#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TP53	7157	broad.mit.edu	37	17	7574023	7574024	+	Frame_Shift_Ins	INS	-	-	T	rs375444154		TCGA-AG-3890-01	TCGA-AG-3890-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr17:7574023_7574024insT	ENST00000269305.4	-	10	1192_1193	c.1003_1004insA	c.(1003-1005)cgtfs	p.R335fs	TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Ins_p.R335fs|TP53_ENST00000420246.2_3'UTR	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	335	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> G (in a sporadic cancer; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R335fs*2(2)|p.R335fs*10(2)|p.R335L(1)|p.?(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAGCGCTCACGCCCACGGATC	0.525		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R335fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	15	Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)	large_intestine(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|stomach(1)	c.1004_1005insA	17						.																																			7514749	SO:0001589	frameshift_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1003_1004insA	17.37:g.7574023_7574024insT	ENSP00000269305:p.Arg335fs		7514748	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1																																																																																				0.525	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
FAM166B	730112	broad.mit.edu	37	9	35562393	35562394	+	Frame_Shift_Ins	INS	-	-	TAGT	rs142582869|rs72402422|rs3068510	byFrequency	TCGA-AG-3890-01	TCGA-AG-3890-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr9:35562393_35562394insTAGT	ENST00000399742.2	-	5	792_793	c.722_723insACTA	c.(721-723)tatfs	p.Y241fs	FAM166B_ENST00000492890.1_5'UTR	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	241								p.Y225fs*1(1)		kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						CGTAGCCCCCATAGTTAGGTAA	0.564														577	0.115216	0.0628	0.0663	5008	,	,		14357	0.2252		0.0437	False		,,,				2504	0.181				p.Y241_G242delinsX												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.723_724insACTA	9						.		,	210,3366		15,180,1593					,	-2.7	1.0		dbSNP_130	24	274,7576		6,262,3657	no	frameshift,utr-3	FAM166B	NM_001164310.1,NM_001099951.2	,	21,442,5250	A1A1,A1R,RR		3.4904,5.8725,4.236	,	,		484,10942				35552394	SO:0001589	frameshift_variant	730112	exon5			BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.719_722dupACTA	9.37:g.35562394_35562397dupTAGT	ENSP00000382646:p.Tyr241fs		35552393	NM_001164310	A1L3B2|B7ZBJ0	Frame_Shift_Ins	INS	ENST00000399742.2	37	CCDS56572.1																																																																																				0.564	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336563.1	NM_001099951	
MYOM3	127294	broad.mit.edu	37	1	24434717	24434718	+	Intron	INS	-	-	C	rs11447181|rs397971954	byFrequency	TCGA-AG-3890-01	TCGA-AG-3890-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:24434717_24434718insC	ENST00000374434.3	-	3	324				MYOM3_ENST00000329601.7_Intron|MYOM3_ENST00000330966.7_Intron|MYOM3_ENST00000475306.1_5'UTR	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3							M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		CAAGGCTGCATCCCCCCGACCC	0.599													CCCCCC|CCCCCC|CCCCCCC|insertion	1373	0.274161	0.1762	0.4107	5008	,	,		19149	0.2986		0.3549	False		,,,				2504	0.2014				.												.	.	0			.	1						.																																			24307305	SO:0001627	intron_variant	127294	.			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.162-154->G	1.37:g.24434723_24434723dupC			24307304	.	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	De_novo_Start_OutOfFrame	INS	ENST00000374434.3	37	CCDS41281.1																																																																																				0.599	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008272.2	NM_152372	
LEPREL1	55214	broad.mit.edu	37	3	189675489	189675490	+	3'UTR	INS	-	-	AGAG	rs3062112|rs149110552|rs557972800|rs3062117|rs72096204|rs111966230|rs537928554|rs72094963|rs571518426|rs144524097	byFrequency	TCGA-AG-3890-01	TCGA-AG-3890-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr3:189675489_189675490insAGAG	ENST00000319332.5	-	0	2535_2536				LEPREL1_ENST00000427335.2_3'UTR	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1						collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	tgtctcTAAGAagagagagaga	0.436																																					.												.	.	0			.	3						.																																			191158184	SO:0001624	3_prime_UTR_variant	55214	.				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.*212->CTCT	3.37:g.189675494_189675497dupAGAG			191158183	.	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Splice_Site	INS	ENST00000319332.5	37	CCDS3294.1																																																																																				0.436	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
FERD3L	222894	broad.mit.edu	37	7	19184892	19184892	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr7:19184892C>T	ENST00000275461.3	-	1	152	c.94G>A	c.(94-96)Gac>Aac	p.D32N	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	32					cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D32N(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						GGTGCGAAGTCGCAGAGGAGA	0.662																																					p.D32N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G94A	7						.						37.0	35.0	36.0					7																	19184892		2200	4300	6500	19151417	SO:0001583	missense	222894	exon1			AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.94G>A	7.37:g.19184892C>T	ENSP00000275461:p.Asp32Asn		19151417	NM_152898	Q495K0	Missense_Mutation	SNP	ENST00000275461.3	37	CCDS5368.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004556	0.54254	.	.	ENSG00000146618	ENST00000275461	D	0.96619	-4.07	5.39	5.39	0.77823	.	0.263805	0.27206	N	0.020429	D	0.90892	0.7138	N	0.24115	0.695	0.19300	N	0.999974	P	0.45078	0.85	B	0.30401	0.115	T	0.83170	-0.0094	10	0.22109	T	0.4	-7.8919	19.1723	0.93583	0.0:1.0:0.0:0.0	.	32	Q96RJ6	FER3L_HUMAN	N	32	ENSP00000275461:D32N	ENSP00000275461:D32N	D	-	1	0	FERD3L	19151417	1.000000	0.71417	0.979000	0.43373	0.865000	0.49528	3.764000	0.55264	2.533000	0.85409	0.650000	0.86243	GAC		0.662	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207627.1		
GPNMB	10457	broad.mit.edu	37	7	23300196	23300196	+	Silent	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr7:23300196C>G	ENST00000381990.2	+	6	983	c.822C>G	c.(820-822)ctC>ctG	p.L274L	GPNMB_ENST00000258733.4_Silent_p.L274L|GPNMB_ENST00000453162.2_Silent_p.L216L|GPNMB_ENST00000539136.1_Silent_p.L175L	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	274	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)	p.L274L(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			GCCACTTCCTCAATTATTCTA	0.418																																					p.L274L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C822G	7						.						176.0	167.0	170.0					7																	23300196		2203	4300	6503	23266721	SO:0001819	synonymous_variant	10457	exon6			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.822C>G	7.37:g.23300196C>G			23266721	NM_001005340	A4D155|Q6UVX1|Q8N1A1	Silent	SNP	ENST00000381990.2	37	CCDS34610.1																																																																																				0.418	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327152.1	NM_001005340	
ZNF138	7697	broad.mit.edu	37	7	64292071	64292071	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr7:64292071T>C	ENST00000359735.3	+	4	627	c.280T>C	c.(280-282)Ttt>Ctt	p.F94L	ZNF138_ENST00000440155.2_Missense_Mutation_p.F125L|ZNF138_ENST00000440598.1_3'UTR|ZNF138_ENST00000437743.1_Missense_Mutation_p.F119L|ZNF138_ENST00000430838.2_3'UTR|ZNF138_ENST00000494380.1_3'UTR|ZNF138_ENST00000307355.7_Missense_Mutation_p.F151L|ZNF138_ENST00000397136.2_Missense_Mutation_p.F94L	NM_001271637.1|NM_001271639.1	NP_001258566.1|NP_001258568.1	P52744	ZN138_HUMAN	zinc finger protein 138	94					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F94L(1)		kidney(1)|large_intestine(3)|lung(2)|stomach(1)	7		Lung NSC(55;0.0795)|all_lung(88;0.18)				CATGCATAAATTTTCAAATTC	0.299																																					p.F125L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T373C	7						.						38.0	40.0	40.0					7																	64292071		2200	4287	6487	63929506	SO:0001583	missense	7697	exon3			U09847	CCDS34645.1, CCDS34645.2, CCDS55115.1, CCDS64659.1, CCDS64660.1, CCDS64661.1, CCDS75607.1	7q11.21	2013-01-08	2005-07-11		ENSG00000197008	ENSG00000197008		"""Zinc fingers, C2H2-type"", ""-"""	12922	protein-coding gene	gene with protein product		604080	"""zinc finger protein 138 (clone pHZ-32)"""				Standard	NM_006524		Approved	pHZ-32	uc031sxl.1	P52744	OTTHUMG00000156603	ENST00000359735.3:c.280T>C	7.37:g.64292071T>C	ENSP00000352770:p.Phe94Leu		63929506	NM_006524	B4DFX2|B4DP87|E9PHI7|E9PHK7	Missense_Mutation	SNP	ENST00000359735.3	37		.	.	.	.	.	.	.	.	.	.	.	3.855	-0.031152	0.07543	.	.	ENSG00000197008	ENST00000307355;ENST00000359735;ENST00000440155;ENST00000437743;ENST00000397136	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	0.149	-0.298	0.12814	.	.	.	.	.	T	0.23649	0.0572	L	0.33137	0.985	0.18873	N	0.999981	B;B;B	0.20368	0.02;0.044;0.02	B;B;B	0.23716	0.026;0.048;0.016	T	0.22871	-1.0204	9	0.44086	T	0.13	.	3.3639	0.07197	0.3528:0.0:0.0:0.6472	.	125;119;94	E9PHI7;E7EWC5;P52744	.;.;ZN138_HUMAN	L	151;94;125;119;94	ENSP00000303533:F151L;ENSP00000352770:F94L;ENSP00000407262:F125L;ENSP00000399528:F119L;ENSP00000380325:F94L	ENSP00000303533:F151L	F	+	1	0	ZNF138	63929506	0.006000	0.16342	0.006000	0.13384	0.006000	0.05464	-0.366000	0.07563	-1.212000	0.02620	-1.240000	0.01540	TTT		0.299	ZNF138-201	KNOWN	basic	protein_coding	protein_coding		NM_006524	
PDYN	5173	broad.mit.edu	37	20	1961312	1961312	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr20:1961312G>A	ENST00000217305.2	-	4	647	c.422C>T	c.(421-423)gCa>gTa	p.A141V	PDYN_ENST00000540134.1_Missense_Mutation_p.A141V|PDYN_ENST00000539905.1_Missense_Mutation_p.A141V|RP4-684O24.5_ENST00000446562.1_RNA	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	141					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.A141V(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCAGACTCTGCTCCCTCCCT	0.547																																					p.A141V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C422T	20						.						116.0	109.0	111.0					20																	1961312		2203	4300	6503	1909312	SO:0001583	missense	5173	exon3				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.422C>T	20.37:g.1961312G>A	ENSP00000217305:p.Ala141Val		1909312	NM_001190892	A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	37	CCDS13023.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416517	0.25552	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	T;T;T	0.81247	-1.47;-1.47;-1.47	4.71	-3.95	0.04118	.	1.069720	0.07158	N	0.850281	T	0.57989	0.2091	N	0.17082	0.46	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.34900	-0.9810	10	0.30078	T	0.28	8.4254	0.1935	0.00137	0.3113:0.2496:0.2033:0.2357	.	141	P01213	PDYN_HUMAN	V	141	ENSP00000440185:A141V;ENSP00000442259:A141V;ENSP00000217305:A141V	ENSP00000217305:A141V	A	-	2	0	PDYN	1909312	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.225000	0.09151	-1.008000	0.03404	0.491000	0.48974	GCA		0.547	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2		
PTGIS	5740	broad.mit.edu	37	20	48156158	48156158	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr20:48156158G>A	ENST00000244043.4	-	5	651	c.622C>T	c.(622-624)Cgc>Tgc	p.R208C	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	208					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)	p.R208C(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	TCGAGCTGGCGAAAGGTGTGG	0.642																																					p.R208C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C622T	20						.						49.0	49.0	49.0					20																	48156158		2203	4300	6503	47589565	SO:0001583	missense	5740	exon5				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.622C>T	20.37:g.48156158G>A	ENSP00000244043:p.Arg208Cys		47589565	NM_000961	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Missense_Mutation	SNP	ENST00000244043.4	37	CCDS13419.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917911	0.73098	.	.	ENSG00000124212	ENST00000244043	T	0.68479	-0.33	4.85	4.85	0.62838	.	0.216019	0.37095	N	0.002243	T	0.79131	0.4394	M	0.75615	2.305	0.58432	D	0.999991	D	0.89917	1.0	D	0.97110	1.0	T	0.78054	-0.2354	10	0.37606	T	0.19	-13.5886	11.4291	0.50029	0.0893:0.0:0.9107:0.0	.	208	Q16647	PTGIS_HUMAN	C	208	ENSP00000244043:R208C	ENSP00000244043:R208C	R	-	1	0	PTGIS	47589565	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.518000	0.35877	2.416000	0.81992	0.561000	0.74099	CGC		0.642	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2		
LYPD3	27076	broad.mit.edu	37	19	43965647	43965647	+	Silent	SNP	G	G	A	rs202091507	byFrequency	TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr19:43965647G>A	ENST00000244333.3	-	5	985	c.897C>T	c.(895-897)ggC>ggT	p.G299G		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	299					cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.G299G(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				GGCCAGCGGCGCCTCCAGTCA	0.622													G|||	2	0.000399361	0.0	0.0	5008	,	,		15926	0.002		0.0	False		,,,				2504	0.0				p.G299G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C897T	19						.						64.0	67.0	66.0					19																	43965647		2203	4300	6503	48657487	SO:0001819	synonymous_variant	27076	exon5			AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.897C>T	19.37:g.43965647G>A			48657487	NM_014400	Q9UJ74	Silent	SNP	ENST00000244333.3	37	CCDS12620.1																																																																																				0.622	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
KIR3DL1	3811	broad.mit.edu	37	19	55295142	55295142	+	Intron	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr19:55295142C>T	ENST00000538269.1	+	2	61				KIR2DL1_ENST00000336077.6_Silent_p.C308C|KIR2DL1_ENST00000291633.7_Silent_p.C334C|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Silent_p.C308C			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.C308C(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		TGAATCACTGCGTTTTCACAC	0.493																																					p.C308C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C924T	19						.						12.0	13.0	12.0					19																	55295142		1997	4021	6018	59986954	SO:0001627	intron_variant	3802	exon8			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-33847C>T	19.37:g.55295142C>T			59986954	NM_014218	O43473|Q14946|Q16541	Silent	SNP	ENST00000538269.1	37																																																																																					0.493	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_013289	
