#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CDH12	1010	broad.mit.edu	37	5	22078605	22078606	+	Frame_Shift_Ins	INS	-	-	G	rs142320441	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:22078605_22078606insG	ENST00000382254.1	-	5	1266_1267	c.180_181insC	c.(178-183)caatttfs	p.F61fs	CDH12_ENST00000522262.1_Frame_Shift_Ins_p.F61fs|CDH12_ENST00000504376.2_Frame_Shift_Ins_p.F61fs	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F61fs*45(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AGCACAAAAAATTGATTCCATA	0.465										HNSCC(59;0.17)																											p.F61fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.181_182insC	5						.																																			22114363	SO:0001589	frameshift_variant	1010	exon5			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.180_181insC	5.37:g.22078605_22078606insG	ENSP00000371689:p.Phe61fs		22114362	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Frame_Shift_Ins	INS	ENST00000382254.1	37	CCDS3890.1																																																																																				0.465	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
LRCH4	4034	broad.mit.edu	37	7	100176019	100176020	+	Intron	INS	-	-	A			TCGA-AG-3894-01	TCGA-AG-3894-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:100176019_100176020insA	ENST00000310300.6	-	6	901				LRCH4_ENST00000497245.1_Intron	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4						nervous system development (GO:0007399)	PML body (GO:0016605)		p.?(1)		NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACCTAGGACTTACCAGGGACTG	0.634																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	7						.																																			100013956	SO:0001627	intron_variant	4034	.			AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.848+1->T	7.37:g.100176020_100176020dupA			100013955	.	A4D2D5|Q8WV85|Q96ID0	Splice_Site	INS	ENST00000310300.6	37	CCDS34706.1																																																																																				0.634	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356110.1	NM_002319	
CBS	875	broad.mit.edu	37	21	44476174	44476175	+	Intron	INS	-	-	C			TCGA-AG-3894-01	TCGA-AG-3894-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr21:44476174_44476175insC	ENST00000398165.3	-	16	1812				CBS_ENST00000544202.1_Intron|CBS_ENST00000359624.3_Intron|CBS_ENST00000352178.5_Intron|CBS_ENST00000398158.1_Intron|CBS_ENST00000398168.1_Frame_Shift_Ins_p.P530fs	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase						cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)	p.P530fs*23(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	CTACCTGCAGGCCCCCCCACCA	0.658																																					.												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	.	21						.																																			43349244	SO:0001627	intron_variant	875	.			L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.1552+737->G	21.37:g.44476181_44476181dupC			43349243	.	B2R993|D3DSK4|Q99425|Q9BWC5	Frame_Shift_Ins	INS	ENST00000398165.3	37	CCDS13693.1																																																																																				0.658	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195525.1	NM_000071	
MUC17	140453	broad.mit.edu	37	7	100677009	100677009	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:100677009C>G	ENST00000306151.4	+	3	2376	c.2312C>G	c.(2311-2313)cCt>cGt	p.P771R		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	771	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.P771R(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCAACAACTCCTCTTGACACA	0.478																																					p.P771R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2312G	7						.						282.0	285.0	284.0					7																	100677009		2203	4300	6503	100463729	SO:0001583	missense	140453	exon3			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2312C>G	7.37:g.100677009C>G	ENSP00000302716:p.Pro771Arg		100463729	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	1.547	-0.540294	0.04053	.	.	ENSG00000169876	ENST00000306151	T	0.03272	3.99	0.932	-0.342	0.12635	.	.	.	.	.	T	0.01835	0.0058	N	0.24115	0.695	0.09310	N	1	P	0.42993	0.797	B	0.31191	0.125	T	0.48927	-0.8991	9	0.17369	T	0.5	.	5.5733	0.17208	0.3215:0.6785:0.0:0.0	.	771	Q685J3	MUC17_HUMAN	R	771	ENSP00000302716:P771R	ENSP00000302716:P771R	P	+	2	0	MUC17	100463729	0.001000	0.12720	0.000000	0.03702	0.024000	0.10985	1.023000	0.30065	-0.073000	0.12842	0.134000	0.15878	CCT		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
DUS4L	11062	broad.mit.edu	37	7	107215731	107215731	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:107215731G>C	ENST00000265720.3	+	6	817	c.455G>C	c.(454-456)gGa>gCa	p.G152A	DUS4L_ENST00000402620.1_Missense_Mutation_p.G31A	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	152							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)	p.G152A(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						GAAACCCCTGGATTTTCAGTT	0.353																																					p.G152A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G455C	7						.						76.0	85.0	82.0					7																	107215731		2202	4300	6502	107002967	SO:0001583	missense	11062	exon6			U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.455G>C	7.37:g.107215731G>C	ENSP00000265720:p.Gly152Ala		107002967	NM_181581	B4DLX0|Q2NKK1	Missense_Mutation	SNP	ENST00000265720.3	37	CCDS5745.1	.	.	.	.	.	.	.	.	.	.	G	1.893	-0.454953	0.04540	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	T;T	0.32023	1.5;1.47	5.63	3.7	0.42460	Aldolase-type TIM barrel (1);	0.469692	0.26677	N	0.023067	T	0.21801	0.0525	L	0.51914	1.62	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.19946	0.027;0.027	T	0.20840	-1.0263	10	0.10111	T	0.7	.	5.6645	0.17687	0.1177:0.1252:0.6284:0.1287	.	152;152	A4D0R5;O95620	.;DUS4L_HUMAN	A	152;31	ENSP00000265720:G152A;ENSP00000385274:G31A	ENSP00000265720:G152A	G	+	2	0	DUS4L	107002967	0.990000	0.36364	0.993000	0.49108	0.344000	0.29017	2.135000	0.42112	2.805000	0.96524	0.655000	0.94253	GGA		0.353	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
SLC26A4	5172	broad.mit.edu	37	7	107314664	107314664	+	Silent	SNP	C	C	T	rs557892300		TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:107314664C>T	ENST00000265715.3	+	5	695	c.471C>T	c.(469-471)ccC>ccT	p.P157P		NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	157					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)	p.P157P(1)		central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						GCATGGCCCCCGACGAACACT	0.423									Pendred syndrome				C|||	1	0.000199681	0.0	0.0	5008	,	,		14887	0.0		0.0	False		,,,				2504	0.001				p.P157P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C471T	7						.						154.0	145.0	148.0					7																	107314664		2203	4300	6503	107101900	SO:0001819	synonymous_variant	5172	exon5	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.471C>T	7.37:g.107314664C>T			107101900	NM_000441	B7Z266|O43170	Silent	SNP	ENST00000265715.3	37	CCDS5746.1																																																																																				0.423	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337148.1	NM_000441	
GPR37	2861	broad.mit.edu	37	7	124404372	124404372	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:124404372G>C	ENST00000303921.2	-	1	1309	c.659C>G	c.(658-660)gCc>gGc	p.A220G		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	220					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)	p.A220G(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCCATTCTGGGCCAGCGCCCG	0.642																																					p.A220G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C659G	7						.						36.0	40.0	39.0					7																	124404372		2203	4300	6503	124191608	SO:0001583	missense	2861	exon1				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.659C>G	7.37:g.124404372G>C	ENSP00000306449:p.Ala220Gly		124191608	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	ENST00000303921.2	37	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238792	0.39598	.	.	ENSG00000170775	ENST00000303921	T	0.72051	-0.62	5.49	5.49	0.81192	.	0.117763	0.56097	D	0.000022	T	0.55768	0.1941	N	0.22421	0.69	0.25417	N	0.988303	B	0.06786	0.001	B	0.06405	0.002	T	0.30060	-0.9991	10	0.16420	T	0.52	-14.4855	14.8127	0.70008	0.0:0.0:1.0:0.0	.	220	O15354	GPR37_HUMAN	G	220	ENSP00000306449:A220G	ENSP00000306449:A220G	A	-	2	0	GPR37	124191608	0.798000	0.28890	1.000000	0.80357	0.904000	0.53231	1.606000	0.36826	2.872000	0.98467	0.638000	0.83543	GCC		0.642	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
PLXNA4	91584	broad.mit.edu	37	7	131853173	131853173	+	Silent	SNP	G	G	A	rs369419660		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:131853173G>A	ENST00000359827.3	-	22	5138	c.4176C>T	c.(4174-4176)acC>acT	p.T1392T	PLXNA4_ENST00000321063.4_Silent_p.T1392T			Q9HCM2	PLXA4_HUMAN	plexin A4	1392					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.T1392T(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TCTGCAGCACGGTCATGATGA	0.572																																					p.T1392T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C4176T	7						.	G		5,4401	9.9+/-24.2	0,5,2198	91.0	90.0	90.0		4176	-11.0	0.4	7		90	0,8600		0,0,4300	no	coding-synonymous	PLXNA4	NM_020911.1		0,5,6498	AA,AG,GG		0.0,0.1135,0.0384		1392/1895	131853173	5,13001	2203	4300	6503	131503713	SO:0001819	synonymous_variant	91584	exon22			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4176C>T	7.37:g.131853173G>A			131503713	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																				0.572	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
NEUROD6	63974	broad.mit.edu	37	7	31377932	31377932	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:31377932G>C	ENST00000297142.3	-	2	1273	c.951C>G	c.(949-951)gaC>gaG	p.D317E		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	317					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.D317E(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						GCAGATGTAAGTCGTAAGGGA	0.463																																					p.D317E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C951G	7						.						82.0	80.0	81.0					7																	31377932		2203	4300	6503	31344457	SO:0001583	missense	63974	exon2			AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.951C>G	7.37:g.31377932G>C	ENSP00000297142:p.Asp317Glu		31344457	NM_022728	Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	37	CCDS5434.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461642	0.43736	.	.	ENSG00000164600	ENST00000297142	D	0.96774	-4.12	5.13	4.23	0.50019	.	0.000000	0.85682	D	0.000000	D	0.93141	0.7816	L	0.46157	1.445	0.53688	D	0.999974	B	0.11235	0.004	B	0.10450	0.005	D	0.89208	0.3562	10	0.36615	T	0.2	-15.0027	9.9129	0.41417	0.0757:0.1407:0.7836:0.0	.	317	Q96NK8	NDF6_HUMAN	E	317	ENSP00000297142:D317E	ENSP00000297142:D317E	D	-	3	2	NEUROD6	31344457	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.836000	0.55813	1.117000	0.41842	0.650000	0.86243	GAC		0.463	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728	
WBSCR17	64409	broad.mit.edu	37	7	70800614	70800614	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:70800614C>G	ENST00000333538.5	+	2	951	c.317C>G	c.(316-318)gCt>gGt	p.A106G	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	106					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.A106G(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CTTTCCCCGGCTGAAGAAGAA	0.483																																					p.A106G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C317G	7						.						45.0	49.0	48.0					7																	70800614		2203	4300	6503	70438550	SO:0001583	missense	64409	exon2			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.317C>G	7.37:g.70800614C>G	ENSP00000329654:p.Ala106Gly		70438550	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	37	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	C	6.920	0.539400	0.13250	.	.	ENSG00000185274	ENST00000333538;ENST00000447516	T;T	0.55413	0.52;1.88	4.89	3.03	0.35002	.	0.357352	0.14576	U	0.311156	T	0.33381	0.0861	N	0.17872	0.535	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17137	-1.0379	10	0.33940	T	0.23	.	6.2244	0.20700	0.4635:0.4469:0.0:0.0896	.	106	Q6IS24	GLTL3_HUMAN	G	106;84	ENSP00000329654:A106G;ENSP00000392019:A84G	ENSP00000329654:A106G	A	+	2	0	WBSCR17	70438550	0.067000	0.21026	0.022000	0.16811	0.381000	0.30169	0.638000	0.24674	0.606000	0.29965	0.491000	0.48974	GCT		0.483	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
PEX1	5189	broad.mit.edu	37	7	92147524	92147524	+	Nonsense_Mutation	SNP	G	G	A	rs201415996		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:92147524G>A	ENST00000248633.4	-	4	498	c.403C>T	c.(403-405)Cga>Tga	p.R135*	PEX1_ENST00000438045.1_Intron|PEX1_ENST00000428214.1_Nonsense_Mutation_p.R135*|PEX1_ENST00000541751.1_5'Flank	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	135					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.R135*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AAAACTATTCGAATTTGATCT	0.353																																					p.R135X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C403T	7						.						100.0	98.0	99.0					7																	92147524		2203	4300	6503	91985460	SO:0001587	stop_gained	5189	exon4			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.403C>T	7.37:g.92147524G>A	ENSP00000248633:p.Arg135*		91985460	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Nonsense_Mutation	SNP	ENST00000248633.4	37	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	G	37	6.325113	0.97476	.	.	ENSG00000127980	ENST00000248633;ENST00000428214;ENST00000545192	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.3009	20.3397	0.98756	0.0:0.0:1.0:0.0	.	.	.	.	X	135	.	ENSP00000248633:R135X	R	-	1	2	PEX1	91985460	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.725000	0.54970	2.803000	0.96430	0.585000	0.79938	CGA		0.353	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
SAMD9L	219285	broad.mit.edu	37	7	92761965	92761965	+	Missense_Mutation	SNP	C	C	T	rs369116471		TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:92761965C>T	ENST00000318238.4	-	5	4536	c.3320G>A	c.(3319-3321)cGt>cAt	p.R1107H	SAMD9L_ENST00000437805.1_Missense_Mutation_p.R1107H|SAMD9L_ENST00000411955.1_Missense_Mutation_p.R1107H	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1107					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.R1107H(2)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTGGCCTGACGTGCCCAGTC	0.393																																					p.R1107H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G3320A	7						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	119.0	120.0	120.0		3320	1.2	0.0	7		120	0,8598		0,0,4299	no	missense	SAMD9L	NM_152703.2	29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	benign	1107/1585	92761965	1,13003	2203	4299	6502	92599901	SO:0001583	missense	219285	exon5			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3320G>A	7.37:g.92761965C>T	ENSP00000326247:p.Arg1107His		92599901	NM_152703	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	ENST00000318238.4	37	CCDS34681.1	.	.	.	.	.	.	.	.	.	.	C	4.282	0.051557	0.08291	2.27E-4	0.0	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.22539	1.95;1.95;1.95	5.02	1.16	0.20824	.	1.398570	0.04865	N	0.444851	T	0.10423	0.0255	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.29427	-1.0012	10	0.44086	T	0.13	-0.9941	1.8039	0.03076	0.1346:0.1566:0.1398:0.569	.	1107	Q8IVG5	SAM9L_HUMAN	H	1107	ENSP00000326247:R1107H;ENSP00000405760:R1107H;ENSP00000408796:R1107H	ENSP00000326247:R1107H	R	-	2	0	SAMD9L	92599901	0.000000	0.05858	0.005000	0.12908	0.118000	0.20060	0.265000	0.18515	0.037000	0.15575	-0.373000	0.07131	CGT		0.393	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341730.1	NM_152703	
ZNF3	7551	broad.mit.edu	37	7	99673177	99673177	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:99673177C>G	ENST00000424697.1	-	4	438	c.132G>C	c.(130-132)aaG>aaC	p.K44N	ZNF3_ENST00000303915.6_Missense_Mutation_p.K44N|ZNF3_ENST00000413658.2_Missense_Mutation_p.K44N|ZNF3_ENST00000299667.4_Missense_Mutation_p.K44N	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	44					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)	p.K44N(1)		NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			GGGACTTGGCCTTTAGGAGCG	0.507																																					p.K44N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G132C	7						.						73.0	80.0	77.0					7																	99673177		2040	4195	6235	99511113	SO:0001583	missense	7551	exon4			AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.132G>C	7.37:g.99673177C>G	ENSP00000415358:p.Lys44Asn		99511113	NM_017715	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Missense_Mutation	SNP	ENST00000424697.1	37	CCDS43619.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218940	0.58560	.	.	ENSG00000166526	ENST00000413658;ENST00000424697;ENST00000303915;ENST00000299667;ENST00000412947;ENST00000449785;ENST00000428683;ENST00000441298;ENST00000415068;ENST00000292393	T;T;T;T;T;T;T;T;T	0.06449	4.75;3.3;3.3;3.3;5.17;5.31;5.31;5.05;5.0	4.63	1.6	0.23607	Krueppel-associated box (1);	0.000000	0.42294	D	0.000740	T	0.13157	0.0319	L	0.43152	1.355	0.25354	N	0.988848	D;P	0.71674	0.998;0.939	D;P	0.76071	0.987;0.514	T	0.02925	-1.1093	10	0.87932	D	0	-17.7308	5.6783	0.17761	0.0:0.6469:0.0:0.3531	.	44;44	P17036;P17036-2	ZNF3_HUMAN;.	N	44;44;44;44;8;44;44;8;44;8	ENSP00000399951:K44N;ENSP00000415358:K44N;ENSP00000306372:K44N;ENSP00000299667:K44N;ENSP00000416088:K8N;ENSP00000405970:K44N;ENSP00000388042:K44N;ENSP00000394113:K8N;ENSP00000416686:K44N	ENSP00000292393:K8N	K	-	3	2	ZNF3	99511113	0.718000	0.27976	1.000000	0.80357	0.998000	0.95712	0.178000	0.16820	0.586000	0.29626	0.650000	0.86243	AAG		0.507	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336247.3	NM_017715	
TAS2R3	50831	broad.mit.edu	37	7	141464109	141464109	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:141464109C>T	ENST00000247879.2	+	1	213	c.151C>T	c.(151-153)Ctg>Ttg	p.L51L	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	51					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.L51L(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					CATCACCACCCTGGCACTCTT	0.398																																					p.L51L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C151T	7						.						252.0	243.0	246.0					7																	141464109		2203	4300	6503	141110578	SO:0001819	synonymous_variant	50831	exon1			AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.151C>T	7.37:g.141464109C>T			141110578	NM_016943	A4D1U2|Q645W2|Q75MV6	Silent	SNP	ENST00000247879.2	37	CCDS5867.1																																																																																				0.398	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349288.1		
ABCF2	10061	broad.mit.edu	37	7	150921944	150921944	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AG-3894-01	TCGA-AG-3894-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr7:150921944delA	ENST00000287844.2	-	3	394	c.285delT	c.(283-285)tttfs	p.F95fs	ABCF2_ENST00000222388.2_Frame_Shift_Del_p.F95fs|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	95	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)	p.H96fs*13(1)		breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTTGACCATGAAAGGTAAGTG	0.493																																					p.F95fs												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.285delT	7						.						122.0	108.0	113.0					7																	150921944		2203	4300	6503	150552877	SO:0001589	frameshift_variant	10061	exon3			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.285delT	7.37:g.150921944delA	ENSP00000287844:p.Phe95fs		150552877	NM_005692	O60864|Q75MJ0|Q75MJ1|Q96TE8	Frame_Shift_Del	DEL	ENST00000287844.2	37	CCDS5923.1																																																																																				0.493	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336086.1	NM_005692	
