monosaccharide binding (GO:0048029)	p.N86S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	25	Esophageal squamous(110;0.162)					CGGATGTTCAATGGTGAGAAG	0.602																																					p.N86S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A257G	19						.	A	SER/ASN,SER/ASN	0,4406		0,0,2203	81.0	81.0	81.0		257,374	-5.9	0.1	19		81	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GPI	NM_000175.3,NM_001184722.1	46,46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign	86/559,125/570	34857731	1,13005	2203	4300	6503	39549571	SO:0001583	missense	2821	exon3			M61214	CCDS12437.1, CCDS54246.1	19q13.1	2012-10-02	2010-05-11			ENSG00000105220	5.3.1.9		4458	protein-coding gene	gene with protein product		172400	"""glucose phosphate isomerase"""			2387591, 8575767	Standard	NM_001184722		Approved	AMF, NLK	uc002nvg.2	P06744		ENST00000356487.5:c.257A>G	19.37:g.34857731A>G	ENSP00000348877:p.Asn86Ser		39549571	NM_000175	B4DG39|Q9BRD3|Q9BSK5|Q9UHE6	Missense_Mutation	SNP	ENST00000356487.5	37	CCDS12437.1	.	.	.	.	.	.	.	.	.	.	A	4.310	0.056813	0.08339	0.0	1.16E-4	ENSG00000105220	ENST00000415930;ENST00000356487;ENST00000392234	D;D	0.93133	-3.17;-3.17	5.54	-5.86	0.02304	.	0.834933	0.11656	N	0.542343	T	0.75034	0.3795	N	0.00395	-1.55	0.09310	N	1	B;B;B;B;B	0.23806	0.0;0.0;0.0;0.091;0.0	B;B;B;B;B	0.36959	0.001;0.003;0.001;0.237;0.0	T	0.70204	-0.4936	10	0.02654	T	1	-12.9609	11.855	0.52431	0.1382:0.3116:0.5502:0.0	.	86;125;69;407;86	B4DE36;B4DG39;B4DVJ0;Q59F85;P06744	.;.;.;.;G6PI_HUMAN	S	125;86;407	ENSP00000405573:N125S;ENSP00000348877:N86S	ENSP00000348877:N86S	N	+	2	0	GPI	39549571	0.000000	0.05858	0.149000	0.22428	0.953000	0.61014	-0.583000	0.05807	-1.389000	0.02090	0.459000	0.35465	AAT		0.602	GPI-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451693.3		
RYR1	6261	broad.mit.edu	37	19	38989869	38989869	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr19:38989869C>A	ENST00000359596.3	+	43	7013	c.7013C>A	c.(7012-7014)gCt>gAt	p.A2338D	RYR1_ENST00000360985.3_Missense_Mutation_p.A2338D|RYR1_ENST00000355481.4_Missense_Mutation_p.A2338D			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2338	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.A2338D(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGCGCTTTGCTGTCTTCGTC	0.612																																					p.A2338D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7013A	19						.						97.0	72.0	80.0					19																	38989869		2203	4300	6503	43681709	SO:0001583	missense	6261	exon43			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7013C>A	19.37:g.38989869C>A	ENSP00000352608:p.Ala2338Asp		43681709	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512601	0.44660	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95238	-3.65;-3.65;-3.65	3.69	3.69	0.42338	Intracellular calcium-release channel (1);	0.000000	0.64402	U	0.000003	D	0.95884	0.8660	L	0.59436	1.845	0.50171	D	0.999852	P;D	0.65815	0.944;0.995	P;D	0.63703	0.714;0.917	D	0.96469	0.9347	10	0.87932	D	0	.	15.1881	0.73020	0.0:1.0:0.0:0.0	.	2338;2338	P21817-2;P21817	.;RYR1_HUMAN	D	2338	ENSP00000352608:A2338D;ENSP00000347667:A2338D;ENSP00000354254:A2338D	ENSP00000347667:A2338D	A	+	2	0	RYR1	43681709	1.000000	0.71417	0.985000	0.45067	0.308000	0.27856	7.651000	0.83577	1.890000	0.54733	0.313000	0.20887	GCT		0.612	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ELL	8178	broad.mit.edu	37	19	18576618	18576618	+	Frame_Shift_Del	DEL	C	C	-			TCGA-AG-3887-01	TCGA-AG-3887-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr19:18576618delC	ENST00000262809.4	-	3	365	c.294delG	c.(292-294)cagfs	p.Q98fs	ELL_ENST00000596124.3_5'UTR	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	98					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)	p.Q98fs*99(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		TGGAGACATACTGCTGGATGC	0.662			T	MLL	AL																																p.Q98fs			Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.294delG	19						.						38.0	41.0	40.0					19																	18576618		2203	4300	6503	18437618	SO:0001589	frameshift_variant	8178	exon3			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.294delG	19.37:g.18576618delC	ENSP00000262809:p.Gln98fs		18437618	NM_006532		Frame_Shift_Del	DEL	ENST00000262809.4	37	CCDS12380.1																																																																																				0.662	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466362.1	NM_006532	
SAE1	10055	broad.mit.edu	37	19	47656157	47656157	+	Silent	SNP	G	G	T	rs569028764	byFrequency	TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr19:47656157G>T	ENST00000270225.7	+	4	455	c.387G>T	c.(385-387)gtG>gtT	p.V129V	SAE1_ENST00000540850.1_Intron|SAE1_ENST00000413379.3_Silent_p.V129V|SAE1_ENST00000598840.1_Intron|SAE1_ENST00000392776.3_Silent_p.V129V	NM_005500.2	NP_005491.1	Q9UBE0	SAE1_HUMAN	SUMO1 activating enzyme subunit 1	129					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitotic cell cycle (GO:0007346)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP-dependent protein binding (GO:0043008)|enzyme activator activity (GO:0008047)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|ubiquitin activating enzyme activity (GO:0004839)	p.V129V(1)		endometrium(3)|large_intestine(5)|lung(4)|ovary(1)	13		all_cancers(25;1.13e-05)|all_lung(116;0.000192)|all_epithelial(76;0.000274)|Lung NSC(112;0.000446)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;0.00013)|OV - Ovarian serous cystadenocarcinoma(262;0.000146)|Epithelial(262;0.00697)|GBM - Glioblastoma multiforme(486;0.0278)		TTCTGCAGGTGTGTCTGACTT	0.408																																					p.V129V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G387T	19						.						134.0	128.0	130.0					19																	47656157		2203	4300	6503	52347997	SO:0001819	synonymous_variant	10055	exon4			BC018271	CCDS12696.1, CCDS54284.1, CCDS54285.1	19q13.32	2013-09-26				ENSG00000142230		"""Ubiquitin-like modifier activating enzymes"""	30660	protein-coding gene	gene with protein product	"""activator Of sumo 1"""	613294				10187858, 9920803, 10217437	Standard	NM_005500		Approved	AOS1, FLJ3091, Sua1	uc002pgc.3	Q9UBE0		ENST00000270225.7:c.387G>T	19.37:g.47656157G>T			52347997	NM_005500	B2RDP5|B3KMQ2|F5GXX7|G3XAK6|O95717|Q9P020	Silent	SNP	ENST00000270225.7	37	CCDS12696.1																																																																																				0.408	SAE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466775.1	NM_005500	
PXDNL	137902	broad.mit.edu	37	8	52258474	52258474	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr8:52258474G>A	ENST00000356297.4	-	20	4035	c.3935C>T	c.(3934-3936)aCg>aTg	p.T1312M	PXDNL_ENST00000543296.1_Intron	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1312					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.T1312M(2)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGACTCTTGCGTCACTGCTCT	0.408																																					p.T1312M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3935T	8						.						151.0	140.0	144.0					8																	52258474		1965	4158	6123	52421027	SO:0001583	missense	137902	exon20				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3935C>T	8.37:g.52258474G>A	ENSP00000348645:p.Thr1312Met		52421027	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.06|13.06	2.122934|2.122934	0.37436|0.37436	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000522933|ENST00000356297	.|T	.|0.65364	.|-0.15	3.71|3.71	1.86|1.86	0.25419|0.25419	.|.	.|.	.|.	.|.	.|.	T|T	0.49098|0.49098	0.1537|0.1537	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|D	.|0.63880	.|0.993	.|P	.|0.54346	.|0.749	T|T	0.35076|0.35076	-0.9803|-0.9803	5|9	.|0.45353	.|T	.|0.12	.|.	6.0102|6.0102	0.19571|0.19571	0.2561:0.0:0.7439:0.0|0.2561:0.0:0.7439:0.0	.|.	.|1312	.|A1KZ92	.|PXDNL_HUMAN	C|M	386|1312	.|ENSP00000348645:T1312M	.|ENSP00000348645:T1312M	R|T	-|-	1|2	0|0	PXDNL|PXDNL	52421027|52421027	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.876000|0.876000	0.28092|0.28092	0.098000|0.098000	0.17522|0.17522	0.467000|0.467000	0.42956|0.42956	CGC|ACG		0.408	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
LAPTM4B	55353	broad.mit.edu	37	8	98863681	98863681	+	Silent	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr8:98863681G>A	ENST00000521545.2	+	7	894	c.660G>A	c.(658-660)ccG>ccA	p.P220P	LAPTM4B_ENST00000445593.2_Silent_p.P311P			Q86VI4	LAP4B_HUMAN	lysosomal protein transmembrane 4 beta	364					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.P311P(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	10	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			AGGAGCCACCGCCACCTTACG	0.517																																					p.P311P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G933A	8						.						135.0	107.0	116.0					8																	98863681		2203	4300	6503	98932857	SO:0001819	synonymous_variant	55353	exon7			AF317417	CCDS6275.1	8q22.1	2008-08-11	2008-08-11		ENSG00000104341	ENSG00000104341			13646	protein-coding gene	gene with protein product		613296					Standard	NM_018407		Approved	LC27	uc003yia.3	Q86VI4	OTTHUMG00000164740	ENST00000521545.2:c.660G>A	8.37:g.98863681G>A			98932857	NM_018407	Q3ZCV5|Q7L909|Q86VH8|Q9H060	Silent	SNP	ENST00000521545.2	37																																																																																					0.517	LAPTM4B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000380016.2		
ANGPT1	284	broad.mit.edu	37	8	108509613	108509613	+	IGR	SNP	C	C	A	rs373049538		TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr8:108509613C>A								ANGPT1 (160863 upstream) : RNA5SP275 (387108 downstream)														p.T58T(1)									ACTGGTCTGTCGTACTCTCAC	0.468																																					p.T58T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G174T	8						.						228.0	190.0	203.0					8																	108509613		2203	4300	6503	108578789	SO:0001628	intergenic_variant	284	exon1																															8.37:g.108509613C>A			108578789	NM_001146		Silent	SNP		37																																																																																				0	0.468								
DENND2D	79961	broad.mit.edu	37	1	111738540	111738540	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr1:111738540C>T	ENST00000357640.4	-	6	872	c.643G>A	c.(643-645)Gag>Aag	p.E215K	DENND2D_ENST00000473682.1_5'UTR|DENND2D_ENST00000369752.5_Missense_Mutation_p.E212K	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	215	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.E215K(2)		breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		TAACCCACCTCAGTGCCTGAG	0.552																																					p.E215K												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G643A	1						.						143.0	140.0	141.0					1																	111738540		2203	4300	6503	111540063	SO:0001583	missense	79961	exon6				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.643G>A	1.37:g.111738540C>T	ENSP00000350266:p.Glu215Lys		111540063	NM_024901	Q5T5V6|Q9BSU0	Missense_Mutation	SNP	ENST00000357640.4	37	CCDS831.1	.	.	.	.	.	.	.	.	.	.	C	36	5.686917	0.96784	.	.	ENSG00000162777	ENST00000357640;ENST00000369752	T;T	0.12569	2.67;2.67	5.24	5.24	0.73138	DENN (3);	4.374290	0.01156	N	0.006533	T	0.24967	0.0606	L	0.46670	1.46	0.53688	D	0.999977	D;D	0.76494	0.998;0.999	D;D	0.68353	0.928;0.957	T	0.00817	-1.1554	10	0.36615	T	0.2	-23.2792	16.283	0.82707	0.0:1.0:0.0:0.0	.	212;215	Q9H6A0-2;Q9H6A0	.;DEN2D_HUMAN	K	215;212	ENSP00000350266:E215K;ENSP00000358767:E212K	ENSP00000350266:E215K	E	-	1	0	DENND2D	111540063	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.818000	0.86416	2.440000	0.82611	0.561000	0.74099	GAG		0.552	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000034456.1	NM_024901	