NLRP7	199713	broad.mit.edu	37	19	55452928	55452928	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr19:55452928C>A	ENST00000590030.1	-	1	192	c.152G>T	c.(151-153)gGc>gTc	p.G51V	NLRP7_ENST00000592784.1_Missense_Mutation_p.G51V|NLRP7_ENST00000588756.1_Missense_Mutation_p.G51V|NLRP7_ENST00000448121.2_Missense_Mutation_p.G51V|NLRP7_ENST00000446217.1_Missense_Mutation_p.G79V|NLRP7_ENST00000328092.5_Missense_Mutation_p.G51V|NLRP7_ENST00000340844.2_Missense_Mutation_p.G51V			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	51	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.						ATP binding (GO:0005524)	p.G51V(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CAGTTTCTTGCCATCAGCCTC	0.448																																					p.G51V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G152T	19						.						114.0	108.0	110.0					19																	55452928		2203	4300	6503	60144740	SO:0001583	missense	199713	exon2			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.152G>T	19.37:g.55452928C>A	ENSP00000465520:p.Gly51Val		60144740	NM_139176	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.389209	0.25118	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	1.53	1.53	0.23141	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.54271	0.1848	L	0.42686	1.345	0.09310	N	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.34601	-0.9822	9	0.35671	T	0.21	.	6.5079	0.22206	0.0:1.0:0.0:0.0	.	79;51;51;51	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	V	51;51;51;79;51	ENSP00000329568:G51V;ENSP00000409137:G51V;ENSP00000339491:G51V;ENSP00000414273:G79V	ENSP00000329568:G51V	G	-	2	0	NLRP7	60144740	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	0.352000	0.20113	1.144000	0.42321	0.313000	0.20887	GGC		0.448	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
MUC16	94025	broad.mit.edu	37	19	9085910	9085910	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr19:9085910G>T	ENST00000397910.4	-	1	6108	c.5905C>A	c.(5905-5907)Cca>Aca	p.P1969T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1969	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P1969T(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATTGTTGGTGGGGTGATGGGA	0.448																																					p.P1969T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5905A	19						.						205.0	202.0	203.0					19																	9085910		2071	4228	6299	8946910	SO:0001583	missense	94025	exon1			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5905C>A	19.37:g.9085910G>T	ENSP00000381008:p.Pro1969Thr		8946910	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.101	-0.405953	0.04832	.	.	ENSG00000181143	ENST00000397910	T	0.03181	4.02	0.235	0.235	0.15431	.	.	.	.	.	T	0.05364	0.0142	N	0.08118	0	.	.	.	D	0.69078	0.997	D	0.68483	0.958	T	0.41822	-0.9487	7	0.87932	D	0	.	.	.	.	.	1969	B5ME49	.	T	1969	ENSP00000381008:P1969T	ENSP00000381008:P1969T	P	-	1	0	MUC16	8946910	0.000000	0.05858	0.270000	0.24601	0.275000	0.26752	-0.552000	0.06020	0.308000	0.22923	0.313000	0.20887	CCA		0.448	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZFP28	140612	broad.mit.edu	37	19	57051017	57051017	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr19:57051017C>G	ENST00000301318.3	+	2	303	c.232C>G	c.(232-234)Ctt>Gtt	p.L78V	ZFP28_ENST00000594386.1_3'UTR|ZFP28_ENST00000591844.1_Missense_Mutation_p.L78V|AC005498.3_ENST00000593218.1_lincRNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	78					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L78V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GGACACTGCTCTTCCCCAGGA	0.512																																					p.L78V	Ovarian(124;554 1662 19430 21141 52494)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C232G	19						.						118.0	116.0	117.0					19																	57051017		2203	4300	6503	61742829	SO:0001583	missense	140612	exon2				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.232C>G	19.37:g.57051017C>G	ENSP00000301318:p.Leu78Val		61742829	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	0.617	-0.822630	0.02755	.	.	ENSG00000196867	ENST00000301318	T	0.06608	3.28	3.58	0.0223	0.14133	.	1.143450	0.06877	N	0.801790	T	0.03053	0.0090	N	0.14661	0.345	0.09310	N	1	B;P	0.43750	0.075;0.816	B;B	0.36534	0.027;0.227	T	0.38222	-0.9671	10	0.17369	T	0.5	.	3.8535	0.08965	0.0:0.544:0.2031:0.253	.	78;78	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	V	78	ENSP00000301318:L78V	ENSP00000301318:L78V	L	+	1	0	ZFP28	61742829	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.342000	0.07801	-0.022000	0.13986	0.462000	0.41574	CTT		0.512	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
LZTS1	11178	broad.mit.edu	37	8	20107448	20107448	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr8:20107448G>T	ENST00000381569.1	-	4	1933	c.1576C>A	c.(1576-1578)Cag>Aag	p.Q526K	LZTS1_ENST00000522290.1_Intron|LZTS1_ENST00000265801.6_Missense_Mutation_p.Q526K			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	526					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q526K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CGCTCATGCTGGAAGCCCGAG	0.647																																					p.Q526K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1576A	8						.						82.0	87.0	86.0					8																	20107448		2203	4300	6503	20151728	SO:0001583	missense	11178	exon3			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1576C>A	8.37:g.20107448G>T	ENSP00000370981:p.Gln526Lys		20151728	NM_021020	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	37	CCDS6015.1	.	.	.	.	.	.	.	.	.	.	g	15.28	2.786117	0.49997	.	.	ENSG00000061337	ENST00000381569;ENST00000265801	T;T	0.41758	0.99;0.99	5.17	5.17	0.71159	.	0.194055	0.45867	D	0.000325	T	0.40743	0.1129	L	0.40543	1.245	0.53005	D	0.999964	P	0.34837	0.472	B	0.37780	0.258	T	0.34675	-0.9819	10	0.51188	T	0.08	-39.5888	17.2477	0.87032	0.0:0.0:1.0:0.0	.	526	Q9Y250	LZTS1_HUMAN	K	526	ENSP00000370981:Q526K;ENSP00000265801:Q526K	ENSP00000265801:Q526K	Q	-	1	0	LZTS1	20151728	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.534000	0.53568	2.419000	0.82065	0.556000	0.70494	CAG		0.647	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
PREX2	80243	broad.mit.edu	37	8	69017454	69017454	+	Intron	SNP	A	A	C			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr8:69017454A>C	ENST00000288368.4	+	24	2992				PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2						adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.S933R(1)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CAGTGTAAGCAGCACATTTCC	0.468																																					p.S933R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2797C	8						.						224.0	189.0	201.0					8																	69017454		2203	4300	6503	69180008	SO:0001627	intron_variant	80243	exon24			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2716-2890A>C	8.37:g.69017454A>C			69180008	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	4.607	0.112895	0.08831	.	.	ENSG00000046889	ENST00000354677	.	.	.	2.58	0.0884	0.14455	.	.	.	.	.	T	0.25344	0.0616	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22941	-1.0202	7	0.49607	T	0.09	.	2.0465	0.03561	0.5862:0.0:0.1535:0.2603	.	933	Q70Z35-3	.	R	933	.	ENSP00000346707:S933R	S	+	1	0	PREX2	69180008	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.177000	0.09796	0.014000	0.14944	0.455000	0.32223	AGC		0.468	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
KCNB2	9312	broad.mit.edu	37	8	73480007	73480007	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr8:73480007C>A	ENST00000523207.1	+	2	626	c.38C>A	c.(37-39)aCt>aAt	p.T13N		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	13					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.T13N(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AACAGGAAGACTTCAAGGTCG	0.502																																					p.T13N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C38A	8						.						88.0	88.0	88.0					8																	73480007		2203	4300	6503	73642561	SO:0001583	missense	9312	exon2			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.38C>A	8.37:g.73480007C>A	ENSP00000430846:p.Thr13Asn		73642561	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159962	0.57368	.	.	ENSG00000182674	ENST00000523207	D	0.96685	-4.09	6.11	6.11	0.99139	.	.	.	.	.	D	0.89777	0.6813	N	0.03608	-0.345	0.46167	D	0.998907	B	0.32302	0.363	B	0.25140	0.058	D	0.87090	0.2172	9	0.23302	T	0.38	.	20.7342	0.99715	0.0:1.0:0.0:0.0	.	13	Q92953	KCNB2_HUMAN	N	13	ENSP00000430846:T13N	ENSP00000430846:T13N	T	+	2	0	KCNB2	73642561	0.973000	0.33851	0.992000	0.48379	0.988000	0.76386	2.670000	0.46833	2.906000	0.99361	0.655000	0.94253	ACT		0.502	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
TSPYL5	85453	broad.mit.edu	37	8	98288946	98288946	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr8:98288946T>A	ENST00000322128.3	-	1	1230	c.1127A>T	c.(1126-1128)aAt>aTt	p.N376I		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	376					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)		p.N376I(1)		cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					CTGCAAGGGATTGGGCCACAA	0.458																																					p.N376I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1127T	8						.						180.0	192.0	188.0					8																	98288946		2203	4300	6503	98358122	SO:0001583	missense	85453	exon1			AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.1127A>T	8.37:g.98288946T>A	ENSP00000322802:p.Asn376Ile		98358122	NM_033512	B3KRF0|Q9C0B3	Missense_Mutation	SNP	ENST00000322128.3	37	CCDS34927.1	.	.	.	.	.	.	.	.	.	.	T	18.81	3.702663	0.68501	.	.	ENSG00000180543	ENST00000322128	T	0.36157	1.27	4.3	4.3	0.51218	.	0.000000	0.35096	N	0.003457	T	0.63307	0.2500	M	0.90595	3.13	0.58432	D	0.99999	D	0.65815	0.995	D	0.74674	0.984	T	0.69997	-0.4993	10	0.87932	D	0	-8.8307	10.1347	0.42699	0.0:0.0:0.0:1.0	.	376	Q86VY4	TSYL5_HUMAN	I	376	ENSP00000322802:N376I	ENSP00000322802:N376I	N	-	2	0	TSPYL5	98358122	0.999000	0.42202	0.993000	0.49108	0.996000	0.88848	2.861000	0.48380	2.174000	0.68829	0.460000	0.39030	AAT		0.458	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380611.1	NM_033512	
ADCY8	114	broad.mit.edu	37	8	131916237	131916237	+	Silent	SNP	G	G	A	rs75415615	byFrequency	TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr8:131916237G>A	ENST00000286355.5	-	7	3784	c.1692C>T	c.(1690-1692)aaC>aaT	p.N564N	ADCY8_ENST00000377928.3_Silent_p.N564N	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	564					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.N564N(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCTCTTCCACGTTATAGTCAC	0.463										HNSCC(32;0.087)			G|||	12	0.00239617	0.0083	0.0	5008	,	,		21546	0.0		0.0	False		,,,				2504	0.001				p.N564N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1692T	8						.	G		19,4387	26.2+/-53.5	0,19,2184	194.0	184.0	187.0		1692	-4.3	1.0	8	dbSNP_131	187	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADCY8	NM_001115.2		0,20,6483	AA,AG,GG		0.0116,0.4312,0.1538		564/1252	131916237	20,12986	2203	4300	6503	131985419	SO:0001819	synonymous_variant	114	exon7			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1692C>T	8.37:g.131916237G>A			131985419	NM_001115		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																				0.463	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
CASZ1	54897	broad.mit.edu	37	1	10714552	10714552	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:10714552G>A	ENST00000377022.3	-	10	2079	c.1762C>T	c.(1762-1764)Cgc>Tgc	p.R588C	CASZ1_ENST00000344008.5_Missense_Mutation_p.R588C|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	588					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R588C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GCTCGGAAGCGCTGGAAGCCG	0.587																																					p.R588C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1762T	1						.						185.0	163.0	170.0					1																	10714552		2203	4300	6503	10637139	SO:0001583	missense	54897	exon10			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1762C>T	1.37:g.10714552G>A	ENSP00000366221:p.Arg588Cys		10637139	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	37	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797369	0.90538	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.97	4.97	0.65823	.	0.095697	0.64402	D	0.000001	T	0.75852	0.3906	L	0.52011	1.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.78347	-0.2239	9	0.87932	D	0	-35.0999	18.6257	0.91336	0.0:0.0:1.0:0.0	.	612;588;588	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	C	588	.	ENSP00000339445:R588C	R	-	1	0	CASZ1	10637139	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.485000	0.60279	2.478000	0.83669	0.561000	0.74099	CGC		0.587	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
SEMA6C	10500	broad.mit.edu	37	1	151107280	151107280	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:151107280G>T	ENST00000341697.3	-	16	3343	c.1652C>A	c.(1651-1653)tCt>tAt	p.S551Y	SEMA6C_ENST00000479820.1_5'Flank			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	551					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.S551Y(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTACCCACCAGATCCCCTGAT	0.532																																					p.S551Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1652A	1						.						136.0	122.0	127.0					1																	151107280		2203	4300	6503	149373904	SO:0001583	missense	10500	exon16			AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1652C>A	1.37:g.151107280G>T	ENSP00000344148:p.Ser551Tyr		149373904	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	37	CCDS984.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338373	0.24253	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.83	3.87	0.44632	.	1.169550	0.06419	N	0.722037	T	0.08179	0.0204	N	0.02539	-0.55	0.20873	N	0.999835	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.12837	0.008;0.0;0.001;0.0	T	0.20273	-1.0280	10	0.22109	T	0.4	.	10.4114	0.44296	0.0:0.0:0.8063:0.1937	.	551;511;551;551	B4DZD4;Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;.;SEM6C_HUMAN	Y	551;511;551;551	ENSP00000357910:S551Y;ENSP00000357908:S511Y;ENSP00000357909:S551Y;ENSP00000344148:S551Y	ENSP00000344148:S551Y	S	-	2	0	SEMA6C	149373904	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	2.637000	0.46553	2.529000	0.85273	0.561000	0.74099	TCT		0.532	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
NUP210L	91181	broad.mit.edu	37	1	154091160	154091160	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:154091160C>T	ENST00000368559.3	-	11	1522	c.1451G>A	c.(1450-1452)cGt>cAt	p.R484H	NUP210L_ENST00000271854.3_Missense_Mutation_p.R484H	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	484					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.R484H(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TACTTTATAACGATATAACAT	0.328																																					p.R484H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1451A	1						.						146.0	148.0	148.0					1																	154091160		1833	4084	5917	152357784	SO:0001583	missense	91181	exon11			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1451G>A	1.37:g.154091160C>T	ENSP00000357547:p.Arg484His		152357784	NM_207308	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	C	8.497	0.863426	0.17250	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05649	3.41;3.41	5.0	1.03	0.20045	Invasin/intimin cell-adhesion (1);	0.463681	0.20461	N	0.091896	T	0.01730	0.0055	L	0.34521	1.04	0.26762	N	0.969976	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.43278	-0.9401	10	0.51188	T	0.08	-3.2393	10.2869	0.43573	0.0:0.6837:0.0:0.3163	.	484;484	E7EP56;Q5VU65	.;P210L_HUMAN	H	484	ENSP00000357547:R484H;ENSP00000271854:R484H	ENSP00000271854:R484H	R	-	2	0	NUP210L	152357784	0.007000	0.16637	0.921000	0.36526	0.526000	0.34562	-0.278000	0.08490	-0.056000	0.13221	-1.346000	0.01242	CGT		0.328	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