DEFB119	245932	broad.mit.edu	37	20	29976953	29976953	+	Intron	SNP	G	G	A	rs150443667	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr20:29976953G>A	ENST00000376321.3	-	1	181				DEFB119_ENST00000376315.2_Missense_Mutation_p.R48W|DEFB119_ENST00000492344.1_Intron|DEFB119_ENST00000339144.3_Intron	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119						defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)		p.R48W(2)|p.R48R(1)		large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			ACACAGCACCGTTTACGATTT	0.458													G|||	3	0.000599042	0.0023	0.0	5008	,	,		20150	0.0		0.0	False		,,,				2504	0.0				p.R48W												.	.	3	Substitution - Missense(2)|Substitution - coding silent(1)	large_intestine(1)|breast(1)|endometrium(1)	c.C142T	20						.	G	,TRP/ARG,	2,4404	4.2+/-10.8	0,2,2201	205.0	176.0	186.0		,142,	2.5	0.4	20	dbSNP_134	186	0,8600		0,0,4300	no	intron,missense,intron	DEFB119	NM_153289.2,NM_153323.3,NM_173460.1	,101,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,	,48/89,	29976953	2,13004	2203	4300	6503	29440614	SO:0001627	intron_variant	245932	exon2			AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.61+1272C>T	20.37:g.29976953G>A			29440614	NM_153323	Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Missense_Mutation	SNP	ENST00000376321.3	37	CCDS13178.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	26.1	4.700900	0.88924	4.54E-4	0.0	ENSG00000180483	ENST00000376315	T	0.11821	2.74	3.49	2.54	0.30619	.	1.825100	0.03092	N	0.159957	T	0.10981	0.0268	.	.	.	0.09310	N	0.999994	B	0.33549	0.417	B	0.23018	0.043	T	0.26744	-1.0094	9	0.87932	D	0	-4.3313	7.0046	0.24830	0.1256:0.0:0.8744:0.0	.	48	Q8N690-2	.	W	48	ENSP00000365492:R48W	ENSP00000365492:R48W	R	-	1	2	DEFB119	29440614	0.628000	0.27138	0.391000	0.26233	0.980000	0.70556	0.817000	0.27281	1.053000	0.40415	0.563000	0.77884	CGG		0.458	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078514.1	NM_153289	
SLC17A9	63910	broad.mit.edu	37	20	61597051	61597051	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr20:61597051C>T	ENST00000370351.4	+	10	1166	c.1035C>T	c.(1033-1035)tcC>tcT	p.S345S	SLC17A9_ENST00000370349.3_Silent_p.S339S|SLC17A9_ENST00000488738.1_3'UTR	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	345					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.S345S(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CATCAGCCTCCATCGGCCTCC	0.637																																					p.S345S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1035T	20						.						106.0	115.0	112.0					20																	61597051		2088	4215	6303	61067496	SO:0001819	synonymous_variant	63910	exon10			AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.1035C>T	20.37:g.61597051C>T			61067496	NM_022082	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Silent	SNP	ENST00000370351.4	37	CCDS42901.1																																																																																				0.637	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080100.1	NM_022082	
TOX4	9878	broad.mit.edu	37	14	21960730	21960730	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr14:21960730A>G	ENST00000405508.1	+	8	1231	c.955A>G	c.(955-957)Atg>Gtg	p.M319V	TOX4_ENST00000448790.2_Missense_Mutation_p.M296V|TOX4_ENST00000262709.3_Missense_Mutation_p.M319V			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	319						chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)	p.M319V(1)		large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		TCCACCTCCTATGGCTACTGT	0.473																																					p.M319V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A955G	14						.						125.0	118.0	121.0					14																	21960730		2203	4300	6503	21030570	SO:0001583	missense	9878	exon7			AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.955A>G	14.37:g.21960730A>G	ENSP00000385102:p.Met319Val		21030570	NM_014828	B4DPY8|B4DSM0|E7EV69	Missense_Mutation	SNP	ENST00000405508.1	37	CCDS32043.1	.	.	.	.	.	.	.	.	.	.	A	0.294	-0.978107	0.02197	.	.	ENSG00000092203	ENST00000405508;ENST00000262709;ENST00000448790;ENST00000545559	T;T;T	0.10382	2.88;2.88;2.88	4.8	-3.78	0.04333	.	0.972226	0.08534	N	0.931560	T	0.04363	0.0120	N	0.08118	0	0.22639	N	0.998902	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47471	-0.9115	10	0.13108	T	0.6	.	8.1372	0.31061	0.4001:0.1054:0.4945:0.0	.	296;319	B4DPY8;O94842	.;TOX4_HUMAN	V	319;319;296;247	ENSP00000385102:M319V;ENSP00000262709:M319V;ENSP00000393080:M296V	ENSP00000262709:M319V	M	+	1	0	TOX4	21030570	0.479000	0.25925	0.980000	0.43619	0.974000	0.67602	0.143000	0.16115	-0.711000	0.04995	0.397000	0.26171	ATG		0.473	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
USP18	11274	broad.mit.edu	37	22	18640570	18640570	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr22:18640570C>T	ENST00000215794.7	+	2	570	c.140C>T	c.(139-141)gCc>gTc	p.A47V		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	47					cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.A47V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						CGTCCCAGGGCCTGGGACTAC	0.557																																					p.A47V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C140T	22						.						101.0	99.0	100.0					22																	18640570		2203	4300	6503	17020570	SO:0001583	missense	11274	exon2			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.140C>T	22.37:g.18640570C>T	ENSP00000215794:p.Ala47Val		17020570	NM_017414	Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	ENST00000215794.7	37	CCDS13752.1	.	.	.	.	.	.	.	.	.	.	.	17.88	3.497655	0.64186	.	.	ENSG00000184979	ENST00000215794	T	0.06933	3.24	4.76	4.76	0.60689	.	0.764858	0.11957	N	0.513084	T	0.07143	0.0181	L	0.27053	0.805	0.26190	N	0.979593	P	0.35077	0.483	B	0.30943	0.122	T	0.25082	-1.0142	10	0.34782	T	0.22	.	13.4545	0.61191	0.0:1.0:0.0:0.0	.	47	Q9UMW8	UBP18_HUMAN	V	47	ENSP00000215794:A47V	ENSP00000215794:A47V	A	+	2	0	USP18	17020570	0.805000	0.28982	0.957000	0.39632	0.365000	0.29674	1.746000	0.38288	2.626000	0.88956	0.591000	0.81541	GCC		0.557	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316368.1		
BPIFC	254240	broad.mit.edu	37	22	32829708	32829708	+	Missense_Mutation	SNP	G	G	A	rs371535232		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr22:32829708G>A	ENST00000397452.1	-	10	1086	c.976C>T	c.(976-978)Cgg>Tgg	p.R326W	BPIFC_ENST00000534972.1_Missense_Mutation_p.R50W|BPIFC_ENST00000432451.2_Missense_Mutation_p.R140W|BPIFC_ENST00000300399.3_Missense_Mutation_p.R326W			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	326						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.R326W(1)									GCACTTACCCGGGAGAGCACG	0.418																																					p.R326W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C976T	22						.	G	TRP/ARG	0,4406		0,0,2203	99.0	93.0	95.0		976	1.2	0.9	22		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	BPIFC	NM_174932.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	326/508	32829708	1,13005	2203	4300	6503	31159708	SO:0001583	missense	254240	exon9			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.976C>T	22.37:g.32829708G>A	ENSP00000380594:p.Arg326Trp		31159708	NM_174932	A2RRF1	Missense_Mutation	SNP	ENST00000397452.1	37	CCDS13906.1	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511912	0.44660	0.0	1.16E-4	ENSG00000184459	ENST00000397452;ENST00000300399;ENST00000534972;ENST00000432451	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.75	1.23	0.21249	.	0.510840	0.21369	N	0.075663	T	0.06781	0.0173	L	0.44542	1.39	0.27177	N	0.960751	B;B	0.20780	0.048;0.038	B;B	0.15052	0.012;0.008	T	0.25012	-1.0144	10	0.62326	D	0.03	-0.2263	4.6379	0.12534	0.1646:0.0:0.5195:0.3159	.	140;326	A2RRF1;Q8NFQ6	.;BPIFC_HUMAN	W	326;326;50;140	ENSP00000380594:R326W;ENSP00000300399:R326W;ENSP00000439123:R50W;ENSP00000408920:R140W	ENSP00000300399:R326W	R	-	1	2	BPIFC	31159708	1.000000	0.71417	0.854000	0.33618	0.912000	0.54170	0.880000	0.28159	0.057000	0.16193	0.655000	0.94253	CGG		0.418	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129029.2	NM_174932	
CYP4F11	57834	broad.mit.edu	37	19	16038110	16038110	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr19:16038110C>T	ENST00000402119.4	-	4	863	c.437G>A	c.(436-438)cGc>cAc	p.R146H	CYP4F11_ENST00000248041.8_Missense_Mutation_p.R146H|CYP4F11_ENST00000326742.8_Missense_Mutation_p.R146H|CYP4F11_ENST00000591841.1_5'UTR	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11									p.R146H(1)		NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						CCGACGGTGGCGGCTCCACTT	0.527																																					p.R146H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437A	19						.						88.0	86.0	87.0					19																	16038110		2203	4300	6503	15899110	SO:0001583	missense	57834	exon5			AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.437G>A	19.37:g.16038110C>T	ENSP00000384588:p.Arg146His		15899110	NM_001128932		Missense_Mutation	SNP	ENST00000402119.4	37	CCDS12337.1	.	.	.	.	.	.	.	.	.	.	c	7.904	0.734949	0.15574	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	T;T;T	0.69306	-0.39;-0.39;-0.39	2.57	0.0749	0.14397	.	0.084182	0.49305	U	0.000143	T	0.53384	0.1793	L	0.55103	1.725	0.47862	D	0.999532	P;B	0.34757	0.467;0.075	B;B	0.33846	0.171;0.104	T	0.39354	-0.9618	10	0.44086	T	0.13	.	5.2688	0.15613	0.0:0.5083:0.0:0.4917	.	146;146	F8W978;Q9HBI6	.;CP4FB_HUMAN	H	146	ENSP00000384588:R146H;ENSP00000248041:R146H;ENSP00000319859:R146H	ENSP00000248041:R146H	R	-	2	0	CYP4F11	15899110	0.426000	0.25506	0.991000	0.47740	0.429000	0.31625	-0.189000	0.09629	-0.020000	0.14032	0.298000	0.19748	CGC		0.527	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460385.2	NM_021187	
ZNF43	7594	broad.mit.edu	37	19	21990430	21990430	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr19:21990430T>G	ENST00000354959.4	-	4	2578	c.2409A>C	c.(2407-2409)caA>caC	p.Q803H	ZNF43_ENST00000598381.1_Missense_Mutation_p.Q797H|ZNF43_ENST00000594012.1_Missense_Mutation_p.Q797H|ZNF43_ENST00000595461.1_Missense_Mutation_p.Q797H	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	803					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q803H(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTGAAAAAGTTTGAGGTGTTG	0.313																																					p.Q803H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2409C	19						.						37.0	39.0	38.0					19																	21990430		2202	4296	6498	21782270	SO:0001583	missense	7594	exon4			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2409A>C	19.37:g.21990430T>G	ENSP00000347045:p.Gln803His		21782270	NM_003423	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	ENST00000354959.4	37	CCDS12413.2	.	.	.	.	.	.	.	.	.	.	T	2.727	-0.265316	0.05754	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.05081	3.5	1.76	-1.36	0.09085	.	.	.	.	.	T	0.03959	0.0111	N	0.25245	0.725	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41752	-0.9491	9	0.62326	D	0.03	.	3.2116	0.06685	0.2288:0.0:0.4586:0.3126	.	803	P17038	ZNF43_HUMAN	H	802;803	ENSP00000347045:Q803H	ENSP00000347045:Q803H	Q	-	3	2	ZNF43	21782270	0.000000	0.05858	0.001000	0.08648	0.116000	0.19942	-4.105000	0.00294	-0.057000	0.13199	0.254000	0.18369	CAA		0.313	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
SLC7A9	11136	broad.mit.edu	37	19	33355008	33355008	+	Missense_Mutation	SNP	C	C	T	rs140134166	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr19:33355008C>T	ENST00000023064.4	-	4	663	c.472G>A	c.(472-474)Gcc>Acc	p.A158T	RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000590341.1_Missense_Mutation_p.A158T|SLC7A9_ENST00000587772.1_Missense_Mutation_p.A158T	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	158			A -> AA (in CSNU). {ECO:0000269|PubMed:11157794}.		amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.A158T(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	TCACAGATGGCGGCGGCGGCC	0.607													C|||	3	0.000599042	0.0023	0.0	5008	,	,		19212	0.0		0.0	False		,,,				2504	0.0				p.A158T	GBM(181;1335 2108 9644 44178 46689)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G472A	19						.	C	THR/ALA,THR/ALA	3,4403	6.2+/-15.9	0,3,2200	49.0	45.0	47.0		472,472	3.9	0.9	19	dbSNP_134	47	0,8600		0,0,4300	no	missense,missense	SLC7A9	NM_001126335.1,NM_014270.4	58,58	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign,benign	158/488,158/488	33355008	3,13003	2203	4300	6503	38046848	SO:0001583	missense	11136	exon4			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.472G>A	19.37:g.33355008C>T	ENSP00000023064:p.Ala158Thr		38046848	NM_001126335	B2R9A6	Missense_Mutation	SNP	ENST00000023064.4	37	CCDS12425.1	.	.	.	.	.	.	.	.	.	.	C	13.75	2.331194	0.41297	6.81E-4	0.0	ENSG00000021488	ENST00000023064	D	0.90133	-2.62	4.97	3.92	0.45320	Amino acid permease domain (1);	0.323891	0.37012	N	0.002300	D	0.87637	0.6227	L	0.43598	1.365	0.41734	D	0.989572	B	0.30526	0.283	B	0.32624	0.149	D	0.86194	0.1614	10	0.51188	T	0.08	.	15.5266	0.75915	0.0:0.861:0.139:0.0	.	158	P82251	BAT1_HUMAN	T	158	ENSP00000023064:A158T	ENSP00000023064:A158T	A	-	1	0	SLC7A9	38046848	0.707000	0.27866	0.931000	0.37212	0.059000	0.15707	1.374000	0.34283	1.200000	0.43188	-0.479000	0.04858	GCC		0.607	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450585.1		
MUC16	94025	broad.mit.edu	37	19	9049723	9049723	+	Silent	SNP	G	G	T			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr19:9049723G>T	ENST00000397910.4	-	5	32111	c.31908C>A	c.(31906-31908)gtC>gtA	p.V10636V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10638	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.V6269V(1)|p.V10636V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGCTGAGCTGACGTCTGCCC	0.478																																					p.V10636V												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C31908A	19						.						120.0	110.0	113.0					19																	9049723		2003	4175	6178	8910723	SO:0001819	synonymous_variant	94025	exon5			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31908C>A	19.37:g.9049723G>T			8910723	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TULP2	7288	broad.mit.edu	37	19	49387079	49387079	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr19:49387079G>A	ENST00000221399.3	-	11	1351	c.1207C>T	c.(1207-1209)Cgg>Tgg	p.R403W		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	403					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.R403W(1)		NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		GTCATTTTCCGAGGCCCCAGG	0.517																																					p.R403W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1207T	19						.						111.0	106.0	107.0					19																	49387079		2203	4300	6503	54078891	SO:0001583	missense	7288	exon11			U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1207C>T	19.37:g.49387079G>A	ENSP00000221399:p.Arg403Trp		54078891	NM_003323	Q8TC50	Missense_Mutation	SNP	ENST00000221399.3	37	CCDS12739.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.640180	0.47153	.	.	ENSG00000104804	ENST00000221399	D	0.98313	-4.86	4.91	3.85	0.44370	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.99171	0.9713	H	0.95574	3.69	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	D	0.99139	1.0855	10	0.87932	D	0	-31.5079	12.4909	0.55899	0.0:0.0:0.8316:0.1684	.	403	O00295	TULP2_HUMAN	W	403	ENSP00000221399:R403W	ENSP00000221399:R403W	R	-	1	2	TULP2	54078891	1.000000	0.71417	0.993000	0.49108	0.034000	0.12701	4.922000	0.63404	1.403000	0.46800	0.650000	0.86243	CGG		0.517	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378633.1	NM_003323	
LOXL2	4017	broad.mit.edu	37	8	23179790	23179790	+	Silent	SNP	G	G	A	rs199848147		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr8:23179790G>A	ENST00000389131.3	-	7	1524	c.1155C>T	c.(1153-1155)atC>atT	p.I385I		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	385	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)	p.I385I(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GGATGGGTCCGATCCCTGCAA	0.502																																					p.I385I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1155T	8						.						111.0	84.0	93.0					8																	23179790		2203	4300	6503	23235735	SO:0001819	synonymous_variant	4017	exon7			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1155C>T	8.37:g.23179790G>A			23235735	NM_002318	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Silent	SNP	ENST00000389131.3	37	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	G	1.534	-0.543577	0.04053	.	.	ENSG00000134013	ENST00000520349	.	.	.	5.49	-11.0	0.00169	.	.	.	.	.	T	0.33789	0.0875	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42189	-0.9466	4	.	.	.	.	3.3297	0.07080	0.2404:0.372:0.2775:0.1102	.	.	.	.	L	102	.	.	S	-	2	0	LOXL2	23235735	0.863000	0.29885	0.384000	0.26145	0.223000	0.24884	0.005000	0.13129	-2.503000	0.00509	-3.090000	0.00065	TCG		0.502	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
HOOK3	84376	broad.mit.edu	37	8	42761359	42761359	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr8:42761359A>C	ENST00000307602.4	+	2	301	c.101A>C	c.(100-102)gAt>gCt	p.D34A		NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	34	Sufficient for interaction with microtubules.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)	p.D34A(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			ACCGTGGAAGATTTAACGAAT	0.408			T	RET	papillary thyroid																																p.D34A			Dom	yes		8	8p11.21	84376	hook homolog 3		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A101C	8						.						132.0	134.0	133.0					8																	42761359		2203	4300	6503	42880516	SO:0001583	missense	84376	exon2			AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.101A>C	8.37:g.42761359A>C	ENSP00000305699:p.Asp34Ala		42880516	NM_032410	D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	ENST00000307602.4	37	CCDS6139.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.485590	0.84854	.	.	ENSG00000168172	ENST00000307602	T	0.52526	0.66	5.44	5.44	0.79542	.	0.207230	0.49305	D	0.000147	T	0.66046	0.2750	M	0.70595	2.14	0.50813	D	0.999895	D;D	0.67145	0.996;0.986	D;D	0.74023	0.982;0.914	T	0.67381	-0.5685	10	0.48119	T	0.1	-20.2464	13.2929	0.60280	1.0:0.0:0.0:0.0	.	34;34	Q2VJ45;Q86VS8	.;HOOK3_HUMAN	A	34	ENSP00000305699:D34A	ENSP00000305699:D34A	D	+	2	0	HOOK3	42880516	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.388000	0.79795	2.178000	0.69098	0.528000	0.53228	GAT		0.408	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383172.2	NM_032410	