SYT6	148281	broad.mit.edu	37	1	114682272	114682272	+	Silent	SNP	C	C	A			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr1:114682272C>A	ENST00000610222.1	-	2	623	c.477G>T	c.(475-477)ctG>ctT	p.L159L	SYT6_ENST00000369547.1_Silent_p.L74L|SYT6_ENST00000607941.1_Silent_p.L74L|SYT6_ENST00000393296.1_Silent_p.L159L|SYT6_ENST00000609117.1_Silent_p.L74L			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	159					acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)	p.L74L(1)		central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGCCGCTGCAGCCGGGTGT	0.597																																					p.L74L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G222T	1						.						93.0	74.0	81.0					1																	114682272		2203	4300	6503	114483795	SO:0001819	synonymous_variant	148281	exon2				CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.477G>T	1.37:g.114682272C>A			114483795	NM_205848	B1AMB8|B3KPK1	Silent	SNP	ENST00000610222.1	37																																																																																					0.597	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000314819.2	NM_205848	
OR2L3	391192	broad.mit.edu	37	1	248224090	248224090	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr1:248224090T>C	ENST00000359959.3	+	1	107	c.107T>C	c.(106-108)aTg>aCg	p.M36T	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M36T(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			ATTTTCCTAATGGCTCTAATT	0.388																																					p.M36T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T107C	1						.						235.0	234.0	234.0					1																	248224090		2203	4297	6500	246290713	SO:0001583	missense	391192	exon1			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.107T>C	1.37:g.248224090T>C	ENSP00000353044:p.Met36Thr		246290713	NM_001004687	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	.	0.016	-1.512729	0.00975	.	.	ENSG00000198128	ENST00000359959	T	0.00344	8.02	2.05	0.852	0.18995	.	.	.	.	.	T	0.00144	0.0004	N	0.05574	-0.02	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.04255	-1.0965	9	0.18276	T	0.48	.	5.9817	0.19411	0.0:0.2714:0.0:0.7286	.	36	Q8NG85	OR2L3_HUMAN	T	36	ENSP00000353044:M36T	ENSP00000353044:M36T	M	+	2	0	OR2L3	246290713	0.000000	0.05858	0.030000	0.17652	0.052000	0.14988	0.763000	0.26517	0.067000	0.16545	0.379000	0.24179	ATG		0.388	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
MCAM	4162	broad.mit.edu	37	11	119183069	119183069	+	Missense_Mutation	SNP	G	G	A	rs200709459		TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr11:119183069G>A	ENST00000264036.4	-	8	945	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	MCAM_ENST00000530144.2_5'Flank|MCAM_ENST00000392814.1_Missense_Mutation_p.R260W	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	311	Ig-like C2-type 1.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R311W(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		TGTTCCTTCCGGGCAGGCTCC	0.587																																					p.R311W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C931T	11						.						88.0	81.0	84.0					11																	119183069		2199	4295	6494	118688279	SO:0001583	missense	4162	exon8			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.931C>T	11.37:g.119183069G>A	ENSP00000264036:p.Arg311Trp		118688279	NM_006500	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794640	0.31777	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.12774	2.65;2.65	4.78	0.26	0.15588	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31702	0.0805	M	0.82923	2.615	0.09310	N	1	D	0.67145	0.996	P	0.58970	0.849	T	0.10291	-1.0636	9	0.72032	D	0.01	-0.4956	9.0336	0.36273	0.0:0.1235:0.3409:0.5356	.	311	P43121	MUC18_HUMAN	W	311;260	ENSP00000264036:R311W;ENSP00000376561:R260W	ENSP00000264036:R311W	R	-	1	2	MCAM	118688279	0.001000	0.12720	0.024000	0.17045	0.153000	0.21895	0.884000	0.28214	0.181000	0.19994	0.561000	0.74099	CGG		0.587	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
OR10G7	390265	broad.mit.edu	37	11	123908885	123908885	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr11:123908885T>C	ENST00000330487.5	-	1	832	c.824A>G	c.(823-825)tAc>tGc	p.Y275C		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y275C(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CAGCGTGGTGTAGAAAACGGC	0.498																																					p.Y275C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A824G	11						.						104.0	95.0	98.0					11																	123908885		2200	4299	6499	123414095	SO:0001583	missense	390265	exon1			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.824A>G	11.37:g.123908885T>C	ENSP00000329689:p.Tyr275Cys		123414095	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239218	0.22711	.	.	ENSG00000182634	ENST00000330487	T	0.00318	8.12	3.28	3.28	0.37604	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36034	N	0.002828	T	0.00784	0.0026	M	0.91090	3.175	0.35218	D	0.775745	D	0.71674	0.998	D	0.73708	0.981	T	0.54282	-0.8317	10	0.87932	D	0	.	11.7536	0.51862	0.0:0.0:0.0:1.0	.	275	Q8NGN6	O10G7_HUMAN	C	275	ENSP00000329689:Y275C	ENSP00000329689:Y275C	Y	-	2	0	OR10G7	123414095	0.900000	0.30661	0.996000	0.52242	0.063000	0.16089	3.503000	0.53340	1.500000	0.48636	0.455000	0.32223	TAC		0.498	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
PRG3	10394	broad.mit.edu	37	11	57146259	57146259	+	Silent	SNP	G	G	T			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr11:57146259G>T	ENST00000287143.2	-	4	511	c.402C>A	c.(400-402)ggC>ggA	p.G134G		NM_006093.3	NP_006084.2	Q8TBJ4	LPPR1_HUMAN	proteoglycan 3	0					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)	p.G134G(1)		large_intestine(3)|lung(5)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	13						AGACAAGGTTGCCTCCGTAGC	0.498																																					p.G134G	Melanoma(154;1456 2519 19358 45229)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C402A	11						.						216.0	207.0	210.0					11																	57146259		2201	4296	6497	56902835	SO:0001819	synonymous_variant	10394	exon4			AF132209	CCDS7954.1	11q12.1	2008-02-05			ENSG00000156575	ENSG00000156575			9363	protein-coding gene	gene with protein product		606814				10318872, 11170744	Standard	NM_006093		Approved	MBPH	uc001njv.2	Q9Y2Y8	OTTHUMG00000167026	ENST00000287143.2:c.402C>A	11.37:g.57146259G>T			56902835	NM_006093	Q5VX23|Q9NXE2	Silent	SNP	ENST00000287143.2	37	CCDS7954.1																																																																																				0.498	PRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392467.1	NM_006093	
PACS1	55690	broad.mit.edu	37	11	65983993	65983993	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr11:65983993C>T	ENST00000320580.4	+	6	841	c.808C>T	c.(808-810)Cgt>Tgt	p.R270C		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	270					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)	p.R270C(1)	RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						TGTTGCAGATCGTTCTCCTGA	0.443																																					p.R270C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C808T	11						.						140.0	128.0	132.0					11																	65983993		2201	4295	6496	65740569	SO:0001583	missense	55690	exon6			AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.808C>T	11.37:g.65983993C>T	ENSP00000316454:p.Arg270Cys		65740569	NM_018026	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	37	CCDS8129.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324346	0.81580	.	.	ENSG00000175115	ENST00000320580	T	0.19806	2.12	5.32	4.37	0.52481	.	0.053068	0.85682	D	0.000000	T	0.44705	0.1306	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.69824	0.719;0.966	T	0.39901	-0.9591	10	0.72032	D	0.01	-11.3526	15.1718	0.72878	0.0:0.8591:0.1409:0.0	.	270;270	Q6VY07;Q6VY07-2	PACS1_HUMAN;.	C	270	ENSP00000316454:R270C	ENSP00000316454:R270C	R	+	1	0	PACS1	65740569	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.106000	0.77039	2.779000	0.95612	0.491000	0.48974	CGT		0.443	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
ROBO3	64221	broad.mit.edu	37	11	124740953	124740953	+	Silent	SNP	T	T	A			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr11:124740953T>A	ENST00000397801.1	+	7	1269	c.1077T>A	c.(1075-1077)gcT>gcA	p.A359A	ROBO3_ENST00000538940.1_Silent_p.A337A	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	359	Ig-like C2-type 4.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)		p.A359A(2)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		AGATGGCAGCTCCTGGAGAGA	0.592																																					p.A359A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T1077A	11						.						49.0	54.0	52.0					11																	124740953		1966	4139	6105	124246163	SO:0001819	synonymous_variant	64221	exon7			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1077T>A	11.37:g.124740953T>A			124246163	NM_022370		Silent	SNP	ENST00000397801.1	37	CCDS44755.1																																																																																				0.592	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
SOBP	55084	broad.mit.edu	37	6	107954900	107954900	+	Silent	SNP	A	A	G			TCGA-AG-3887-01	TCGA-AG-3887-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr6:107954900A>G	ENST00000317357.5	+	6	1511	c.852A>G	c.(850-852)gaA>gaG	p.E284E		NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)									p.E284E(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		CTCCCATGGAAAATAAAGCAG	0.522																																					p.E284E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A852G	6						.						56.0	61.0	60.0					6																	107954900		1933	4112	6045	108061593	SO:0001819	synonymous_variant	55084	exon6			AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.852A>G	6.37:g.107954900A>G			108061593	NM_018013		Silent	SNP	ENST00000317357.5	37	CCDS43488.1																																																																																				0.522	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013	
KIF13A	63971	broad.mit.edu	37	6	17764878	17764878	+	Silent	SNP	C	C	T	rs56327112	byFrequency	TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr6:17764878C>T	ENST00000259711.6	-	39	4986	c.4881G>A	c.(4879-4881)acG>acA	p.T1627T	KIF13A_ENST00000378814.5_Silent_p.T1579T|KIF13A_ENST00000378826.2_Silent_p.T1592T|KIF13A_ENST00000378843.2_Silent_p.T1579T|KIF13A_ENST00000378816.5_Silent_p.T1592T	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1627					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1627T(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CTGCATCCTTCGTCTGAATGG	0.517													c|||	6	0.00119808	0.0045	0.0	5008	,	,		19519	0.0		0.0	False		,,,				2504	0.0				p.T1627T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G4881A	6						.	C	,,,	14,4098		0,14,2042	78.0	76.0	77.0		4776,4737,4737,4881	-7.2	0.0	6	dbSNP_129	77	0,8408		0,0,4204	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	KIF13A	NM_001105566.2,NM_001105567.2,NM_001105568.2,NM_022113.5	,,,	0,14,6246	TT,TC,CC		0.0,0.3405,0.1118	,,,	1592/1771,1579/1758,1579/1750,1627/1806	17764878	14,12506	2056	4204	6260	17872857	SO:0001819	synonymous_variant	63971	exon39			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.4881G>A	6.37:g.17764878C>T			17872857	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Silent	SNP	ENST00000259711.6	37	CCDS47381.1																																																																																				0.517	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
PNPLA1	285848	broad.mit.edu	37	6	36259268	36259268	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr6:36259268G>A	ENST00000394571.2	+	2	377	c.377G>A	c.(376-378)cGc>cAc	p.R126H	PNPLA1_ENST00000388715.3_Missense_Mutation_p.R31H|PNPLA1_ENST00000312917.5_Missense_Mutation_p.R31H	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	126	Patatin.				lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)	p.R31H(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						AGCCTCACCCGCTTAACGGAC	0.602																																					p.R126H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G377A	6						.						68.0	61.0	63.0					6																	36259268		2203	4300	6503	36367246	SO:0001583	missense	285848	exon2				CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.377G>A	6.37:g.36259268G>A	ENSP00000378072:p.Arg126His		36367246	NM_001145717	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Missense_Mutation	SNP	ENST00000394571.2	37	CCDS54997.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882637	0.72410	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.24	4.36	0.52297	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.000000	0.64402	D	0.000012	D	0.82435	0.5036	M	0.71206	2.165	0.43275	D	0.995239	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.84937	0.0863	10	0.87932	D	0	-21.413	11.3522	0.49594	0.0887:0.0:0.9113:0.0	.	126;31	Q8N8W4;Q8N8W4-3	PLPL1_HUMAN;.	H	31;31;126;126	ENSP00000373367:R31H;ENSP00000321116:R31H;ENSP00000391868:R126H;ENSP00000378072:R126H	ENSP00000321116:R31H	R	+	2	0	PNPLA1	36367246	0.999000	0.42202	0.830000	0.32933	0.591000	0.36615	8.356000	0.90085	1.198000	0.43158	0.467000	0.42956	CGC		0.602	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