ASH1L	55870	broad.mit.edu	37	1	155327391	155327391	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:155327391G>T	ENST00000368346.3	-	14	7599	c.6960C>A	c.(6958-6960)caC>caA	p.H2320Q	RNU6-106P_ENST00000384405.1_RNA|ASH1L_ENST00000392403.3_Missense_Mutation_p.H2315Q			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2320					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)	p.H2315Q(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TCTTCAGCTTGTGCTTAGACT	0.443																																					p.H2315Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6945A	1						.						231.0	206.0	214.0					1																	155327391		2203	4300	6503	153594015	SO:0001583	missense	55870	exon14			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.6960C>A	1.37:g.155327391G>T	ENSP00000357330:p.His2320Gln		153594015	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	37		.	.	.	.	.	.	.	.	.	.	g	23.2	4.387082	0.82902	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.88431	-2.38;-2.38	4.79	4.79	0.61399	Bromodomain (1);	0.000000	0.85682	D	0.000000	D	0.90123	0.6914	L	0.35854	1.095	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.78314	0.979;0.991	D	0.90409	0.4408	10	0.49607	T	0.09	.	17.6191	0.88076	0.0:0.0:1.0:0.0	.	2320;2315	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	Q	2320;2315	ENSP00000357330:H2320Q;ENSP00000376204:H2315Q	ENSP00000357330:H2320Q	H	-	3	2	ASH1L	153594015	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.411000	0.80078	2.482000	0.83794	0.573000	0.79308	CAC		0.443	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
CD1E	913	broad.mit.edu	37	1	158326577	158326577	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:158326577A>C	ENST00000368167.3	+	6	1297	c.1058A>C	c.(1057-1059)aAc>aCc	p.N353T	CD1E_ENST00000368166.3_Missense_Mutation_p.N152T|CD1E_ENST00000368165.3_Missense_Mutation_p.N263T|CD1E_ENST00000452291.2_Missense_Mutation_p.N164T|CD1E_ENST00000368154.1_Missense_Mutation_p.N109T|CD1E_ENST00000368160.3_Missense_Mutation_p.N341T|CD1E_ENST00000368164.3_3'UTR|CD1E_ENST00000444681.2_Missense_Mutation_p.N254T|CD1E_ENST00000368155.3_Missense_Mutation_p.N196T|CD1E_ENST00000368157.1_Missense_Mutation_p.N97T|CD1E_ENST00000368161.3_3'UTR|CD1E_ENST00000368156.1_Missense_Mutation_p.N251T|CD1E_ENST00000368163.3_Missense_Mutation_p.N286T	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	353					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)	p.N353T(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					ATGGGAGCCAACACTCAGGAC	0.428																																					p.N263T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A788C	1						.						108.0	104.0	105.0					1																	158326577		1908	4123	6031	156593201	SO:0001583	missense	913	exon5			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.1058A>C	1.37:g.158326577A>C	ENSP00000357149:p.Asn353Thr		156593201	NM_001185107	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.319976	0.41096	.	.	ENSG00000158488	ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368163;ENST00000368157;ENST00000368160;ENST00000368156;ENST00000368155;ENST00000368154	T;T;T;T;T;T;T;T;T;T;T	0.56611	5.0;4.46;3.14;3.13;3.41;2.71;0.45;4.61;3.4;2.91;0.47	4.88	-0.124	0.13523	.	1.844580	0.02634	N	0.104653	T	0.47002	0.1422	L	0.54323	1.7	0.09310	N	1	B;D;B;P;P;B;P;D;P;B	0.67145	0.418;0.96;0.218;0.617;0.617;0.1;0.688;0.996;0.902;0.218	B;P;B;B;B;B;B;P;P;B	0.59056	0.053;0.57;0.085;0.121;0.121;0.024;0.115;0.851;0.52;0.085	T	0.28073	-1.0055	10	0.72032	D	0.01	0.0149	7.1281	0.25484	0.552:0.0:0.448:0.0	.	254;263;196;152;341;353;164;109;251;286	E7EP01;P15812-5;P15812-7;P15812-9;P15812-2;P15812;P15812-8;P15812-11;P15812-6;P15812-4	.;.;.;.;.;CD1E_HUMAN;.;.;.;.	T	254;353;164;263;152;286;97;341;251;196;109	ENSP00000402906:N254T;ENSP00000357149:N353T;ENSP00000416228:N164T;ENSP00000357147:N263T;ENSP00000357148:N152T;ENSP00000357145:N286T;ENSP00000357139:N97T;ENSP00000357142:N341T;ENSP00000357138:N251T;ENSP00000357137:N196T;ENSP00000357136:N109T	ENSP00000357136:N109T	N	+	2	0	CD1E	156593201	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.389000	0.20751	0.054000	0.16065	0.533000	0.62120	AAC		0.428	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
OR10Z1	128368	broad.mit.edu	37	1	158576428	158576428	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:158576428C>T	ENST00000361284.1	+	1	200	c.200C>T	c.(199-201)tCc>tTc	p.S67F		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S67F(1)		endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TCCTTCCTATCCTTCTCTGAG	0.532																																					p.S67F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C200T	1						.						249.0	244.0	246.0					1																	158576428		2203	4300	6503	156843052	SO:0001583	missense	128368	exon1			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.200C>T	1.37:g.158576428C>T	ENSP00000354707:p.Ser67Phe		156843052	NM_001004478	Q5VYL0|Q6IFR7	Missense_Mutation	SNP	ENST00000361284.1	37	CCDS30901.1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641731	0.29157	.	.	ENSG00000198967	ENST00000361284	T	0.12361	2.69	5.36	5.36	0.76844	GPCR, rhodopsin-like superfamily (1);	0.184684	0.26800	N	0.022426	T	0.42381	0.1200	H	0.95402	3.665	0.19300	N	0.999971	D	0.76494	0.999	D	0.70716	0.97	T	0.52026	-0.8630	10	0.87932	D	0	.	18.0328	0.89290	0.0:1.0:0.0:0.0	.	67	Q8NGY1	O10Z1_HUMAN	F	67	ENSP00000354707:S67F	ENSP00000354707:S67F	S	+	2	0	OR10Z1	156843052	0.064000	0.20934	0.281000	0.24762	0.012000	0.07955	2.453000	0.44970	2.783000	0.95769	0.655000	0.94253	TCC		0.532	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478	
SMG7	9887	broad.mit.edu	37	1	183515228	183515228	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:183515228C>T	ENST00000347615.2	+	17	2617	c.2498C>T	c.(2497-2499)cCg>cTg	p.P833L	SMG7_ENST00000508461.1_Missense_Mutation_p.P791L|SMG7_ENST00000515829.2_Missense_Mutation_p.P787L|SMG7_ENST00000367537.3_Missense_Mutation_p.P816L|SMG7_ENST00000456731.2_Missense_Mutation_p.P745L|SMG7_ENST00000507469.1_Missense_Mutation_p.P787L	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	833	Gln/Pro-rich.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.P833L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CTGTTTGAGCCGTCATTGCAA	0.468																																					p.P791L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2372T	1						.						79.0	85.0	83.0					1																	183515228		2203	4300	6503	181781851	SO:0001583	missense	9887	exon16			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2498C>T	1.37:g.183515228C>T	ENSP00000340766:p.Pro833Leu		181781851	NM_001174061	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	37	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633866	0.47049	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.62	4.65	0.58169	.	0.301659	0.34245	N	0.004135	T	0.22205	0.0535	N	0.08118	0	0.53688	D	0.99997	B;B;B;B;B;B	0.27700	0.186;0.185;0.186;0.133;0.186;0.185	B;B;B;B;B;B	0.19666	0.01;0.012;0.01;0.026;0.017;0.019	T	0.07065	-1.0792	10	0.37606	T	0.19	-10.9844	11.8691	0.52511	0.3411:0.6589:0.0:0.0	.	791;816;745;787;833;787	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	L	745;816;791;745;833;787;787	ENSP00000407629:P745L;ENSP00000356507:P816L;ENSP00000426915:P791L;ENSP00000388390:P745L;ENSP00000340766:P833L;ENSP00000425133:P787L;ENSP00000421358:P787L	ENSP00000340766:P833L	P	+	2	0	SMG7	181781851	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.732000	0.68563	2.633000	0.89246	0.655000	0.94253	CCG		0.468	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
LGR6	59352	broad.mit.edu	37	1	202287420	202287420	+	Silent	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:202287420C>T	ENST00000367278.3	+	18	2078	c.1989C>T	c.(1987-1989)gcC>gcT	p.A663A	LGR6_ENST00000255432.7_Silent_p.A611A|LGR6_ENST00000439764.2_Silent_p.A524A	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	663					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)	p.A663A(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						TCACTCTGGCCGCAGTGCAGT	0.682																																					p.A611A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1833T	1						.						20.0	18.0	19.0					1																	202287420		2203	4300	6503	200554043	SO:0001819	synonymous_variant	59352	exon18			AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.1989C>T	1.37:g.202287420C>T			200554043	NM_021636	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	ENST00000367278.3	37	CCDS30971.1																																																																																				0.682	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
LYST	1130	broad.mit.edu	37	1	235920623	235920623	+	Silent	SNP	G	G	A	rs201154390		TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:235920623G>A	ENST00000389794.3	-	24	7191	c.7017C>T	c.(7015-7017)ctC>ctT	p.L2339L	LYST_ENST00000389793.2_Silent_p.L2339L			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2339					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.L2339L(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGTGGTTAACGAGGACCAAAA	0.338													G|||	1	0.000199681	0.0	0.0	5008	,	,		16644	0.001		0.0	False		,,,				2504	0.0				p.L2339L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C7017T	1						.						107.0	98.0	101.0					1																	235920623		2203	4300	6503	233987246	SO:0001819	synonymous_variant	1130	exon24			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.7017C>T	1.37:g.235920623G>A			233987246	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																				0.338	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
CYP4Z1	199974	broad.mit.edu	37	1	47534369	47534369	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:47534369G>A	ENST00000334194.3	+	2	256	c.253G>A	c.(253-255)Gga>Aga	p.G85R		NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	85						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.G85R(1)		cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						CTTGTGGGTTGGACCCTTTAC	0.443																																					p.G85R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G253A	1						.						201.0	175.0	184.0					1																	47534369		2203	4300	6503	47306956	SO:0001583	missense	199974	exon2			AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.253G>A	1.37:g.47534369G>A	ENSP00000334246:p.Gly85Arg		47306956	NM_178134	Q5VVE4	Missense_Mutation	SNP	ENST00000334194.3	37	CCDS545.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.050461	0.75960	.	.	ENSG00000186160	ENST00000334194	T	0.73789	-0.78	2.83	2.83	0.33086	.	0.000000	0.64402	U	0.000018	D	0.82323	0.5012	M	0.85462	2.755	0.32184	N	0.579984	P	0.51537	0.946	P	0.56514	0.8	D	0.85362	0.1108	10	0.72032	D	0.01	.	9.2757	0.37698	0.0:0.0:1.0:0.0	.	85	Q86W10	CP4Z1_HUMAN	R	85	ENSP00000334246:G85R	ENSP00000334246:G85R	G	+	1	0	CYP4Z1	47306956	1.000000	0.71417	0.737000	0.30932	0.669000	0.39330	3.993000	0.56987	1.581000	0.49865	0.461000	0.40582	GGA		0.443	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022020.1	NM_178134	
STIL	6491	broad.mit.edu	37	1	47767996	47767996	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:47767996C>G	ENST00000360380.3	-	5	538	c.175G>C	c.(175-177)Gag>Cag	p.E59Q	STIL_ENST00000243182.6_Missense_Mutation_p.E59Q|STIL_ENST00000337817.5_Missense_Mutation_p.E59Q|STIL_ENST00000371877.3_Missense_Mutation_p.E59Q|STIL_ENST00000396221.2_Missense_Mutation_p.E59Q	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	59					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.E59Q(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				ATGGTCTTCTCAGTCACCACA	0.368																																					p.E59Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G175C	1						.						102.0	103.0	103.0					1																	47767996		2203	4300	6503	47540583	SO:0001583	missense	6491	exon4			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.175G>C	1.37:g.47767996C>G	ENSP00000353544:p.Glu59Gln		47540583	NM_001048166	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229064	0.58777	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475;ENST00000413565	T;T;T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42;0.42;0.42	5.42	3.55	0.40652	.	0.150226	0.64402	D	0.000017	T	0.66684	0.2814	M	0.78637	2.42	0.36138	D	0.846586	P;P;P;P;P	0.47762	0.713;0.9;0.713;0.9;0.9	P;P;P;P;P	0.53549	0.729;0.729;0.729;0.729;0.729	T	0.77175	-0.2684	10	0.72032	D	0.01	-12.7646	14.9953	0.71428	0.0:0.9247:0.0:0.0753	.	59;59;59;59;59	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	Q	59;59;59;59;59;59;63	ENSP00000353544:E59Q;ENSP00000337367:E59Q;ENSP00000360944:E59Q;ENSP00000379523:E59Q;ENSP00000243182:E59Q;ENSP00000411664:E59Q;ENSP00000412019:E63Q	ENSP00000243182:E59Q	E	-	1	0	STIL	47540583	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	3.461000	0.53035	0.657000	0.30906	-1.360000	0.01215	GAG		0.368	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
CHML	1122	broad.mit.edu	37	1	241798077	241798077	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr1:241798077A>T	ENST00000366553.1	-	1	1155	c.992T>A	c.(991-993)cTa>cAa	p.L331Q	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	331					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.L331Q(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			GTTGGGAGTTAGTTTTTTAGT	0.333																																					p.L331Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T992A	1						.						131.0	132.0	132.0					1																	241798077		2203	4299	6502	239864700	SO:0001583	missense	1122	exon1			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.992T>A	1.37:g.241798077A>T	ENSP00000355511:p.Leu331Gln		239864700	NM_001821	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	ENST00000366553.1	37	CCDS31073.1	.	.	.	.	.	.	.	.	.	.	A	18.63	3.664530	0.67700	.	.	ENSG00000203668	ENST00000366553	D	0.90261	-2.64	4.96	4.96	0.65561	.	0.156037	0.41194	U	0.000923	D	0.94932	0.8361	.	.	.	0.58432	D	0.999991	D	0.89917	1.0	D	0.87578	0.998	D	0.95361	0.8455	9	0.87932	D	0	-9.28	12.937	0.58320	1.0:0.0:0.0:0.0	.	331	P26374	RAE2_HUMAN	Q	331	ENSP00000355511:L331Q	ENSP00000355511:L331Q	L	-	2	0	CHML	239864700	0.995000	0.38212	0.995000	0.50966	0.991000	0.79684	8.014000	0.88676	2.222000	0.72286	0.533000	0.62120	CTA		0.333	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095712.1	NM_001821	
RDX	5962	broad.mit.edu	37	11	110104081	110104081	+	Missense_Mutation	SNP	C	C	T	rs34471100		TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr11:110104081C>T	ENST00000343115.4	-	13	1787	c.1468G>A	c.(1468-1470)Gat>Aat	p.D490N	RDX_ENST00000544551.1_Missense_Mutation_p.D354N|RDX_ENST00000405097.1_Missense_Mutation_p.D490N|RDX_ENST00000530301.1_Intron|RDX_ENST00000528498.1_Missense_Mutation_p.D490N|RDX_ENST00000528900.1_Missense_Mutation_p.D143N	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	490	Glu-rich.		D -> N (in dbSNP:rs34471100).		actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)	p.D490N(1)		endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		TTATTCTCATCGTGTTCATCA	0.443													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18238	0.0		0.0	False		,,,				2504	0.0				p.D490N	Esophageal Squamous(55;25 1062 11040 28755 44273)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1468A	11						.	C	ASN/ASP	10,4392	16.8+/-37.8	0,10,2191	236.0	216.0	223.0		1468	5.1	1.0	11	dbSNP_126	223	2,8594	2.2+/-6.3	0,2,4296	yes	missense	RDX	NM_002906.3	23	0,12,6487	TT,TC,CC		0.0233,0.2272,0.0923	benign	490/584	110104081	12,12986	2201	4298	6499	109609291	SO:0001583	missense	5962	exon13			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.1468G>A	11.37:g.110104081C>T	ENSP00000342830:p.Asp490Asn		109609291	NM_002906	A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	ENST00000343115.4	37	CCDS8343.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	16.96	3.265990	0.59540	0.002272	2.33E-4	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000343115;ENST00000544551;ENST00000530085	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	6.01	5.09	0.68999	Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80507	0.4636	M	0.80847	2.515	0.58432	D	0.999998	B;P;B;B	0.40834	0.174;0.73;0.208;0.144	B;B;B;B	0.35688	0.067;0.208;0.11;0.028	T	0.77608	-0.2524	10	0.21014	T	0.42	.	11.7841	0.52032	0.0:0.8655:0.0:0.1345	rs34471100	354;490;490;143	F5H1A7;A7YIJ8;P35241;A7YIK3	.;.;RADI_HUMAN;.	N	490;490;143;490;354;160	ENSP00000432112:D490N;ENSP00000384136:D490N;ENSP00000433580:D143N;ENSP00000342830:D490N;ENSP00000445826:D354N;ENSP00000434788:D160N	ENSP00000342830:D490N	D	-	1	0	RDX	109609291	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.638000	0.61353	2.861000	0.98227	0.650000	0.86243	GAT		0.443	RDX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390535.2	NM_002906	