ZFHX4	79776	broad.mit.edu	37	8	77764140	77764140	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr8:77764140A>C	ENST00000521891.2	+	10	5431	c.4983A>C	c.(4981-4983)aaA>aaC	p.K1661N	ZFHX4_ENST00000455469.2_Missense_Mutation_p.K1616N|ZFHX4_ENST00000050961.6_Missense_Mutation_p.K1616N|ZFHX4_ENST00000518282.1_Missense_Mutation_p.K1635N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1616	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.K1661N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TAAACAGCAAAGATACCCATT	0.458										HNSCC(33;0.089)																											p.K1661N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4983C	8						.						87.0	85.0	86.0					8																	77764140		1930	4133	6063	77926695	SO:0001583	missense	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4983A>C	8.37:g.77764140A>C	ENSP00000430497:p.Lys1661Asn		77926695	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	11.11	1.542992	0.27563	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51574	0.7;0.75;0.72;0.71	4.41	1.98	0.26296	.	0.000000	0.47455	U	0.000237	T	0.47507	0.1449	L	0.38531	1.155	0.58432	D	0.999997	D;D;D	0.58268	0.97;0.982;0.982	P;P;P	0.60345	0.683;0.832;0.873	T	0.27365	-1.0076	10	0.21540	T	0.41	.	8.1875	0.31348	0.7605:0.0:0.2395:0.0	.	1616;1616;1661	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	N	1661;1661;1616;1616;1635	ENSP00000430497:K1661N;ENSP00000399605:K1616N;ENSP00000050961:K1616N;ENSP00000430848:K1635N	ENSP00000050961:K1616N	K	+	3	2	ZFHX4	77926695	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.053000	0.57427	0.320000	0.23234	0.443000	0.29094	AAA		0.458	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
TSPYL5	85453	broad.mit.edu	37	8	98289688	98289688	+	Missense_Mutation	SNP	C	C	T	rs115912728	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr8:98289688C>T	ENST00000322128.3	-	1	488	c.385G>A	c.(385-387)Gtg>Atg	p.V129M		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	129					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)		p.V129M(1)		cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					GGCCTTCCCACGGTTCCCGCT	0.711													C|||	3	0.000599042	0.0023	0.0	5008	,	,		12869	0.0		0.0	False		,,,				2504	0.0				p.V129M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G385A	8						.	C	MET/VAL	2,4376		0,2,2187	15.0	18.0	17.0		385	0.8	0.0	8	dbSNP_132	17	0,8540		0,0,4270	no	missense	TSPYL5	NM_033512.2	21	0,2,6457	TT,TC,CC		0.0,0.0457,0.0155	possibly-damaging	129/418	98289688	2,12916	2189	4270	6459	98358864	SO:0001583	missense	85453	exon1			AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.385G>A	8.37:g.98289688C>T	ENSP00000322802:p.Val129Met		98358864	NM_033512	B3KRF0|Q9C0B3	Missense_Mutation	SNP	ENST00000322128.3	37	CCDS34927.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	C	11.62	1.691822	0.30052	4.57E-4	0.0	ENSG00000180543	ENST00000322128	T	0.16073	2.37	3.73	0.748	0.18376	.	0.657622	0.11658	N	0.542173	T	0.05090	0.0136	N	0.22421	0.69	0.09310	N	1	P	0.35242	0.492	B	0.20384	0.029	T	0.27773	-1.0064	10	0.46703	T	0.11	-7.327	2.2944	0.04146	0.2041:0.5024:0.1825:0.1109	.	129	Q86VY4	TSYL5_HUMAN	M	129	ENSP00000322802:V129M	ENSP00000322802:V129M	V	-	1	0	TSPYL5	98358864	0.000000	0.05858	0.048000	0.18961	0.929000	0.56500	0.207000	0.17395	0.138000	0.18790	0.650000	0.86243	GTG		0.711	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380611.1	NM_033512	
FAM49B	51571	broad.mit.edu	37	8	130883640	130883640	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr8:130883640G>T	ENST00000519824.2	-	4	449	c.176C>A	c.(175-177)gCt>gAt	p.A59D	FAM49B_ENST00000522941.1_De_novo_Start_OutOfFrame|FAM49B_ENST00000401979.2_Missense_Mutation_p.A59D|FAM49B_ENST00000518879.1_Intron|FAM49B_ENST00000522746.1_Missense_Mutation_p.A59D|FAM49B_ENST00000519540.1_Missense_Mutation_p.A59D|FAM49B_ENST00000519110.1_Missense_Mutation_p.A59D|SNORA25_ENST00000363205.1_RNA|FAM49B_ENST00000522250.1_De_novo_Start_OutOfFrame|FAM49B_ENST00000517654.1_Missense_Mutation_p.A59D|FAM49B_ENST00000523509.1_Missense_Mutation_p.A59D	NM_016623.4	NP_057707.3	Q9NUQ9	FA49B_HUMAN	family with sequence similarity 49, member B	59						cilium (GO:0005929)|extracellular vesicular exosome (GO:0070062)		p.A59D(1)		kidney(1)|large_intestine(6)|lung(4)|prostate(1)	12	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			TTCGTGGCCAGCTCCTCTGTA	0.408																																					p.A59D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C176A	8						.						114.0	110.0	111.0					8																	130883640		2203	4300	6503	130952822	SO:0001583	missense	51571	exon7			AF208851	CCDS6361.1	8q24	2004-08-20				ENSG00000153310			25216	protein-coding gene	gene with protein product							Standard	NM_001256763		Approved	BM-009	uc003ysu.4	Q9NUQ9		ENST00000519824.2:c.176C>A	8.37:g.130883640G>T	ENSP00000429150:p.Ala59Asp		130952822	NM_016623	Q96AZ5|Q9NW21|Q9NZE7	De_novo_Start_OutOfFrame	SNP	ENST00000519824.2	37	CCDS6361.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.008367|5.008367	0.93346|0.93346	.|.	.|.	ENSG00000153310|ENSG00000153310	ENST00000522746;ENST00000523509;ENST00000401979;ENST00000519110;ENST00000519824;ENST00000517654;ENST00000519540;ENST00000519142;ENST00000520204;ENST00000518283;ENST00000523993;ENST00000520254;ENST00000519020;ENST00000518167;ENST00000517672|ENST00000311292	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.55760|.	0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84620|0.84620	0.5512|0.5512	M|M	0.88377|0.88377	2.95|2.95	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.85938|0.85938	0.1456|0.1456	10|6	0.72032|0.54805	D|T	0.01|0.06	-9.5159|-9.5159	19.0946|19.0946	0.93244|0.93244	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	59|.	Q9NUQ9|.	FA49B_HUMAN|.	D|M	59|15	ENSP00000428117:A59D;ENSP00000429802:A59D;ENSP00000384880:A59D;ENSP00000429078:A59D;ENSP00000429150:A59D;ENSP00000430674:A59D;ENSP00000429499:A59D;ENSP00000430806:A59D;ENSP00000429051:A59D;ENSP00000430694:A59D;ENSP00000429074:A59D;ENSP00000430127:A59D;ENSP00000429659:A59D;ENSP00000427994:A59D;ENSP00000430434:A59D|.	ENSP00000384880:A59D|ENSP00000311651:L15M	A|L	-|-	2|1	0|2	FAM49B|FAM49B	130952822|130952822	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.476000|9.476000	0.97823|0.97823	2.745000|2.745000	0.94114|0.94114	0.650000|0.650000	0.86243|0.86243	GCT|CTG		0.408	FAM49B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380390.2	NM_016623	
STXBP3	6814	broad.mit.edu	37	1	109299379	109299379	+	Silent	SNP	G	G	A	rs572320628		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:109299379G>A	ENST00000370008.3	+	4	299	c.249G>A	c.(247-249)ccG>ccA	p.P83P		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	83	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)	p.P83P(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TCATCACTCCGACATCAAAGG	0.308																																					p.P83P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G249A	1						.						40.0	41.0	40.0					1																	109299379		2202	4292	6494	109100902	SO:0001819	synonymous_variant	6814	exon4			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.249G>A	1.37:g.109299379G>A			109100902	NM_007269	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Silent	SNP	ENST00000370008.3	37	CCDS790.1																																																																																				0.308	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030591.1	NM_007269	
NRAS	4893	broad.mit.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A	1						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	115058053	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys		115058053	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
SYCP1	6847	broad.mit.edu	37	1	115489889	115489889	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:115489889A>T	ENST00000369522.3	+	27	2510	c.2270A>T	c.(2269-2271)aAa>aTa	p.K757I	SYCP1_ENST00000369518.1_Missense_Mutation_p.K757I	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	757					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.K757I(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCAATCTCAAAGCTGAACTT	0.328																																					p.K757I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2270T	1						.						62.0	65.0	64.0					1																	115489889		2203	4294	6497	115291412	SO:0001583	missense	6847	exon27			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2270A>T	1.37:g.115489889A>T	ENSP00000358535:p.Lys757Ile		115291412	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	37	CCDS879.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.857935	0.32791	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.52526	0.66;0.66;0.66	5.12	1.55	0.23275	.	0.165879	0.52532	D	0.000075	T	0.37019	0.0988	L	0.55481	1.735	0.29877	N	0.826383	P	0.41131	0.739	P	0.52881	0.712	T	0.29305	-1.0016	10	0.66056	D	0.02	-8.1621	8.254	0.31743	0.7549:0.0:0.2451:0.0	.	757	Q15431	SYCP1_HUMAN	I	757	ENSP00000358535:K757I;ENSP00000410011:K757I;ENSP00000358531:K757I	ENSP00000358531:K757I	K	+	2	0	SYCP1	115291412	0.930000	0.31532	0.649000	0.29536	0.028000	0.11728	1.825000	0.39081	0.071000	0.16664	-0.280000	0.10049	AAA		0.328	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
MRPS21	54460	broad.mit.edu	37	1	150280640	150280640	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:150280640C>T	ENST00000369084.5	+	2	689	c.242C>T	c.(241-243)gCa>gTa	p.A81V	MRPS21_ENST00000309092.7_Missense_Mutation_p.A81V	NM_018997.3	NP_061870.1	P82921	RT21_HUMAN	mitochondrial ribosomal protein S21	81					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.A81V(1)		kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	4	Lung NSC(24;5.57e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGAATCGGGCAGATCCGTGG	0.537																																					p.A81V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C242T	1						.						50.0	46.0	47.0					1																	150280640		2203	4300	6503	148547264	SO:0001583	missense	54460	exon2			AB051353	CCDS950.1	1q21	2012-09-13			ENSG00000187145			"""Mitochondrial ribosomal proteins / small subunits"""	14046	protein-coding gene	gene with protein product		611984					Standard	NM_031901		Approved		uc001euk.3	P82921	OTTHUMG00000012544	ENST00000369084.5:c.242C>T	1.37:g.150280640C>T	ENSP00000358080:p.Ala81Val		148547264	NM_018997	Q5TB11|Q9BST6	Missense_Mutation	SNP	ENST00000369084.5	37	CCDS950.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.239273	0.22711	.	.	ENSG00000187145	ENST00000309092;ENST00000369084	T;T	0.30448	1.53;1.53	4.94	2.93	0.34026	.	.	.	.	.	T	0.04952	0.0133	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40001	-0.9586	8	0.14656	T	0.56	.	5.626	0.17482	0.3342:0.5477:0.0:0.1181	.	81	P82921	RT21_HUMAN	V	81	ENSP00000312395:A81V;ENSP00000358080:A81V	ENSP00000312395:A81V	A	+	2	0	MRPS21	148547264	0.014000	0.17966	0.952000	0.39060	0.958000	0.62258	1.886000	0.39688	1.323000	0.45263	-0.127000	0.14921	GCA		0.537	MRPS21-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035813.1	NM_018997	
C1orf226	400793	broad.mit.edu	37	1	162351811	162351811	+	Silent	SNP	G	G	T			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:162351811G>T	ENST00000458626.2	+	1	292	c.120G>T	c.(118-120)ggG>ggT	p.G40G	C1orf226_ENST00000426197.2_Silent_p.G83G|RP11-565P22.6_ENST00000431696.1_Silent_p.G149G	NM_001085375.1	NP_001078844.1	A1L170	CA226_HUMAN	chromosome 1 open reading frame 226	40								p.G83G(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12						AGCCTGGGGGGCCAGGACTCT	0.662																																					p.G40G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G120T	1						.						10.0	13.0	12.0					1																	162351811		1842	4059	5901	160618435	SO:0001819	synonymous_variant	400793	exon1			AI480219, AK023199, AK125122, AL512785, BC127743	CCDS44268.1, CCDS53422.1	1q23.3	2013-10-11			ENSG00000239887	ENSG00000239887			34351	protein-coding gene	gene with protein product						14702039	Standard	NM_001085375		Approved	FLJ13137	uc010pkt.1	A1L170	OTTHUMG00000031376	ENST00000458626.2:c.120G>T	1.37:g.162351811G>T			160618435	NM_001085375	B4DF31	Silent	SNP	ENST00000458626.2	37	CCDS53422.1																																																																																				0.662	C1orf226-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076793.2	NM_001085375	
CTSE	1510	broad.mit.edu	37	1	206320205	206320205	+	Silent	SNP	G	G	T	rs149390455		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:206320205G>T	ENST00000358184.2	+	4	466	c.348G>T	c.(346-348)acG>acT	p.T116T	CTSE_ENST00000468617.1_3'UTR|CTSE_ENST00000432969.2_Silent_p.T41T|CTSE_ENST00000361052.3_Silent_p.T116T|CTSE_ENST00000360218.2_Silent_p.T116T	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	116					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.T116T(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TTCCAGAGACGCACAGCAGGT	0.577																																					p.T116T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G348T	1						.	G	,	0,4406		0,0,2203	116.0	103.0	108.0		348,348	-9.2	0.0	1	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	CTSE	NM_001910.3,NM_148964.2	,	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	,	116/397,116/364	206320205	1,13005	2203	4300	6503	204486828	SO:0001819	synonymous_variant	1510	exon4			BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.348G>T	1.37:g.206320205G>T			204486828	NM_001910	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Silent	SNP	ENST00000358184.2	37	CCDS1462.1																																																																																				0.577	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910	
THEMIS2	9473	broad.mit.edu	37	1	28208860	28208860	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:28208860A>C	ENST00000373921.3	+	4	1029	c.1025A>C	c.(1024-1026)cAg>cCg	p.Q342P	THEMIS2_ENST00000373925.1_Intron|THEMIS2_ENST00000373927.3_Intron|THEMIS2_ENST00000328928.7_Intron	NM_001105556.1	NP_001099026.1	Q5TEJ8	THMS2_HUMAN	thymocyte selection associated family member 2	342	CABIT 2.				cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Q342P(1)									GGTGCTTTCCAGCCAGGCCGG	0.662																																					p.Q342P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1025C	1						.						21.0	26.0	24.0					1																	28208860		1964	4157	6121	28081447	SO:0001583	missense	9473	exon4			AF044896	CCDS30653.1, CCDS30654.1, CCDS41290.1, CCDS65461.1	1p35.2	2012-07-10	2012-07-10	2012-07-10	ENSG00000130775	ENSG00000130775			16839	protein-coding gene	gene with protein product	"""induced by contact to basement membrane 1"""		"""chromosome 1 open reading frame 38"""	C1orf38		16219472	Standard	XM_005246041		Approved	ICB-1, Icb-1	uc001bpc.4	Q5TEJ8	OTTHUMG00000003735	ENST00000373921.3:c.1025A>C	1.37:g.28208860A>C	ENSP00000363031:p.Gln342Pro		28081447	NM_001105556	A2RTZ3|B4DZT9|B4DZY3|O60560|Q5TEJ1|Q5TEJ9|Q5TEK1|Q68DP4|Q9BYB6|Q9NS90	Missense_Mutation	SNP	ENST00000373921.3	37	CCDS41290.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.756904	0.49362	.	.	ENSG00000130775	ENST00000442118;ENST00000373921	T;T	0.14391	2.51;2.51	5.32	1.66	0.24008	.	0.785740	0.12579	N	0.456566	T	0.21387	0.0515	M	0.70595	2.14	0.38288	D	0.942639	P	0.49696	0.927	P	0.52109	0.69	T	0.19386	-1.0307	10	0.38643	T	0.18	-24.9168	4.1701	0.10326	0.6061:0.0:0.152:0.2419	.	342	Q5TEJ8	THMS2_HUMAN	P	205;342	ENSP00000413725:Q205P;ENSP00000363031:Q342P	ENSP00000363031:Q342P	Q	+	2	0	C1orf38	28081447	0.000000	0.05858	1.000000	0.80357	0.939000	0.58152	-0.247000	0.08866	0.975000	0.38392	0.454000	0.30748	CAG		0.662	THEMIS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011148.1	NM_004848	
GJB3	2707	broad.mit.edu	37	1	35251004	35251005	+	Missense_Mutation	DNP	TC	TC	AA			TCGA-AG-3894-01	TCGA-AG-3894-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:35251004_35251005TC>AA	ENST00000373366.2	+	2	1256_1257	c.641_642TC>AA	c.(640-642)gTC>gAA	p.V214E	GJB3_ENST00000373362.3_Missense_Mutation_p.V214E|RP1-34M23.5_ENST00000542839.1_RNA	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	214					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)	p.V214>?(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				TGCCACAGGGTCCTGCGAGGCC	0.624																																					.												.	.	1	Complex(1)	large_intestine(1)	c.641_642AA	1						.																																			35023592	SO:0001583	missense	2707	exon2			BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	Exception_encountered	1.37:g.35251004_35251005delinsAA	ENSP00000362464:p.Val214Glu		35023591	NM_024009	B2R790|Q2TAZ8	Missense_Mutation	DNP	ENST00000373366.2	37	CCDS384.1																																																																																				0.624	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011559.1	NM_024009	
TRIM33	51592	broad.mit.edu	37	1	114976275	114976277	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-AG-3894-01	TCGA-AG-3894-01			TTC	-	TTC	TTC	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:114976275_114976277delTTC	ENST00000358465.2	-	5	1085_1087	c.1002_1004delGAA	c.(1000-1005)aagaat>aat	p.K334del	TRIM33_ENST00000369543.2_In_Frame_Del_p.K334del|TRIM33_ENST00000450349.2_5'UTR	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	334	Necessary for oligomerization.				gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K334delK(1)		breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGAACATAATTCTTCTTCTCAA	0.335			T	RET	papillary thyroid																																p.334_335del			Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	.	1	Deletion - In frame(1)	large_intestine(1)	c.1002_1004del	1						.																																			114777800	SO:0001651	inframe_deletion	51592	exon5			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1002_1004delGAA	1.37:g.114976281_114976283delTTC	ENSP00000351250:p.Lys334del		114777798	NM_015906	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	In_Frame_Del	DEL	ENST00000358465.2	37	CCDS872.1																																																																																				0.335	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
OR11L1	391189	broad.mit.edu	37	1	248004661	248004661	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr1:248004661C>T	ENST00000355784.2	-	1	593	c.538G>A	c.(538-540)Gac>Aac	p.D180N		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	180						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D180N(1)		NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGCGGGAGGTCGCAGAAGAAA	0.507																																					p.D180N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538A	1						.						79.0	83.0	82.0					1																	248004661		2203	4300	6503	246071284	SO:0001583	missense	391189	exon1			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.538G>A	1.37:g.248004661C>T	ENSP00000348033:p.Asp180Asn		246071284	NM_001001959		Missense_Mutation	SNP	ENST00000355784.2	37	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798668	0.70567	.	.	ENSG00000197591	ENST00000355784	T	0.00188	8.59	4.27	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38548	U	0.001657	T	0.00524	0.0017	M	0.75264	2.295	0.34296	D	0.683767	D	0.89917	1.0	D	0.85130	0.997	T	0.66701	-0.5857	10	0.72032	D	0.01	.	14.1813	0.65577	0.0:0.8489:0.151:0.0	.	180	Q8NGX0	O11L1_HUMAN	N	180	ENSP00000348033:D180N	ENSP00000348033:D180N	D	-	1	0	OR11L1	246071284	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	3.847000	0.55895	1.125000	0.41998	0.543000	0.68304	GAC		0.507	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