SYNE1	23345	broad.mit.edu	37	6	152708291	152708291	+	Silent	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr6:152708291G>A	ENST00000367255.5	-	54	9004	c.8403C>T	c.(8401-8403)taC>taT	p.Y2801Y	SYNE1_ENST00000448038.1_Silent_p.Y2808Y|SYNE1_ENST00000341594.5_Silent_p.Y2840Y|SYNE1_ENST00000265368.4_Silent_p.Y2801Y|SYNE1_ENST00000423061.1_Silent_p.Y2808Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2801					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.Y2801Y(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGTCTTTTCGTAGAGCTCCC	0.463										HNSCC(10;0.0054)																											p.Y2808Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C8424T	6						.						163.0	147.0	152.0					6																	152708291		2203	4300	6503	152749984	SO:0001819	synonymous_variant	23345	exon54			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.8403C>T	6.37:g.152708291G>A			152749984	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
C17orf97	400566	broad.mit.edu	37	17	263324	263324	+	Missense_Mutation	SNP	G	G	C	rs202235370	byFrequency	TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr17:263324G>C	ENST00000360127.6	+	2	706	c.690G>C	c.(688-690)gaG>gaC	p.E230D	C17orf97_ENST00000571106.1_Intron|AC108004.3_ENST00000466740.2_RNA	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	230	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCGACCCCGAGGCCCTCAAGG	0.721													G|||	4	0.000798722	0.0	0.0	5008	,	,		7501	0.001		0.001	False		,,,				2504	0.002				p.E230D												.	.	0			c.G690C	17						.						6.0	11.0	9.0					17																	263324		1891	4035	5926	263670	SO:0001583	missense	400566	exon3			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.690G>C	17.37:g.263324G>C	ENSP00000353245:p.Glu230Asp		263670	NM_001013672	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	G	0	-2.624371	0.00117	.	.	ENSG00000187624	ENST00000360127	T	0.33216	1.42	0.799	-1.6	0.08426	.	.	.	.	.	T	0.10078	0.0247	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26087	-1.0113	9	0.16420	T	0.52	.	3.06	0.06196	0.2383:0.0:0.4872:0.2745	.	230	Q6ZQX7-4	.	D	230	ENSP00000353245:E230D	ENSP00000353245:E230D	E	+	3	2	C17orf97	263670	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-3.499000	0.00450	-1.566000	0.01673	-1.206000	0.01644	GAG		0.721	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
TRPV1	7442	broad.mit.edu	37	17	3494318	3494318	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr17:3494318G>A	ENST00000571088.1	-	4	757	c.544C>T	c.(544-546)Cgg>Tgg	p.R182W	SHPK_ENST00000572705.1_Missense_Mutation_p.R182W|TRPV1_ENST00000425167.2_Missense_Mutation_p.R182W|TRPV1_ENST00000310522.5_Missense_Mutation_p.R182W|TRPV1_ENST00000399756.4_Missense_Mutation_p.R182W|TRPV1_ENST00000174621.6_Missense_Mutation_p.R180W|TRPV1_ENST00000576351.1_Missense_Mutation_p.R182W|TRPV1_ENST00000399759.3_Missense_Mutation_p.R182W	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	182					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)	p.R182W(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	TCCGTTTGCCGCGCGATCTCC	0.622																																					p.R182W	Melanoma(38;962 1762 15789)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C544T	17						.						65.0	67.0	67.0					17																	3494318		2132	4226	6358	3441067	SO:0001583	missense	7442	exon4			AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.544C>T	17.37:g.3494318G>A	ENSP00000461007:p.Arg182Trp		3441067	NM_018727	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	ENST00000571088.1	37	CCDS45576.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034963	0.54896	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61	5.19	1.95	0.26073	Ankyrin repeat-containing domain (2);	0.228496	0.44285	D	0.000472	T	0.73481	0.3592	L	0.59436	1.845	0.28444	N	0.916665	D;D;D;D	0.76494	0.991;0.999;0.999;0.998	B;P;P;B	0.57776	0.356;0.505;0.827;0.404	T	0.65985	-0.6035	10	0.87932	D	0	-30.8259	7.4197	0.27065	0.0:0.2441:0.3757:0.3802	.	182;180;182;182	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	W	182;182;180;182;182	ENSP00000382661:R182W;ENSP00000382659:R182W;ENSP00000174621:R180W;ENSP00000409627:R182W;ENSP00000311692:R182W	ENSP00000174621:R180W	R	-	1	2	TRPV1	3441067	0.986000	0.35501	0.998000	0.56505	0.471000	0.32888	2.311000	0.43717	1.321000	0.45227	-0.152000	0.13540	CGG		0.622	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727	
VTN	7448	broad.mit.edu	37	17	26694440	26694440	+	Missense_Mutation	SNP	G	G	A	rs201545006		TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr17:26694440G>A	ENST00000226218.4	-	8	2005	c.1387C>T	c.(1387-1389)Cgc>Tgc	p.R463C	SARM1_ENST00000379061.4_Intron|VTN_ENST00000438614.1_Intron|VTN_ENST00000431468.1_5'Flank|CTB-96E2.2_ENST00000555059.2_Intron|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Intron|VTN_ENST00000536498.1_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	463					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R463C(1)		kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	GCGATGGAGCGTGGGTAGGGA	0.617																																					p.R463C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1387T	17						.						114.0	96.0	102.0					17																	26694440		2203	4300	6503	23718567	SO:0001583	missense	7448	exon8			BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.1387C>T	17.37:g.26694440G>A	ENSP00000226218:p.Arg463Cys		23718567	NM_000638	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796665	0.70567	.	.	ENSG00000255604	ENST00000226218	T	0.03242	4.0	5.45	5.45	0.79879	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.27027	0.0662	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.06373	-1.0830	10	0.87932	D	0	-29.6817	19.4714	0.94965	0.0:0.0:1.0:0.0	.	463	P04004	VTNC_HUMAN	C	463	ENSP00000226218:R463C	ENSP00000226218:R463C	R	-	1	0	AC002094.1	23718567	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	4.607000	0.61133	2.837000	0.97791	0.591000	0.81541	CGC		0.617	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
SALL1	6299	broad.mit.edu	37	16	51174728	51174728	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr16:51174728G>A	ENST00000251020.4	-	2	1438	c.1405C>T	c.(1405-1407)Cgt>Tgt	p.R469C	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.R372C|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	469					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R469C(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GTATGGGAACGCAAGTGGATC	0.507																																					p.R469C	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1405T	16	GRCh37	HI971487	SALL1	I		.						99.0	93.0	95.0					16																	51174728		2198	4300	6498	49732229	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1405C>T	16.37:g.51174728G>A	ENSP00000251020:p.Arg469Cys		49732229	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831141	0.71258	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.25749	1.78;1.78	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.56963	0.2021	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63967	-0.6517	10	0.87932	D	0	.	18.685	0.91560	0.0:0.0:1.0:0.0	.	469	Q9NSC2	SALL1_HUMAN	C	469;372;433	ENSP00000251020:R469C;ENSP00000407914:R372C	ENSP00000251020:R469C	R	-	1	0	SALL1	49732229	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.864000	0.99589	2.386000	0.81285	0.563000	0.77884	CGT		0.507	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
CES1	1066	broad.mit.edu	37	16	55857578	55857578	+	Silent	SNP	G	G	A	rs373389314		TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr16:55857578G>A	ENST00000361503.4	-	4	550	c.420C>T	c.(418-420)caC>caT	p.H140H	CES1_ENST00000566555.1_5'UTR|CES1_ENST00000360526.3_Silent_p.H141H|CES1_ENST00000422046.2_Silent_p.H140H			P23141	EST1_HUMAN	carboxylesterase 1	140					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.H141H(1)							all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	GCCCCCCTCCGTGGATCCACA	0.562																																					p.H140H	NSCLC(162;1801 2756 42904 52896)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C420T	16						.	G	,,	2,4390		0,2,2194	64.0	58.0	60.0		420,423,420	-7.7	0.7	16		60	0,8596		0,0,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CES1	NM_001025194.1,NM_001025195.1,NM_001266.4	,,	0,2,6492	AA,AG,GG		0.0,0.0455,0.0154	,,	140/568,141/569,140/567	55857578	2,12986	2196	4298	6494	54415079	SO:0001819	synonymous_variant	1066	exon4			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.420C>T	16.37:g.55857578G>A			54415079	NM_001266	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Silent	SNP	ENST00000361503.4	37	CCDS45488.1																																																																																				0.562	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
SMAD4	4089	broad.mit.edu	37	18	48604788	48604788	+	Missense_Mutation	SNP	A	A	T	rs377767385		TCGA-AG-3887-01	TCGA-AG-3887-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr18:48604788A>T	ENST00000342988.3	+	12	2148	c.1610A>T	c.(1609-1611)gAc>gTc	p.D537V	SMAD4_ENST00000588745.1_Missense_Mutation_p.D441V|SMAD4_ENST00000586253.1_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.D537V	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	537	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(2)|p.D537G(1)|p.L536fs*11(1)|p.L536fs*14(1)|p.D537V(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CAGCTCCTAGACGAAGTACTT	0.483																																					p.D537V												SMAD4,large_intestine,NS,Substitution - Missense,+1	.	42	Whole gene deletion(36)|Substitution - Missense(2)|Deletion - Frameshift(2)|Unknown(2)	pancreas(26)|large_intestine(6)|lung(3)|breast(3)|stomach(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.A1610T	18						.						79.0	81.0	81.0					18																	48604788		2203	4300	6503	46858786	SO:0001583	missense	4089	exon12			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1610A>T	18.37:g.48604788A>T	ENSP00000341551:p.Asp537Val		46858786	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703094	0.68501	.	.	ENSG00000141646	ENST00000342988;ENST00000398417	D;D	0.98090	-4.71;-4.71	6.07	6.07	0.98685	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.99045	0.9673	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99509	1.0955	10	0.87932	D	0	.	15.6232	0.76824	1.0:0.0:0.0:0.0	.	537	Q13485	SMAD4_HUMAN	V	537	ENSP00000341551:D537V;ENSP00000381452:D537V	ENSP00000341551:D537V	D	+	2	0	SMAD4	46858786	1.000000	0.71417	0.989000	0.46669	0.955000	0.61496	9.118000	0.94355	2.326000	0.78906	0.533000	0.62120	GAC		0.483	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