OR10A3	26496	broad.mit.edu	37	11	7960215	7960215	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr11:7960215G>T	ENST00000360759.3	-	1	926	c.853C>A	c.(853-855)Ctc>Atc	p.L285I		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	285					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L285I(1)		endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGCGGATTGAGCAGAGGGGTA	0.413																																					p.L285I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C853A	11						.						177.0	163.0	168.0					11																	7960215		2201	4296	6497	7916791	SO:0001583	missense	26496	exon1			BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.853C>A	11.37:g.7960215G>T	ENSP00000353988:p.Leu285Ile		7916791	NM_001003745	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	37	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.549641	0.27652	.	.	ENSG00000170683	ENST00000360759	T	0.44083	0.93	4.65	1.77	0.24775	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32028	U	0.006697	T	0.51822	0.1697	L	0.47716	1.5	0.24611	N	0.993723	D	0.71674	0.998	D	0.83275	0.996	T	0.37934	-0.9684	10	0.59425	D	0.04	.	8.5403	0.33388	0.2542:0.0:0.7458:0.0	.	285	P58181	O10A3_HUMAN	I	285	ENSP00000353988:L285I	ENSP00000353988:L285I	L	-	1	0	OR10A3	7916791	0.109000	0.22037	1.000000	0.80357	0.005000	0.04900	-0.218000	0.09240	0.305000	0.22832	-0.225000	0.12378	CTC		0.413	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745	
GTF2H1	2965	broad.mit.edu	37	11	18357325	18357325	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr11:18357325A>C	ENST00000265963.4	+	3	339	c.179A>C	c.(178-180)aAa>aCa	p.K60T	GTF2H1_ENST00000531757.1_3'UTR|GTF2H1_ENST00000453096.2_Missense_Mutation_p.K60T|GTF2H1_ENST00000524753.4_5'Flank|GTF2H1_ENST00000534641.1_Intron	NM_005316.3	NP_005307.1	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1, 62kDa	60					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	core TFIIH complex (GO:0000439)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K60T(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	20						CCAGAAGGAAAAGCTAAAATT	0.423								Nucleotide excision repair (NER)																													p.K60T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A179C	11						.						97.0	87.0	91.0					11																	18357325		2199	4293	6492	18313901	SO:0001583	missense	2965	exon4				CCDS7838.1	11p15.1-p14	2012-11-05	2002-08-29		ENSG00000110768	ENSG00000110768		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	4655	protein-coding gene	gene with protein product		189972	"""general transcription factor IIH, polypeptide 1 (62kD subunit)"""			1529339, 8162052	Standard	NM_005316		Approved	BTF2, P62, TFIIH	uc001moh.2	P32780	OTTHUMG00000167690	ENST00000265963.4:c.179A>C	11.37:g.18357325A>C	ENSP00000265963:p.Lys60Thr		18313901	NM_001142307	B3KXE0|D3DQY2|Q6I9Y7|Q9H5K5|Q9NQD9	Missense_Mutation	SNP	ENST00000265963.4	37	CCDS7838.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.874110	0.91664	.	.	ENSG00000110768	ENST00000453096;ENST00000525831;ENST00000265963	T;T	0.29142	1.58;1.58	5.75	5.75	0.90469	TFIIH p62 subunit, N-terminal (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.57946	0.2088	M	0.78456	2.415	0.80722	D	1	P	0.45715	0.865	D	0.69142	0.962	T	0.57159	-0.7859	10	0.44086	T	0.13	-10.1612	16.0671	0.80891	1.0:0.0:0.0:0.0	.	60	P32780	TF2H1_HUMAN	T	60	ENSP00000393638:K60T;ENSP00000265963:K60T	ENSP00000265963:K60T	K	+	2	0	GTF2H1	18313901	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.679000	0.91220	2.192000	0.70111	0.460000	0.39030	AAA		0.423	GTF2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395627.2	NM_005316	
ZW10	9183	broad.mit.edu	37	11	113614651	113614651	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr11:113614651C>T	ENST00000200135.3	-	10	1528	c.1384G>A	c.(1384-1386)Gag>Aag	p.E462K		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	462					ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)	p.E462K(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		TTTTCAGGCTCTAAATTCATC	0.403																																					p.E462K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1384A	11						.						227.0	200.0	209.0					11																	113614651		2201	4296	6497	113119861	SO:0001583	missense	9183	exon10			U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.1384G>A	11.37:g.113614651C>T	ENSP00000200135:p.Glu462Lys		113119861	NM_004724	A1A528	Missense_Mutation	SNP	ENST00000200135.3	37	CCDS8363.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.086649	0.55861	.	.	ENSG00000086827	ENST00000200135	T	0.47528	0.84	5.57	3.67	0.42095	.	0.048140	0.85682	D	0.000000	T	0.42630	0.1211	M	0.70595	2.14	0.58432	D	0.999999	B	0.09022	0.002	B	0.22386	0.039	T	0.24261	-1.0165	10	0.07813	T	0.8	-8.5333	10.0266	0.42074	0.0:0.7855:0.1387:0.0757	.	462	O43264	ZW10_HUMAN	K	462	ENSP00000200135:E462K	ENSP00000200135:E462K	E	-	1	0	ZW10	113119861	1.000000	0.71417	0.950000	0.38849	0.694000	0.40290	2.183000	0.42565	0.686000	0.31488	-0.384000	0.06662	GAG		0.403	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724	
OLIG3	167826	broad.mit.edu	37	6	137815030	137815030	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr6:137815030C>T	ENST00000367734.2	-	1	501	c.278G>A	c.(277-279)cGc>cAc	p.R93H		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	93	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.R93H(1)		endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		CATCCGCTTGCGTTCGCGTCC	0.612																																					p.R93H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G278A	6						.						132.0	99.0	110.0					6																	137815030		2203	4300	6503	137856723	SO:0001583	missense	167826	exon1			AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.278G>A	6.37:g.137815030C>T	ENSP00000356708:p.Arg93His		137856723	NM_175747	Q8N8Q0	Missense_Mutation	SNP	ENST00000367734.2	37	CCDS5186.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631274	0.87660	.	.	ENSG00000177468	ENST00000367734	D	0.94000	-3.33	5.44	5.44	0.79542	Helix-loop-helix DNA-binding (5);	0.142257	0.47455	D	0.000240	D	0.97888	0.9306	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.98951	1.0794	10	0.87932	D	0	-1.9	19.2352	0.93856	0.0:1.0:0.0:0.0	.	93	Q7RTU3	OLIG3_HUMAN	H	93	ENSP00000356708:R93H	ENSP00000356708:R93H	R	-	2	0	OLIG3	137856723	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	7.814000	0.86154	2.534000	0.85438	0.591000	0.81541	CGC		0.612	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042405.1	NM_175747	
CDYL	9425	broad.mit.edu	37	6	4937855	4937856	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-AG-3890-01	TCGA-AG-3890-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr6:4937855_4937856GG>TT	ENST00000328908.5	+	6	1298_1299	c.1167_1168GG>TT	c.(1165-1170)ctGGta>ctTTta	p.V390L	CDYL_ENST00000343762.5_Missense_Mutation_p.V204L|CDYL_ENST00000397588.3_Missense_Mutation_p.V336L|CDYL_ENST00000472453.1_3'UTR|CDYL_ENST00000449732.2_Missense_Mutation_p.V204L			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	390					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)	p.L389>?(1)		breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		ACAGCAAGCTGGTACTGCTCAG	0.455																																					.												.	.	1	Complex(1)	large_intestine(1)	c.609_610TT	6						.																																			4882855	SO:0001583	missense	9425	exon4			AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	Exception_encountered	6.37:g.4937855_4937856delinsTT	ENSP00000330512:p.Val390Leu		4882854	NM_001143970	A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Missense_Mutation	DNP	ENST00000328908.5	37																																																																																					0.455	CDYL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000039736.1	NM_004824	
PTCHD4	442213	broad.mit.edu	37	6	47847354	47847354	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr6:47847354A>G	ENST00000339488.4	-	3	1259	c.1226T>C	c.(1225-1227)aTc>aCc	p.I409T		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	409						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)	p.I409T(1)									TGCAGAAGGGATCTTACAGCA	0.488																																					p.I409T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1226C	6						.						99.0	90.0	93.0					6																	47847354		2203	4300	6503	47955313	SO:0001583	missense	442213	exon3				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1226T>C	6.37:g.47847354A>G	ENSP00000341914:p.Ile409Thr		47955313	NM_001013732	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	A	12.62	1.993295	0.35131	.	.	ENSG00000244694	ENST00000339488	D	0.92149	-2.98	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.83959	0.5367	L	0.51422	1.61	0.80722	D	1	B	0.27013	0.166	B	0.32090	0.14	T	0.81737	-0.0796	10	0.12766	T	0.61	.	14.738	0.69430	1.0:0.0:0.0:0.0	.	409	Q6ZW05	CF138_HUMAN	T	409	ENSP00000341914:I409T	ENSP00000341914:I409T	I	-	2	0	C6orf138	47955313	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	1.895000	0.54865	0.528000	0.53228	ATC		0.488	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
ZNF451	26036	broad.mit.edu	37	6	57012559	57012559	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr6:57012559A>G	ENST00000370706.4	+	10	1920	c.1676A>G	c.(1675-1677)tAt>tGt	p.Y559C	RP11-203B9.4_ENST00000592038.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.Y559C|ZNF451_ENST00000357489.3_Missense_Mutation_p.Y559C	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y559C(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GGACACAGATATTTTTATGAG	0.358																																					p.Y559C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1676G	6						.						162.0	164.0	163.0					6																	57012559		2203	4300	6503	57120518	SO:0001583	missense	26036	exon10			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.1676A>G	6.37:g.57012559A>G	ENSP00000359740:p.Tyr559Cys		57120518	NM_015555	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	37	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.957640	0.53400	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.09911	2.93;2.93;2.93	5.41	2.83	0.33086	Zinc finger, C2H2 (1);	0.125791	0.56097	D	0.000037	T	0.15696	0.0378	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.998	D;P;D;P	0.65323	0.934;0.86;0.929;0.86	T	0.00972	-1.1495	10	0.54805	T	0.06	-21.823	10.3868	0.44145	0.7396:0.0:0.0:0.2604	.	559;559;559;559	Q9Y4E5-2;Q9Y4E5;E9PH99;Q4KMR5	.;ZN451_HUMAN;.;.	C	559	ENSP00000359740:Y559C;ENSP00000350083:Y559C;ENSP00000421645:Y559C	ENSP00000350083:Y559C	Y	+	2	0	ZNF451	57120518	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.743000	0.55104	0.860000	0.35481	0.528000	0.53228	TAT		0.358	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	
COL12A1	1303	broad.mit.edu	37	6	75812378	75812378	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr6:75812378G>A	ENST00000322507.8	-	56	8659	c.8350C>T	c.(8350-8352)Cct>Tct	p.P2784S	COL12A1_ENST00000416123.2_Missense_Mutation_p.P2708S|COL12A1_ENST00000483888.2_Missense_Mutation_p.P2784S|COL12A1_ENST00000511023.1_5'Flank|COL12A1_ENST00000345356.6_Missense_Mutation_p.P1620S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2784	Collagen-like 1.|Triple-helical region (COL2) with 1 imperfection.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.P2784S(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GGGCCTGGAGGACCTATGTCT	0.502																																					p.P2784S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8350T	6						.						52.0	52.0	52.0					6																	75812378		1832	4088	5920	75869098	SO:0001583	missense	1303	exon56			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8350C>T	6.37:g.75812378G>A	ENSP00000325146:p.Pro2784Ser		75869098	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281378	0.80692	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05;-5.05	5.29	5.29	0.74685	.	0.154579	0.43747	D	0.000534	D	0.97888	0.9306	L	0.45744	1.44	0.51233	D	0.999912	D;D	0.58970	0.984;0.958	P;P	0.59595	0.839;0.86	D	0.97365	0.9972	10	0.21014	T	0.42	.	17.1248	0.86711	0.0:0.0:1.0:0.0	.	1620;2784	Q99715-2;Q99715	.;COCA1_HUMAN	S	2784;422;2708;1620;2708;2784	ENSP00000325146:P2784S;ENSP00000399812:P422S;ENSP00000305147:P1620S;ENSP00000412864:P2708S;ENSP00000421216:P2784S	ENSP00000325146:P2784S	P	-	1	0	COL12A1	75869098	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.543000	0.67225	2.466000	0.83321	0.591000	0.81541	CCT		0.502	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
PLEKHG1	57480	broad.mit.edu	37	6	151153151	151153151	+	Silent	SNP	C	C	A			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr6:151153151C>A	ENST00000358517.2	+	15	3115	c.2904C>A	c.(2902-2904)gcC>gcA	p.A968A	PLEKHG1_ENST00000367328.1_Silent_p.A968A			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	968							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A968A(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GGATGGAGGCCACAGATAAGA	0.493																																					p.A968A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2904A	6						.						125.0	138.0	134.0					6																	151153151		2203	4300	6503	151194844	SO:0001819	synonymous_variant	57480	exon16			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.2904C>A	6.37:g.151153151C>A			151194844	NM_001029884	Q5T1F2	Silent	SNP	ENST00000358517.2	37	CCDS34552.1																																																																																				0.493	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
SHMT1	6470	broad.mit.edu	37	17	18233941	18233941	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr17:18233941C>A	ENST00000316694.3	-	10	1233	c.1099G>T	c.(1099-1101)Ggc>Tgc	p.G367C	SHMT1_ENST00000352886.6_Missense_Mutation_p.G287C|SHMT1_ENST00000354098.3_Missense_Mutation_p.G328C|SHMT1_ENST00000539052.1_Missense_Mutation_p.G229C	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	367					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.G367C(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CCATCTGTGCCTTTGGAACGG	0.478																																					p.G367C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1099T	17						.						118.0	101.0	107.0					17																	18233941		2203	4300	6503	18174666	SO:0001583	missense	6470	exon10				CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1099G>T	17.37:g.18233941C>A	ENSP00000318868:p.Gly367Cys		18174666	NM_004169	B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	ENST00000316694.3	37	CCDS11196.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.655381	0.88056	.	.	ENSG00000176974	ENST00000316694;ENST00000395684;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.52	5.52	0.82312	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.092522	0.85682	D	0.000000	T	0.74023	0.3662	H	0.98559	4.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.993;0.988	T	0.83146	-0.0106	10	0.87932	D	0	-27.3016	13.0665	0.59036	0.0:0.9261:0.0:0.0739	.	367;328;367	A8MYA6;P34896-2;P34896	.;.;GLYC_HUMAN	C	367;142;287;229;328;367	ENSP00000318868:G367C;ENSP00000345881:G287C;ENSP00000440089:G229C;ENSP00000318805:G328C	ENSP00000318868:G367C	G	-	1	0	SHMT1	18174666	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.026000	0.70873	2.761000	0.94854	0.655000	0.94253	GGC		0.478	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130831.2	NM_004169	