OR51B4	79339	broad.mit.edu	37	11	5322906	5322906	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr11:5322906C>A	ENST00000380224.1	-	1	320	c.271G>T	c.(271-273)Gcc>Tcc	p.A91S	HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_033179.2	NP_149419.2	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B, member 4	91					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A91S(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCAGCATGGGCAATCTCCCTC	0.502																																					p.A91S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G271T	11						.						146.0	131.0	136.0					11																	5322906		2201	4297	6498	5279482	SO:0001583	missense	79339	exon1			BC069094	CCDS7757.1	11p15.4	2012-08-09			ENSG00000183251	ENSG00000183251		"""GPCR / Class A : Olfactory receptors"""	14708	protein-coding gene	gene with protein product							Standard	NM_033179		Approved		uc010qza.2	Q9Y5P0	OTTHUMG00000066665	ENST00000380224.1:c.271G>T	11.37:g.5322906C>A	ENSP00000369573:p.Ala91Ser		5279482	NM_033179	A7MAV5|Q6NTD7	Missense_Mutation	SNP	ENST00000380224.1	37	CCDS7757.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.266480	0.00259	.	.	ENSG00000183251	ENST00000380224	T	0.30448	1.53	4.39	-3.48	0.04739	GPCR, rhodopsin-like superfamily (1);	1.364310	0.04873	N	0.446276	T	0.04815	0.0130	N	0.00217	-1.83	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31613	-0.9937	10	0.02654	T	1	.	0.7886	0.01053	0.3726:0.2692:0.114:0.2442	.	91	Q9Y5P0	O51B4_HUMAN	S	91	ENSP00000369573:A91S	ENSP00000369573:A91S	A	-	1	0	OR51B4	5279482	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.643000	0.00058	-0.487000	0.06735	-0.345000	0.07892	GCC		0.502	OR51B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142956.2	NM_033179	
SPON1	10418	broad.mit.edu	37	11	14284473	14284473	+	RNA	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr11:14284473C>T	ENST00000534587.1	-	0	158				SPON1_ENST00000310358.7_RNA														p.R737W(1)									CCGAGAGAGCCGGCGGAGTGA	0.587																																					p.A737A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2211T	11						.						38.0	40.0	39.0					11																	14284473		1919	4114	6033	14241049			10418	exon15																															11.37:g.14284473C>T			14241049	NM_006108		Missense_Mutation	SNP	ENST00000534587.1	37		.	.	.	.	.	.	.	.	.	.	C	19.68	3.872510	0.72180	.	.	ENSG00000152268	ENST00000310358	.	.	.	6.04	1.34	0.21922	.	0.045895	0.85682	D	0.000000	T	0.77068	0.4076	.	.	.	0.53005	D	0.999969	D	0.89917	1.0	D	0.72075	0.976	D	0.83492	0.0070	7	0.66056	D	0.02	.	14.4744	0.67537	0.5911:0.4089:0.0:0.0	.	738	Q9HCB6	SPON1_HUMAN	W	737	.	ENSP00000309297:R737W	R	+	1	2	SPON1	14241049	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.383000	0.34385	0.361000	0.24292	0.561000	0.74099	CGG		0.587	RP11-21L19.1-001	KNOWN	basic	antisense	antisense	OTTHUMT00000386031.1		
SAAL1	113174	broad.mit.edu	37	11	18105187	18105187	+	Silent	SNP	T	T	C			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr11:18105187T>C	ENST00000524803.1	-	10	1183	c.1134A>G	c.(1132-1134)acA>acG	p.T378T	SAAL1_ENST00000300013.4_Silent_p.T377T|SAAL1_ENST00000529318.1_Silent_p.T380T			Q96ER3	SAAL1_HUMAN	serum amyloid A-like 1	378								p.T378T(1)		breast(2)|large_intestine(5)|lung(8)	15						TAGTTTCCTCTGTGTTAGACT	0.338																																					p.T378T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1134G	11						.						138.0	135.0	136.0					11																	18105187		2200	4293	6493	18061763	SO:0001819	synonymous_variant	113174	exon10			AK123457	CCDS31439.1	11p15.1	2005-10-28			ENSG00000166788	ENSG00000166788			25158	protein-coding gene	gene with protein product							Standard	NM_138421		Approved	FLJ41463	uc001mnq.3	Q96ER3	OTTHUMG00000166428	ENST00000524803.1:c.1134A>G	11.37:g.18105187T>C			18061763	NM_138421	A6NH05	Silent	SNP	ENST00000524803.1	37	CCDS31439.1																																																																																				0.338	SAAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389728.1	NM_138421	
OR5D18	219438	broad.mit.edu	37	11	55587894	55587894	+	Silent	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr11:55587894C>G	ENST00000333976.4	+	1	809	c.789C>G	c.(787-789)ccC>ccG	p.P263P		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P263P(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				ACTGTGTGCCCAACTCCAAAA	0.522																																					p.P263P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C789G	11						.						93.0	87.0	89.0					11																	55587894		2200	4296	6496	55344470	SO:0001819	synonymous_variant	219438	exon1			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.789C>G	11.37:g.55587894C>G			55344470	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	37	CCDS31510.1																																																																																				0.522	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
PPP6R3	55291	broad.mit.edu	37	11	68377454	68377454	+	Missense_Mutation	SNP	G	G	A	rs199837553		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr11:68377454G>A	ENST00000393800.2	+	23	2787	c.2533G>A	c.(2533-2535)Gcg>Acg	p.A845T	PPP6R3_ENST00000527403.2_Missense_Mutation_p.A810T|PPP6R3_ENST00000529710.1_Missense_Mutation_p.A765T|PPP6R3_ENST00000524904.1_Missense_Mutation_p.A839T|PPP6R3_ENST00000534534.1_Missense_Mutation_p.A613T|PPP6R3_ENST00000524845.1_Missense_Mutation_p.A816T|PPP6R3_ENST00000265636.5_Missense_Mutation_p.A765T|PPP6R3_ENST00000393799.2_Missense_Mutation_p.A851T|PPP6R3_ENST00000393801.3_Missense_Mutation_p.A851T|PPP6R3_ENST00000265637.4_Missense_Mutation_p.A799T	NM_001164161.1|NM_001164162.1|NM_001164163.1	NP_001157633.1|NP_001157634.1|NP_001157635.1	Q5H9R7	PP6R3_HUMAN	protein phosphatase 6, regulatory subunit 3	845					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)	p.A765T(1)|p.A851T(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(10)|liver(2)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						GGCGAAGTGCGCGGCGCCCAG	0.607													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18275	0.0		0.0	False		,,,				2504	0.0				p.A765T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2293A	11						.	A	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4400		0,0,2200	76.0	70.0	72.0		2551,2533,2515,2446,2293,2293	-3.4	0.0	11		72	1,8587	1.2+/-3.3	0,1,4293	no	missense,missense,missense,missense,missense,missense	PPP6R3	NM_001164160.1,NM_001164161.1,NM_001164162.1,NM_001164163.1,NM_001164164.1,NM_018312.4	58,58,58,58,58,58	0,1,6493	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign	851/880,845/874,839/868,816/845,765/792,765/794	68377454	1,12987	2200	4294	6494	68134030	SO:0001583	missense	55291	exon22			AF264779	CCDS8182.1, CCDS53671.1, CCDS53672.1, CCDS53673.1, CCDS53674.1, CCDS53675.1	11q13	2012-04-17	2010-06-28	2010-06-28	ENSG00000110075	ENSG00000110075		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	1173	protein-coding gene	gene with protein product	"""sporulation-induced transcript 4-associated protein"""	610879	"""chromosome 11 open reading frame 23"", ""SAPS domain family, member 3"""	C11orf23, SAPS3		11401438, 16769727	Standard	NM_018312		Approved	SAPLa, DKFZp781E2374, DKFZp781O2362, DKFZp781E17107, SAP190, SAPL, PP6R3, FLJ11058, FLJ43065, KIAA1558, MGC125711, MGC125712	uc001onv.3	Q5H9R7		ENST00000393800.2:c.2533G>A	11.37:g.68377454G>A	ENSP00000377389:p.Ala845Thr		68134030	NM_001164164	Q3B7I1|Q3I4Y0|Q3KR35|Q68CR3|Q7L4R8|Q8N3B2|Q96MB2|Q9H2K5|Q9H2K6|Q9HCL4|Q9NUY3	Missense_Mutation	SNP	ENST00000393800.2	37	CCDS53672.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	g	7.497	0.651791	0.14516	0.0	1.16E-4	ENSG00000110075	ENST00000393799;ENST00000393800;ENST00000534534;ENST00000524845;ENST00000265637;ENST00000524904;ENST00000393801;ENST00000265636;ENST00000529710;ENST00000527403;ENST00000534190	T;T;T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.2	-3.41	0.04839	.	1.693780	0.03025	N	0.151328	T	0.18383	0.0441	N	0.02011	-0.69	0.09310	N	1	B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001;0.0;0.001;0.0	B;B;B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001;0.0;0.001;0.001	T	0.08411	-1.0723	10	0.16420	T	0.52	.	4.1507	0.10237	0.5346:0.0971:0.2609:0.1075	.	528;613;765;816;839;845;851;765	B4DYU6;E9PQP7;Q5H9R7-3;Q5H9R7-6;Q5H9R7-2;Q5H9R7;Q5H9R7-5;Q5H9R7-4	.;.;.;.;.;PP6R3_HUMAN;.;.	T	851;845;613;816;799;839;851;765;765;810;552	ENSP00000377388:A851T;ENSP00000377389:A845T;ENSP00000434429:A613T;ENSP00000431415:A816T;ENSP00000265637:A799T;ENSP00000433058:A839T;ENSP00000377390:A851T;ENSP00000265636:A765T;ENSP00000437329:A765T;ENSP00000433565:A810T;ENSP00000436209:A552T	ENSP00000265636:A765T	A	+	1	0	PPP6R3	68134030	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.044000	0.12023	-1.159000	0.02807	-0.993000	0.02533	GCG		0.607	PPP6R3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395275.1	NM_018312	
BTG4	54766	broad.mit.edu	37	11	111365923	111365923	+	Silent	SNP	A	A	T			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr11:111365923A>T	ENST00000356018.2	-	5	826	c.627T>A	c.(625-627)ccT>ccA	p.P209P		NM_017589.3	NP_060059.1	Q9NY30	BTG4_HUMAN	B-cell translocation gene 4	209					cell cycle arrest (GO:0007050)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|neuron differentiation (GO:0030182)			p.P209P(1)		large_intestine(2)|upper_aerodigestive_tract(1)	3		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)		TGTAACACTTAGGATGCTTCT	0.562																																					p.P209P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T627A	11						.						109.0	86.0	94.0					11																	111365923		2201	4297	6498	110871133	SO:0001819	synonymous_variant	54766	exon5			AJ271351	CCDS8346.1	11q23	2008-05-27				ENSG00000137707			13862	protein-coding gene	gene with protein product		605673				10995567	Standard	NM_017589		Approved	PC3B	uc001plj.3	Q9NY30		ENST00000356018.2:c.627T>A	11.37:g.111365923A>T			110871133	NM_017589	Q8NEH7	Silent	SNP	ENST00000356018.2	37	CCDS8346.1																																																																																				0.562	BTG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391177.1		
CEP85L	387119	broad.mit.edu	37	6	118803034	118803034	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr6:118803034T>A	ENST00000368491.3	-	8	2274	c.1653A>T	c.(1651-1653)aaA>aaT	p.K551N	CEP85L_ENST00000368488.5_Missense_Mutation_p.K554N	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	551						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.K551N(1)									TCTCTTCAAGTTTTTTTTCTG	0.318																																					p.K554N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1662T	6						.						85.0	72.0	76.0					6																	118803034		1792	4058	5850	118909727	SO:0001583	missense	387119	exon9			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1653A>T	6.37:g.118803034T>A	ENSP00000357477:p.Lys551Asn		118909727	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	ENST00000368491.3	37	CCDS43498.1	.	.	.	.	.	.	.	.	.	.	T	4.466	0.086359	0.08583	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604	T;T;T	0.11821	2.74;2.74;2.74	5.24	-1.29	0.09288	.	0.434840	0.26013	N	0.026874	T	0.02571	0.0078	L	0.50333	1.59	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.42899	-0.9424	10	0.23302	T	0.38	-1.323	1.6485	0.02766	0.1692:0.4201:0.2061:0.2046	.	554;551	F8W6J2;Q5SZL2	.;CF204_HUMAN	N	551;554;554	ENSP00000357477:K551N;ENSP00000357474:K554N;ENSP00000392131:K554N	ENSP00000357474:K554N	K	-	3	2	C6orf204	118909727	0.030000	0.19436	0.676000	0.29932	0.507000	0.33981	-1.040000	0.03546	-0.225000	0.09913	-0.366000	0.07423	AAA		0.318	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
VNN1	8876	broad.mit.edu	37	6	133014198	133014198	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr6:133014198G>T	ENST00000367928.4	-	4	804	c.791C>A	c.(790-792)gCa>gAa	p.A264E		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	264	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)	p.A264E(1)		NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		TATGTTGGATGCAAGGAAATT	0.388																																					p.A264E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C791A	6						.						119.0	104.0	109.0					6																	133014198		2203	4300	6503	133055891	SO:0001583	missense	8876	exon4			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.791C>A	6.37:g.133014198G>T	ENSP00000356905:p.Ala264Glu		133055891	NM_004666	A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Missense_Mutation	SNP	ENST00000367928.4	37	CCDS5159.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846418	0.71603	.	.	ENSG00000112299	ENST00000367928	D	0.87571	-2.27	6.07	5.03	0.67393	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.068718	0.64402	D	0.000012	D	0.94178	0.8132	H	0.95043	3.615	0.45979	D	0.998796	D	0.64830	0.994	P	0.59288	0.855	D	0.95115	0.8241	10	0.87932	D	0	-13.3355	16.2658	0.82579	0.073:0.0:0.927:0.0	.	264	O95497	VNN1_HUMAN	E	264	ENSP00000356905:A264E	ENSP00000356905:A264E	A	-	2	0	VNN1	133055891	0.560000	0.26570	0.981000	0.43875	0.801000	0.45260	4.153000	0.58118	2.884000	0.98904	0.655000	0.94253	GCA		0.388	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042263.1		
UHRF1BP1	54887	broad.mit.edu	37	6	34824039	34824039	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr6:34824039C>T	ENST00000192788.5	+	10	1315	c.1144C>T	c.(1144-1146)Cgc>Tgc	p.R382C	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.R382C	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	382							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.R382C(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						ACATTGGGTACGCCACTGTGA	0.473																																					p.R382C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1144T	6						.						129.0	136.0	134.0					6																	34824039		2050	4199	6249	34932017	SO:0001583	missense	54887	exon10			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.1144C>T	6.37:g.34824039C>T	ENSP00000192788:p.Arg382Cys		34932017	NM_017754	Q9NXE0	Missense_Mutation	SNP	ENST00000192788.5	37	CCDS43455.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901144	0.52227	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.09630	2.96;2.96	5.67	2.65	0.31530	.	0.127712	0.50627	D	0.000112	T	0.14830	0.0358	L	0.42245	1.32	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.01608	-1.1313	10	0.59425	D	0.04	-11.9209	14.4575	0.67425	0.4605:0.5395:0.0:0.0	.	382	Q6BDS2	URFB1_HUMAN	C	382	ENSP00000192788:R382C;ENSP00000400628:R382C	ENSP00000192788:R382C	R	+	1	0	UHRF1BP1	34932017	0.972000	0.33761	0.334000	0.25495	0.970000	0.65996	2.162000	0.42367	0.797000	0.33971	0.655000	0.94253	CGC		0.473	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
COL12A1	1303	broad.mit.edu	37	6	75887464	75887464	+	Silent	SNP	T	T	C			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr6:75887464T>C	ENST00000322507.8	-	12	2661	c.2352A>G	c.(2350-2352)ccA>ccG	p.P784P	COL12A1_ENST00000416123.2_Silent_p.P784P|COL12A1_ENST00000483888.2_Silent_p.P784P|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	784	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.P784P(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ATTTCGTGTCTGGAATCAAGT	0.423																																					p.P784P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2352G	6						.						288.0	281.0	283.0					6																	75887464		1874	4100	5974	75944184	SO:0001819	synonymous_variant	1303	exon12			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2352A>G	6.37:g.75887464T>C			75944184	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	37	CCDS43482.1																																																																																				0.423	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
SYNE1	23345	broad.mit.edu	37	6	152523014	152523014	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr6:152523014G>A	ENST00000367255.5	-	127	23691	c.23090C>T	c.(23089-23091)tCg>tTg	p.S7697L	SYNE1_ENST00000265368.4_Missense_Mutation_p.S7697L|SYNE1_ENST00000356820.4_Missense_Mutation_p.S2221L|SYNE1_ENST00000448038.1_Missense_Mutation_p.S7626L|SYNE1_ENST00000423061.1_Missense_Mutation_p.S7626L|SYNE1_ENST00000341594.5_Missense_Mutation_p.S7309L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7697					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.S7697L(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGAGACTGCGAAAGCTTCTT	0.428										HNSCC(10;0.0054)																											p.S2221L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6662T	6						.						102.0	108.0	106.0					6																	152523014		2203	4300	6503	152564707	SO:0001583	missense	23345	exon42			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23090C>T	6.37:g.152523014G>A	ENSP00000356224:p.Ser7697Leu		152564707	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167508	0.78339	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	6.08	6.08	0.98989	.	0.206543	0.34507	N	0.003905	T	0.55130	0.1901	M	0.78223	2.4	0.58432	D	0.999999	D;D;D;D	0.71674	0.994;0.994;0.998;0.997	P;P;P;P	0.60012	0.74;0.74;0.867;0.74	T	0.57452	-0.7809	10	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	7697;7697;7626;7626	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	L	7697;343;7626;7697;7626;7309;2221;619	ENSP00000356224:S7697L;ENSP00000356226:S343L;ENSP00000396024:S7626L;ENSP00000265368:S7697L;ENSP00000390975:S7626L;ENSP00000341887:S7309L;ENSP00000349276:S2221L;ENSP00000356220:S619L	ENSP00000265368:S7697L	S	-	2	0	SYNE1	152564707	1.000000	0.71417	0.909000	0.35828	0.423000	0.31445	6.753000	0.74904	2.894000	0.99253	0.591000	0.81541	TCG		0.428	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
KRT26	353288	broad.mit.edu	37	17	38926622	38926622	+	Silent	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr17:38926622G>A	ENST00000335552.4	-	3	612	c.564C>T	c.(562-564)gcC>gcT	p.A188A		NM_181539.4	NP_853517.2			keratin 26									p.A188A(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				CACTGGTGTCGGCCTCAACAC	0.493																																					p.A188A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C564T	17						.						132.0	125.0	127.0					17																	38926622		2203	4300	6503	36180148	SO:0001819	synonymous_variant	353288	exon3			AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.564C>T	17.37:g.38926622G>A			36180148	NM_181539		Silent	SNP	ENST00000335552.4	37	CCDS11374.1																																																																																				0.493	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539	
CYB5D1	124637	broad.mit.edu	37	17	7762101	7762101	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr17:7762101C>T	ENST00000332439.4	+	3	567	c.415C>T	c.(415-417)Cgc>Tgc	p.R139C	LSMD1_ENST00000575071.1_5'Flank|LSMD1_ENST00000576861.1_Intron|CYB5D1_ENST00000570446.1_Intron|CYB5D1_ENST00000571846.1_Missense_Mutation_p.R139C|LSMD1_ENST00000570555.1_5'UTR|LSMD1_ENST00000575208.1_5'Flank|LSMD1_ENST00000335155.5_5'Flank|LSMD1_ENST00000333775.5_5'Flank|LSMD1_ENST00000575771.1_5'Flank|LSMD1_ENST00000576384.1_5'Flank	NM_144607.4	NP_653208.2	Q6P9G0	CB5D1_HUMAN	cytochrome b5 domain containing 1	139							heme binding (GO:0020037)|metal ion binding (GO:0046872)	p.R139C(1)		breast(1)|endometrium(1)|large_intestine(2)|skin(2)	6		all_cancers(10;0.11)|Prostate(122;0.219)				CCGGAGCATCCGCATCATTAA	0.577											OREG0024147	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R139C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C415T	17						.						44.0	41.0	42.0					17																	7762101		2203	4300	6503	7702826	SO:0001583	missense	124637	exon3			AK057061	CCDS11123.1	17p13.1	2006-01-12	2006-01-12						26516	protein-coding gene	gene with protein product						12477932	Standard	NM_144607		Approved	FLJ32499	uc002gjb.4	Q6P9G0		ENST00000332439.4:c.415C>T	17.37:g.7762101C>T	ENSP00000331479:p.Arg139Cys	644	7702826	NM_144607	D3DTQ8|Q96DM7	Missense_Mutation	SNP	ENST00000332439.4	37	CCDS11123.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068770	0.76301	.	.	ENSG00000182224	ENST00000332439;ENST00000541486	T	0.55234	0.53	5.33	3.36	0.38483	Cytochrome b5 (1);	0.061993	0.64402	N	0.000003	T	0.51193	0.1660	M	0.77406	2.37	0.80722	D	1	P;P	0.45768	0.866;0.572	B;B	0.38616	0.277;0.104	T	0.57112	-0.7867	10	0.87932	D	0	-4.1499	10.6921	0.45877	0.0:0.8421:0.0:0.1579	.	139;139	Q6P9G0-2;Q6P9G0	.;CB5D1_HUMAN	C	139	ENSP00000331479:R139C	ENSP00000331479:R139C	R	+	1	0	CYB5D1	7702826	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	5.443000	0.66581	0.640000	0.30582	0.462000	0.41574	CGC		0.577	CYB5D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440841.1	NM_144607	