PIK3CA	5290	broad.mit.edu	37	3	178928226	178928226	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr3:178928226C>T	ENST00000263967.3	+	9	1569	c.1412C>T	c.(1411-1413)cCa>cTa	p.P471L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	471	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.P471L(6)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TAGGAAACTCCATGCTTAGAG	0.368		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.P471L	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	.	6	Substitution - Missense(6)	large_intestine(2)|endometrium(2)|skin(2)	c.C1412T	3						.						99.0	93.0	95.0					3																	178928226		1846	4090	5936	180410920	SO:0001583	missense	5290	exon9				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1412C>T	3.37:g.178928226C>T	ENSP00000263967:p.Pro471Leu		180410920	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756128	0.89843	.	.	ENSG00000121879	ENST00000263967	T	0.75821	-0.97	5.64	5.64	0.86602	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.107853	0.64402	D	0.000005	D	0.83769	0.5326	M	0.74258	2.255	0.80722	D	1	D	0.56968	0.978	P	0.57620	0.824	T	0.81326	-0.0983	10	0.30854	T	0.27	-14.0418	19.6973	0.96031	0.0:1.0:0.0:0.0	.	471	P42336	PK3CA_HUMAN	L	471	ENSP00000263967:P471L	ENSP00000263967:P471L	P	+	2	0	PIK3CA	180410920	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.466000	0.80914	2.674000	0.91012	0.655000	0.94253	CCA		0.368	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
IL17RC	84818	broad.mit.edu	37	3	9972097	9972097	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr3:9972097T>A	ENST00000295981.3	+	15	1723	c.1505T>A	c.(1504-1506)cTt>cAt	p.L502H	IL17RC_ENST00000498214.1_Intron|IL17RC_ENST00000403601.3_Missense_Mutation_p.L431H|IL17RC_ENST00000455057.1_Missense_Mutation_p.L399H|IL17RC_ENST00000413608.1_Missense_Mutation_p.L431H|IL17RC_ENST00000383812.4_Missense_Mutation_p.L416H|IL17RC_ENST00000416074.2_Missense_Mutation_p.L270H	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	502					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)	p.L502H(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GCAGCTCGCCTTGGAGAGTAC	0.582																																					p.L416H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1247A	3						.						56.0	53.0	54.0					3																	9972097		2203	4300	6503	9947097	SO:0001583	missense	84818	exon14			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1505T>A	3.37:g.9972097T>A	ENSP00000295981:p.Leu502His		9947097	NM_032732	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	De_novo_Start_OutOfFrame	SNP	ENST00000295981.3	37	CCDS2590.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.675707	0.47781	.	.	ENSG00000163702	ENST00000383812;ENST00000295981;ENST00000436503;ENST00000403601;ENST00000416074;ENST00000455057;ENST00000413608	T;T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36;2.36	5.84	4.65	0.58169	.	0.250149	0.28393	N	0.015520	T	0.34019	0.0883	M	0.63843	1.955	0.28096	N	0.931625	P;D;B;B;D;D;D;P;D;D	0.89917	0.465;0.999;0.335;0.105;1.0;1.0;0.999;0.465;0.999;0.999	B;D;B;B;D;D;P;B;D;D	0.68353	0.148;0.955;0.049;0.071;0.943;0.943;0.903;0.148;0.915;0.957	T	0.13098	-1.0522	10	0.44086	T	0.13	-4.1499	9.0641	0.36453	0.1636:0.0:0.0:0.8364	.	416;270;399;414;431;431;270;416;502;431	Q8NAC3-4;F5H4Z2;E9PHG1;A8BWD5;E9PHJ6;A8BWC9;B4E008;Q8NAC3-3;Q8NAC3;Q8NAC3-2	.;.;.;.;.;.;.;.;I17RC_HUMAN;.	H	416;502;406;431;270;399;431	ENSP00000373323:L416H;ENSP00000295981:L502H;ENSP00000401128:L406H;ENSP00000384969:L431H;ENSP00000395315:L270H;ENSP00000407894:L399H;ENSP00000396064:L431H	ENSP00000295981:L502H	L	+	2	0	IL17RC	9947097	0.268000	0.24133	0.897000	0.35233	0.308000	0.27856	1.602000	0.36783	1.000000	0.39049	0.459000	0.35465	CTT		0.582	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
RNF168	165918	broad.mit.edu	37	3	196199068	196199068	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr3:196199068G>C	ENST00000318037.3	-	6	1932	c.1338C>G	c.(1336-1338)gaC>gaG	p.D446E	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	446					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D446E(1)		NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CCAATAACCTGTCCTGTTCTT	0.408																																					p.D446E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1338G	3						.						183.0	178.0	180.0					3																	196199068		2203	4300	6503	197683465	SO:0001583	missense	165918	exon6			AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.1338C>G	3.37:g.196199068G>C	ENSP00000320898:p.Asp446Glu		197683465	NM_152617	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912295	0.72983	.	.	ENSG00000163961	ENST00000318037	T	0.59906	0.23	6.08	-0.0015	0.14034	.	0.000000	0.64402	D	0.000002	T	0.72170	0.3427	M	0.80183	2.485	0.37234	D	0.9058	D	0.89917	1.0	D	0.87578	0.998	T	0.75351	-0.3348	10	0.87932	D	0	-29.4718	9.8172	0.40860	0.6423:0.0:0.3577:0.0	.	446	Q8IYW5	RN168_HUMAN	E	446	ENSP00000320898:D446E	ENSP00000320898:D446E	D	-	3	2	RNF168	197683465	0.987000	0.35691	0.968000	0.41197	0.818000	0.46254	0.084000	0.14891	0.131000	0.18576	0.591000	0.81541	GAC		0.408	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
TXNRD1	7296	broad.mit.edu	37	12	104645445	104645445	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr12:104645445C>T	ENST00000525566.1	+	2	256	c.232C>T	c.(232-234)Cgc>Tgc	p.R78C	TXNRD1_ENST00000429002.2_Missense_Mutation_p.R78C|TXNRD1_ENST00000526006.1_3'UTR	NM_001093771.2	NP_001087240.1	Q16881	TRXR1_HUMAN	thioredoxin reductase 1	78	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.R78C(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CACATGCACACGCTGTACTGA	0.453																																					p.R78C	Ovarian(139;555 1836 9186 9946 10884)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C232T	12						.						91.0	92.0	92.0					12																	104645445		2095	4233	6328	103169575	SO:0001583	missense	7296	exon2				CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000525566.1:c.232C>T	12.37:g.104645445C>T	ENSP00000434516:p.Arg78Cys		103169575	NM_001093771	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	ENST00000525566.1	37	CCDS53820.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857990	0.51376	.	.	ENSG00000198431	ENST00000525566;ENST00000429002	T;T	0.29655	1.56;1.56	4.85	-1.33	0.09172	Glutaredoxin (2);Thioredoxin-like fold (2);	.	.	.	.	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	D	0.54397	0.966	B	0.37508	0.252	T	0.21861	-1.0233	9	0.40728	T	0.16	0.0751	9.1985	0.37242	0.0:0.5276:0.0:0.4724	.	78	Q16881	TRXR1_HUMAN	C	78	ENSP00000434516:R78C;ENSP00000412045:R78C	ENSP00000412045:R78C	R	+	1	0	TXNRD1	103169575	0.000000	0.05858	0.000000	0.03702	0.373000	0.29922	0.025000	0.13577	-0.366000	0.08064	0.561000	0.74099	CGC		0.453	TXNRD1-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000389960.1	NM_003330	
NDUFA9	4704	broad.mit.edu	37	12	4771774	4771774	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr12:4771774G>A	ENST00000266544.5	+	6	648	c.628G>A	c.(628-630)Gag>Aag	p.E210K	RP11-500M8.7_ENST00000536588.1_3'UTR	NM_005002.4	NP_004993.1	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa	210					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|sodium ion transport (GO:0006814)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)|protein complex binding (GO:0032403)	p.E210K(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21						CTTTGGAAGAGAGGATAGATT	0.398																																					p.E210K	Colon(75;996 1244 23946 25294 29232)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G628A	12						.						165.0	157.0	160.0					12																	4771774		2203	4300	6503	4642035	SO:0001583	missense	4704	exon6			AF050641	CCDS8532.1	12p13.3	2011-09-14	2002-08-29		ENSG00000139180	ENSG00000139180		"""Mitochondrial respiratory chain complex / Complex I"", ""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	7693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 22E, member 1"", ""complex I 39kDa subunit"""	603834	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 (39kD)"""	NDUFS2L		8486360, 19027726	Standard	NM_005002		Approved	SDR22E1, CI-39k	uc001qnc.3	Q16795		ENST00000266544.5:c.628G>A	12.37:g.4771774G>A	ENSP00000266544:p.Glu210Lys		4642035	NM_005002	Q14076|Q2NKX0	Missense_Mutation	SNP	ENST00000266544.5	37	CCDS8532.1	.	.	.	.	.	.	.	.	.	.	G	35	5.420323	0.96111	.	.	ENSG00000139180	ENST00000266544	D	0.93247	-3.19	5.15	5.15	0.70609	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.97526	0.9190	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98455	1.0593	10	0.87932	D	0	-1.8039	17.7642	0.88473	0.0:0.0:1.0:0.0	.	210;210	A8K4V2;Q16795	.;NDUA9_HUMAN	K	210	ENSP00000266544:E210K	ENSP00000266544:E210K	E	+	1	0	NDUFA9	4642035	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	9.287000	0.95975	2.530000	0.85305	0.555000	0.69702	GAG		0.398	NDUFA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398900.2	NM_005002	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
PTHLH	5744	broad.mit.edu	37	12	28116698	28116698	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr12:28116698C>G	ENST00000545234.1	-	5	647	c.107G>C	c.(106-108)aGa>aCa	p.R36T	PTHLH_ENST00000535992.1_Missense_Mutation_p.R36T|PTHLH_ENST00000395872.1_Missense_Mutation_p.R36T|PTHLH_ENST00000395868.3_Missense_Mutation_p.R36T|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000354417.3_Missense_Mutation_p.R36T|PTHLH_ENST00000201015.4_Missense_Mutation_p.R36T|PTHLH_ENST00000538310.1_Missense_Mutation_p.R36T|PTHLH_ENST00000539239.1_Missense_Mutation_p.R36T			P12272	PTHR_HUMAN	parathyroid hormone-like hormone	36					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)	p.R36T(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					AGACACAGCTCTTTTGCTTTG	0.393																																					p.R36T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G107C	12						.						79.0	80.0	80.0					12																	28116698		2203	4300	6503	28007965	SO:0001583	missense	5744	exon4				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.107G>C	12.37:g.28116698C>G	ENSP00000441765:p.Arg36Thr		28007965	NM_002820	Q15251|Q6FH74	Missense_Mutation	SNP	ENST00000545234.1	37	CCDS44853.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.568828	0.86439	.	.	ENSG00000087494	ENST00000395872;ENST00000539239;ENST00000545234;ENST00000538310;ENST00000354417;ENST00000201015;ENST00000535992;ENST00000395868;ENST00000542963;ENST00000534890	D;D;D;D;D;D;D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1;-3.1;-3.1;-3.1;-3.1;-3.1;-3.1	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.93009	0.7775	M	0.66297	2.02	0.52099	D	0.999949	P	0.47484	0.896	P	0.46510	0.519	D	0.93696	0.7011	10	0.87932	D	0	-18.6092	18.7334	0.91744	0.0:1.0:0.0:0.0	.	36	P12272	PTHR_HUMAN	T	36;36;36;36;36;36;36;36;36;44	ENSP00000379213:R36T;ENSP00000441571:R36T;ENSP00000441765:R36T;ENSP00000441890:R36T;ENSP00000346398:R36T;ENSP00000201015:R36T;ENSP00000440613:R36T;ENSP00000379209:R36T;ENSP00000444519:R36T;ENSP00000445157:R44T	ENSP00000201015:R36T	R	-	2	0	PTHLH	28007965	1.000000	0.71417	0.807000	0.32361	0.994000	0.84299	6.248000	0.72418	2.665000	0.90641	0.655000	0.94253	AGA		0.393	PTHLH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402913.1	NM_198965	
HOXC9	3225	broad.mit.edu	37	12	54394194	54394194	+	Silent	SNP	C	C	T	rs34136736	byFrequency	TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr12:54394194C>T	ENST00000303450.4	+	1	292	c.222C>T	c.(220-222)tcC>tcT	p.S74S	HOXC-AS1_ENST00000512427.1_RNA|HOXC9_ENST00000508190.1_Silent_p.S74S|HOXC-AS1_ENST00000505700.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|HOXC9_ENST00000504557.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	74					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)	p.S74S(1)		large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						CTCAGTCGTCCGTGGTATATC	0.677																																					p.S74S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C222T	12						.	C		1,4405	2.1+/-5.4	0,1,2202	34.0	33.0	33.0		222	1.0	1.0	12	dbSNP_126	33	3,8595	3.0+/-9.4	0,3,4296	no	coding-synonymous	HOXC9	NM_006897.1		0,4,6498	TT,TC,CC		0.0349,0.0227,0.0308		74/261	54394194	4,13000	2203	4299	6502	52680461	SO:0001819	synonymous_variant	3225	exon1				CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.222C>T	12.37:g.54394194C>T			52680461	NM_006897	B2RCN7|Q9H1I0	Silent	SNP	ENST00000303450.4	37	CCDS8869.1																																																																																				0.677	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1		