ZNF830	91603	broad.mit.edu	37	17	33289465	33289465	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr17:33289465G>A	ENST00000361952.3	+	1	917	c.880G>A	c.(880-882)Gaa>Aaa	p.E294K	CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000421975.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	294					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.E294K(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				CATAGTTGCCGAAGAGGATGA	0.507																																					p.E294K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G880A	17						.						103.0	89.0	94.0					17																	33289465		2203	4300	6503	30313578	SO:0001583	missense	91603	exon1			AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.880G>A	17.37:g.33289465G>A	ENSP00000354518:p.Glu294Lys		30313578	NM_052857	Q96F60|Q96GZ5|Q9BU38	Missense_Mutation	SNP	ENST00000361952.3	37	CCDS32618.1	.	.	.	.	.	.	.	.	.	.	G	33	5.285509	0.95517	.	.	ENSG00000198783	ENST00000361952	T	0.20881	2.04	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40194	-0.9576	10	0.66056	D	0.02	-17.3466	16.1635	0.81734	0.0:0.0:1.0:0.0	.	294	Q96NB3	ZN830_HUMAN	K	294	ENSP00000354518:E294K	ENSP00000354518:E294K	E	+	1	0	ZNF830	30313578	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	8.332000	0.90024	2.894000	0.99253	0.655000	0.94253	GAA		0.507	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
LCMT1	51451	broad.mit.edu	37	16	25143723	25143723	+	Splice_Site	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr16:25143723G>T	ENST00000399069.3	+	3	361	c.206G>T	c.(205-207)gGa>gTa	p.G69V	LCMT1_ENST00000380966.4_Splice_Site_p.G69V	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	69					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.G69V(1)							GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	TCCCCCCTAGGATATTTTGCT	0.483																																					p.G69V	Colon(200;565 2072 24396 47922 50898)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G206T	16						.						107.0	102.0	103.0					16																	25143723		1949	4144	6093	25051224	SO:0001630	splice_region_variant	51451	exon3			AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.206-1G>T	16.37:g.25143723G>T			25051224	NM_016309	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.043432	0.55003	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.25912	1.77;1.77	5.51	5.51	0.81932	.	0.060518	0.64402	D	0.000003	T	0.66479	0.2793	H	0.97023	3.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.992;1.0	T	0.78635	-0.2127	9	.	.	.	.	16.9326	0.86195	0.0:0.0:1.0:0.0	.	69;69	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	V	69;69;86	ENSP00000382021:G69V;ENSP00000370353:G69V	.	G	+	2	0	LCMT1	25051224	1.000000	0.71417	0.998000	0.56505	0.796000	0.44982	8.729000	0.91490	2.591000	0.87537	0.655000	0.94253	GGA		0.483	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309	Missense_Mutation
KIFC3	3801	broad.mit.edu	37	16	57803780	57803780	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr16:57803780T>C	ENST00000379655.4	-	8	1284	c.1027A>G	c.(1027-1029)Att>Gtt	p.I343V	KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000540079.2_Missense_Mutation_p.I241V|KIFC3_ENST00000543930.1_Missense_Mutation_p.I204V|KIFC3_ENST00000539578.1_Missense_Mutation_p.I285V|KIFC3_ENST00000445690.2_Missense_Mutation_p.I343V|KIFC3_ENST00000541240.1_Missense_Mutation_p.I365V|KIFC3_ENST00000421376.2_Missense_Mutation_p.I204V|KIFC3_ENST00000465878.2_Missense_Mutation_p.I204V|KIFC3_ENST00000562903.1_Missense_Mutation_p.I204V	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	343					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.I343V(1)		breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				GCCTCCTCAATGGCCCGGTTC	0.627																																					p.I343V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1027G	16						.						68.0	56.0	60.0					16																	57803780		2198	4300	6498	56361281	SO:0001583	missense	3801	exon8			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1027A>G	16.37:g.57803780T>C	ENSP00000368976:p.Ile343Val		56361281	NM_001130100	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Missense_Mutation	SNP	ENST00000379655.4	37	CCDS10789.2	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222488	0.39300	.	.	ENSG00000140859	ENST00000379655;ENST00000445690;ENST00000421376;ENST00000541240;ENST00000540079;ENST00000543930;ENST00000539578	T;T;T;T;T;T;T	0.73897	-0.74;-0.71;-0.7;-0.71;-0.7;-0.79;-0.69	5.74	5.74	0.90152	.	0.053662	0.85682	D	0.000000	T	0.63379	0.2506	L	0.31420	0.93	0.40370	D	0.979335	P;P;P;B;B;P;B	0.44578	0.651;0.754;0.64;0.082;0.058;0.838;0.188	B;P;B;B;B;B;B	0.45119	0.194;0.47;0.097;0.155;0.034;0.279;0.1	T	0.60875	-0.7176	10	0.13470	T	0.59	.	9.3862	0.38345	0.0:0.0799:0.0:0.9201	.	365;285;204;241;48;343;204	B7Z484;F5H4I9;B7Z896;F5H3M2;B7Z3I6;Q9BVG8;A8K6S2	.;.;.;.;.;KIFC3_HUMAN;.	V	343;343;204;365;241;204;285	ENSP00000368976:I343V;ENSP00000401696:I343V;ENSP00000396399:I204V;ENSP00000442008:I365V;ENSP00000438805:I241V;ENSP00000444012:I204V;ENSP00000444884:I285V	ENSP00000368976:I343V	I	-	1	0	KIFC3	56361281	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	2.897000	0.48664	2.198000	0.70561	0.533000	0.62120	ATT		0.627	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257329.2	NM_005550	
ASXL3	80816	broad.mit.edu	37	18	31323783	31323783	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr18:31323783T>A	ENST00000269197.5	+	12	3971	c.3971T>A	c.(3970-3972)cTa>cAa	p.L1324Q		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1324	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L1324Q(1)		breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AAGCAGTTACTAATATCAAGC	0.453																																					p.L1324Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3971A	18						.						174.0	174.0	174.0					18																	31323783		2018	4200	6218	29577781	SO:0001583	missense	80816	exon12			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3971T>A	18.37:g.31323783T>A	ENSP00000269197:p.Leu1324Gln		29577781	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	T	14.17	2.456157	0.43634	.	.	ENSG00000141431	ENST00000269197	T	0.15952	2.38	5.92	2.27	0.28462	.	.	.	.	.	T	0.11110	0.0271	N	0.24115	0.695	0.19945	N	0.999942	P	0.46395	0.877	B	0.41860	0.368	T	0.15954	-1.0419	9	0.38643	T	0.18	.	6.3032	0.21125	0.0:0.5264:0.0:0.4736	.	1324	Q9C0F0	ASXL3_HUMAN	Q	1324	ENSP00000269197:L1324Q	ENSP00000269197:L1324Q	L	+	2	0	ASXL3	29577781	0.928000	0.31464	0.010000	0.14722	0.939000	0.58152	1.558000	0.36309	0.493000	0.27837	0.533000	0.62120	CTA		0.453	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
SMAD2	4087	broad.mit.edu	37	18	45374929	45374929	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr18:45374929G>A	ENST00000402690.2	-	8	1308	c.914C>T	c.(913-915)cCa>cTa	p.P305L	SMAD2_ENST00000586040.1_Missense_Mutation_p.P275L|SMAD2_ENST00000356825.4_Missense_Mutation_p.P275L|SMAD2_ENST00000262160.6_Missense_Mutation_p.P305L|SMAD2_ENST00000591214.1_Missense_Mutation_p.P275L	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	305	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)	p.P305L(1)|p.P305Q(1)		breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						TGAATTTGATGGGTCTGTAAA	0.403																																					p.P275L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C824T	18						.						126.0	114.0	118.0					18																	45374929		2203	4300	6503	43628927	SO:0001583	missense	4087	exon7			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.914C>T	18.37:g.45374929G>A	ENSP00000384449:p.Pro305Leu		43628927	NM_001135937		Missense_Mutation	SNP	ENST00000402690.2	37	CCDS11934.1	.	.	.	.	.	.	.	.	.	.	G	33	5.235112	0.95207	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.97114	-4.25;-4.25;-4.25	5.81	5.81	0.92471	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98264	0.9425	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.958;1.0	D	0.99010	1.0814	10	0.87932	D	0	.	20.0912	0.97820	0.0:0.0:1.0:0.0	.	275;275;305	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	L	305;275;305	ENSP00000262160:P305L;ENSP00000349282:P275L;ENSP00000384449:P305L	ENSP00000262160:P305L	P	-	2	0	SMAD2	43628927	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.869000	0.99810	2.746000	0.94184	0.591000	0.81541	CCA		0.403	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450571.1	NM_005901	
STAC	6769	broad.mit.edu	37	3	36484923	36484923	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr3:36484923T>G	ENST00000273183.3	+	2	479	c.179T>G	c.(178-180)tTc>tGc	p.F60C	STAC_ENST00000476388.1_3'UTR|STAC_ENST00000457375.2_Missense_Mutation_p.F60C	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	60					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)	p.F60C(1)		endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						GCTGACAACTTCTTCCAGCGA	0.502																																					p.F60C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T179G	3						.						90.0	72.0	78.0					3																	36484923		2203	4300	6503	36459927	SO:0001583	missense	6769	exon2			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.179T>G	3.37:g.36484923T>G	ENSP00000273183:p.Phe60Cys		36459927	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.238697	0.79800	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000434649	T;T;T	0.78707	-1.2;-0.88;-0.99	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	D	0.85470	0.5704	L	0.59436	1.845	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.95	D	0.86999	0.2115	10	0.72032	D	0.01	.	14.71	0.69222	0.0:0.0:0.0:1.0	.	60;60	E9PEA7;Q99469	.;STAC_HUMAN	C	60;60;49	ENSP00000273183:F60C;ENSP00000393713:F60C;ENSP00000398403:F49C	ENSP00000273183:F60C	F	+	2	0	STAC	36459927	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.956000	0.87863	2.011000	0.59026	0.528000	0.53228	TTC		0.502	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
PCYT1A	5130	broad.mit.edu	37	3	195997294	195997294	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr3:195997294A>C	ENST00000292823.2	-	3	281	c.109T>G	c.(109-111)Tgt>Ggt	p.C37G	PCYT1A_ENST00000431016.1_Missense_Mutation_p.C37G|PCYT1A_ENST00000491544.1_5'UTR|RP11-447L10.1_ENST00000431391.1_3'UTR|PCYT1A_ENST00000419333.1_Missense_Mutation_p.C37G	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	37					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)	p.C37G(1)		cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	ACCACTGCACAGCGCTGCACT	0.483																																					p.C37G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T109G	3						.						299.0	291.0	294.0					3																	195997294		2203	4300	6503	197481691	SO:0001583	missense	5130	exon3			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.109T>G	3.37:g.195997294A>C	ENSP00000292823:p.Cys37Gly		197481691	NM_005017	A9LYK9|D3DXB1|Q86Y88	Missense_Mutation	SNP	ENST00000292823.2	37	CCDS3315.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.608744	0.28623	.	.	ENSG00000161217	ENST00000441879;ENST00000419333;ENST00000292823;ENST00000431016;ENST00000411591;ENST00000412869;ENST00000443555	.	.	.	6.03	0.689	0.18033	.	0.333481	0.41001	D	0.000961	T	0.29850	0.0746	L	0.34521	1.04	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.05354	-1.0890	9	0.16896	T	0.51	-30.1607	1.2377	0.01956	0.5384:0.1532:0.1614:0.1471	.	37	P49585	PCY1A_HUMAN	G	37	.	ENSP00000292823:C37G	C	-	1	0	PCYT1A	197481691	0.996000	0.38824	0.985000	0.45067	0.975000	0.68041	1.013000	0.29937	0.487000	0.27698	0.533000	0.62120	TGT		0.483	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341147.1	NM_005017	
GPR19	2842	broad.mit.edu	37	12	12814647	12814647	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr12:12814647C>T	ENST00000540510.1	-	2	928	c.736G>A	c.(736-738)Gtc>Atc	p.V246I	GPR19_ENST00000332427.2_Missense_Mutation_p.V246I			P46093	GPR4_HUMAN	G protein-coupled receptor 19	204					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V246I(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		TATTTTATGACCTTTTGGTAA	0.433																																					p.V246I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G736A	12						.						38.0	42.0	40.0					12																	12814647		2203	4300	6503	12705914	SO:0001583	missense	2842	exon4				CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.736G>A	12.37:g.12814647C>T	ENSP00000441832:p.Val246Ile		12705914	NM_006143	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000540510.1	37	CCDS8652.1	.	.	.	.	.	.	.	.	.	.	C	5.822	0.335880	0.11013	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.23147	1.92;1.92	5.62	5.62	0.85841	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.14442	0.0349	N	0.13168	0.305	0.48135	D	0.99959	B	0.20550	0.046	B	0.26310	0.068	T	0.04870	-1.0921	10	0.02654	T	1	-29.8564	13.5819	0.61907	0.0:0.9249:0.0:0.0751	.	246	Q15760	GPR19_HUMAN	I	246	ENSP00000441832:V246I;ENSP00000333744:V246I	ENSP00000333744:V246I	V	-	1	0	GPR19	12705914	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	4.048000	0.57390	2.642000	0.89623	0.655000	0.94253	GTC		0.433	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
SLCO1A2	6579	broad.mit.edu	37	12	21422638	21422638	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr12:21422638G>C	ENST00000307378.6	-	16	2577	c.1857C>G	c.(1855-1857)atC>atG	p.I619M	SLCO1A2_ENST00000452078.1_Missense_Mutation_p.I619M|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.I487M|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.I487M	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	619					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.I619M(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	AAAGAATTAAGATGATTAAGG	0.363																																					p.I619M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1857G	12						.						95.0	94.0	95.0					12																	21422638		2203	4300	6503	21313905	SO:0001583	missense	6579	exon16				CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1857C>G	12.37:g.21422638G>C	ENSP00000305974:p.Ile619Met		21313905	NM_134431	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247497	0.39697	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524	T;T;T;T	0.45276	1.13;1.13;0.9;0.9	4.76	-0.796	0.10912	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.533866	0.19347	N	0.116501	T	0.36552	0.0971	M	0.64404	1.975	0.09310	N	1	B	0.22211	0.066	B	0.26614	0.071	T	0.37267	-0.9713	10	0.56958	D	0.05	.	8.0539	0.30593	0.5406:0.0:0.4594:0.0	.	619	P46721	SO1A2_HUMAN	M	619;619;487;487	ENSP00000305974:I619M;ENSP00000393973:I619M;ENSP00000394854:I487M;ENSP00000439401:I487M	ENSP00000305974:I619M	I	-	3	3	SLCO1A2	21313905	0.215000	0.23574	0.002000	0.10522	0.005000	0.04900	0.183000	0.16919	-0.074000	0.12820	-0.251000	0.11542	ATC		0.363	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