ACLY	47	broad.mit.edu	37	17	40063716	40063716	+	Silent	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr17:40063716G>A	ENST00000352035.2	-	7	856	c.726C>T	c.(724-726)ttC>ttT	p.F242F	ACLY_ENST00000590151.1_Silent_p.F242F|ACLY_ENST00000393896.2_Silent_p.F242F|ACLY_ENST00000537919.1_Intron|ACLY_ENST00000353196.1_Silent_p.F242F	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	242	ATP-grasp.				ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.F242F(1)	NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CCTCCCGCCCGAAGGGGGGAG	0.582																																					p.F242F	Colon(64;807 1396 15971 30971)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C726T	17						.						74.0	74.0	74.0					17																	40063716		2203	4300	6503	37317242	SO:0001819	synonymous_variant	47	exon7			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.726C>T	17.37:g.40063716G>A			37317242	NM_198830	B4DIM0|B4E3P0|Q13037|Q9BRL0	Silent	SNP	ENST00000352035.2	37	CCDS11412.1																																																																																				0.582	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
SCNN1G	6340	broad.mit.edu	37	16	23226531	23226531	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr16:23226531G>A	ENST00000300061.2	+	13	1834	c.1691G>A	c.(1690-1692)cGc>cAc	p.R564H	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	564					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)	p.R564H(1)		NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	ATTGCCCGCCGCCAGTGGCAG	0.587																																					p.R564H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1691A	16						.						92.0	87.0	89.0					16																	23226531		2197	4300	6497	23134032	SO:0001583	missense	6340	exon13			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1691G>A	16.37:g.23226531G>A	ENSP00000300061:p.Arg564His		23134032	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	37	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	G	5.103	0.204701	0.09704	.	.	ENSG00000166828	ENST00000300061	T	0.73575	-0.76	5.22	-0.291	0.12843	.	0.550372	0.18016	N	0.154418	T	0.48892	0.1525	N	0.08118	0	0.18873	N	0.999981	B	0.11235	0.004	B	0.06405	0.002	T	0.28235	-1.0050	10	0.15499	T	0.54	-39.1964	10.5884	0.45296	0.4739:0.0:0.5261:0.0	.	564	P51170	SCNNG_HUMAN	H	564	ENSP00000300061:R564H	ENSP00000300061:R564H	R	+	2	0	SCNN1G	23134032	0.000000	0.05858	0.161000	0.22692	0.615000	0.37417	-0.164000	0.09983	-0.292000	0.08999	-0.258000	0.10820	CGC		0.587	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
TIGD7	91151	broad.mit.edu	37	16	3350349	3350349	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr16:3350349T>G	ENST00000396862.1	-	2	2094	c.266A>C	c.(265-267)cAa>cCa	p.Q89P	TIGD7_ENST00000268674.2_Missense_Mutation_p.Q89P|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	89	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q89P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						GCGTTTCTGTTGGTACCACAT	0.512																																					p.Q89P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A266C	16						.						142.0	137.0	139.0					16																	3350349		2197	4300	6497	3290350	SO:0001583	missense	91151	exon2			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.266A>C	16.37:g.3350349T>G	ENSP00000380071:p.Gln89Pro		3290350	NM_033208	Q9BXZ0	Missense_Mutation	SNP	ENST00000396862.1	37	CCDS10500.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.058381	0.36277	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.32515	1.45;1.45	4.38	4.38	0.52667	Homeodomain-related (1);Pogo transposase / Cenp-B / PDC2, DNA-binding HTH domain (3);Homeodomain-like (1);	0.000000	0.34555	U	0.003875	T	0.46718	0.1407	L	0.58810	1.83	0.29759	N	0.835736	D	0.71674	0.998	D	0.76575	0.988	T	0.39583	-0.9607	10	0.31617	T	0.26	.	9.9239	0.41481	0.0:0.0:0.0:1.0	.	89	Q6NT04	TIGD7_HUMAN	P	89	ENSP00000380071:Q89P;ENSP00000268674:Q89P	ENSP00000268674:Q89P	Q	-	2	0	TIGD7	3290350	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.039000	0.41193	1.852000	0.53769	0.533000	0.62120	CAA		0.512	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208	
CACNG3	10368	broad.mit.edu	37	16	24366271	24366271	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr16:24366271C>T	ENST00000005284.3	+	3	1615	c.413C>T	c.(412-414)gCg>gTg	p.A138V		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	138					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.A138V(2)		NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		ATTCTCAGCGCGGGCATCTTT	0.567																																					p.A138V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C413T	16						.						58.0	53.0	55.0					16																	24366271		2197	4300	6497	24273772	SO:0001583	missense	10368	exon3			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.413C>T	16.37:g.24366271C>T	ENSP00000005284:p.Ala138Val		24273772	NM_006539		Missense_Mutation	SNP	ENST00000005284.3	37	CCDS10620.1	.	.	.	.	.	.	.	.	.	.	C	33	5.213030	0.95069	.	.	ENSG00000006116	ENST00000005284	D	0.91068	-2.78	5.41	4.45	0.53987	.	0.112679	0.64402	D	0.000015	D	0.93314	0.7869	M	0.88031	2.925	0.80722	D	1	P	0.51653	0.947	P	0.47827	0.558	D	0.94124	0.7382	10	0.59425	D	0.04	-12.7101	15.2787	0.73764	0.1414:0.8586:0.0:0.0	.	138	O60359	CCG3_HUMAN	V	138	ENSP00000005284:A138V	ENSP00000005284:A138V	A	+	2	0	CACNG3	24273772	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.089000	0.76909	1.487000	0.48415	0.561000	0.74099	GCG		0.567	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254548.1	NM_006539	
SALL1	6299	broad.mit.edu	37	16	51175491	51175491	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr16:51175491C>T	ENST00000251020.4	-	2	675	c.642G>A	c.(640-642)gcG>gcA	p.A214A	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.A117A|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	214					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A214A(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CGCCGCACCTCGCTTCCTGGG	0.602																																					p.A214A	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G642A	16						.						73.0	78.0	76.0					16																	51175491		2198	4300	6498	49732992	SO:0001819	synonymous_variant	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.642G>A	16.37:g.51175491C>T			49732992	NM_002968	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	ENST00000251020.4	37	CCDS10747.1																																																																																				0.602	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
CHD9	80205	broad.mit.edu	37	16	53358218	53358218	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr16:53358218G>A	ENST00000398510.3	+	38	8192	c.8105G>A	c.(8104-8106)gGa>gAa	p.G2702E	CHD9_ENST00000564845.1_Missense_Mutation_p.G2686E|CHD9_ENST00000566029.1_Missense_Mutation_p.G2686E|CHD9_ENST00000447540.1_Missense_Mutation_p.G2687E			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2702					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.G2703E(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CCTTCTGGAGGAGAAGCTAAA	0.498																																					p.G2686E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8057A	16						.						60.0	59.0	60.0					16																	53358218		1897	4124	6021	51915719	SO:0001583	missense	80205	exon39			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.8105G>A	16.37:g.53358218G>A	ENSP00000381522:p.Gly2702Glu		51915719	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	ENST00000398510.3	37		.	.	.	.	.	.	.	.	.	.	G	8.015	0.758311	0.15846	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D	0.85484	-1.99	5.47	4.5	0.54988	.	0.113275	0.39274	N	0.001411	T	0.71837	0.3387	N	0.12182	0.205	0.41841	D	0.990127	B;B;P;B	0.39480	0.261;0.004;0.675;0.42	B;B;B;B	0.35353	0.028;0.011;0.201;0.198	T	0.74237	-0.3730	10	0.33940	T	0.23	-19.5627	15.1708	0.72872	0.0713:0.0:0.9287:0.0	.	768;2687;2702;2686	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	E	2687;2686;768	ENSP00000396345:G2687E	ENSP00000381522:G2686E	G	+	2	0	CHD9	51915719	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.911000	0.63328	2.729000	0.93468	0.655000	0.94253	GGA		0.498	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
TCEB3B	51224	broad.mit.edu	37	18	44561432	44561432	+	Silent	SNP	G	G	A	rs576550803	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr18:44561432G>A	ENST00000332567.4	-	1	556	c.204C>T	c.(202-204)gaC>gaT	p.D68D	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	68	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.D68D(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGGCCGCTAAGTCTCTGGCAA	0.652																																					p.D68D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C204T	18						.						18.0	19.0	19.0					18																	44561432		2200	4294	6494	42815430	SO:0001819	synonymous_variant	51224	exon1			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.204C>T	18.37:g.44561432G>A			42815430	NM_016427	Q9P2V9	Silent	SNP	ENST00000332567.4	37	CCDS11932.1																																																																																				0.652	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
ST8SIA3	51046	broad.mit.edu	37	18	55027257	55027257	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr18:55027257C>T	ENST00000324000.3	+	4	2926	c.892C>T	c.(892-894)Cgg>Tgg	p.R298W		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	298					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.R298W(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GTCACCTAAACGGCTGAGCAC	0.418																																					p.R298W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C892T	18						.						101.0	95.0	97.0					18																	55027257		2203	4300	6503	53178255	SO:0001583	missense	51046	exon4			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.892C>T	18.37:g.55027257C>T	ENSP00000320431:p.Arg298Trp		53178255	NM_015879	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	ENST00000324000.3	37	CCDS32834.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021529	0.93462	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.35236	1.32	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65479	-0.6158	10	0.87932	D	0	-7.2102	20.3293	0.98710	0.0:1.0:0.0:0.0	.	298	O43173	SIA8C_HUMAN	W	405;298	ENSP00000320431:R298W	ENSP00000320431:R298W	R	+	1	2	ST8SIA3	53178255	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.576000	0.60915	2.906000	0.99361	0.655000	0.94253	CGG		0.418	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449765.1	NM_015879	
PTPRM	5797	broad.mit.edu	37	18	8069983	8069983	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr18:8069983G>T	ENST00000332175.8	+	8	2469	c.1432G>T	c.(1432-1434)Gat>Tat	p.D478Y	PTPRM_ENST00000400060.4_Missense_Mutation_p.D478Y|PTPRM_ENST00000580170.1_Missense_Mutation_p.D478Y|PTPRM_ENST00000578571.1_3'UTR|PTPRM_ENST00000400053.4_Missense_Mutation_p.D416Y|PTPRM_ENST00000444013.1_Missense_Mutation_p.D265Y	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	478	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.D478Y(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGTGCAGACAGATGAAGACCG	0.418																																					p.D478Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1432T	18						.						83.0	67.0	72.0					18																	8069983		2203	4300	6503	8059983	SO:0001583	missense	5797	exon8			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1432G>T	18.37:g.8069983G>T	ENSP00000331418:p.Asp478Tyr		8059983	NM_002845	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876511	0.91664	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.52	5.52	0.82312	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72779	0.3503	M	0.65975	2.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.979;0.997;0.997	T	0.74562	-0.3624	10	0.72032	D	0.01	.	19.4558	0.94889	0.0:0.0:1.0:0.0	.	265;478;478	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	Y	478;478;416;265	ENSP00000331418:D478Y;ENSP00000382933:D478Y;ENSP00000382927:D416Y;ENSP00000387608:D265Y	ENSP00000331418:D478Y	D	+	1	0	PTPRM	8059983	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.380000	0.97202	2.611000	0.88343	0.655000	0.94253	GAT		0.418	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
FBXO15	201456	broad.mit.edu	37	18	71740898	71740898	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr18:71740898G>A	ENST00000419743.2	-	10	1410	c.1331C>T	c.(1330-1332)cCg>cTg	p.P444L	FBXO15_ENST00000269500.5_Missense_Mutation_p.P368L|FBXO15_ENST00000580806.1_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	444						SCF ubiquitin ligase complex (GO:0019005)		p.P368L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		CAGGCACACCGGGGAACTGAA	0.478																																					p.P368L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1103T	18						.						183.0	172.0	175.0					18																	71740898		2203	4300	6503	69891878	SO:0001583	missense	201456	exon10			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1331C>T	18.37:g.71740898G>A	ENSP00000393154:p.Pro444Leu		69891878	NM_152676	B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	g	24.2	4.509540	0.85282	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.42131	0.98;0.98	5.9	5.9	0.94986	.	0.049509	0.85682	D	0.000000	T	0.64338	0.2589	M	0.77103	2.36	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.58172	0.834;0.834	T	0.66909	-0.5804	10	0.87932	D	0	-11.1147	20.2814	0.98513	0.0:0.0:1.0:0.0	.	444;368	B3KST3;Q8NCQ5	.;FBX15_HUMAN	L	368;444	ENSP00000269500:P368L;ENSP00000393154:P444L	ENSP00000269500:P368L	P	-	2	0	FBXO15	69891878	1.000000	0.71417	0.958000	0.39756	0.650000	0.38633	7.058000	0.76676	2.809000	0.96659	0.651000	0.88453	CCG		0.478	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676	
C3orf20	84077	broad.mit.edu	37	3	14799047	14799047	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr3:14799047C>G	ENST00000253697.3	+	13	2562	c.2110C>G	c.(2110-2112)Ccc>Gcc	p.P704A	C3orf20_ENST00000435614.1_Missense_Mutation_p.P582A|C3orf20_ENST00000412910.1_Missense_Mutation_p.P582A	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	704						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.P704A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						CCTGTTGGCGCCCCGAGACCC	0.607																																					p.P582A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1744G	3						.						51.0	50.0	50.0					3																	14799047		2203	4300	6503	14774051	SO:0001583	missense	84077	exon13			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2110C>G	3.37:g.14799047C>G	ENSP00000253697:p.Pro704Ala		14774051	NM_001184958	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	ENST00000253697.3	37	CCDS33706.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270909	0.40194	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.08634	3.36;3.07;3.07	4.95	4.95	0.65309	.	0.000000	0.49916	D	0.000126	T	0.27349	0.0671	M	0.72479	2.2	0.38726	D	0.953558	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.02625	-1.1132	10	0.56958	D	0.05	-27.3471	13.7034	0.62622	0.0:1.0:0.0:0.0	.	582;704	Q8ND61-2;Q8ND61	.;CC020_HUMAN	A	704;582;582	ENSP00000253697:P704A;ENSP00000402933:P582A;ENSP00000396081:P582A	ENSP00000253697:P704A	P	+	1	0	C3orf20	14774051	0.972000	0.33761	0.886000	0.34754	0.006000	0.05464	2.415000	0.44635	2.299000	0.77371	0.297000	0.19635	CCC		0.607	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340586.1	NM_032137	
PLS1	5357	broad.mit.edu	37	3	142402999	142402999	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr3:142402999T>A	ENST00000337777.3	+	7	944	c.731T>A	c.(730-732)aTt>aAt	p.I244N	PLS1_ENST00000457734.2_Missense_Mutation_p.I244N|PLS1_ENST00000497002.1_Missense_Mutation_p.I244N	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	244	Actin-binding 1.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.I244N(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GATATTGAGATTTCCAGGAAT	0.403																																					p.I244N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T731A	3						.						160.0	155.0	157.0					3																	142402999		2203	4300	6503	143885689	SO:0001583	missense	5357	exon7			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.731T>A	3.37:g.142402999T>A	ENSP00000336831:p.Ile244Asn		143885689	NM_002670	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	ENST00000337777.3	37	CCDS3125.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446004	0.63178	.	.	ENSG00000120756	ENST00000457734;ENST00000476044;ENST00000337777;ENST00000497002	D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78	4.89	4.89	0.63831	Calponin homology domain (2);	0.243774	0.46442	D	0.000298	D	0.94676	0.8283	M	0.74467	2.265	0.58432	D	0.999997	P	0.36789	0.57	B	0.36885	0.235	D	0.95251	0.8360	10	0.87932	D	0	-12.4595	14.9516	0.71080	0.0:0.0:0.0:1.0	.	244	Q14651	PLSI_HUMAN	N	244;165;244;244	ENSP00000387890:I244N;ENSP00000417481:I165N;ENSP00000336831:I244N;ENSP00000418700:I244N	ENSP00000336831:I244N	I	+	2	0	PLS1	143885689	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.409000	0.80053	2.169000	0.68431	0.477000	0.44152	ATT		0.403	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
SMC4	10051	broad.mit.edu	37	3	160138629	160138629	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr3:160138629A>T	ENST00000357388.3	+	13	2410	c.1959A>T	c.(1957-1959)gaA>gaT	p.E653D	SMC4_ENST00000462787.1_Missense_Mutation_p.E653D|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000360111.2_Missense_Mutation_p.E653D|SMC4_ENST00000469762.1_Missense_Mutation_p.E628D|SMC4_ENST00000344722.5_Missense_Mutation_p.E653D	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	653	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.E653D(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TAGCCCAAGAATGTGTAAACT	0.353																																					p.E653D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1959T	3						.						118.0	109.0	112.0					3																	160138629		2203	4300	6503	161621323	SO:0001583	missense	10051	exon13			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1959A>T	3.37:g.160138629A>T	ENSP00000349961:p.Glu653Asp		161621323	NM_001002800	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	A	11.96	1.795166	0.31777	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.43	1.22	0.21188	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.281414	0.40385	N	0.001101	T	0.73233	0.3561	L	0.33093	0.98	0.37653	D	0.922487	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.001	T	0.61850	-0.6978	10	0.13853	T	0.58	-13.3025	9.9803	0.41809	0.584:0.3181:0.0:0.098	.	653;628;628;653	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	D	653;653;628;653;653;247	ENSP00000349961:E653D;ENSP00000353225:E653D;ENSP00000417964:E628D;ENSP00000420734:E653D;ENSP00000341382:E653D	ENSP00000341382:E653D	E	+	3	2	SMC4	161621323	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.088000	0.41663	0.317000	0.23160	0.445000	0.29226	GAA		0.353	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