TMEM132B	114795	broad.mit.edu	37	12	126139253	126139253	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr12:126139253G>T	ENST00000299308.3	+	9	3242	c.3234G>T	c.(3232-3234)atG>atT	p.M1078I	TMEM132B_ENST00000535886.1_Missense_Mutation_p.M590I	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	1078						integral component of membrane (GO:0016021)		p.M1078I(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAGACCAGATGTAAACTCCTT	0.408																																					p.M1078I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3234T	12						.						63.0	58.0	59.0					12																	126139253		1865	4084	5949	124705206	SO:0001583	missense	114795	exon9			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.3234G>T	12.37:g.126139253G>T	ENSP00000299308:p.Met1078Ile		124705206	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	37	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138149	0.37728	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.08807	3.83;3.05	5.81	5.81	0.92471	.	0.131674	0.53938	D	0.000055	T	0.09949	0.0244	L	0.34521	1.04	0.43550	D	0.995854	B	0.28933	0.228	B	0.28011	0.085	T	0.17289	-1.0374	10	0.38643	T	0.18	.	20.0838	0.97793	0.0:0.0:1.0:0.0	.	1078	Q14DG7	T132B_HUMAN	I	1078;590	ENSP00000299308:M1078I;ENSP00000440436:M590I	ENSP00000299308:M1078I	M	+	3	0	TMEM132B	124705206	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.845000	0.92153	2.741000	0.93983	0.655000	0.94253	ATG		0.408	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
POTEB2	100287399	broad.mit.edu	37	15	21071315	21071315	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr15:21071315C>T	ENST00000454856.4	-	1	328	c.296G>A	c.(295-297)cGt>cAt	p.R99H		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	99								p.R99H(1)									ATCTTCTCGACGGACGTGGTA	0.587																																					p.R136H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G407A	15						.						1.0	1.0	1.0					15																	21071315		53	386	439	19335894	SO:0001583	missense	339010	exon1				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.296G>A	15.37:g.21071315C>T	ENSP00000456953:p.Arg99His		19335894	NM_207355		Missense_Mutation	SNP	ENST00000454856.4	37	CCDS59248.1																																																																																				0.587	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1		
ATP10A	57194	broad.mit.edu	37	15	25961909	25961909	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr15:25961909C>A	ENST00000356865.6	-	9	1855	c.1744G>T	c.(1744-1746)Gtc>Ttc	p.V582F		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	582					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.V582F(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GACGTGACGACGACTGTGTTG	0.592																																					p.V582F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1744T	15						.						154.0	136.0	142.0					15																	25961909		2203	4300	6503	23513002	SO:0001583	missense	57194	exon9			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1744G>T	15.37:g.25961909C>A	ENSP00000349325:p.Val582Phe		23513002	NM_024490	Q4G0S9|Q969I4	Missense_Mutation	SNP	ENST00000356865.6	37	CCDS32178.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.426030	0.83667	.	.	ENSG00000206190	ENST00000356865	T	0.71817	-0.6	5.39	5.39	0.77823	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.062052	0.64402	D	0.000005	D	0.86464	0.5939	M	0.84585	2.705	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88386	0.3005	10	0.87932	D	0	-29.2495	19.1608	0.93531	0.0:1.0:0.0:0.0	.	582	O60312	AT10A_HUMAN	F	582	ENSP00000349325:V582F	ENSP00000349325:V582F	V	-	1	0	ATP10A	23513002	0.999000	0.42202	0.371000	0.25978	0.467000	0.32768	3.877000	0.56123	2.521000	0.84997	0.655000	0.94253	GTC		0.592	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
HDC	3067	broad.mit.edu	37	15	50546857	50546857	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr15:50546857G>A	ENST00000267845.3	-	5	848	c.446C>T	c.(445-447)aCg>aTg	p.T149M	HDC_ENST00000543581.1_Missense_Mutation_p.T149M	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.T149M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TTCACTGACCGTGCTCTGCAG	0.468																																					p.T149M	GBM(95;1627 1936 6910 9570)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C446T	15						.						72.0	69.0	70.0					15																	50546857		2196	4295	6491	48334149	SO:0001583	missense	3067	exon5				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.446C>T	15.37:g.50546857G>A	ENSP00000267845:p.Thr149Met		48334149	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009858	0.75046	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.40225	1.04;1.04	5.79	4.82	0.62117	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.053861	0.64402	D	0.000001	T	0.75488	0.3856	H	0.95917	3.74	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.83611	0.0134	10	0.87932	D	0	-14.1593	16.3449	0.83120	0.0:0.1318:0.8682:0.0	.	149;149	B7ZM01;P19113	.;DCHS_HUMAN	M	149	ENSP00000267845:T149M;ENSP00000440252:T149M	ENSP00000267845:T149M	T	-	2	0	HDC	48334149	1.000000	0.71417	0.972000	0.41901	0.611000	0.37282	7.658000	0.83755	2.733000	0.93635	0.655000	0.94253	ACG		0.468	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
BCL2A1	597	broad.mit.edu	37	15	80263104	80263104	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3887-01	TCGA-AG-3887-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr15:80263104A>G	ENST00000267953.3	-	1	684	c.358T>C	c.(358-360)Tat>Cat	p.Y120H	BCL2A1_ENST00000335661.6_Missense_Mutation_p.Y120H	NM_004049.3	NP_004040.1	Q16548	B2LA1_HUMAN	BCL2-related protein A1	120					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Y120H(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	12						GCAACAAAATATGAAATCTCC	0.388																																					p.Y120H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T358C	15						.						117.0	124.0	122.0					15																	80263104		2203	4300	6503	78050159	SO:0001583	missense	597	exon1				CCDS10312.1, CCDS45322.1	15q24.3	2014-05-20			ENSG00000140379	ENSG00000140379			991	protein-coding gene	gene with protein product		601056		HBPA1		8589678, 12771180	Standard	NM_004049		Approved	GRS, BFL1, BCL2L5, ACC-1, ACC-2	uc002bfc.4	Q16548	OTTHUMG00000144173	ENST00000267953.3:c.358T>C	15.37:g.80263104A>G	ENSP00000267953:p.Tyr120His		78050159	NM_004049	Q6FGZ4|Q6FH19|Q86W13|Q99524	Missense_Mutation	SNP	ENST00000267953.3	37	CCDS10312.1	.	.	.	.	.	.	.	.	.	.	A	4.056	0.008054	0.07912	.	.	ENSG00000140379	ENST00000267953;ENST00000335661	T;T	0.11169	2.8;2.8	5.48	-1.13	0.09775	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (3);	1.084810	0.06993	N	0.821914	T	0.06462	0.0166	N	0.16602	0.42	0.09310	N	1	B;B	0.11235	0.004;0.0	B;B	0.12837	0.008;0.005	T	0.43032	-0.9416	10	0.33141	T	0.24	-12.9343	5.7601	0.18195	0.5215:0.0:0.3534:0.1251	.	120;120	Q86W13;Q16548	.;B2LA1_HUMAN	H	120	ENSP00000267953:Y120H;ENSP00000335250:Y120H	ENSP00000267953:Y120H	Y	-	1	0	BCL2A1	78050159	0.027000	0.19231	0.000000	0.03702	0.000000	0.00434	0.551000	0.23361	-0.189000	0.10482	-1.151000	0.01829	TAT		0.388	BCL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291372.1	NM_004049	
CEMIP	57214	broad.mit.edu	37	15	81229022	81229022	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr15:81229022T>C	ENST00000394685.3	+	24	3436	c.3017T>C	c.(3016-3018)aTt>aCt	p.I1006T	KIAA1199_ENST00000356249.5_Missense_Mutation_p.I1006T|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Missense_Mutation_p.I1006T			Q8WUJ3	CEMIP_HUMAN		1006					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.I1006T(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AAGATGTACATTCAAGCCTAC	0.463																																					p.I1006T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3017C	15						.						129.0	136.0	134.0					15																	81229022		2203	4300	6503	79016077	SO:0001583	missense	57214	exon23																														ENST00000394685.3:c.3017T>C	15.37:g.81229022T>C	ENSP00000378177:p.Ile1006Thr		79016077	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349844	0.82132	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.72282	-0.64;-0.64;-0.64	5.4	5.4	0.78164	.	0.057734	0.64402	D	0.000001	T	0.76849	0.4045	M	0.72118	2.19	0.48571	D	0.999671	P	0.52463	0.953	P	0.50109	0.631	T	0.79383	-0.1826	10	0.52906	T	0.07	-19.8121	15.4265	0.75055	0.0:0.0:0.0:1.0	.	1006	Q8WUJ3	K1199_HUMAN	T	1006	ENSP00000220244:I1006T;ENSP00000378177:I1006T;ENSP00000348583:I1006T	ENSP00000220244:I1006T	I	+	2	0	KIAA1199	79016077	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.386000	0.79775	2.045000	0.60652	0.383000	0.25322	ATT		0.463	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
MRPL46	26589	broad.mit.edu	37	15	89010571	89010571	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	G	G	G	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr15:89010571G>T	ENST00000312475.4	-	1	79	c.38C>A	c.(37-39)gCg>gAg	p.A13E	MRPL46_ENST00000559538.1_5'Flank|MRPS11_ENST00000325844.4_5'Flank|MRPS11_ENST00000353598.6_5'Flank	NM_022163.3	NP_071446.2	Q9H2W6	RM46_HUMAN	mitochondrial ribosomal protein L46	13						mitochondrion (GO:0005739)|ribosome (GO:0005840)	hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CCAACCCCCCGCCACCCCTAA	0.682																																					p.A13E												.	.	0			c.C38A	15						.						10.0	14.0	13.0					15																	89010571		2184	4282	6466	86811575	SO:0001583	missense	26589	exon1			AF210056	CCDS10341.1	15q25.3	2012-10-08	2001-12-10	2001-12-14	ENSG00000259494	ENSG00000259494		"""Mitochondrial ribosomal proteins / large subunits"""	1192	protein-coding gene	gene with protein product		611851	"""chromosome 15 open reading frame 4"""	C15orf4		11761714, 11551941	Standard	NM_022163		Approved	LIECG2, P2ECSL	uc002bmj.2	Q9H2W6	OTTHUMG00000148683	ENST00000312475.4:c.38C>A	15.37:g.89010571G>T	ENSP00000312311:p.Ala13Glu		86811575	NM_022163	B2RD75|Q9HBU8	Missense_Mutation	SNP	ENST00000312475.4	37	CCDS10341.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.686951	0.48097	.	.	ENSG00000173867	ENST00000312475	T	0.47177	0.85	4.71	3.8	0.43715	.	0.694969	0.14788	N	0.298386	T	0.28433	0.0703	N	0.08118	0	0.09310	N	1	P	0.47106	0.89	B	0.42188	0.379	T	0.04579	-1.0941	10	0.25751	T	0.34	.	11.5976	0.50984	0.0873:0.0:0.9127:0.0	.	13	Q9H2W6	RM46_HUMAN	E	13	ENSP00000312311:A13E	ENSP00000312311:A13E	A	-	2	0	MRPL46	86811575	0.006000	0.16342	0.002000	0.10522	0.010000	0.07245	1.114000	0.31196	1.196000	0.43129	0.655000	0.94253	GCG		0.682	MRPL46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309073.1	NM_022163	
SLC4A4	8671	broad.mit.edu	37	4	72432767	72432767	+	3'UTR	SNP	A	A	C			TCGA-AG-3887-01	TCGA-AG-3887-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr4:72432767A>C	ENST00000264485.5	+	0	3360				SLC4A4_ENST00000351898.6_3'UTR|SLC4A4_ENST00000340595.3_3'UTR|SLC4A4_ENST00000425175.1_Missense_Mutation_p.K1049T	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4						bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)	p.K1049T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	CATGCTGATAAAATTCCTTTC	0.363																																					p.K1049T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3146C	4						.						146.0	133.0	137.0					4																	72432767		2203	4300	6503	72651631	SO:0001624	3_prime_UTR_variant	8671	exon24			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.*3A>C	4.37:g.72432767A>C			72651631	NM_001134742	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.714513	0.48622	.	.	ENSG00000080493	ENST00000425175	T	0.79454	-1.27	5.6	5.6	0.85130	.	.	.	.	.	T	0.50786	0.1636	N	0.01505	-0.83	0.42146	D	0.991537	B	0.02656	0.0	B	0.04013	0.001	T	0.52801	-0.8527	9	0.59425	D	0.04	.	7.4449	0.27205	0.7832:0.1441:0.0727:0.0	.	1049	A5JJ20	.	T	1049	ENSP00000393557:K1049T	ENSP00000393557:K1049T	K	+	2	0	SLC4A4	72651631	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.021000	0.49651	2.141000	0.66446	0.383000	0.25322	AAA		0.363	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