ZNF705A	440077	broad.mit.edu	37	12	8329645	8329645	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr12:8329645A>C	ENST00000359286.4	+	5	458	c.369A>C	c.(367-369)gaA>gaC	p.E123D		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E123D(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		ATTCGGGAGAAGATTGCACTC	0.383																																					p.E123D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A369C	12						.						93.0	94.0	94.0					12																	8329645		2202	4291	6493	8220912	SO:0001583	missense	440077	exon5			AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.369A>C	12.37:g.8329645A>C	ENSP00000352233:p.Glu123Asp		8220912	NM_001004328		Missense_Mutation	SNP	ENST00000359286.4	37	CCDS31737.1	.	.	.	.	.	.	.	.	.	.	.	12.66	2.004177	0.35320	.	.	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.01629	4.72;4.72	1.35	-1.66	0.08265	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01387	0.0045	L	0.41236	1.265	0.19945	N	0.99994	B	0.32409	0.37	B	0.17098	0.017	T	0.44651	-0.9314	9	0.87932	D	0	.	2.1135	0.03708	0.3249:0.0:0.1856:0.4895	.	123	Q6ZN79	Z705A_HUMAN	D	123	ENSP00000379816:E123D;ENSP00000352233:E123D	ENSP00000352233:E123D	E	+	3	2	ZNF705A	8220912	0.252000	0.23972	0.002000	0.10522	0.081000	0.17604	0.039000	0.13884	-0.450000	0.07107	0.329000	0.21502	GAA		0.383	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400449.1	NM_001004328	
CNTN1	1272	broad.mit.edu	37	12	41333214	41333214	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr12:41333214T>A	ENST00000551295.2	+	12	1423	c.1306T>A	c.(1306-1308)Tgc>Agc	p.C436S	CNTN1_ENST00000347616.1_Missense_Mutation_p.C436S|CNTN1_ENST00000348761.2_Missense_Mutation_p.C425S|CNTN1_ENST00000547849.1_Missense_Mutation_p.C436S|CNTN1_ENST00000360099.3_Missense_Mutation_p.C436S|CNTN1_ENST00000547702.1_Missense_Mutation_p.C436S	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	436	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.C436S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GATAATTGAATGCAAACCTAA	0.393																																					p.C425S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1273A	12						.						96.0	93.0	94.0					12																	41333214		2203	4300	6503	39619481	SO:0001583	missense	1272	exon11			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1306T>A	12.37:g.41333214T>A	ENSP00000447006:p.Cys436Ser		39619481	NM_175038	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.334383	0.81801	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37	4.83	4.83	0.62350	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81959	0.4933	H	0.97659	4.05	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.88677	0.3199	10	0.87932	D	0	.	15.1084	0.72336	0.0:0.0:0.0:1.0	.	436;425;436	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	S	436;436;436;436;436;425	ENSP00000448004:C436S;ENSP00000447006:C436S;ENSP00000448653:C436S;ENSP00000325660:C436S;ENSP00000353213:C436S;ENSP00000261160:C425S	ENSP00000325660:C436S	C	+	1	0	CNTN1	39619481	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.456000	0.80751	2.112000	0.64535	0.459000	0.35465	TGC		0.393	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
NUTM1	256646	broad.mit.edu	37	15	34648027	34648027	+	Silent	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr15:34648027C>G	ENST00000333756.4	+	7	1889	c.1734C>G	c.(1732-1734)ccC>ccG	p.P578P	NUTM1_ENST00000537011.1_Silent_p.P606P|NUTM1_ENST00000438749.3_Silent_p.P596P	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	578						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P578P(1)									CTCCGGGACCCTTGGGTGTGG	0.607																																					p.P578P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1734G	15						.						30.0	33.0	32.0					15																	34648027		2200	4297	6497	32435319	SO:0001819	synonymous_variant	256646	exon7			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.1734C>G	15.37:g.34648027C>G			32435319	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Silent	SNP	ENST00000333756.4	37	CCDS32190.1																																																																																				0.607	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	
LRRC49	54839	broad.mit.edu	37	15	71185236	71185236	+	Start_Codon_SNP	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr15:71185236G>A	ENST00000260382.5	+	1	263	c.3G>A	c.(1-3)atG>atA	p.M1I	LRRC49_ENST00000544974.2_Intron|LRRC49_ENST00000560691.1_5'Flank|THAP10_ENST00000249861.4_5'Flank|LRRC49_ENST00000560369.1_Start_Codon_SNP_p.M1I|LRRC49_ENST00000443425.2_5'UTR	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	1						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.M1I(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						CTCCTATCATGATTCCCGGGA	0.517											OREG0023244	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3A	15						.						166.0	153.0	158.0					15																	71185236		2199	4297	6496	68972290	SO:0001582	initiator_codon_variant	54839	exon1				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.3G>A	15.37:g.71185236G>A	ENSP00000260382:p.Met1Ile	1128	68972290	NM_017691	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	ENST00000260382.5	37	CCDS32282.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.711590	0.89112	.	.	ENSG00000137821	ENST00000260382	T	0.40476	1.03	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000002	T	0.38268	0.1034	.	.	.	0.80722	D	1	B;B	0.20261	0.043;0.043	B;B	0.16722	0.016;0.016	T	0.19451	-1.0305	9	0.87932	D	0	-25.4749	14.7543	0.69552	0.0:0.0:1.0:0.0	.	1;1	B7Z366;Q8IUZ0	.;LRC49_HUMAN	I	1	ENSP00000260382:M1I	ENSP00000260382:M1I	M	+	3	0	LRRC49	68972290	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.113000	0.57851	2.865000	0.98341	0.655000	0.94253	ATG		0.517	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691	Missense_Mutation
CENPE	1062	broad.mit.edu	37	4	104067001	104067001	+	Silent	SNP	T	T	C			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr4:104067001T>C	ENST00000265148.3	-	30	4487	c.4398A>G	c.(4396-4398)aaA>aaG	p.K1466K	CENPE_ENST00000380026.3_Silent_p.K1441K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1466					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.K1466K(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTACAATTTCTTTTATGTTTT	0.318																																					p.K1466K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A4398G	4						.						82.0	86.0	85.0					4																	104067001		2202	4299	6501	104286450	SO:0001819	synonymous_variant	1062	exon30			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4398A>G	4.37:g.104067001T>C			104286450	NM_001813	A6NKY9|A8K2U7|Q4LE75	Silent	SNP	ENST00000265148.3	37	CCDS34042.1																																																																																				0.318	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TET2	54790	broad.mit.edu	37	4	106156671	106156671	+	Silent	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr4:106156671G>A	ENST00000540549.1	+	3	2432	c.1572G>A	c.(1570-1572)gaG>gaA	p.E524E	TET2_ENST00000394764.1_Silent_p.E524E|TET2_ENST00000413648.2_Silent_p.E524E|TET2_ENST00000380013.4_Silent_p.E524E|TET2_ENST00000513237.1_Silent_p.E545E|TET2_ENST00000305737.2_Silent_p.E524E|TET2_ENST00000545826.1_Silent_p.E524E			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	524					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.E524E(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GCAGTGGAGAGCTACAGGACA	0.473			"""Mis N, F"""		MDS																																p.E524E			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1572A	4						.						71.0	67.0	69.0					4																	106156671		2203	4300	6503	106376120	SO:0001819	synonymous_variant	54790	exon3			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.1572G>A	4.37:g.106156671G>A			106376120	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Silent	SNP	ENST00000540549.1	37	CCDS47120.1																																																																																				0.473	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
TADA2B	93624	broad.mit.edu	37	4	7056151	7056151	+	Silent	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr4:7056151G>A	ENST00000310074.7	+	2	822	c.633G>A	c.(631-633)cgG>cgA	p.R211R	TADA2B_ENST00000515646.1_Silent_p.R119R|TADA2B_ENST00000512388.1_Silent_p.R136R	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	211					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R211R(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						TGTACGTGCGGAAGCTGAAAG	0.577																																					p.R211R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G633A	4						.						83.0	89.0	87.0					4																	7056151		2033	4199	6232	7107052	SO:0001819	synonymous_variant	93624	exon2			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.633G>A	4.37:g.7056151G>A			7107052	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Silent	SNP	ENST00000310074.7	37	CCDS47007.1																																																																																				0.577	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
NDST3	9348	broad.mit.edu	37	4	118975946	118975946	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr4:118975946G>T	ENST00000296499.5	+	2	1284	c.881G>T	c.(880-882)gGg>gTg	p.G294V	NDST3_ENST00000433996.2_Missense_Mutation_p.G294V	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	294	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.G294V(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						TTCTTATCAGGGAAGAGGCTG	0.413																																					p.G294V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G881T	4						.						157.0	146.0	150.0					4																	118975946		2203	4299	6502	119195394	SO:0001583	missense	9348	exon2			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.881G>T	4.37:g.118975946G>T	ENSP00000296499:p.Gly294Val		119195394	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576757	0.45902	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.47177	1.19;0.85	5.23	5.23	0.72850	.	0.210967	0.49916	D	0.000128	T	0.71324	0.3326	M	0.79926	2.475	0.80722	D	1	D;D;D	0.76494	0.999;0.957;0.979	D;P;P	0.71184	0.972;0.905;0.79	T	0.76038	-0.3105	10	0.87932	D	0	.	18.795	0.91990	0.0:0.0:1.0:0.0	.	294;294;294	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	V	294	ENSP00000296499:G294V;ENSP00000396625:G294V	ENSP00000296499:G294V	G	+	2	0	NDST3	119195394	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.334000	0.65923	2.424000	0.82194	0.655000	0.94253	GGG		0.413	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
NGFRAP1	27018	broad.mit.edu	37	X	102632732	102632732	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chrX:102632732G>A	ENST00000372645.3	+	3	640	c.313G>A	c.(313-315)Gat>Aat	p.D105N	NGFRAP1_ENST00000372635.1_Missense_Mutation_p.D105N|NGFRAP1_ENST00000299872.7_Missense_Mutation_p.D105N|NGFRAP1_ENST00000372634.1_Missense_Mutation_p.D95N|NGFRAP1_ENST00000361298.4_Missense_Mutation_p.D95N			Q00994	BEX3_HUMAN	nerve growth factor receptor (TNFRSF16) associated protein 1	105	Interaction with 14-3-3 epsilon. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|metal ion binding (GO:0046872)	p.D105N(1)		NS(2)|endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						TGACCATCATGATGAATTTTG	0.413																																					p.D95N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G283A	X						.						87.0	85.0	85.0					X																	102632732		2203	4300	6503	102519388	SO:0001583	missense	27018	exon3			AF187064	CCDS14508.1, CCDS14509.1	Xq22.2	2014-03-21			ENSG00000166681	ENSG00000166681			13388	protein-coding gene	gene with protein product	"""brain expressed, X-linked 3"""	300361				10764727, 16221301, 2171551	Standard	NM_206915		Approved	BEX3, HGR74, Bex, NADE, DXS6984E	uc004ekj.1	Q00994	OTTHUMG00000022099	ENST00000372645.3:c.313G>A	X.37:g.102632732G>A	ENSP00000361728:p.Asp105Asn		102519388	NM_206917	B2RD17|D3DXA3|Q5JQT4|Q5JQT5	Missense_Mutation	SNP	ENST00000372645.3	37	CCDS14508.1	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252081	0.59212	.	.	ENSG00000166681	ENST00000361298;ENST00000372645;ENST00000372635;ENST00000372634;ENST00000299872	T;T;T;T;T	0.10668	2.85;2.85;2.85;2.85;2.85	4.1	3.0	0.34707	.	0.000000	0.46145	D	0.000317	T	0.13243	0.0321	M	0.79258	2.445	0.26892	N	0.967306	B	0.06786	0.001	B	0.04013	0.001	T	0.18935	-1.0321	10	0.66056	D	0.02	-8.5894	5.4021	0.16301	0.2072:0.0:0.7928:0.0	.	105	Q00994	BEX3_HUMAN	N	95;105;105;95;105	ENSP00000354843:D95N;ENSP00000361728:D105N;ENSP00000361718:D105N;ENSP00000361717:D95N;ENSP00000299872:D105N	ENSP00000299872:D105N	D	+	1	0	NGFRAP1	102519388	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.055000	0.41345	0.807000	0.34208	0.600000	0.82982	GAT		0.413	NGFRAP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057709.1	NM_014380	
DDX26B	203522	broad.mit.edu	37	X	134713964	134713964	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chrX:134713964G>C	ENST00000370752.4	+	15	2594	c.2260G>C	c.(2260-2262)Gac>Cac	p.D754H	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	754								p.D754H(1)		large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					TGACCAAAAAGACCCAGTAGC	0.408																																					p.D754H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2260C	X						.						86.0	75.0	79.0					X																	134713964		2203	4300	6503	134541630	SO:0001583	missense	203522	exon15			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.2260G>C	X.37:g.134713964G>C	ENSP00000359788:p.Asp754His		134541630	NM_182540	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	37	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	G	2.709	-0.269306	0.05716	.	.	ENSG00000165359	ENST00000370752	T	0.30714	1.52	5.26	3.29	0.37713	.	1.433790	0.04600	N	0.398413	T	0.24353	0.0590	N	0.19112	0.55	0.09310	N	1	B;B	0.29162	0.235;0.023	B;B	0.32022	0.139;0.066	T	0.32798	-0.9893	10	0.45353	T	0.12	1.6869	7.3224	0.26536	0.1031:0.3334:0.5635:0.0	.	754;754	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	H	754	ENSP00000359788:D754H	ENSP00000359788:D754H	D	+	1	0	DDX26B	134541630	0.619000	0.27059	0.001000	0.08648	0.014000	0.08584	1.070000	0.30653	0.401000	0.25424	0.422000	0.28245	GAC		0.408	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540	
MCF2	4168	broad.mit.edu	37	X	138708819	138708819	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chrX:138708819G>A	ENST00000370576.4	-	5	744	c.535C>T	c.(535-537)Cat>Tat	p.H179Y	MCF2_ENST00000520602.1_Missense_Mutation_p.H239Y|MCF2_ENST00000414978.1_Missense_Mutation_p.H239Y|MCF2_ENST00000519895.1_Missense_Mutation_p.H239Y|MCF2_ENST00000370573.4_Missense_Mutation_p.H179Y|MCF2_ENST00000370578.4_Missense_Mutation_p.H324Y|MCF2_ENST00000536274.1_Missense_Mutation_p.H140Y|MCF2_ENST00000338585.6_Missense_Mutation_p.H179Y	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	179					apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H239Y(1)|p.H179Y(1)		NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					ATTTGCCGATGACATTCTAGT	0.338																																					p.H239Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C715T	X						.						166.0	154.0	158.0					X																	138708819		2203	4300	6503	138536485	SO:0001583	missense	4168	exon8				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.535C>T	X.37:g.138708819G>A	ENSP00000359608:p.His179Tyr		138536485	NM_001099855	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000370576.4	37	CCDS14667.1	.	.	.	.	.	.	.	.	.	.	g	11.96	1.795996	0.31777	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	4.98	0.958	0.19619	.	1.768580	0.02618	N	0.102868	T	0.33673	0.0871	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B;B;P;B	0.36874	0.002;0.13;0.001;0.001;0.004;0.001;0.572;0.002	B;B;B;B;B;B;B;B	0.40506	0.001;0.079;0.002;0.001;0.002;0.002;0.331;0.001	T	0.12116	-1.0560	10	0.11794	T	0.64	.	3.8763	0.09058	0.0857:0.1361:0.4944:0.2838	.	239;324;140;179;179;324;179;179	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	Y	239;179;140;324;239;239;179;179	ENSP00000427745:H239Y;ENSP00000359608:H179Y;ENSP00000438155:H140Y;ENSP00000359610:H324Y;ENSP00000397055:H239Y;ENSP00000430276:H239Y;ENSP00000359605:H179Y;ENSP00000342204:H179Y	ENSP00000342204:H179Y	H	-	1	0	MCF2	138536485	0.007000	0.16637	0.000000	0.03702	0.187000	0.23431	1.599000	0.36751	0.070000	0.16634	0.597000	0.82753	CAT		0.338	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058560.1	NM_005369	