CACNA2D2	9254	broad.mit.edu	37	3	50417407	50417407	+	Silent	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr3:50417407G>A	ENST00000479441.1	-	9	884	c.885C>T	c.(883-885)atC>atT	p.I295I	CACNA2D2_ENST00000423994.2_Silent_p.I295I|CACNA2D2_ENST00000424201.2_Silent_p.I295I|CACNA2D2_ENST00000395083.1_Silent_p.I295I|CACNA2D2_ENST00000360963.3_Silent_p.I226I|CACNA2D2_ENST00000435965.1_Silent_p.I295I|CACNA2D2_ENST00000266039.3_Silent_p.I295I|CACNA2D2_ENST00000429770.1_Silent_p.I295I			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	295	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.I295I(1)		breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	ACACATCCACGATGATGACCA	0.602																																					p.I295I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C885T	3						.						146.0	125.0	132.0					3																	50417407		2203	4300	6503	50392411	SO:0001819	synonymous_variant	9254	exon9			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.885C>T	3.37:g.50417407G>A			50392411	NM_006030	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Silent	SNP	ENST00000479441.1	37	CCDS54588.1																																																																																				0.602	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
HTR3D	200909	broad.mit.edu	37	3	183756569	183756569	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr3:183756569C>G	ENST00000382489.3	+	8	1171	c.1171C>G	c.(1171-1173)Cca>Gca	p.P391A	HTR3D_ENST00000334128.2_Missense_Mutation_p.P216A|HTR3D_ENST00000428798.2_Missense_Mutation_p.P341A|HTR3D_ENST00000453435.1_Missense_Mutation_p.P170A	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	391					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)	p.P216A(1)|p.P391A(1)		large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	AGGGCAGATGCCAGGCCCTGG	0.617																																					p.P391A												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1171G	3						.						48.0	48.0	48.0					3																	183756569		2203	4300	6503	185239263	SO:0001583	missense	200909	exon8			AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.1171C>G	3.37:g.183756569C>G	ENSP00000371929:p.Pro391Ala		185239263	NM_001163646	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	ENST00000382489.3	37	CCDS54685.1	.	.	.	.	.	.	.	.	.	.	C	9.884	1.202333	0.22121	.	.	ENSG00000186090	ENST00000334128;ENST00000428798;ENST00000382489;ENST00000453435	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	3.77	1.37	0.22104	Neurotransmitter-gated ion-channel transmembrane domain (1);	1.058060	0.07471	N	0.902282	T	0.82029	0.4948	M	0.86028	2.79	0.09310	N	1	B;B;B;B	0.29162	0.118;0.235;0.036;0.12	B;B;B;B	0.29440	0.07;0.102;0.023;0.09	T	0.63107	-0.6711	10	0.20046	T	0.44	-4.579	5.8752	0.18824	0.0:0.6833:0.0:0.3167	.	391;216;170;216	Q70Z44;Q70Z44-2;Q70Z44-3;F6WC43	5HT3D_HUMAN;.;.;.	A	216;341;391;170	ENSP00000334315:P216A;ENSP00000405409:P341A;ENSP00000371929:P391A;ENSP00000389268:P170A	ENSP00000334315:P216A	P	+	1	0	HTR3D	185239263	0.000000	0.05858	0.004000	0.12327	0.037000	0.13140	-0.424000	0.07025	0.154000	0.19237	0.558000	0.71614	CCA		0.617	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
KLRB1	3820	broad.mit.edu	37	12	9750672	9750672	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr12:9750672C>T	ENST00000229402.3	-	5	546	c.500G>A	c.(499-501)tGg>tAg	p.W167*		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	167	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.W167*(1)		endometrium(2)|large_intestine(6)|lung(4)	12						GCCGTTTATCCACTTCCAGTT	0.318																																					p.W167X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G500A	12						.						48.0	46.0	47.0					12																	9750672		2202	4292	6494	9641939	SO:0001587	stop_gained	3820	exon5			U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.500G>A	12.37:g.9750672C>T	ENSP00000229402:p.Trp167*		9641939	NM_002258	Q24K24	Nonsense_Mutation	SNP	ENST00000229402.3	37	CCDS8601.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093799	0.56075	.	.	ENSG00000111796	ENST00000229402	.	.	.	3.06	3.06	0.35304	.	0.000000	0.40222	N	0.001142	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6897	9.8491	0.41046	0.0:1.0:0.0:0.0	.	.	.	.	X	167	.	ENSP00000229402:W167X	W	-	2	0	KLRB1	9641939	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	2.227000	0.42972	2.022000	0.59522	0.655000	0.94253	TGG		0.318	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400280.1	NM_002258	
OVCH1	341350	broad.mit.edu	37	12	29624865	29624865	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr12:29624865C>T	ENST00000318184.5	-	16	1725	c.1726G>A	c.(1726-1728)Gca>Aca	p.A576T	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	576	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.A576T(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					TCCCCTCCTGCGATTCTTCTG	0.507																																					p.A576T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1726A	12						.						53.0	54.0	54.0					12																	29624865		1937	4131	6068	29516132	SO:0001583	missense	341350	exon16			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.1726G>A	12.37:g.29624865C>T	ENSP00000326708:p.Ala576Thr		29516132	NM_183378		Missense_Mutation	SNP	ENST00000318184.5	37		.	.	.	.	.	.	.	.	.	.	C	11.84	1.758403	0.31137	.	.	ENSG00000187950	ENST00000318184	D	0.88354	-2.37	2.31	1.42	0.22433	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.71879	0.3392	N	0.08118	0	0.09310	N	1	P	0.48230	0.907	B	0.36845	0.234	T	0.66184	-0.5987	9	0.59425	D	0.04	.	4.3494	0.11148	0.0:0.5551:0.0:0.4449	.	576	Q7RTY7	OVCH1_HUMAN	T	576	ENSP00000326708:A576T	ENSP00000326708:A576T	A	-	1	0	OVCH1	29516132	0.001000	0.12720	0.047000	0.18901	0.979000	0.70002	0.101000	0.15251	0.549000	0.28973	0.655000	0.94253	GCA		0.507	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395997.2	NM_183378	
PRICKLE1	144165	broad.mit.edu	37	12	42858385	42858385	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr12:42858385G>A	ENST00000455697.1	-	7	1736	c.1451C>T	c.(1450-1452)gCt>gTt	p.A484V	RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.A484V|PRICKLE1_ENST00000552240.1_Missense_Mutation_p.A484V|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.A484V|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.A484V	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	484					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.A484V(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		GCTGCCATAAGCAGAATCGCC	0.468																																					p.A484V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1451T	12						.						61.0	58.0	59.0					12																	42858385		2203	4300	6503	41144652	SO:0001583	missense	144165	exon7			AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1451C>T	12.37:g.42858385G>A	ENSP00000401060:p.Ala484Val		41144652	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	37	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	G	35	5.434968	0.96150	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.64103	0.2568	N	0.14661	0.345	0.80722	D	1	D	0.57899	0.981	P	0.57911	0.829	T	0.67956	-0.5536	10	0.59425	D	0.04	-6.3067	20.3277	0.98707	0.0:0.0:1.0:0.0	.	484	Q96MT3	PRIC1_HUMAN	V	484	ENSP00000401060:A484V;ENSP00000398947:A484V;ENSP00000448359:A484V;ENSP00000345064:A484V;ENSP00000449819:A484V	ENSP00000345064:A484V	A	-	2	0	PRICKLE1	41144652	1.000000	0.71417	0.959000	0.39883	0.995000	0.86356	9.420000	0.97426	2.879000	0.98667	0.650000	0.86243	GCT		0.468	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
GPR84	53831	broad.mit.edu	37	12	54757284	54757284	+	Missense_Mutation	SNP	G	G	A	rs145386200	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr12:54757284G>A	ENST00000551809.1	-	1	987	c.352C>T	c.(352-354)Cgc>Tgc	p.R118C	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.R118C			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.R118C(1)		NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						AGGAGGTAGCGTCCCAGTGCG	0.587													G|||	3	0.000599042	0.0008	0.0	5008	,	,		21756	0.002		0.0	False		,,,				2504	0.0				p.R118C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C352T	12						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	90.0	79.0	83.0		352	4.3	1.0	12	dbSNP_134	83	0,8600		0,0,4300	no	missense	GPR84	NM_020370.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	118/397	54757284	1,13005	2203	4300	6503	53043551	SO:0001583	missense	53831	exon2			AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.352C>T	12.37:g.54757284G>A	ENSP00000450310:p.Arg118Cys		53043551	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	37	CCDS8878.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.03	3.747977	0.69533	2.27E-4	0.0	ENSG00000139572	ENST00000267015;ENST00000551809	D;D	0.97186	-4.28;-4.28	5.21	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	D	0.98526	0.9508	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.98776	1.0730	10	0.87932	D	0	-19.9123	13.6225	0.62144	0.0:0.0:0.845:0.155	.	118	Q9NQS5	GPR84_HUMAN	C	118	ENSP00000267015:R118C;ENSP00000450310:R118C	ENSP00000267015:R118C	R	-	1	0	GPR84	53043551	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	2.733000	0.47360	2.602000	0.87976	0.555000	0.69702	CGC		0.587	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
PLEKHG7	440107	broad.mit.edu	37	12	93150130	93150130	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr12:93150130C>T	ENST00000344636.3	+	8	847	c.663C>T	c.(661-663)agC>agT	p.S221S		NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	221							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S221S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						CACCAACCAGCAGACACCTTC	0.368																																					p.S221S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C663T	12						.						90.0	90.0	90.0					12																	93150130		2203	4300	6503	91674261	SO:0001819	synonymous_variant	440107	exon8			AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.663C>T	12.37:g.93150130C>T			91674261	NM_001004330	B2RNR7	Silent	SNP	ENST00000344636.3	37	CCDS31873.1																																																																																				0.368	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330	
GNPTAB	79158	broad.mit.edu	37	12	102183810	102183810	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr12:102183810C>T	ENST00000299314.7	-	3	491	c.229G>A	c.(229-231)Gtt>Att	p.V77I	GNPTAB_ENST00000549940.1_Missense_Mutation_p.V77I|snoU13_ENST00000459085.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	77					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)	p.V77I(2)		NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						GTGTAAACAACGTCAATCGGC	0.428																																					p.V77I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G229A	12						.						207.0	184.0	192.0					12																	102183810		2203	4300	6503	100707941	SO:0001583	missense	79158	exon3			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.229G>A	12.37:g.102183810C>T	ENSP00000299314:p.Val77Ile		100707941	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	ENST00000299314.7	37	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.289333	0.59976	.	.	ENSG00000111670	ENST00000299314;ENST00000549940	D;D	0.97480	-4.07;-4.4	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.97387	0.9145	L	0.45137	1.4	0.80722	D	1	P;D	0.89917	0.897;1.0	B;D	0.64237	0.127;0.923	D	0.96193	0.9139	10	0.28530	T	0.3	-19.639	20.2182	0.98305	0.0:1.0:0.0:0.0	.	77;77	Q3T906-2;Q3T906	.;GNPTA_HUMAN	I	77	ENSP00000299314:V77I;ENSP00000449150:V77I	ENSP00000299314:V77I	V	-	1	0	GNPTAB	100707941	1.000000	0.71417	0.987000	0.45799	0.793000	0.44817	7.412000	0.80091	2.785000	0.95823	0.655000	0.94253	GTT		0.428	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
ICE2	79664	broad.mit.edu	37	15	60734742	60734742	+	Silent	SNP	T	T	C			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr15:60734742T>C	ENST00000261520.4	-	12	2532	c.2298A>G	c.(2296-2298)caA>caG	p.Q766Q	NARG2_ENST00000439632.1_Silent_p.Q629Q	NM_024611.4	NP_078887.2												p.Q766Q(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						AAACTGGAAATTGCTGCAATG	0.323																																					p.Q766Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2298G	15						.						77.0	71.0	73.0					15																	60734742		2203	4299	6502	58522034	SO:0001819	synonymous_variant	79664	exon12																														ENST00000261520.4:c.2298A>G	15.37:g.60734742T>C			58522034	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	37	CCDS10176.1																																																																																				0.323	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
KIAA1109	84162	broad.mit.edu	37	4	123120528	123120528	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr4:123120528A>C	ENST00000264501.4	+	14	1676	c.1303A>C	c.(1303-1305)Att>Ctt	p.I435L	KIAA1109_ENST00000388738.3_Missense_Mutation_p.I435L|KIAA1109_ENST00000455637.1_Missense_Mutation_p.I435L|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	435					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.I435L(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CACTCCTGCTATTAAGGGACA	0.373																																					p.I435L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1303C	4						.						189.0	159.0	169.0					4																	123120528		1844	4088	5932	123339978	SO:0001583	missense	84162	exon12			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1303A>C	4.37:g.123120528A>C	ENSP00000264501:p.Ile435Leu		123339978	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.87|17.87	3.495920|3.495920	0.64186|0.64186	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	D;D;D|.	0.94138|.	-3.36;-3.36;-3.36|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.528136|.	0.17756|.	N|.	0.163068|.	T|T	0.52484|0.52484	0.1737|0.1737	N|N	0.21194|0.21194	0.64|0.64	0.46458|0.46458	D|D	0.999054|0.999054	B|.	0.25312|.	0.123|.	B|.	0.21917|.	0.037|.	T|T	0.49523|0.49523	-0.8931|-0.8931	10|5	0.17832|.	T|.	0.49|.	.|.	15.671|15.671	0.77274|0.77274	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	435|.	Q2LD37|.	K1109_HUMAN|.	L|S	435|267	ENSP00000264501:I435L;ENSP00000373390:I435L;ENSP00000389925:I435L|.	ENSP00000264501:I435L|.	I|Y	+|+	1|2	0|0	KIAA1109|KIAA1109	123339978|123339978	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.038000|7.038000	0.76537|0.76537	2.119000|2.119000	0.64992|0.64992	0.482000|0.482000	0.46254|0.46254	ATT|TAT		0.373	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FAT4	79633	broad.mit.edu	37	4	126336582	126336582	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr4:126336582C>T	ENST00000394329.3	+	5	6477	c.6464C>T	c.(6463-6465)gCa>gTa	p.A2155V	FAT4_ENST00000335110.5_Missense_Mutation_p.A453V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2155	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A2155V(2)		NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCCATCTTTGCACAAGCTTTG	0.403																																					p.A2155V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6464T	4						.						94.0	88.0	90.0					4																	126336582		2203	4300	6503	126556032	SO:0001583	missense	79633	exon5			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.6464C>T	4.37:g.126336582C>T	ENSP00000377862:p.Ala2155Val		126556032	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	15.01	2.705768	0.48412	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01804	4.63;4.63	5.42	4.55	0.56014	Cadherin (2);Cadherin-like (1);	0.552403	0.12951	U	0.425838	T	0.02610	0.0079	L	0.43923	1.385	0.42608	D	0.9933	B;B	0.18968	0.01;0.032	B;B	0.19946	0.025;0.027	T	0.51919	-0.8644	10	0.26408	T	0.33	.	13.3256	0.60457	0.0:0.9209:0.0:0.0791	.	453;2155	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	V	2155;453	ENSP00000377862:A2155V;ENSP00000335169:A453V	ENSP00000335169:A453V	A	+	2	0	FAT4	126556032	1.000000	0.71417	0.025000	0.17156	0.827000	0.46813	5.946000	0.70234	1.219000	0.43474	0.557000	0.71058	GCA		0.403	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
STOX2	56977	broad.mit.edu	37	4	184938359	184938359	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr4:184938359C>T	ENST00000308497.4	+	4	4138	c.2703C>T	c.(2701-2703)agC>agT	p.S901S		NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	901					embryo development (GO:0009790)|maternal placenta development (GO:0001893)			p.S901S(1)		breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		TCCGAGCGAGCGCGGAGCCCC	0.532																																					p.S901S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2703T	4						.						58.0	61.0	60.0					4																	184938359		1893	4115	6008	185175353	SO:0001819	synonymous_variant	56977	exon4			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.2703C>T	4.37:g.184938359C>T			185175353	NM_020225	A6H8U4|Q9NPS8	Silent	SNP	ENST00000308497.4	37	CCDS47167.1																																																																																				0.532	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361433.3	NM_020225	
IL1RAPL2	26280	broad.mit.edu	37	X	104984642	104984642	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chrX:104984642C>T	ENST00000372582.1	+	8	1762	c.1006C>T	c.(1006-1008)Cga>Tga	p.R336*	IL1RAPL2_ENST00000344799.4_Nonsense_Mutation_p.R336*|IL1RAPL2_ENST00000485671.1_3'UTR	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	336	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)	p.R336*(2)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGTTGAAAACCGAAATGGACG	0.378																																					p.R336X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C1006T	X						.						76.0	67.0	70.0					X																	104984642		2203	4300	6503	104871298	SO:0001587	stop_gained	26280	exon8			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1006C>T	X.37:g.104984642C>T	ENSP00000361663:p.Arg336*		104871298	NM_017416	Q2M3U3|Q9NZN0	Nonsense_Mutation	SNP	ENST00000372582.1	37	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	C	39	7.831195	0.98513	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	.	.	.	5.61	3.59	0.41128	.	0.000000	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	14.7819	0.69774	0.3377:0.6623:0.0:0.0	.	.	.	.	X	336	.	ENSP00000344976:R336X	R	+	1	2	IL1RAPL2	104871298	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.084000	0.30828	1.077000	0.40990	0.600000	0.82982	CGA		0.378	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
CNGA2	1260	broad.mit.edu	37	X	150908119	150908119	+	Missense_Mutation	SNP	C	C	T	rs141559818		TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chrX:150908119C>T	ENST00000329903.4	+	3	322	c.289C>T	c.(289-291)Cgt>Tgt	p.R97C		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	97			R -> H (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.R97C(1)		breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					ATTCCTCGAGCGTTTTCGTGG	0.547																																					p.R97C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C289T	X						.	C	CYS/ARG	1,3834		0,1,0,1631,571	123.0	92.0	103.0		289	4.6	1.0	X	dbSNP_134	103	1,6727		0,0,1,2428,1871	no	missense	CNGA2	NM_005140.1	180	0,1,1,4059,2442	TT,TC,T,CC,C		0.0149,0.0261,0.0189	possibly-damaging	97/665	150908119	2,10561	2203	4300	6503	150658775	SO:0001583	missense	1260	exon4			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.289C>T	X.37:g.150908119C>T	ENSP00000328478:p.Arg97Cys		150658775	NM_005140	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	37	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111017	0.77210	2.61E-4	1.49E-4	ENSG00000183862	ENST00000329903	T	0.61627	0.09	5.58	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.73814	0.3635	M	0.81802	2.56	0.50813	D	0.999892	D	0.89917	1.0	D	0.83275	0.996	T	0.76033	-0.3107	10	0.59425	D	0.04	.	9.2713	0.37673	0.3734:0.6265:0.0:0.0	.	97	Q16280	CNGA2_HUMAN	C	97	ENSP00000328478:R97C	ENSP00000328478:R97C	R	+	1	0	CNGA2	150658775	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	2.903000	0.48711	2.338000	0.79540	0.529000	0.55759	CGT		0.547	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