DCHS2	54798	broad.mit.edu	37	4	155156597	155156597	+	Silent	SNP	C	C	T	rs61741036		TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr4:155156597C>T	ENST00000357232.4	-	25	7841	c.7842G>A	c.(7840-7842)ccG>ccA	p.P2614P		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2614					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P2614P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCAACCATTCCGGAGTGGCAT	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19474	0.0		0.0	False		,,,				2504	0.0				p.P2614P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G7842A	4						.	C		1,4405	2.1+/-5.4	0,1,2202	121.0	120.0	120.0		7842	-11.6	0.0	4	dbSNP_129	120	0,8600		0,0,4300	no	coding-synonymous	DCHS2	NM_017639.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		2614/2917	155156597	1,13005	2203	4300	6503	155376047	SO:0001819	synonymous_variant	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7842G>A	4.37:g.155156597C>T			155376047	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																				0.493	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
FRMPD4	9758	broad.mit.edu	37	X	12734767	12734767	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chrX:12734767G>A	ENST00000380682.1	+	15	2695	c.2189G>A	c.(2188-2190)gGg>gAg	p.G730E		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	730					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.G720E(1)		breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GCCGCGGAGGGGATCGAGGAA	0.557																																					p.G730E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2189A	X						.						109.0	110.0	109.0					X																	12734767		2203	4300	6503	12644688	SO:0001583	missense	9758	exon15			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.2189G>A	X.37:g.12734767G>A	ENSP00000370057:p.Gly730Glu		12644688	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113894	0.77210	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.25912	1.77	5.71	5.71	0.89125	.	0.050249	0.85682	D	0.000000	T	0.51601	0.1684	M	0.72118	2.19	0.46725	D	0.999171	D;D	0.76494	0.999;0.999	D;D	0.65684	0.937;0.937	T	0.53982	-0.8361	10	0.87932	D	0	-27.4928	18.8648	0.92287	0.0:0.0:1.0:0.0	.	722;730	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	E	730;721;719	ENSP00000370057:G730E	ENSP00000304583:G719E	G	+	2	0	FRMPD4	12644688	1.000000	0.71417	0.596000	0.28811	0.653000	0.38743	9.360000	0.97119	2.402000	0.81655	0.600000	0.82982	GGG		0.557	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
IL1RAPL2	26280	broad.mit.edu	37	X	105011533	105011533	+	Missense_Mutation	SNP	C	C	T	rs367966545		TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chrX:105011533C>T	ENST00000372582.1	+	11	2696	c.1940C>T	c.(1939-1941)aCg>aTg	p.T647M	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.T647M	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	647					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.T647M(2)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CTGCCTCTGACGCTACTCAAC	0.468																																					p.T647M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1940T	X						.						131.0	131.0	131.0					X																	105011533		2203	4300	6503	104898189	SO:0001583	missense	26280	exon11			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1940C>T	X.37:g.105011533C>T	ENSP00000361663:p.Thr647Met		104898189	NM_017416	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803705	0.50315	.	.	ENSG00000189108	ENST00000372582;ENST00000344799;ENST00000538500	T;T;T	0.07216	3.5;3.5;3.21	5.83	4.96	0.65561	.	0.155567	0.45867	D	0.000330	T	0.12518	0.0304	M	0.71581	2.175	0.54753	D	0.999987	P	0.42337	0.776	B	0.36885	0.235	T	0.01578	-1.1320	10	0.87932	D	0	.	14.3304	0.66553	0.1491:0.8509:0.0:0.0	.	647	Q9NP60	IRPL2_HUMAN	M	647;647;252	ENSP00000361663:T647M;ENSP00000344976:T647M;ENSP00000445576:T252M	ENSP00000344976:T647M	T	+	2	0	IL1RAPL2	104898189	0.998000	0.40836	0.779000	0.31741	0.899000	0.52679	3.749000	0.55150	1.185000	0.42971	0.600000	0.82982	ACG		0.468	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
SLC6A8	6535	broad.mit.edu	37	X	152958817	152958817	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chrX:152958817T>C	ENST00000253122.5	+	6	1488	c.1012T>C	c.(1012-1014)Tac>Cac	p.Y338H	SLC6A8_ENST00000430077.2_Missense_Mutation_p.Y223H|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	338					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)	p.Y338H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	CAACAACTGCTACAAGTAAGC	0.637																																					p.Y338H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1012C	X						.						51.0	52.0	52.0					X																	152958817		2203	4300	6503	152612011	SO:0001583	missense	6535	exon6				CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1012T>C	X.37:g.152958817T>C	ENSP00000253122:p.Tyr338His		152612011	NM_005629	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	ENST00000253122.5	37	CCDS14726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	24.5|24.5	4.542141|4.542141	0.85917|0.85917	.|.	.|.	ENSG00000130821|ENSG00000130821	ENST00000413787|ENST00000253122;ENST00000430077;ENST00000328897	T|T;T	0.78003|0.76448	-1.14|-1.02;-1.02	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	.|0.000000	.|0.64402	.|U	.|0.000003	D|D	0.84192|0.84192	0.5418|0.5418	L|L	0.60455|0.60455	1.87|1.87	0.80722|0.80722	D|D	1|1	.|D;P	.|0.71674	.|0.998;0.932	.|D;P	.|0.66084	.|0.941;0.761	D|D	0.85746|0.85746	0.1340|0.1340	7|10	0.87932|0.72032	D|D	0|0.01	.|.	12.6996|12.6996	0.57024|0.57024	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|357;338	.|Q59EV7;P48029	.|.;SC6A8_HUMAN	P|H	53|338;223;344	ENSP00000400463:L53P|ENSP00000253122:Y338H;ENSP00000403041:Y223H	ENSP00000400463:L53P|ENSP00000253122:Y338H	L|Y	+|+	2|1	0|0	SLC6A8|SLC6A8	152612011|152612011	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	7.710000|7.710000	0.84655|0.84655	1.843000|1.843000	0.53566|0.53566	0.430000|0.430000	0.28490|0.28490	CTA|TAC		0.637	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1		
PLXNA3	55558	broad.mit.edu	37	X	153694773	153694773	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chrX:153694773C>T	ENST00000369682.3	+	16	3029	c.2854C>T	c.(2854-2856)Cgg>Tgg	p.R952W		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	952	IPT/TIG 2.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)	p.R952W(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGGGGGCACACGGCTTACCAT	0.677																																					p.R952W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2854T	X						.						63.0	74.0	70.0					X																	153694773		2202	4300	6502	153347967	SO:0001583	missense	55558	exon16			X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.2854C>T	X.37:g.153694773C>T	ENSP00000358696:p.Arg952Trp		153347967	NM_017514	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	C	2.627	-0.287332	0.05605	.	.	ENSG00000130827	ENST00000369682	T	0.77358	-1.09	4.98	2.1	0.27182	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.186098	0.43579	D	0.000544	T	0.64571	0.2610	N	0.25485	0.75	0.21290	N	0.999736	B	0.06786	0.001	B	0.08055	0.003	T	0.51340	-0.8718	10	0.38643	T	0.18	.	12.6135	0.56563	0.5647:0.4353:0.0:0.0	.	952	P51805	PLXA3_HUMAN	W	952	ENSP00000358696:R952W	ENSP00000358696:R952W	R	+	1	2	PLXNA3	153347967	0.000000	0.05858	0.607000	0.28956	0.160000	0.22226	-0.238000	0.08977	0.006000	0.14734	0.591000	0.81541	CGG		0.677	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
IL1RN	3557	broad.mit.edu	37	2	113890279	113890279	+	Missense_Mutation	SNP	G	G	A	rs373101669		TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:113890279G>A	ENST00000409930.3	+	4	429	c.365G>A	c.(364-366)cGc>cAc	p.R122H	IL1RN_ENST00000259206.5_Missense_Mutation_p.R125H|IL1RN_ENST00000361779.3_Missense_Mutation_p.R88H|IL1RN_ENST00000409052.1_Missense_Mutation_p.R88H|IL1RN_ENST00000354115.2_Missense_Mutation_p.R104H	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	122					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)	p.R125H(1)|p.R88H(1)		breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	CAGGACAAGCGCTTCGCCTTC	0.577									Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R104H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G311A	2						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	90.0	85.0	86.0		311,374,365,263	5.8	1.0	2		86	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	IL1RN	NM_000577.4,NM_173841.2,NM_173842.2,NM_173843.2	29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	104/160,125/181,122/178,88/144	113890279	1,13005	2203	4300	6503	113606750	SO:0001583	missense	3557	exon5	Familial Cancer Database	Lichen Sclerosis, Familial	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.365G>A	2.37:g.113890279G>A	ENSP00000387173:p.Arg122His		113606750	NM_000577	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	ENST00000409930.3	37	CCDS46396.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.121714	0.77436	0.0	1.16E-4	ENSG00000136689	ENST00000409052;ENST00000361779;ENST00000259206;ENST00000354115;ENST00000409930	T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04	5.8	5.8	0.92144	.	0.048476	0.85682	D	0.000000	T	0.56834	0.2012	M	0.92833	3.35	0.46011	D	0.998813	D;P;D	0.89917	1.0;0.943;0.983	D;P;P	0.91635	0.999;0.575;0.814	T	0.65932	-0.6048	10	0.72032	D	0.01	-22.6235	15.561	0.76244	0.0:0.0:1.0:0.0	.	122;104;125	P18510;P18510-2;Q53SC2	IL1RA_HUMAN;.;.	H	88;88;125;104;122	ENSP00000387210:R88H;ENSP00000354816:R88H;ENSP00000259206:R125H;ENSP00000329072:R104H;ENSP00000387173:R122H	ENSP00000259206:R125H	R	+	2	0	IL1RN	113606750	1.000000	0.71417	0.998000	0.56505	0.417000	0.31264	5.063000	0.64332	2.755000	0.94549	0.655000	0.94253	CGC		0.577	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330802.1	NM_173841	
ARHGAP15	55843	broad.mit.edu	37	2	144194591	144194591	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:144194591C>A	ENST00000295095.6	+	8	850	c.683C>A	c.(682-684)cCa>cAa	p.P228Q	AC096558.1_ENST00000442794.1_RNA|AC096558.1_ENST00000549032.1_RNA|AC096558.1_ENST00000550516.1_RNA|RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	228					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)	p.P228Q(1)		endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		GAACAGAAACCAGAGCACAGA	0.328																																					p.P228Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C683A	2						.						72.0	71.0	71.0					2																	144194591		2203	4300	6503	143911061	SO:0001583	missense	55843	exon8			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.683C>A	2.37:g.144194591C>A	ENSP00000295095:p.Pro228Gln		143911061	NM_018460	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392489	0.42410	.	.	ENSG00000075884	ENST00000295095	T	0.08896	3.04	5.4	5.4	0.78164	.	0.179871	0.49916	D	0.000139	T	0.16896	0.0406	L	0.49350	1.555	0.39274	D	0.964434	D;B	0.61697	0.99;0.032	P;B	0.54664	0.758;0.025	T	0.01045	-1.1470	10	0.36615	T	0.2	.	14.0732	0.64872	0.1507:0.8493:0.0:0.0	.	228;228	B4E0R3;Q53QZ3	.;RHG15_HUMAN	Q	228	ENSP00000295095:P228Q	ENSP00000295095:P228Q	P	+	2	0	ARHGAP15	143911061	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	3.959000	0.56744	2.531000	0.85337	0.650000	0.86243	CCA		0.328	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
FAP	2191	broad.mit.edu	37	2	163055367	163055367	+	Silent	SNP	T	T	A			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:163055367T>A	ENST00000188790.4	-	16	1509	c.1302A>T	c.(1300-1302)ccA>ccT	p.P434P	FAP_ENST00000443424.1_Silent_p.P409P	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.P434P(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						ACTTCTTGCTTGGAGGATAGC	0.373																																					p.P434P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1302T	2						.						152.0	128.0	136.0					2																	163055367		2203	4300	6503	162763613	SO:0001819	synonymous_variant	2191	exon16			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1302A>T	2.37:g.163055367T>A			162763613	NM_004460		Silent	SNP	ENST00000188790.4	37	CCDS33311.1																																																																																				0.373	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		