CHDC2	286464	broad.mit.edu	37	X	36091288	36091288	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chrX:36091288G>A	ENST00000313548.4	+	4	409	c.223G>A	c.(223-225)Gat>Aat	p.D75N		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	75						integral component of membrane (GO:0016021)		p.D75N(1)									TTTGCACTTGGATGAAAGTGA	0.353																																					p.D75N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G223A	X						.						68.0	63.0	65.0					X																	36091288		2202	4300	6502	36001209	SO:0001583	missense	286464	exon4			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.223G>A	X.37:g.36091288G>A	ENSP00000324767:p.Asp75Asn		36001209	NM_173695		Missense_Mutation	SNP	ENST00000313548.4	37	CCDS14238.1	.	.	.	.	.	.	.	.	.	.	G	7.741	0.701356	0.15172	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	4.74	0.511	0.16989	.	1.299200	0.05535	N	0.564651	T	0.17577	0.0422	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.22941	-1.0202	9	0.17369	T	0.5	-0.1147	5.2102	0.15312	0.3206:0.1677:0.5116:0.0	.	75	Q8N9S7	CX059_HUMAN	N	75	.	ENSP00000324767:D75N	D	+	1	0	CXorf59	36001209	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.212000	0.02994	0.007000	0.14760	-0.344000	0.07964	GAT		0.353	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173695	
L1CAM	3897	broad.mit.edu	37	X	153136382	153136382	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chrX:153136382G>A	ENST00000370060.1	-	7	746	c.557C>T	c.(556-558)aCg>aTg	p.T186M	L1CAM_ENST00000361699.4_Missense_Mutation_p.T186M|L1CAM_ENST00000543994.1_Missense_Mutation_p.T188M|L1CAM_ENST00000361981.3_Missense_Mutation_p.T181M|L1CAM_ENST00000370057.3_Missense_Mutation_p.T186M|L1CAM_ENST00000538883.1_Missense_Mutation_p.T188M|L1CAM_ENST00000370055.1_Missense_Mutation_p.T181M	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	186	Ig-like C2-type 2.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)	p.T186M(2)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCCCATCGTCACCCGCTC	0.607																																					p.T181M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C542T	X						.						227.0	156.0	180.0					X																	153136382		2203	4300	6503	152789576	SO:0001583	missense	3897	exon5			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.557C>T	X.37:g.153136382G>A	ENSP00000359077:p.Thr186Met		152789576	NM_001143963	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	37	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.233009	0.39498	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000540065;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	4.57	4.57	0.56435	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.211607	0.32703	N	0.005742	T	0.74884	0.3775	L	0.52011	1.625	0.29094	N	0.881934	P;P;P	0.40230	0.66;0.66;0.708	B;B;B	0.41917	0.254;0.254;0.37	T	0.72587	-0.4248	10	0.37606	T	0.19	.	15.4841	0.75551	0.0:0.0:1.0:0.0	.	181;186;186	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	M	186;188;186;188;181;56;181;186	ENSP00000359077:T186M;ENSP00000438430:T188M;ENSP00000359074:T186M;ENSP00000439645:T188M;ENSP00000354712:T181M;ENSP00000359072:T181M;ENSP00000355380:T186M	ENSP00000355380:T186M	T	-	2	0	L1CAM	152789576	0.038000	0.19896	0.814000	0.32528	0.715000	0.41141	1.932000	0.40143	2.253000	0.74438	0.436000	0.28706	ACG		0.607	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
MERTK	10461	broad.mit.edu	37	2	112686937	112686937	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr2:112686937G>T	ENST00000295408.4	+	2	559	c.302G>T	c.(301-303)gGa>gTa	p.G101V	RN7SL297P_ENST00000483161.2_RNA|MERTK_ENST00000409780.1_Intron|MERTK_ENST00000421804.2_Missense_Mutation_p.G101V			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	101	Ig-like C2-type 1.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G101V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						CACACAGTTGGACACATAATA	0.448																																					p.G101V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G302T	2						.						106.0	97.0	100.0					2																	112686937		2203	4300	6503	112403408	SO:0001583	missense	10461	exon2			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.302G>T	2.37:g.112686937G>T	ENSP00000295408:p.Gly101Val		112403408	NM_006343	Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.524408	0.44969	.	.	ENSG00000153208	ENST00000295408;ENST00000421804	T;T	0.66638	-0.22;-0.22	4.13	4.13	0.48395	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.000000	0.33477	U	0.004872	T	0.74268	0.3694	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.69480	-0.5134	10	0.08179	T	0.78	-17.8289	13.7598	0.62959	0.0:0.0:1.0:0.0	.	101	Q12866	MERTK_HUMAN	V	101	ENSP00000295408:G101V;ENSP00000389152:G101V	ENSP00000295408:G101V	G	+	2	0	MERTK	112403408	1.000000	0.71417	0.992000	0.48379	0.255000	0.26057	4.853000	0.62911	2.277000	0.76020	0.557000	0.71058	GGA		0.448	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MBD5	55777	broad.mit.edu	37	2	149247655	149247655	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr2:149247655G>T	ENST00000407073.1	+	12	4752	c.3755G>T	c.(3754-3756)aGa>aTa	p.R1252I	MBD5_ENST00000404807.1_Missense_Mutation_p.R1485I	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	1252					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.R1252I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		TTACCACCAAGAAACTGTCCA	0.423																																					p.R1252I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3755T	2						.						68.0	69.0	68.0					2																	149247655		2203	4300	6503	148964125	SO:0001583	missense	55777	exon12			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.3755G>T	2.37:g.149247655G>T	ENSP00000386049:p.Arg1252Ile		148964125	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	ENST00000407073.1	37	CCDS33302.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845499	0.32606	.	.	ENSG00000204406	ENST00000407073;ENST00000404807	T;T	0.50813	0.73;0.77	6.11	4.32	0.51571	.	0.163883	0.44097	D	0.000498	T	0.45155	0.1328	N	0.24115	0.695	0.48288	D	0.99962	D;D	0.60160	0.987;0.987	P;P	0.52217	0.693;0.693	T	0.47898	-0.9081	10	0.87932	D	0	-8.0632	13.2067	0.59800	0.129:0.0:0.871:0.0	.	1485;1252	E9PHH0;Q9P267	.;MBD5_HUMAN	I	1252;1485	ENSP00000386049:R1252I;ENSP00000384672:R1485I	ENSP00000384672:R1485I	R	+	2	0	MBD5	148964125	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.811000	0.75221	0.922000	0.37019	0.655000	0.94253	AGA		0.423	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
NABP1	64859	broad.mit.edu	37	2	192543403	192543403	+	Silent	SNP	A	A	G			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr2:192543403A>G	ENST00000425611.2	+	1	146	c.63A>G	c.(61-63)ttA>ttG	p.L21L	NABP1_ENST00000409510.1_Intron|NABP1_ENST00000410026.2_Intron	NM_001031716.2	NP_001026886.1	Q96AH0	SOSB2_HUMAN	nucleic acid binding protein 1	21					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SOSS complex (GO:0070876)	RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L21L(1)									TGAAAAACTTAAATGTCGTCT	0.557																																					p.L21L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A63G	2						.						42.0	50.0	47.0					2																	192543403		2203	4300	6503	192251648	SO:0001819	synonymous_variant	64859	exon1			BC017114	CCDS33352.1, CCDS58745.1	2q32.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000173559	ENSG00000173559			26232	protein-coding gene	gene with protein product	"""single-stranded DNA-binding protein 2"", ""sensor of single-strand DNA complex subunit B2"""	612103	"""oligonucleotide/oligosaccharide-binding fold containing 2A"""	OBFC2A			Standard	NM_001031716		Approved	FLJ22833, DKFZp667M1322, FLJ13624, MGC111163, SSB2, hSSB2, SOSS-B2	uc002usx.3	Q96AH0	OTTHUMG00000132720	ENST00000425611.2:c.63A>G	2.37:g.192543403A>G			192251648	NM_001031716	Q658Y8|Q9H5X6	Silent	SNP	ENST00000425611.2	37	CCDS33352.1																																																																																				0.557	NABP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256060.1	NM_022837	
EPHA4	2043	broad.mit.edu	37	2	222294696	222294696	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr2:222294696G>A	ENST00000281821.2	-	15	2713	c.2672C>T	c.(2671-2673)aCa>aTa	p.T891I	EPHA4_ENST00000409854.1_Missense_Mutation_p.T891I|EPHA4_ENST00000392071.4_Missense_Mutation_p.T840I|EPHA4_ENST00000409938.1_Missense_Mutation_p.T891I	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	891					adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.T891I(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CTCCGTCCCTGTCCTCTTCAA	0.493																																					p.T891I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2672T	2						.						198.0	195.0	196.0					2																	222294696		2203	4300	6503	222002940	SO:0001583	missense	2043	exon15			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2672C>T	2.37:g.222294696G>A	ENSP00000281821:p.Thr891Ile		222002940	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	37	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202211	0.38905	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	5.93	5.93	0.95920	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.40743	0.1129	N	0.21545	0.675	0.80722	D	1	P	0.40398	0.716	B	0.27887	0.084	T	0.31251	-0.9950	10	0.18276	T	0.48	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	891	P54764	EPHA4_HUMAN	I	891;891;891;840	ENSP00000281821:T891I;ENSP00000386276:T891I;ENSP00000386829:T891I;ENSP00000375923:T840I	ENSP00000281821:T891I	T	-	2	0	EPHA4	222002940	1.000000	0.71417	0.991000	0.47740	0.948000	0.59901	9.869000	0.99810	2.826000	0.97356	0.655000	0.94253	ACA		0.493	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
PPP1CB	5500	broad.mit.edu	37	2	28999821	28999821	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr2:28999821G>A	ENST00000395366.2	+	2	429	c.157G>A	c.(157-159)Gaa>Aaa	p.E53K	PPP1CB_ENST00000358506.2_Missense_Mutation_p.E53K|PPP1CB_ENST00000296122.6_Missense_Mutation_p.E53K	NM_002709.2	NP_002700.1	P62140	PP1B_HUMAN	protein phosphatase 1, catalytic subunit, beta isozyme	53					cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|G2/M transition of mitotic cell cycle (GO:0000086)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|myosin phosphatase activity (GO:0017018)|myosin-light-chain-phosphatase activity (GO:0050115)|phosphatase activity (GO:0016791)|protein kinase binding (GO:0019901)	p.E53K(1)		cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					TATTCTTTTGGAATTGGAAGC	0.408																																					p.E53K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G157A	2						.						138.0	140.0	139.0					2																	28999821		2203	4300	6503	28853325	SO:0001583	missense	5500	exon3				CCDS33169.1	2p23	2013-01-18	2010-03-05		ENSG00000213639	ENSG00000213639	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9282	protein-coding gene	gene with protein product		600590	"""protein phosphatase 1, catalytic subunit, beta isoform"""			8312365	Standard	NM_002709		Approved	PP1B, PP-1B, PP1beta	uc002rmg.3	P62140	OTTHUMG00000152011	ENST00000395366.2:c.157G>A	2.37:g.28999821G>A	ENSP00000378769:p.Glu53Lys		28853325	NM_206876	B2R5V4|D6W565|P37140|Q5U087|Q6FG45	Missense_Mutation	SNP	ENST00000395366.2	37	CCDS33169.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.963271	0.92791	.	.	ENSG00000213639	ENST00000455580;ENST00000420282;ENST00000441461;ENST00000358506;ENST00000296122;ENST00000395366	T;T;T;T;T;T	0.46451	3.38;0.88;0.87;3.38;3.38;3.38	5.36	5.36	0.76844	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.85682	D	0.000000	T	0.55146	0.1902	M	0.92833	3.35	0.80722	D	1	P;B	0.35507	0.506;0.018	B;B	0.29440	0.102;0.02	T	0.67593	-0.5631	10	0.72032	D	0.01	-18.8464	19.4592	0.94910	0.0:0.0:1.0:0.0	.	25;53	B4E163;P62140	.;PP1B_HUMAN	K	25;53;53;53;53;53	ENSP00000390715:E25K;ENSP00000398839:E53K;ENSP00000414918:E53K;ENSP00000351298:E53K;ENSP00000296122:E53K;ENSP00000378769:E53K	ENSP00000296122:E53K	E	+	1	0	PPP1CB	28853325	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.656000	0.90262	0.655000	0.94253	GAA		0.408	PPP1CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324841.1		
ANKMY1	51281	broad.mit.edu	37	2	241463532	241463532	+	Silent	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr2:241463532C>G	ENST00000272972.3	-	7	1549	c.1335G>C	c.(1333-1335)gtG>gtC	p.V445V	ANKMY1_ENST00000405002.1_Silent_p.V215V|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000406958.1_Intron|ANKMY1_ENST00000536462.1_Silent_p.V257V|ANKMY1_ENST00000405523.3_Silent_p.V304V|ANKMY1_ENST00000361678.4_Silent_p.V304V|ANKMY1_ENST00000373318.2_Silent_p.V304V|ANKMY1_ENST00000403283.1_Silent_p.V383V|ANKMY1_ENST00000401804.1_Silent_p.V534V|ANKMY1_ENST00000391987.1_Silent_p.V445V|ANKMY1_ENST00000373320.4_Silent_p.V215V	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	445							metal ion binding (GO:0046872)	p.V445V(1)		central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GCCCGCTTTCCACATGGCCAA	0.597																																					p.V445V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1335C	2						.						97.0	86.0	89.0					2																	241463532		2203	4300	6503	241112205	SO:0001819	synonymous_variant	51281	exon7			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1335G>C	2.37:g.241463532C>G			241112205	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	ENST00000272972.3	37	CCDS2536.1																																																																																				0.597	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
PLIN2	123	broad.mit.edu	37	9	19126236	19126236	+	Silent	SNP	G	G	C			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr9:19126236G>C	ENST00000276914.2	-	3	281	c.102C>G	c.(100-102)ctC>ctG	p.L34L	PLIN2_ENST00000411567.1_Silent_p.L34L|PLIN2_ENST00000380465.3_Silent_p.L34L|PLIN2_ENST00000380464.3_Silent_p.L34L	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	34					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L34L(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						CCTTTGTACTGAGATAGGCTG	0.537																																					p.L34L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C102G	9						.						172.0	130.0	144.0					9																	19126236		2203	4300	6503	19116236	SO:0001819	synonymous_variant	123	exon3			X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.102C>G	9.37:g.19126236G>C			19116236	NM_001122	Q9BSC3	Silent	SNP	ENST00000276914.2	37	CCDS6490.1																																																																																				0.537	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