FMNL2	114793	broad.mit.edu	37	2	153473648	153473648	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:153473648A>C	ENST00000288670.9	+	13	1623	c.1256A>C	c.(1255-1257)aAg>aCg	p.K419T	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	419	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)		p.K419T(1)		central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						GCCATGTCCAAGATTGTGGAA	0.443																																					p.K419T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1256C	2						.						138.0	129.0	132.0					2																	153473648		1928	4143	6071	153181894	SO:0001583	missense	114793	exon13			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1256A>C	2.37:g.153473648A>C	ENSP00000288670:p.Lys419Thr		153181894	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	37	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.554891	0.86231	.	.	ENSG00000157827	ENST00000288670	T	0.50277	0.75	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.69895	0.3162	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69154	-0.5220	10	0.30854	T	0.27	.	16.2167	0.82231	1.0:0.0:0.0:0.0	.	419	Q96PY5-3	.	T	419	ENSP00000288670:K419T	ENSP00000288670:K419T	K	+	2	0	FMNL2	153181894	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.231000	0.72958	0.533000	0.62120	AAG		0.443	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
TTN	7273	broad.mit.edu	37	2	179435825	179435825	+	Missense_Mutation	SNP	G	G	A	rs368914555	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:179435825G>A	ENST00000591111.1	-	276	70335	c.70111C>T	c.(70111-70113)Cgg>Tgg	p.R23371W	TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R22444W|TTN_ENST00000589042.1_Missense_Mutation_p.R25012W|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R16072W|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R16139W|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R15947W|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	23371	Fibronectin type-III 70. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R16139W(1)|p.R16072W(1)|p.R22442W(1)|p.R15947W(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCTCTGGCCGTCCTGGTGGA	0.458													G|||	10	0.00199681	0.0	0.0	5008	,	,		21269	0.0		0.0	False		,,,				2504	0.0102				p.D15946D												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C47838T	2						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,3974		0,0,1987	121.0	126.0	124.0		47839,67330,48214,48415	3.5	0.4	2		124	1,8311		0,1,4155	no	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	101,101,101,101	0,1,6142	AA,AG,GG		0.012,0.0,0.0081	probably-damaging,probably-damaging,probably-damaging,probably-damaging	15947/26927,22444/33424,16072/27052,16139/27119	179435825	1,12285	1987	4156	6143	179144071	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.70111C>T	2.37:g.179435825G>A	ENSP00000465570:p.Arg23371Trp		179144071	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	10.13	1.264803	0.23136	0.0	1.2E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.28	3.45	0.39498	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71467	0.3343	M	0.80616	2.505	0.37131	D	0.901288	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.65987	0.94;0.94;0.94;0.914	T	0.79699	-0.1694	9	0.87932	D	0	.	14.5479	0.68044	0.0:0.0:0.7219:0.278	.	15947;16072;16139;23371	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	W	22444;15947;16139;16072;15945	ENSP00000343764:R22444W;ENSP00000434586:R15947W;ENSP00000340554:R16139W;ENSP00000352154:R16072W	ENSP00000340554:R16139W	R	-	1	2	TTN	179144071	1.000000	0.71417	0.428000	0.26697	0.936000	0.57629	3.558000	0.53749	0.696000	0.31696	-0.158000	0.13435	CGG		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PTPRN	5798	broad.mit.edu	37	2	220161201	220161201	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:220161201G>A	ENST00000295718.2	-	17	2588	c.2348C>T	c.(2347-2349)aCg>aTg	p.T783M	AC114803.3_ENST00000417355.1_RNA|MIR153-1_ENST00000384914.1_RNA|PTPRN_ENST00000497977.1_5'UTR|PTPRN_ENST00000409251.3_Missense_Mutation_p.T754M|PTPRN_ENST00000423636.2_Missense_Mutation_p.T693M	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	783	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T783M(1)		breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CGGGCCCTGCGTGGCTATGTA	0.607																																					p.T693M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2078T	2						.						80.0	74.0	76.0					2																	220161201		2203	4300	6503	219869445	SO:0001583	missense	5798	exon17				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2348C>T	2.37:g.220161201G>A	ENSP00000295718:p.Thr783Met		219869445	NM_001199764	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615140	0.66672	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	D;D;D	0.88046	-2.33;-2.33;-2.33	4.56	4.56	0.56223	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.85682	D	0.000000	D	0.95862	0.8653	H	0.96720	3.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97614	1.0131	10	0.87932	D	0	.	17.3328	0.87271	0.0:0.0:1.0:0.0	.	754;783	Q6NSL1;Q16849	.;PTPRN_HUMAN	M	754;783;754;693	ENSP00000386638:T754M;ENSP00000295718:T783M;ENSP00000444244:T693M	ENSP00000295718:T783M	T	-	2	0	PTPRN	219869445	1.000000	0.71417	0.944000	0.38274	0.526000	0.34562	9.734000	0.98822	2.245000	0.73994	0.655000	0.94253	ACG		0.607	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		
NYAP2	57624	broad.mit.edu	37	2	226447508	226447508	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:226447508G>A	ENST00000272907.6	+	4	1788	c.1375G>A	c.(1375-1377)Gct>Act	p.A459T	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	459	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)			p.A459T(2)									CCCTTACGACGCTGTGCATTC	0.627																																					p.A459T												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G1375A	2						.						45.0	50.0	48.0					2																	226447508		2039	4199	6238	226155752	SO:0001583	missense	57624	exon4			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.1375G>A	2.37:g.226447508G>A	ENSP00000272907:p.Ala459Thr		226155752	NM_020864	A2RRN4|Q96NL2	Missense_Mutation	SNP	ENST00000272907.6	37	CCDS46529.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145976	0.37923	.	.	ENSG00000144460	ENST00000272907	T	0.30714	1.52	5.19	4.22	0.49857	.	0.247464	0.41823	D	0.000812	T	0.15522	0.0374	N	0.14661	0.345	0.80722	D	1	P	0.49961	0.93	B	0.38194	0.267	T	0.02533	-1.1145	10	0.28530	T	0.3	-13.4619	10.5722	0.45206	0.0:0.0:0.5605:0.4395	.	459	Q9P242	K1486_HUMAN	T	459	ENSP00000272907:A459T	ENSP00000272907:A459T	A	+	1	0	KIAA1486	226155752	0.998000	0.40836	0.977000	0.42913	0.941000	0.58515	3.662000	0.54510	2.415000	0.81967	0.563000	0.77884	GCT		0.627	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
PNPT1	87178	broad.mit.edu	37	2	55894202	55894202	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:55894202A>T	ENST00000447944.2	-	13	1186	c.1100T>A	c.(1099-1101)cTt>cAt	p.L367H		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	367					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)	p.L367H(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TACATTCCTAAGTGAAGTCAA	0.348																																					p.L367H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1100A	2						.						100.0	95.0	97.0					2																	55894202		2203	4300	6503	55747706	SO:0001583	missense	87178	exon13			BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1100T>A	2.37:g.55894202A>T	ENSP00000400646:p.Leu367His		55747706	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Missense_Mutation	SNP	ENST00000447944.2	37	CCDS1856.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.680995	0.88542	.	.	ENSG00000138035	ENST00000447944	T	0.69040	-0.37	5.65	5.65	0.86999	Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (1);Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.070917	0.56097	D	0.000026	T	0.82130	0.4970	M	0.78285	2.405	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	D	0.84540	0.0638	10	0.87932	D	0	-9.4002	16.2323	0.82352	1.0:0.0:0.0:0.0	.	367	Q8TCS8	PNPT1_HUMAN	H	367	ENSP00000400646:L367H	ENSP00000386075:L367H	L	-	2	0	PNPT1	55747706	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.017000	0.93651	2.288000	0.76882	0.529000	0.55759	CTT		0.348	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
PCBP1	5093	broad.mit.edu	37	2	70315180	70315180	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3894-01	TCGA-AG-3894-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:70315180T>A	ENST00000303577.5	+	1	596	c.305T>A	c.(304-306)cTg>cAg	p.L102Q	PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000425333.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	102	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L102Q(2)|p.L102P(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						ACCCTGAGGCTGGTGGTGCCG	0.612																																					p.L102Q	Colon(85;1146 1307 3484 18706 25380)											.	.	3	Substitution - Missense(3)	large_intestine(3)	c.T305A	2						.						57.0	70.0	66.0					2																	70315180		2200	4299	6499	70168684	SO:0001583	missense	5093	exon1				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.305T>A	2.37:g.70315180T>A	ENSP00000305556:p.Leu102Gln		70168684	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	37	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	17.76	3.469571	0.63625	.	.	ENSG00000169564	ENST00000303577	T	0.34859	1.34	4.16	4.16	0.48862	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.082382	0.49916	U	0.000122	T	0.72070	0.3415	H	0.97783	4.075	0.58432	D	0.99999	D	0.89917	1.0	D	0.97110	1.0	T	0.81777	-0.0777	10	0.87932	D	0	.	11.8577	0.52449	0.0:0.0:0.0:1.0	.	102	Q15365	PCBP1_HUMAN	Q	102	ENSP00000305556:L102Q	ENSP00000305556:L102Q	L	+	2	0	PCBP1	70168684	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	4.781000	0.62389	2.120000	0.65058	0.477000	0.44152	CTG		0.612	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
DNER	92737	broad.mit.edu	37	2	230456484	230456484	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr2:230456484C>A	ENST00000341772.4	-	2	531	c.397G>T	c.(397-399)Gaa>Taa	p.E133*		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	133	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Interaction with NOTCH1. {ECO:0000250}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)	p.E133*(1)		NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		AGTGCCTGTTCACAGTTGGGA	0.567																																					p.E133X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G397T	2						.						78.0	62.0	67.0					2																	230456484		2203	4300	6503	230164728	SO:0001587	stop_gained	92737	exon2			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.397G>T	2.37:g.230456484C>A	ENSP00000345229:p.Glu133*		230164728	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Nonsense_Mutation	SNP	ENST00000341772.4	37	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	C	37	6.271630	0.97431	.	.	ENSG00000187957	ENST00000341772	.	.	.	5.69	5.69	0.88448	.	0.210162	0.49305	D	0.000141	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.7953	0.96478	0.0:1.0:0.0:0.0	.	.	.	.	X	133	.	ENSP00000345229:E133X	E	-	1	0	DNER	230164728	1.000000	0.71417	0.953000	0.39169	0.506000	0.33950	6.734000	0.74801	2.673000	0.90976	0.655000	0.94253	GAA		0.567	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
TLN1	7094	broad.mit.edu	37	9	35732997	35732997	+	5'Flank	SNP	C	C	G	rs376045014		TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr9:35732997C>G	ENST00000314888.9	-	0	0				CREB3_ENST00000486056.1_3'UTR|TLN1_ENST00000540444.1_5'Flank|CREB3_ENST00000353704.2_Missense_Mutation_p.P45R	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)	p.P45R(1)		NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCGCAGGTACCGAGCGACTGG	0.557																																					p.P45R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C134G	9						.						160.0	167.0	165.0					9																	35732997		2203	4300	6503	35722997	SO:0001631	upstream_gene_variant	10488	exon2			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874		9.37:g.35732997C>G	Exception_encountered		35722997	NM_006368	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838655	0.51057	.	.	ENSG00000107175	ENST00000353704	T	0.63580	-0.05	5.03	2.47	0.30058	.	0.538653	0.18456	N	0.140665	T	0.40670	0.1126	N	0.22421	0.69	0.28951	N	0.890412	P	0.37176	0.586	B	0.40134	0.32	T	0.34976	-0.9807	10	0.07175	T	0.84	-8.4347	4.4241	0.11495	0.1652:0.1105:0.0:0.7243	.	45	O43889-2	.	R	45	ENSP00000342136:P45R	ENSP00000342136:P45R	P	+	2	0	CREB3	35722997	0.918000	0.31147	0.367000	0.25926	0.401000	0.30781	1.313000	0.33585	0.280000	0.22209	0.585000	0.79938	CCG		0.557	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
DBH	1621	broad.mit.edu	37	9	136508566	136508566	+	Missense_Mutation	SNP	C	C	A	rs201600007	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr9:136508566C>A	ENST00000393056.2	+	4	788	c.776C>A	c.(775-777)gCc>gAc	p.A259D		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	259					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.A259D(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GGCAATGAGGCCCTTGTCCAC	0.672																																					p.A259D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C776A	9						.						74.0	72.0	73.0					9																	136508566		2203	4300	6503	135498387	SO:0001583	missense	1621	exon4			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.776C>A	9.37:g.136508566C>A	ENSP00000376776:p.Ala259Asp		135498387	NM_000787	Q5T381|Q96AG2	Missense_Mutation	SNP	ENST00000393056.2	37	CCDS6977.2	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055530	0.36277	.	.	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.33438	1.41;1.41	5.04	4.13	0.48395	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.49699	1.58	0.58432	D	0.999996	B	0.33528	0.416	B	0.41666	0.363	T	0.18272	-1.0342	10	0.48119	T	0.1	-7.9464	14.6342	0.68678	0.0:0.8534:0.1466:0.0	.	259	P09172	DOPO_HUMAN	D	259;196;196	ENSP00000376776:A259D;ENSP00000263611:A196D	ENSP00000263611:A196D	A	+	2	0	DBH	135498387	0.998000	0.40836	0.997000	0.53966	0.018000	0.09664	3.583000	0.53928	1.099000	0.41499	-0.156000	0.13503	GCC		0.672	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054929.2	NM_000787	
ATP12A	479	broad.mit.edu	37	13	25281181	25281181	+	Silent	SNP	C	C	T	rs2289908	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:25281181C>T	ENST00000381946.3	+	16	2357	c.2190C>T	c.(2188-2190)acC>acT	p.T730T	ATP12A_ENST00000218548.6_Silent_p.T736T			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	730					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.T730T(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TTGCTGTGACCGGGGATGGAG	0.562													c|||	3	0.000599042	0.0	0.0	5008	,	,		17883	0.003		0.0	False		,,,				2504	0.0				p.T736T	Pancreas(156;1582 1935 18898 22665 26498)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2208T	13						.						73.0	64.0	67.0					13																	25281181		2203	4300	6503	24179181	SO:0001819	synonymous_variant	479	exon16			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2190C>T	13.37:g.25281181C>T			24179181	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	37	CCDS31948.1																																																																																				0.562	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
AMER2	219287	broad.mit.edu	37	13	25745584	25745584	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:25745584C>T	ENST00000515384.1	-	1	841	c.174G>A	c.(172-174)ccG>ccA	p.P58P	AMER2_ENST00000357816.2_Silent_p.P58P|AMER2_ENST00000381853.3_Silent_p.P58P|AMER2-AS1_ENST00000413501.1_lincRNA			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	58	Gly-rich.				ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.P58P(2)									TCCCCGACGGCGGCTCGGCGG	0.597																																					p.P58P												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G174A	13						.						26.0	32.0	30.0					13																	25745584		2176	4271	6447	24643584	SO:0001819	synonymous_variant	219287	exon1			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.174G>A	13.37:g.25745584C>T			24643584	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Silent	SNP	ENST00000515384.1	37	CCDS53859.1																																																																																				0.597	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
SHISA2	387914	broad.mit.edu	37	13	26620912	26620912	+	Silent	SNP	C	C	T	rs138455555	byFrequency	TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:26620912C>T	ENST00000319420.3	-	2	682	c.627G>A	c.(625-627)ccG>ccA	p.P209P		NM_001007538.1	NP_001007539.1	Q6UWI4	SHSA2_HUMAN	shisa family member 2	209					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P209P(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	17						TGGTCCCTTCCGGCAAGCAAC	0.587																																					p.P209P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G627A	13						.	C		0,4406		0,0,2203	147.0	136.0	140.0		627	-8.4	0.9	13	dbSNP_134	140	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous	SHISA2	NM_001007538.1		0,7,6496	TT,TC,CC		0.0814,0.0,0.0538		209/296	26620912	7,12999	2203	4300	6503	25518912	SO:0001819	synonymous_variant	387914	exon2				CCDS31951.1	13q12.13	2013-07-31	2013-07-31	2008-04-01	ENSG00000180730	ENSG00000180730		"""Shisa homologs"""	20366	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 13"", ""transmembrane protein 46"", ""shisa homolog 2 (Xenopus laevis)"""	C13orf13, TMEM46			Standard	NM_001007538		Approved	bA398O19.2, PRO28631, WGAR9166, hShisa	uc001uqm.1	Q6UWI4	OTTHUMG00000016612	ENST00000319420.3:c.627G>A	13.37:g.26620912C>T			25518912	NM_001007538	B9EH70|Q5W0G8	Silent	SNP	ENST00000319420.3	37	CCDS31951.1																																																																																				0.587	SHISA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044239.2	NM_001007538	
PCDH9	5101	broad.mit.edu	37	13	67205527	67205527	+	Missense_Mutation	SNP	G	G	A	rs150709677		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:67205527G>A	ENST00000377865.2	-	3	3289	c.3155C>T	c.(3154-3156)aCg>aTg	p.T1052M	PCDH9_ENST00000456367.1_Missense_Mutation_p.T1018M|PCDH9_ENST00000328454.5_Missense_Mutation_p.T1018M|RNU7-87P_ENST00000459343.1_RNA|PCDH9_ENST00000544246.1_Missense_Mutation_p.T1052M			Q9HC56	PCDH9_HUMAN	protocadherin 9	1052					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1052M(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GAGATGAAACGTAACACGGCG	0.498																																					p.T1018M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3053T	13						.	G	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	81.0	71.0	75.0		3053,3155	5.6	1.0	13	dbSNP_134	75	0,8600		0,0,4300	no	missense,missense	PCDH9	NM_020403.4,NM_203487.2	81,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1018/1204,1052/1238	67205527	1,13005	2203	4300	6503	66103528	SO:0001583	missense	5101	exon3			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3155C>T	13.37:g.67205527G>A	ENSP00000367096:p.Thr1052Met		66103528	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541342	0.85917	2.27E-4	0.0	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.68479	-0.33;-0.33;0.13;0.13	5.63	5.63	0.86233	.	0.000000	0.45867	D	0.000336	T	0.77082	0.4078	L	0.61036	1.89	0.44956	D	0.997973	B;D	0.63880	0.33;0.993	B;P	0.55303	0.079;0.773	T	0.79125	-0.1932	10	0.87932	D	0	.	19.6801	0.95958	0.0:0.0:1.0:0.0	.	1018;1052	Q9HC56-2;Q9HC56	.;PCDH9_HUMAN	M	1052;1052;1018;1018	ENSP00000442186:T1052M;ENSP00000367096:T1052M;ENSP00000401699:T1018M;ENSP00000332060:T1018M	ENSP00000332060:T1018M	T	-	2	0	PCDH9	66103528	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	9.476000	0.97823	2.652000	0.90054	0.655000	0.94253	ACG		0.498	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