FIGN	55137	broad.mit.edu	37	2	164467524	164467524	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:164467524G>A	ENST00000333129.3	-	3	1132	c.818C>T	c.(817-819)gCg>gTg	p.A273V	FIGN_ENST00000482917.1_5'Flank|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	273	Pro-rich.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.A273V(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						AGGCAGGTACGCTGAAGGCGG	0.607																																					p.A273V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C818T	2						.						36.0	40.0	39.0					2																	164467524		2007	4162	6169	164175770	SO:0001583	missense	55137	exon3			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.818C>T	2.37:g.164467524G>A	ENSP00000333836:p.Ala273Val		164175770	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662542	0.29515	.	.	ENSG00000182263	ENST00000333129	D	0.93133	-3.17	6.07	5.19	0.71726	.	0.058176	0.64402	D	0.000002	D	0.91808	0.7408	L	0.47716	1.5	0.58432	D	0.999998	D	0.63880	0.993	P	0.44897	0.463	D	0.92091	0.5680	10	0.59425	D	0.04	-9.21	16.7962	0.85602	0.0:0.0:0.87:0.13	.	273	Q5HY92	FIGN_HUMAN	V	273	ENSP00000333836:A273V	ENSP00000333836:A273V	A	-	2	0	FIGN	164175770	1.000000	0.71417	0.929000	0.37066	0.014000	0.08584	7.833000	0.86765	1.555000	0.49500	-0.182000	0.12963	GCG		0.607	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
SCN1A	6323	broad.mit.edu	37	2	166898868	166898868	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:166898868G>T	ENST00000303395.4	-	12	2109	c.2110C>A	c.(2110-2112)Cta>Ata	p.L704I	AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.L676I|SCN1A_ENST00000423058.2_Missense_Mutation_p.L704I|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.L693I			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	704					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.L693I(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGATCTTCTAGAAAGTCCATG	0.348																																					p.L676I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2026A	2						.						151.0	144.0	147.0					2																	166898868		2203	4300	6503	166607114	SO:0001583	missense	6323	exon12			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2110C>A	2.37:g.166898868G>T	ENSP00000303540:p.Leu704Ile		166607114	NM_001165964	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284588	0.59867	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.90900	-2.75;-2.75;-2.75;-2.75	5.82	5.82	0.92795	Domain of unknown function DUF3451 (1);	0.000000	0.51477	D	0.000085	D	0.94414	0.8203	M	0.74258	2.255	0.49483	D	0.999794	D;D;P	0.69078	0.996;0.997;0.563	D;D;B	0.85130	0.994;0.997;0.417	D	0.92550	0.6049	10	0.27082	T	0.32	.	14.2815	0.66216	0.0706:0.0:0.9294:0.0	.	693;676;704	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	I	704;704;693;676	ENSP00000407030:L704I;ENSP00000303540:L704I;ENSP00000364554:L693I;ENSP00000386312:L676I	ENSP00000303540:L704I	L	-	1	2	SCN1A	166607114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.518000	0.53451	2.745000	0.94114	0.655000	0.94253	CTA		0.348	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
PRKD3	23683	broad.mit.edu	37	2	37487526	37487526	+	Splice_Site	SNP	T	T	C			TCGA-AG-3887-01	TCGA-AG-3887-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:37487526T>C	ENST00000379066.1	-	15	2648	c.1886A>G	c.(1885-1887)aAt>aGt	p.N629S	PRKD3_ENST00000234179.2_Splice_Site_p.N629S			O94806	KPCD3_HUMAN	protein kinase D3	629	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)	p.N629S(2)		breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				ATGGTGCAAATTCTGAAGAGA	0.383																																					p.N629S	Melanoma(80;621 1355 8613 11814 51767)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1886G	2						.						67.0	64.0	65.0					2																	37487526		2203	4300	6503	37341030	SO:0001630	splice_region_variant	23683	exon14			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1885-1A>G	2.37:g.37487526T>C			37341030	NM_005813	D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	ENST00000379066.1	37	CCDS1789.1	.	.	.	.	.	.	.	.	.	.	T	11.39	1.623387	0.28889	.	.	ENSG00000115825	ENST00000379066;ENST00000234179;ENST00000443977	T;T;T	0.63913	-0.07;-0.07;-0.07	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.053822	0.64402	D	0.000001	T	0.34366	0.0895	N	0.01267	-0.92	0.80722	D	1	B	0.10296	0.003	B	0.17098	0.017	T	0.27502	-1.0072	10	0.18710	T	0.47	-26.6536	15.4586	0.75336	0.0:0.0:0.0:1.0	.	629	O94806	KPCD3_HUMAN	S	629;629;164	ENSP00000368356:N629S;ENSP00000234179:N629S;ENSP00000398743:N164S	ENSP00000234179:N629S	N	-	2	0	PRKD3	37341030	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	5.165000	0.64959	2.052000	0.61016	0.528000	0.53228	AAT		0.383	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218570.3	NM_005813	Missense_Mutation
TTN	7273	broad.mit.edu	37	2	179419859	179419859	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr2:179419859G>A	ENST00000591111.1	-	281	83628	c.83404C>T	c.(83404-83406)Cct>Tct	p.P27802S	TTN_ENST00000359218.5_Missense_Mutation_p.P20503S|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P20570S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P20378S|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P29443S|TTN_ENST00000342992.6_Missense_Mutation_p.P26875S|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27802	Ig-like 130.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P20378S(1)|p.P20503S(1)|p.P26873S(1)|p.P20570S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTCTAGAGGCAAATCAATT	0.368																																					p.C20377C												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C61131T	2						.						74.0	70.0	72.0					2																	179419859		1823	4078	5901	179128105	SO:0001583	missense	7273	exon159			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.83404C>T	2.37:g.179419859G>A	ENSP00000465570:p.Pro27802Ser		179128105	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	19.93	3.918860	0.73098	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62364	0.03;0.27;0.23;0.24	5.66	5.66	0.87406	Fibronectin, type III (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.67505	0.2900	N	0.12422	0.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.999;0.996	T	0.73563	-0.3943	9	0.87932	D	0	.	20.1041	0.97884	0.0:0.0:1.0:0.0	.	20378;20503;20570;27802	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	26875;20378;20570;20503;20375	ENSP00000343764:P26875S;ENSP00000434586:P20378S;ENSP00000340554:P20570S;ENSP00000352154:P20503S	ENSP00000340554:P20570S	P	-	1	0	TTN	179128105	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.646000	0.74348	2.826000	0.97356	0.655000	0.94253	CCT		0.368	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ACO1	48	broad.mit.edu	37	9	32407368	32407368	+	Silent	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr9:32407368G>A	ENST00000309951.6	+	3	345	c.207G>A	c.(205-207)acG>acA	p.T69T	ACO1_ENST00000379923.1_Silent_p.T69T|ACO1_ENST00000541043.1_5'UTR	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	69					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.T69T(1)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GGAATGTCACGCAGCACAAGA	0.428																																					p.T69T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G207A	9						.						139.0	115.0	123.0					9																	32407368		2203	4300	6503	32397368	SO:0001819	synonymous_variant	48	exon3			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.207G>A	9.37:g.32407368G>A			32397368	NM_002197	D3DRK7|Q14652|Q5VZA7	Silent	SNP	ENST00000309951.6	37	CCDS6525.1																																																																																				0.428	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
GRHPR	9380	broad.mit.edu	37	9	37432009	37432009	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr9:37432009G>T	ENST00000318158.6	+	8	824	c.739G>T	c.(739-741)Gac>Tac	p.D247Y	GRHPR_ENST00000607784.1_Missense_Mutation_p.D247Y	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	247					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)	p.D247Y(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		TCCCAGGGGCGACGTCGTAAA	0.557																																					p.D247Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G739T	9						.						161.0	124.0	137.0					9																	37432009		2203	4300	6503	37422009	SO:0001583	missense	9380	exon8			AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.739G>T	9.37:g.37432009G>T	ENSP00000313432:p.Asp247Tyr		37422009	NM_012203	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	ENST00000318158.6	37	CCDS6609.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186985	0.38609	.	.	ENSG00000137106	ENST00000318158	T	0.77620	-1.11	5.77	4.88	0.63580	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (2);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	.	.	.	.	D	0.84338	0.5450	L	0.61036	1.89	0.09310	N	0.99999	D;P	0.64830	0.994;0.763	D;P	0.65323	0.934;0.677	T	0.75255	-0.3382	9	0.66056	D	0.02	.	10.3369	0.43854	0.0712:0.1347:0.794:0.0	.	260;247	Q5M7Z5;Q9UBQ7	.;GRHPR_HUMAN	Y	247	ENSP00000313432:D247Y	ENSP00000313432:D247Y	D	+	1	0	GRHPR	37422009	0.997000	0.39634	0.617000	0.29091	0.016000	0.09150	5.131000	0.64751	1.586000	0.49944	-0.136000	0.14681	GAC		0.557	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052442.1	NM_012203	
UGGT2	55757	broad.mit.edu	37	13	96553120	96553120	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3887-01	TCGA-AG-3887-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr13:96553120A>G	ENST00000376747.3	-	22	2645	c.2575T>C	c.(2575-2577)Ttc>Ctc	p.F859L		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	859					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.F859L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TCTTGACAGAACAACTGGTGA	0.358																																					p.F859L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2575C	13						.						128.0	120.0	123.0					13																	96553120		2203	4300	6503	95351121	SO:0001583	missense	55757	exon22			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2575T>C	13.37:g.96553120A>G	ENSP00000365938:p.Phe859Leu		95351121	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	ENST00000376747.3	37	CCDS9480.1	.	.	.	.	.	.	.	.	.	.	A	19.01	3.744124	0.69418	.	.	ENSG00000102595	ENST00000376747	T	0.08193	3.12	5.79	5.79	0.91817	.	0.048765	0.85682	D	0.000000	T	0.11707	0.0285	L	0.60455	1.87	0.80722	D	1	B	0.10296	0.003	B	0.15484	0.013	T	0.07616	-1.0763	10	0.23891	T	0.37	-13.5522	16.1338	0.81465	1.0:0.0:0.0:0.0	.	859	Q9NYU1	UGGG2_HUMAN	L	859	ENSP00000365938:F859L	ENSP00000365938:F859L	F	-	1	0	UGGT2	95351121	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.408000	0.90221	2.216000	0.71823	0.459000	0.35465	TTC		0.358	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
COL4A1	1282	broad.mit.edu	37	13	110845216	110845216	+	Missense_Mutation	SNP	G	G	A	rs369960952		TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr13:110845216G>A	ENST00000375820.4	-	23	1547	c.1426C>T	c.(1426-1428)Cgg>Tgg	p.R476W	COL4A1_ENST00000543140.1_Missense_Mutation_p.R476W	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	476	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)	p.R476R(1)|p.R470W(1)|p.R476W(1)|p.R470R(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGAGGCCCCCGATATCCGTCT	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		17658	0.0		0.0	False		,,,				2504	0.001				p.R476W												.	.	4	Substitution - Missense(2)|Substitution - coding silent(2)	large_intestine(2)|prostate(2)	c.C1426T	13						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	67.0	69.0	68.0		1426	4.9	0.1	13		68	0,8600		0,0,4300	no	missense	COL4A1	NM_001845.4	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	476/1670	110845216	1,13005	2203	4300	6503	109643217	SO:0001583	missense	1282	exon23			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1426C>T	13.37:g.110845216G>A	ENSP00000364979:p.Arg476Trp		109643217	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538106	0.27475	2.27E-4	0.0	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198;ENST00000543140	D;D	0.93859	-3.3;-3.3	4.87	4.87	0.63330	.	0.363174	0.24262	N	0.040075	D	0.95993	0.8695	M	0.91768	3.24	0.29138	N	0.879201	D	0.67145	0.996	P	0.54815	0.761	D	0.93064	0.6477	10	0.66056	D	0.02	.	11.1297	0.48339	0.0854:0.0:0.9146:0.0	.	476	P02462	CO4A1_HUMAN	W	470;476;476;476	ENSP00000364979:R476W;ENSP00000443348:R476W	ENSP00000364973:R470W	R	-	1	2	COL4A1	109643217	1.000000	0.71417	0.060000	0.19600	0.064000	0.16182	4.956000	0.63645	2.400000	0.81607	0.563000	0.77884	CGG		0.498	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