DIAPH3	81624	broad.mit.edu	37	13	60435600	60435600	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr13:60435600T>A	ENST00000400324.4	-	22	2898	c.2678A>T	c.(2677-2679)aAg>aTg	p.K893M	DIAPH3_ENST00000267215.4_Missense_Mutation_p.K893M|DIAPH3_ENST00000400330.1_Missense_Mutation_p.K893M|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400319.1_Missense_Mutation_p.K823M|DIAPH3_ENST00000400320.1_Missense_Mutation_p.K847M|DIAPH3_ENST00000377908.2_Missense_Mutation_p.K882M	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	893	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.K893M(1)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		ATCAGGGTACTTCTCTTCACA	0.363																																					p.K630M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1889T	13						.						146.0	135.0	138.0					13																	60435600		1831	4081	5912	59333601	SO:0001583	missense	81624	exon16			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2678A>T	13.37:g.60435600T>A	ENSP00000383178:p.Lys893Met		59333601	NM_030932	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	ENST00000400324.4	37	CCDS41898.1	.	.	.	.	.	.	.	.	.	.	T	19.04	3.750895	0.69533	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	T;T;T;T;T;T	0.67171	-0.25;-0.25;-0.25;-0.25;-0.25;2.03	5.38	5.38	0.77491	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.163603	0.53938	D	0.000041	T	0.79610	0.4475	M	0.85542	2.76	0.36914	D	0.891026	D;D;D	0.62365	0.991;0.96;0.975	P;P;P	0.61722	0.893;0.844;0.807	D	0.85185	0.1006	10	0.87932	D	0	.	8.7342	0.34519	0.0:0.1481:0.0:0.8519	.	630;630;893	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	M	893;893;882;847;823;882;823;847;893;630;893	ENSP00000383178:K893M;ENSP00000383184:K893M;ENSP00000367141:K882M;ENSP00000383173:K823M;ENSP00000383174:K847M;ENSP00000267215:K893M	ENSP00000267214:K630M	K	-	2	0	DIAPH3	59333601	0.992000	0.36948	0.999000	0.59377	0.980000	0.70556	2.462000	0.45049	2.051000	0.60960	0.459000	0.35465	AAG		0.363	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
DIS3	22894	broad.mit.edu	37	13	73335921	73335921	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr13:73335921C>T	ENST00000377767.4	-	18	2474	c.2374G>A	c.(2374-2376)Gct>Act	p.A792T	DIS3_ENST00000377780.4_Missense_Mutation_p.A762T|DIS3_ENST00000545453.1_Missense_Mutation_p.A630T	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	792					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.A792T(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		ATAGCCACAGCCAAAAGCCGA	0.363										Multiple Myeloma(4;0.011)																											p.A762T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2284A	13						.						91.0	87.0	89.0					13																	73335921		2203	4300	6503	72233922	SO:0001583	missense	22894	exon18			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2374G>A	13.37:g.73335921C>T	ENSP00000366997:p.Ala792Thr		72233922	NM_001128226	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	ENST00000377767.4	37	CCDS9447.1	.	.	.	.	.	.	.	.	.	.	C	36	5.690863	0.96793	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.35236	1.32;1.32;1.32	5.96	5.96	0.96718	Ribonuclease II/R (2);	0.187742	0.56097	N	0.000026	T	0.56804	0.2010	L	0.53249	1.67	0.80722	D	1	D;P	0.60160	0.987;0.951	D;P	0.65233	0.933;0.895	T	0.49960	-0.8883	10	0.48119	T	0.1	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	762;792	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	T	792;762;630	ENSP00000366997:A792T;ENSP00000367011:A762T;ENSP00000440058:A630T	ENSP00000366997:A792T	A	-	1	0	DIS3	72233922	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.582000	0.82546	2.832000	0.97577	0.655000	0.94253	GCT		0.363	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045250.2	NM_014953	
FARP1	10160	broad.mit.edu	37	13	99020390	99020390	+	Silent	SNP	T	T	G			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr13:99020390T>G	ENST00000319562.6	+	5	604	c.339T>G	c.(337-339)gtT>gtG	p.V113V	FARP1_ENST00000376586.2_Silent_p.V113V|FARP1_ENST00000595437.1_Silent_p.V113V	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	113	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.V113V(2)		breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ACGTTGTTGTTAAGTTTGTGG	0.358																																					p.V113V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T339G	13						.						100.0	91.0	94.0					13																	99020390		2203	4300	6503	97818391	SO:0001819	synonymous_variant	10160	exon5			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.339T>G	13.37:g.99020390T>G			97818391	NM_005766	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	37	CCDS9487.1																																																																																				0.358	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
MCM10	55388	broad.mit.edu	37	10	13251284	13251284	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3890-01	TCGA-AG-3890-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr10:13251284G>A	ENST00000484800.2	+	20	2705	c.2602G>A	c.(2602-2604)Gct>Act	p.A868T	MCM10_ENST00000378714.3_Missense_Mutation_p.A867T|MCM10_ENST00000378694.1_3'UTR			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	868					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.A868T(1)		central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						AGAAGAACATGCTAAATTTCT	0.398																																					p.A867T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2599A	10						.						100.0	96.0	98.0					10																	13251284		2203	4300	6503	13291290	SO:0001583	missense	55388	exon20			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2602G>A	10.37:g.13251284G>A	ENSP00000418268:p.Ala868Thr		13291290	NM_018518	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339179	0.60963	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800	T;T	0.15139	2.45;2.45	5.38	4.46	0.54185	Replication factor Mcm10 (1);	0.439235	0.26328	N	0.025011	T	0.26810	0.0656	L	0.51422	1.61	0.26993	N	0.965101	P;P	0.49358	0.905;0.923	P;P	0.51135	0.529;0.66	T	0.03662	-1.1015	10	0.38643	T	0.18	-12.4486	16.3696	0.83350	0.0:0.1852:0.8148:0.0	.	867;868	Q7L590-2;Q7L590	.;MCM10_HUMAN	T	867;868;868	ENSP00000367986:A867T;ENSP00000418268:A868T	ENSP00000354945:A868T	A	+	1	0	MCM10	13291290	0.999000	0.42202	0.996000	0.52242	0.965000	0.64279	1.947000	0.40293	2.512000	0.84698	0.561000	0.74099	GCT		0.398	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
PCDH15	65217	broad.mit.edu	37	10	55582386	55582386	+	Silent	SNP	A	A	G			TCGA-AG-3890-01	TCGA-AG-3890-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr10:55582386A>G	ENST00000320301.6	-	33	5494	c.5100T>C	c.(5098-5100)ctT>ctC	p.L1700L	PCDH15_ENST00000395433.1_Silent_p.L1677L|PCDH15_ENST00000395432.2_Silent_p.L1660L|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395430.1_Silent_p.L1697L|PCDH15_ENST00000437009.1_Silent_p.L1631L|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000361849.3_Silent_p.L1702L|PCDH15_ENST00000373957.3_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1700					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.L1700L(1)|p.L1707L(1)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTGAAGGAGAAAGTTCCAAGG	0.383										HNSCC(58;0.16)																											p.L1660L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T4980C	10						.						106.0	105.0	105.0					10																	55582386		2203	4300	6503	55252392	SO:0001819	synonymous_variant	65217	exon31			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.5100T>C	10.37:g.55582386A>G			55252392	NM_001142767	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	ENST00000320301.6	37	CCDS7248.1																																																																																				0.383	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
MCMBP	79892	broad.mit.edu	37	10	121596417	121596417	+	Silent	SNP	T	T	C			TCGA-AG-3890-01	TCGA-AG-3890-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr10:121596417T>C	ENST00000360003.3	-	13	1708	c.1539A>G	c.(1537-1539)tcA>tcG	p.S513S	MCMBP_ENST00000369077.3_Silent_p.S511S|MCMBP_ENST00000466047.1_5'UTR	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein	513					DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.S513S(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						CCGGGAGGAGTGACCTCCCCT	0.413																																					p.S513S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1539G	10						.						100.0	92.0	95.0					10																	121596417		2203	4300	6503	121586407	SO:0001819	synonymous_variant	79892	exon13			BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159	ENST00000360003.3:c.1539A>G	10.37:g.121596417T>C			121586407	NM_024834	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Silent	SNP	ENST00000360003.3	37	CCDS7617.1																																																																																				0.413	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834	
ZNF474	133923	broad.mit.edu	37	5	121488577	121488577	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr5:121488577C>T	ENST00000296600.4	+	2	1275	c.892C>T	c.(892-894)Cgc>Tgc	p.R298C	ZNF474_ENST00000514925.1_Intron|CTC-441N14.1_ENST00000505209.1_RNA|CTC-441N14.2_ENST00000504829.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	298							metal ion binding (GO:0046872)	p.R298C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		TACCTCAGACCGCCTCCTGGT	0.473																																					p.R298C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C892T	5						.						74.0	67.0	69.0					5																	121488577		2203	4300	6503	121516476	SO:0001583	missense	133923	exon2			AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.892C>T	5.37:g.121488577C>T	ENSP00000296600:p.Arg298Cys		121516476	NM_207317	A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	C	2.728	-0.265168	0.05754	.	.	ENSG00000164185	ENST00000296600	T	0.58652	0.32	5.43	0.555	0.17247	.	0.128918	0.33309	U	0.005046	T	0.49474	0.1559	M	0.75615	2.305	0.09310	N	1	B	0.18166	0.026	B	0.19148	0.024	T	0.49380	-0.8946	10	0.66056	D	0.02	-7.0257	2.6977	0.05139	0.1282:0.5301:0.1243:0.2174	.	298	Q6S9Z5	ZN474_HUMAN	C	298	ENSP00000296600:R298C	ENSP00000296600:R298C	R	+	1	0	ZNF474	121516476	0.008000	0.16893	0.000000	0.03702	0.027000	0.11550	0.586000	0.23894	-0.200000	0.10300	-0.736000	0.03550	CGC		0.473	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317	
SREK1IP1	285672	broad.mit.edu	37	5	64023970	64023970	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr5:64023970C>G	ENST00000513458.4	-	4	409	c.242G>C	c.(241-243)aGc>aCc	p.S81T		NM_173829.3	NP_776190.1	Q8N9Q2	SR1IP_HUMAN	SREK1-interacting protein 1	81	Lys-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)		nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S81T(1)		breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6						tttttctttgcttttttcttt	0.274																																					p.S81T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G242C	5						.																																			64059726	SO:0001583	missense	285672	exon4			AK094073	CCDS34171.1	5q12.3	2010-09-20	2010-09-20	2010-09-20	ENSG00000153006	ENSG00000153006			26716	protein-coding gene	gene with protein product	"""p18 splicing regulatory protein"""		"""SFRS12-interacting protein 1"""	SFRS12IP1		15456940	Standard	NM_173829		Approved	FLJ36754, P18SRP	uc003jtk.3	Q8N9Q2	OTTHUMG00000162291	ENST00000513458.4:c.242G>C	5.37:g.64023970C>G	ENSP00000427401:p.Ser81Thr		64059726	NM_173829	Q32NC8	Missense_Mutation	SNP	ENST00000513458.4	37	CCDS34171.1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773941	0.31411	.	.	ENSG00000153006	ENST00000513458	.	.	.	3.52	2.64	0.31445	.	0.791346	0.12361	N	0.475606	T	0.40145	0.1105	L	0.54323	1.7	0.29924	N	0.822514	P	0.43392	0.805	P	0.45506	0.483	T	0.25502	-1.0130	9	0.20046	T	0.44	-4.3379	8.3881	0.32512	0.2334:0.7666:0.0:0.0	.	81	Q8N9Q2	SR1IP_HUMAN	T	81	.	ENSP00000427401:S81T	S	-	2	0	SREK1IP1	64059726	0.990000	0.36364	1.000000	0.80357	0.994000	0.84299	-0.012000	0.12699	1.054000	0.40438	-0.152000	0.13540	AGC		0.274	SREK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368457.4	NM_173829	
APC	324	broad.mit.edu	37	5	112174093	112174093	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-3890-01	TCGA-AG-3890-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr5:112174093delT	ENST00000457016.1	+	16	3182	c.2802delT	c.(2800-2802)actfs	p.T934fs	APC_ENST00000257430.4_Frame_Shift_Del_p.T934fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.T934fs			P25054	APC_HUMAN	adenomatous polyposis coli	934	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Y935fs*5(1)|p.Y935fs*20(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ATTCAAACACTTACAATTTCA	0.363		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.T916fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	3	Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	large_intestine(2)|skin(1)	c.2748delT	5	GRCh37	CD041147|CD971993	APC	D		.						70.0	71.0	71.0					5																	112174093		2202	4300	6502	112201992	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2802delT	5.37:g.112174093delT	ENSP00000413133:p.Thr934fs		112201992	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.363	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
HMMR	3161	broad.mit.edu	37	5	162909781	162909781	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr5:162909781C>G	ENST00000358715.3	+	13	1552	c.1516C>G	c.(1516-1518)Caa>Gaa	p.Q506E	RP11-80G7.1_ENST00000521666.1_RNA|HMMR_ENST00000353866.3_Missense_Mutation_p.Q491E|RP11-80G7.1_ENST00000514724.2_RNA|HMMR_ENST00000393915.4_Missense_Mutation_p.Q507E|HMMR_ENST00000432118.2_Missense_Mutation_p.Q420E			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	506					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)	p.Q506E(1)		cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	GAGCTCAAATCAAGAATATGT	0.403																																					p.Q491E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1471G	5						.						73.0	73.0	73.0					5																	162909781		2203	4300	6503	162842359	SO:0001583	missense	3161	exon12			U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1516C>G	5.37:g.162909781C>G	ENSP00000351554:p.Gln506Glu		162842359	NM_012485	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	C	5.461	0.270129	0.10349	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.08807	3.05;3.05;3.05;3.05;3.05	5.43	3.52	0.40303	.	0.212390	0.47852	N	0.000209	T	0.04998	0.0134	N	0.19112	0.55	0.26795	N	0.969329	B;B;B;B	0.19200	0.023;0.034;0.029;0.029	B;B;B;B	0.18871	0.022;0.023;0.017;0.017	T	0.37596	-0.9699	10	0.02654	T	1	-6.4027	12.9493	0.58389	0.0:0.4758:0.5242:0.0	.	420;507;491;506	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	E	392;491;507;483;420;506	ENSP00000400527:Q392E;ENSP00000185942:Q491E;ENSP00000377492:Q507E;ENSP00000402673:Q420E;ENSP00000351554:Q506E	ENSP00000185942:Q491E	Q	+	1	0	HMMR	162842359	0.992000	0.36948	0.938000	0.37757	0.771000	0.43674	1.054000	0.30455	1.405000	0.46838	0.650000	0.86243	CAA		0.403	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484	
DNM1P46	196968	broad.mit.edu	37	15	100341255	100341255	+	RNA	SNP	C	C	T	rs75981261	byFrequency	TCGA-AG-3890-01	TCGA-AG-3890-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3890-01	TCGA-AG-3890-01	g.chr15:100341255C>T	ENST00000341853.1	-	0	391					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										ACCATGAGGTCCCACACGGTC	0.567																																					.												.	.	0			.	15						.						65.0	61.0	62.0					15																	100341255		1551	3571	5122	98158778			196968	.			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100341255C>T			98158778	.	Q3ZCN3	Missense_Mutation	SNP	ENST00000341853.1	37																																																																																					0.567	DNM1P46-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000313543.1	NR_003260	