EDNRB	1910	broad.mit.edu	37	13	78474707	78474707	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3894-01	TCGA-AG-3894-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:78474707A>G	ENST00000334286.5	-	5	1270	c.1034T>C	c.(1033-1035)cTg>cCg	p.L345P	EDNRB_ENST00000446573.1_Missense_Mutation_p.L345P|EDNRB_ENST00000377211.4_Missense_Mutation_p.L435P	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	345					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.L345P(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	AGTGAGCTTCAGAATCCTGCT	0.423																																					p.L345P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1034C	13						.						84.0	88.0	87.0					13																	78474707		2203	4300	6503	77372708	SO:0001583	missense	1910	exon5			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.1034T>C	13.37:g.78474707A>G	ENSP00000335311:p.Leu345Pro		77372708	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.548178	0.86022	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.44482	0.92;0.92;0.92	5.62	5.62	0.85841	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75243	0.3823	H	0.95745	3.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.99;0.999	D	0.83475	0.0061	10	0.87932	D	0	-14.6951	16.1323	0.81449	1.0:0.0:0.0:0.0	.	345;435;345	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	P	435;345;345	ENSP00000366416:L435P;ENSP00000403401:L345P;ENSP00000335311:L345P	ENSP00000335311:L345P	L	-	2	0	EDNRB	77372708	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.910000	0.92685	2.277000	0.76020	0.528000	0.53228	CTG		0.423	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
HS6ST3	266722	broad.mit.edu	37	13	97484897	97484897	+	Silent	SNP	G	G	T			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:97484897G>T	ENST00000376705.2	+	2	885	c.861G>T	c.(859-861)ggG>ggT	p.G287G		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	287					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)	p.G287G(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					GCTACCCTGGGGATGACTGGT	0.562																																					p.G287G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G861T	13						.						63.0	57.0	59.0					13																	97484897		2203	4300	6503	96282898	SO:0001819	synonymous_variant	266722	exon2			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.861G>T	13.37:g.97484897G>T			96282898	NM_153456	Q5W0L0|Q68CW6	Silent	SNP	ENST00000376705.2	37	CCDS9481.1																																																																																				0.562	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456	
PCCA	5095	broad.mit.edu	37	13	100807321	100807321	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr13:100807321C>T	ENST00000376285.1	+	5	427	c.389C>T	c.(388-390)gCc>gTc	p.A130V	PCCA_ENST00000376286.4_Missense_Mutation_p.A104V|PCCA_ENST00000485946.1_3'UTR|PCCA_ENST00000376279.3_Missense_Mutation_p.A130V	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	130	Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)	p.A130V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	ATCATGGAAGCCATTAAGAAA	0.448																																					p.A130V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C389T	13						.						108.0	106.0	107.0					13																	100807321		2203	4300	6503	99605322	SO:0001583	missense	5095	exon5			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.389C>T	13.37:g.100807321C>T	ENSP00000365462:p.Ala130Val		99605322	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419210	0.62622	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97303	-4.33;-4.33;-4.33	5.69	5.69	0.88448	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Biotin carboxylation domain (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.062827	0.64402	D	0.000006	D	0.95809	0.8636	L	0.50333	1.59	0.80722	D	1	B;P;P	0.39326	0.412;0.668;0.486	B;B;B	0.43916	0.436;0.197;0.298	D	0.94588	0.7785	10	0.36615	T	0.2	.	13.4914	0.61397	0.0:0.9194:0.0:0.0806	.	130;104;130	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	V	104;130;130	ENSP00000365463:A104V;ENSP00000365456:A130V;ENSP00000365462:A130V	ENSP00000365456:A130V	A	+	2	0	PCCA	99605322	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.772000	0.68889	2.685000	0.91497	0.655000	0.94253	GCC		0.448	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		
TUBB8	347688	broad.mit.edu	37	10	93397	93397	+	Missense_Mutation	SNP	G	G	A	rs559882106		TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr10:93397G>A	ENST00000309812.4	-	4	997	c.935C>T	c.(934-936)aCg>aTg	p.T312M	TUBB8_ENST00000413237.3_5'Flank|TUBB8_ENST00000447903.2_Missense_Mutation_p.T240M	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	312					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.T312M(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GGCAGCCGCCGTTAGGTAGCG	0.537													g|||	1	0.000199681	0.0	0.0	5008	,	,		19635	0.0		0.0	False		,,,				2504	0.001				p.T240M	Pancreas(192;2041 3010 9013 18103)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C719T	10						.						56.0	71.0	66.0					10																	93397		1843	3629	5472	83397	SO:0001583	missense	347688	exon4			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.935C>T	10.37:g.93397G>A	ENSP00000311042:p.Thr312Met		83397	NM_001164154	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	G	9.714	1.157837	0.21454	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	D	0.85171	-1.95	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.180284	0.33327	U	0.005023	D	0.91546	0.7330	H	0.97659	4.05	0.36099	D	0.843982	B;D	0.76494	0.3;0.999	B;P	0.54372	0.018;0.75	D	0.90420	0.4416	9	0.87932	D	0	.	5.9051	0.18992	8.0E-4:0.0:0.9992:0.0	.	275;312	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	M	240;278;275;312	ENSP00000403895:T240M	ENSP00000272035:T278M	T	-	2	0	RP11-631M21.2	83397	1.000000	0.71417	0.016000	0.15963	0.016000	0.09150	6.635000	0.74295	0.119000	0.18210	0.121000	0.15741	ACG		0.537	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
ATRNL1	26033	broad.mit.edu	37	10	117226742	117226742	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr10:117226742C>T	ENST00000355044.3	+	23	3602	c.3476C>T	c.(3475-3477)aCg>aTg	p.T1159M	ATRNL1_ENST00000423111.2_Missense_Mutation_p.T210M|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1159					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.T1159K(1)|p.T1159M(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CTCAACATTACGTGGTCTGTC	0.299																																					p.T1159M												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C3476T	10						.						131.0	126.0	128.0					10																	117226742		2202	4296	6498	117216732	SO:0001583	missense	26033	exon23			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3476C>T	10.37:g.117226742C>T	ENSP00000347152:p.Thr1159Met		117216732	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439717	0.83885	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;T	0.52526	0.66;0.66	4.69	4.69	0.59074	.	0.096790	0.64402	D	0.000001	T	0.66761	0.2822	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	P;P	0.60609	0.877;0.877	T	0.72782	-0.4189	10	0.87932	D	0	-9.0931	17.9819	0.89144	0.0:1.0:0.0:0.0	.	210;1159	B4DH41;Q5VV63	.;ATRN1_HUMAN	M	1159;210	ENSP00000347152:T1159M;ENSP00000409624:T210M	ENSP00000347152:T1159M	T	+	2	0	ATRNL1	117216732	1.000000	0.71417	0.918000	0.36340	0.882000	0.50991	7.580000	0.82523	2.311000	0.77944	0.655000	0.94253	ACG		0.299	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
APC	324	broad.mit.edu	37	5	112128143	112128143	+	Splice_Site	SNP	C	C	T	rs62619935		TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:112128143C>T	ENST00000457016.1	+	7	1026	c.646C>T	c.(646-648)Cga>Tga	p.R216*	APC_ENST00000508376.2_Splice_Site_p.R216*|APC_ENST00000257430.4_Splice_Site_p.R216*			P25054	APC_HUMAN	adenomatous polyposis coli	216	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R216*(12)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTATTTTAGCGAAGAATAGC	0.323		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R216X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	12	Substitution - Nonsense(12)	large_intestine(12)	c.C646T	5	GRCh37	CM992133	APC	M	rs62619935	.						52.0	51.0	51.0					5																	112128143		2202	4300	6502	112156042	SO:0001630	splice_region_variant	324	exon8	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.646-1C>T	5.37:g.112128143C>T			112156042	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	39	7.466758	0.98302	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.19	2.99	0.34606	.	0.630262	0.16042	N	0.232387	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2274	1.7088	0.02888	0.2899:0.3634:0.2259:0.1208	rs62619935	.	.	.	X	216	.	.	R	+	1	2	APC	112156042	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	0.662000	0.25038	1.304000	0.44892	-0.158000	0.13435	CGA		0.323	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	Nonsense_Mutation
PCDHB16	57717	broad.mit.edu	37	5	140564100	140564100	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:140564100G>A	ENST00000361016.2	+	1	3121	c.1966G>A	c.(1966-1968)Gcc>Acc	p.A656T		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	656	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A656T(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGGCCACCGCCACGCTGCA	0.706																																					p.A656T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1966A	5						.						21.0	25.0	23.0					5																	140564100		2165	4244	6409	140544284	SO:0001583	missense	57717	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1966G>A	5.37:g.140564100G>A	ENSP00000354293:p.Ala656Thr		140544284	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	13.48	2.251085	0.39797	.	.	ENSG00000196963	ENST00000361016	T	0.50548	0.74	3.75	3.75	0.43078	Cadherin (4);Cadherin-like (1);	0.573872	0.13146	N	0.410254	T	0.43831	0.1265	L	0.43554	1.36	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.43988	-0.9357	10	0.62326	D	0.03	.	15.2277	0.73364	0.0:0.0:1.0:0.0	.	656	Q9NRJ7	PCDBG_HUMAN	T	656	ENSP00000354293:A656T	ENSP00000354293:A656T	A	+	1	0	PCDHB16	140544284	0.001000	0.12720	1.000000	0.80357	0.782000	0.44232	0.923000	0.28757	1.638000	0.50547	0.298000	0.19748	GCC		0.706	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB13	56123	broad.mit.edu	37	5	140595300	140595300	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:140595300C>G	ENST00000341948.4	+	1	1792	c.1605C>G	c.(1603-1605)gaC>gaG	p.D535E		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	535	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D535E(1)		NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGCTTCAGACCACGGCTCCC	0.677																																					p.D535E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1605G	5						.						52.0	59.0	57.0					5																	140595300		2203	4300	6503	140575484	SO:0001583	missense	56123	exon1			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1605C>G	5.37:g.140595300C>G	ENSP00000345491:p.Asp535Glu		140575484	NM_018933	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	.	.	.	.	.	.	.	.	.	.	N	15.74	2.923741	0.52653	.	.	ENSG00000187372	ENST00000341948;ENST00000430318	T	0.80304	-1.36	3.42	2.17	0.27698	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.89466	0.6723	M	0.91196	3.185	0.23704	N	0.997062	D	0.89917	1.0	D	0.81914	0.995	T	0.77270	-0.2650	9	0.87932	D	0	.	5.478	0.16706	0.0:0.6053:0.0:0.3947	.	535	Q9Y5F0	PCDBD_HUMAN	E	535	ENSP00000345491:D535E	ENSP00000345491:D535E	D	+	3	2	PCDHB13	140575484	0.010000	0.17322	0.037000	0.18230	0.002000	0.02628	0.230000	0.17852	1.644000	0.50603	0.449000	0.29647	GAC		0.677	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
PCDHGB7	56099	broad.mit.edu	37	5	140798415	140798415	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:140798415G>A	ENST00000398594.2	+	1	989	c.989G>A	c.(988-990)cGg>cAg	p.R330Q	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	330	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R330Q(1)		central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTCAACACGGTGTAAAGTA	0.403																																					p.R330Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G989A	5						.						75.0	71.0	72.0					5																	140798415		1880	4105	5985	140778599	SO:0001583	missense	56099	exon1			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.989G>A	5.37:g.140798415G>A	ENSP00000381594:p.Arg330Gln		140778599	NM_032101	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	6.226	0.409788	0.11812	.	.	ENSG00000254122	ENST00000398594	T	0.52295	0.67	5.7	2.07	0.26955	Cadherin (4);Cadherin-like (1);	0.957125	0.08379	N	0.954798	T	0.20536	0.0494	N	0.01668	-0.77	0.20563	N	0.999884	B;B	0.11235	0.004;0.002	B;B	0.08055	0.003;0.002	T	0.24548	-1.0157	10	0.20046	T	0.44	.	8.9543	0.35807	0.7812:0.0:0.2188:0.0	.	330;330	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	Q	330	ENSP00000381594:R330Q	ENSP00000381594:R330Q	R	+	2	0	PCDHGB7	140778599	0.001000	0.12720	0.993000	0.49108	0.387000	0.30353	1.094000	0.30951	0.125000	0.18397	-0.367000	0.07326	CGG		0.403	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
ITK	3702	broad.mit.edu	37	5	156649874	156649874	+	Splice_Site	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:156649874G>A	ENST00000422843.3	+	6	649	c.497G>A	c.(496-498)cGa>cAa	p.R166Q	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	166					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.R166Q(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CTTCCCCAGCGACCACTTTGG	0.493			T	SYK	peripheral T-cell lymphoma																																p.R166Q	Esophageal Squamous(70;1378 1469 8785 19883)		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G497A	5						.						83.0	80.0	81.0					5																	156649874		2203	4300	6503	156582452	SO:0001630	splice_region_variant	3702	exon6			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.496-1G>A	5.37:g.156649874G>A			156582452	NM_005546	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	37	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.503528	0.26949	.	.	ENSG00000113263	ENST00000521769;ENST00000422843	D;T	0.89617	-2.54;-0.9	5.81	4.03	0.46877	.	0.434100	0.23014	N	0.052940	D	0.82838	0.5124	L	0.52573	1.65	0.35863	D	0.827628	B	0.21905	0.062	B	0.12156	0.007	T	0.79364	-0.1834	10	0.25751	T	0.34	.	7.2212	0.25988	0.243:0.0:0.757:0.0	.	166	Q08881	ITK_HUMAN	Q	41;166	ENSP00000430327:R41Q;ENSP00000398655:R166Q	ENSP00000398655:R166Q	R	+	2	0	ITK	156582452	0.166000	0.22962	0.952000	0.39060	0.120000	0.20174	0.904000	0.28491	1.463000	0.47967	0.591000	0.81541	CGA		0.493	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		Missense_Mutation
GZMK	3003	broad.mit.edu	37	5	54320566	54320566	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3894-01	TCGA-AG-3894-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:54320566G>A	ENST00000231009.2	+	2	213	c.143G>A	c.(142-144)gGa>gAa	p.G48E	ESM1_ENST00000598310.1_5'Flank|CTD-2313F11.1_ENST00000371487.3_RNA|CTD-2313F11.1_ENST00000608929.1_RNA|CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000608466.1_RNA|CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA|CTD-2313F11.1_ENST00000607910.1_RNA|CTD-2313F11.1_ENST00000596909.2_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	48	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G48E(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CAGTATGGCGGACATCACGTT	0.473																																					p.G48E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G143A	5						.						57.0	58.0	57.0					5																	54320566		2203	4300	6503	54356323	SO:0001583	missense	3003	exon2			BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.143G>A	5.37:g.54320566G>A	ENSP00000231009:p.Gly48Glu		54356323	NM_002104	B2R563	Missense_Mutation	SNP	ENST00000231009.2	37	CCDS3964.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.264835	0.40095	.	.	ENSG00000113088	ENST00000231009	D	0.88586	-2.4	5.11	4.23	0.50019	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.458056	0.20870	N	0.084197	D	0.90868	0.7131	L	0.58669	1.825	0.09310	N	1	P	0.43314	0.803	P	0.51615	0.675	D	0.85007	0.0903	10	0.54805	T	0.06	.	14.9433	0.71012	0.0:0.1442:0.8558:0.0	.	48	P49863	GRAK_HUMAN	E	48	ENSP00000231009:G48E	ENSP00000231009:G48E	G	+	2	0	GZMK	54356323	0.003000	0.15002	0.007000	0.13788	0.405000	0.30901	1.364000	0.34171	1.507000	0.48752	0.591000	0.81541	GGA		0.473	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214098.1	NM_002104	
FGF18	8817	broad.mit.edu	37	5	170863255	170863255	+	Silent	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr5:170863255C>T	ENST00000274625.5	+	3	772	c.228C>T	c.(226-228)cgC>cgT	p.R76R		NM_003862.2	NP_003853.1	O76093	FGF18_HUMAN	fibroblast growth factor 18	76					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte development (GO:0002063)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intramembranous ossification (GO:0001957)|lung development (GO:0030324)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleolus (GO:0005730)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)	p.R76R(1)		endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	9	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TCAGTGCCCGCGGCGAGGATG	0.592																																					p.R76R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C228T	5						.						76.0	70.0	72.0					5																	170863255		2202	4300	6502	170795860	SO:0001819	synonymous_variant	8817	exon3			AB007422	CCDS4378.1	5q34	2008-02-05			ENSG00000156427	ENSG00000156427			3674	protein-coding gene	gene with protein product		603726				9660775, 9742123	Standard	NM_003862		Approved	FGF-18, ZFGF5	uc003mbk.3	O76093	OTTHUMG00000130464	ENST00000274625.5:c.228C>T	5.37:g.170863255C>T			170795860	NM_003862	D3DQL7|Q6UWF1	Silent	SNP	ENST00000274625.5	37	CCDS4378.1																																																																																				0.592	FGF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252857.2	NM_033649, NM_003862	
HMGN2P46	283651	broad.mit.edu	37	15	45848141	45848141	+	lincRNA	SNP	C	C	T			TCGA-AG-3894-01	TCGA-AG-3894-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3894-01	TCGA-AG-3894-01	g.chr15:45848141C>T	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							GAAGTGTGTGCATTTTTGATA	0.363																																					.												.	.	0			.	15						.						51.0	48.0	49.0					15																	45848141		2157	4202	6359	43635433			283651	.																															15.37:g.45848141C>T			43635433	.		Missense_Mutation	SNP	ENST00000557965.1	37																																																																																					0.363	RP11-96O20.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000416553.1		