COL13A1	1305	broad.mit.edu	37	10	71640268	71640268	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr10:71640268G>A	ENST00000398978.3	+	6	937	c.445G>A	c.(445-447)Gga>Aga	p.G149R	COL13A1_ENST00000520267.1_Intron|COL13A1_ENST00000398971.3_Missense_Mutation_p.G149R|COL13A1_ENST00000398968.3_Missense_Mutation_p.G149R|COL13A1_ENST00000522165.1_Missense_Mutation_p.G149R|COL13A1_ENST00000398966.3_Missense_Mutation_p.G149R|COL13A1_ENST00000520133.1_Intron|COL13A1_ENST00000517713.1_Missense_Mutation_p.G149R|COL13A1_ENST00000398974.3_Missense_Mutation_p.G137R|COL13A1_ENST00000356340.3_Missense_Mutation_p.G149R|COL13A1_ENST00000398969.3_Intron|COL13A1_ENST00000398973.3_Missense_Mutation_p.G149R|COL13A1_ENST00000398964.3_Intron|COL13A1_ENST00000398972.3_Missense_Mutation_p.G149R|COL13A1_ENST00000354547.3_Missense_Mutation_p.G149R|COL13A1_ENST00000357811.3_Missense_Mutation_p.G149R	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1									p.G149R(2)		endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GGGGTCCCCCGGAGACGCTGG	0.622																																					p.G149R												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G445A	10						.						33.0	34.0	33.0					10																	71640268		1822	4077	5899	71310274	SO:0001583	missense	1305	exon6			AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.445G>A	10.37:g.71640268G>A	ENSP00000381949:p.Gly149Arg		71310274	NM_080802		Missense_Mutation	SNP	ENST00000398978.3	37	CCDS44419.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961267	0.53400	.	.	ENSG00000197467	ENST00000398974;ENST00000398971;ENST00000398968;ENST00000398966;ENST00000356340;ENST00000398972;ENST00000398973;ENST00000398978;ENST00000354547;ENST00000357811;ENST00000517713;ENST00000522165	D;D;D;D;D;D;D;D;D;D;D;D	0.95724	-3.52;-3.69;-3.59;-3.66;-3.79;-3.31;-3.46;-3.42;-3.37;-3.36;-3.21;-3.32	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000003	D	0.97983	0.9336	M	0.88031	2.925	0.46222	D	0.998939	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.999;0.999;0.999;0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98794	1.0737	10	0.87932	D	0	-3.9353	16.1293	0.81414	0.0:0.0:1.0:0.0	.	149;149;149;149;149;149;137;149;149;149;158;149;149;149;149	Q5TAT6;Q5TAT6-5;Q5TAT6-6;E9PEG9;E7ES55;E7ES51;E7ES46;E7ES49;Q5TAT6-3;Q5TAT6-4;E7EX21;Q5TAT6-7;Q5TAT6-8;Q5TAT6-2;G5E987	CODA1_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.	R	137;149;149;149;149;149;149;149;149;149;149;149	ENSP00000381946:G137R;ENSP00000381943:G149R;ENSP00000381940:G149R;ENSP00000381938:G149R;ENSP00000348695:G149R;ENSP00000381944:G149R;ENSP00000381945:G149R;ENSP00000381949:G149R;ENSP00000346553:G149R;ENSP00000350463:G149R;ENSP00000430061:G149R;ENSP00000428342:G149R	ENSP00000346553:G149R	G	+	1	0	COL13A1	71310274	1.000000	0.71417	0.998000	0.56505	0.707000	0.40811	4.768000	0.62293	2.559000	0.86315	0.655000	0.94253	GGA		0.622	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
APC	324	broad.mit.edu	37	5	112175069	112175069	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr5:112175069C>T	ENST00000457016.1	+	16	4158	c.3778C>T	c.(3778-3780)Cag>Tag	p.Q1260*	APC_ENST00000508376.2_Nonsense_Mutation_p.Q1260*|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1260*			P25054	APC_HUMAN	adenomatous polyposis coli	1260	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1260*(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAACAATACAGACTTATTG	0.388		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1242X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Substitution - Nonsense(1)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(1)|soft_tissue(1)|skin(1)	c.C3724T	5	GRCh37	CD941589	APC	D		.						51.0	53.0	52.0					5																	112175069		2202	4300	6502	112202968	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3778C>T	5.37:g.112175069C>T	ENSP00000413133:p.Gln1260*		112202968	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	40	8.033442	0.98621	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.03	6.03	0.97812	.	0.053822	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.6155	20.5568	0.99304	0.0:1.0:0.0:0.0	.	.	.	.	X	1260	.	.	Q	+	1	0	APC	112202968	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.487000	0.81328	2.861000	0.98227	0.655000	0.94253	CAG		0.388	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
ZNF608	57507	broad.mit.edu	37	5	123980114	123980114	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr5:123980114G>A	ENST00000306315.5	-	5	4381	c.3946C>T	c.(3946-3948)Cga>Tga	p.R1316*	ZNF608_ENST00000504926.1_Nonsense_Mutation_p.R889*|ZNF608_ENST00000513985.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1316							metal ion binding (GO:0046872)	p.R1316*(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GGAGTCTTTCGATCATCATTT	0.468																																					p.R1316X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C3946T	5						.						261.0	245.0	251.0					5																	123980114		2203	4300	6503	124008013	SO:0001587	stop_gained	57507	exon5			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.3946C>T	5.37:g.123980114G>A	ENSP00000307746:p.Arg1316*		124008013	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Nonsense_Mutation	SNP	ENST00000306315.5	37	CCDS34219.1	.	.	.	.	.	.	.	.	.	.	G	47	13.290585	0.99732	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	.	.	.	5.76	4.88	0.63580	.	0.270216	0.37348	N	0.002137	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.5662	17.0898	0.86619	0.0:0.127:0.873:0.0	.	.	.	.	X	889;1316	.	.	R	-	1	2	ZNF608	124008013	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	2.329000	0.43876	1.544000	0.49359	0.643000	0.83706	CGA		0.468	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
PCDHB15	56121	broad.mit.edu	37	5	140625822	140625822	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr5:140625822G>A	ENST00000231173.3	+	1	676	c.676G>A	c.(676-678)Gtc>Atc	p.V226I		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	226	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.V226I(1)		NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCTGGCACCGTCCAGATCCT	0.602																																					p.V226I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G676A	5						.						51.0	51.0	51.0					5																	140625822		2203	4300	6503	140606006	SO:0001583	missense	56121	exon1			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.676G>A	5.37:g.140625822G>A	ENSP00000231173:p.Val226Ile		140606006	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	37	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	A	6.437	0.448677	0.12223	.	.	ENSG00000113248	ENST00000231173	T	0.52983	0.64	4.92	-3.7	0.04437	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35537	0.0935	L	0.49513	1.565	0.09310	N	1	B	0.10296	0.003	B	0.15870	0.014	T	0.38650	-0.9651	9	0.72032	D	0.01	.	4.4093	0.11425	0.3768:0.0:0.3858:0.2375	.	226	Q9Y5E8	PCDBF_HUMAN	I	226	ENSP00000231173:V226I	ENSP00000231173:V226I	V	+	1	0	PCDHB15	140606006	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-2.546000	0.00932	-0.776000	0.04578	-0.500000	0.04577	GTC		0.602	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
ESM1	11082	broad.mit.edu	37	5	54277827	54277827	+	Missense_Mutation	SNP	G	G	A	rs367904025		TCGA-AG-3887-01	TCGA-AG-3887-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr5:54277827G>A	ENST00000381405.4	-	2	594	c.449C>T	c.(448-450)aCg>aTg	p.T150M	ESM1_ENST00000598310.1_Intron|ESM1_ENST00000381403.4_Intron	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	150					angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)	p.T150M(1)		breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			GTGCTTACCCGTGAGAGAAAC	0.408																																					p.T150M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C449T	5						.	G	,MET/THR	0,4406		0,0,2203	110.0	109.0	109.0		,449	5.0	0.8	5		109	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	ESM1	NM_001135604.1,NM_007036.4	,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,possibly-damaging	,150/185	54277827	1,13005	2203	4300	6503	54313584	SO:0001583	missense	11082	exon2			X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.449C>T	5.37:g.54277827G>A	ENSP00000370812:p.Thr150Met		54313584	NM_007036	B2R4G3|Q15330|Q3V4E3|Q96ES3	Missense_Mutation	SNP	ENST00000381405.4	37	CCDS3963.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650943	0.47362	0.0	1.16E-4	ENSG00000164283	ENST00000381405	.	.	.	5.9	5.01	0.66863	.	0.688458	0.14128	N	0.339559	T	0.50956	0.1646	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	P	0.50791	0.65	T	0.54529	-0.8280	9	0.72032	D	0.01	-16.4134	15.229	0.73372	0.0:0.14:0.86:0.0	.	150	Q9NQ30	ESM1_HUMAN	M	150	.	ENSP00000370812:T150M	T	-	2	0	ESM1	54313584	1.000000	0.71417	0.823000	0.32752	0.197000	0.23852	5.422000	0.66453	1.458000	0.47871	0.563000	0.77884	ACG		0.408	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2	NM_007036	
APC	324	broad.mit.edu	37	5	112175217	112175218	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-AG-3887-01	TCGA-AG-3887-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr5:112175217_112175218delAA	ENST00000457016.1	+	16	4306_4307	c.3926_3927delAA	c.(3925-3927)gaafs	p.E1309fs	APC_ENST00000508376.2_Frame_Shift_Del_p.E1309fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.E1309fs			P25054	APC_HUMAN	adenomatous polyposis coli	1309	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.			E -> G (in Ref. 1; AAA60353/AAA60354). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1309fs*4(73)|p.I1311fs*4(2)|p.K1310fs*4(2)|p.?(1)|p.E1309fs*6(1)|p.K1310fs*10(1)|p.K1192fs*3(1)|p.K1308fs*4(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAAATAAAAGAAAAGATTGGAA	0.421	E1309fs*4(LS1034_LARGE_INTESTINE)	12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.1291_1291del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,upper_aerodigestive_tract,sinonasal_and_nasal_cavity,Substitution - Missense,+1	.	82	Deletion - Frameshift(78)|Insertion - Frameshift(3)|Unknown(1)	large_intestine(72)|stomach(5)|thyroid(2)|soft_tissue(2)|skin(1)	c.3872_3873del	5	GRCh37	CD920817|CD995194|CM973705	APC	D|M	rs80338757	.																																			112203117	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3926_3927delAA	5.37:g.112175219_112175220delAA	ENSP00000413133:p.Glu1309fs		112203116	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.421	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CLK4	57396	broad.mit.edu	37	5	178030720	178030720	+	Silent	SNP	C	C	A			TCGA-AG-3887-01	TCGA-AG-3887-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3887-01	TCGA-AG-3887-01	g.chr5:178030720C>A	ENST00000316308.4	-	13	1512	c.1344G>T	c.(1342-1344)ctG>ctT	p.L448L		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	448	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.L448L(2)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		CCAGGTCAAACAGTTTCTCAT	0.313																																					p.L448L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1344T	5						.						89.0	86.0	87.0					5																	178030720		2202	4300	6502	177963326	SO:0001819	synonymous_variant	57396	exon13			AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.1344G>T	5.37:g.178030720C>A			177963326	NM_020666		Silent	SNP	ENST00000316308.4	37	CCDS4437.1																																																																																				0.313	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
