#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TP53	7157	broad.mit.edu	37	17	7576891	7576892	+	Frame_Shift_Ins	INS	-	-	TGGC			TCGA-AG-3898-01	TCGA-AG-3898-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr17:7576891_7576892insTGGC	ENST00000269305.4	-	9	1143_1144	c.954_955insGCCA	c.(952-957)ccaaagfs	p.PK318fs	TP53_ENST00000445888.2_Frame_Shift_Ins_p.PK318fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.PK318fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Ins_p.PK318fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.PK318fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	318	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		P -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.K319*(8)|p.P318fs*15(2)|p.K319fs*19(2)|p.K319E(2)|p.P318fs*21(1)|p.S315fs*22(1)|p.?(1)|p.S314fs*25(1)|p.L308fs*15(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGTTTCTTCTTTGGCTGGGGAG	0.47		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.K187fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,NS,Substitution - Nonsense,0	.	27	Substitution - Nonsense(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(2)|Substitution - Missense(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(6)|bone(4)|upper_aerodigestive_tract(3)|breast(3)|large_intestine(2)|stomach(2)|central_nervous_system(2)|urinary_tract(1)|lung(1)|skin(1)|ovary(1)|liver(1)	c.559_560insGCCA	17						.																																			7517617	SO:0001589	frameshift_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.951_954dupGCCA	17.37:g.7576892_7576895dupTGGC	ENSP00000269305:p.Pro318fs		7517616	NM_001126116	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1																																																																																				0.470	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RNF133	168433	broad.mit.edu	37	7	122338728	122338728	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr7:122338728A>T	ENST00000340112.2	-	1	482	c.245T>A	c.(244-246)aTc>aAc	p.I82N	CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	82	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.I82N(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						TGCATTTTGGATTTTTCCCTC	0.458																																					p.I82N	Colon(198;1778 2057 7449 19869 45985)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T245A	7						.						125.0	133.0	130.0					7																	122338728		2203	4299	6502	122125964	SO:0001583	missense	168433	exon1			AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.245T>A	7.37:g.122338728A>T	ENSP00000344489:p.Ile82Asn		122125964	NM_139175	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	37	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	A	2.356	-0.347693	0.05208	.	.	ENSG00000188050	ENST00000340112	T	0.13089	2.62	6.06	-8.6	0.00889	.	1.896570	0.03151	N	0.167944	T	0.03915	0.0110	N	0.01493	-0.835	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37454	-0.9705	10	0.39692	T	0.17	.	4.5968	0.12334	0.594:0.1548:0.1252:0.126	.	82	Q8WVZ7	RN133_HUMAN	N	82	ENSP00000344489:I82N	ENSP00000344489:I82N	I	-	2	0	RNF133	122125964	0.000000	0.05858	0.000000	0.03702	0.361000	0.29550	-0.994000	0.03716	-1.415000	0.02022	-1.815000	0.00603	ATC		0.458	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
ZC3HAV1	56829	broad.mit.edu	37	7	138774426	138774426	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr7:138774426T>G	ENST00000242351.5	-	2	704	c.388A>C	c.(388-390)Aac>Cac	p.N130H	ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.N130H|ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.N130H	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	130	N-terminal domain.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)	p.N130H(1)		cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TCCTCTTTGTTCAGTCCAGAG	0.408																																					p.N130H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A388C	7						.						121.0	109.0	113.0					7																	138774426		2203	4300	6503	138424966	SO:0001583	missense	56829	exon2			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.388A>C	7.37:g.138774426T>G	ENSP00000242351:p.Asn130His		138424966	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	ENST00000242351.5	37	CCDS5851.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741287	0.49151	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652	T;T;T	0.45668	0.89;0.89;0.89	4.21	2.96	0.34315	.	0.292580	0.24886	N	0.034816	T	0.53850	0.1822	L	0.60455	1.87	0.21445	N	0.99969	D;D	0.89917	0.999;1.0	D;D	0.76071	0.987;0.97	T	0.33624	-0.9861	10	0.72032	D	0.01	.	6.4587	0.21944	0.2167:0.0:0.0:0.7833	.	130;130	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	H	130	ENSP00000242351:N130H;ENSP00000418385:N130H;ENSP00000419855:N130H	ENSP00000242351:N130H	N	-	1	0	ZC3HAV1	138424966	0.850000	0.29656	0.900000	0.35374	0.703000	0.40648	2.673000	0.46858	1.895000	0.54865	0.528000	0.53228	AAC		0.408	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
FAM115C	285966	broad.mit.edu	37	7	143417092	143417092	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr7:143417092C>G	ENST00000441159.2	+	3	1006	c.940C>G	c.(940-942)Cta>Gta	p.L314V	FAM115C_ENST00000425618.2_Missense_Mutation_p.L33V|FAM115C_ENST00000411497.2_Missense_Mutation_p.L33V|FAM115C_ENST00000444908.2_Missense_Mutation_p.L314V|FAM115C_ENST00000409703.3_Missense_Mutation_p.L150V|FAM115C_ENST00000357344.4_Missense_Mutation_p.L314V|FAM115C_ENST00000411935.1_Missense_Mutation_p.L150V			A6NFQ2	F115C_HUMAN	family with sequence similarity 115, member C	314					hematopoietic progenitor cell differentiation (GO:0002244)			p.L314V(1)		endometrium(2)|large_intestine(4)|lung(2)|prostate(1)	9						GTGTCCTCTCCTATCGGAGCA	0.557																																					p.L150V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C448G	7						.						4.0	4.0	4.0					7																	143417092		1106	2465	3571	143048025	SO:0001583	missense	285966	exon2			AY167570	CCDS34769.1, CCDS47735.1, CCDS47735.2	7q35	2010-08-03	2008-06-12	2008-06-12	ENSG00000170379	ENSG00000170379			26878	protein-coding gene	gene with protein product			"""family with sequence similarity 139, member A"""	FAM139A			Standard	NM_173678		Approved	FLJ40722	uc003wdf.3	A6NFQ2	OTTHUMG00000153232	ENST00000441159.2:c.940C>G	7.37:g.143417092C>G	ENSP00000404265:p.Leu314Val		143048025	NM_001130026	B4DK02|Q14D25|Q17RQ4|Q8IWQ0|Q8NF84	Missense_Mutation	SNP	ENST00000441159.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	5.437|5.437	0.265728|0.265728	0.10294|0.10294	.|.	.|.	ENSG00000170379|ENSG00000170379	ENST00000444908;ENST00000411497;ENST00000357344;ENST00000441159;ENST00000411935;ENST00000409703;ENST00000425618|ENST00000518791	T;T;T;T;T|.	0.21734|.	1.99;1.99;1.99;1.99;1.99|.	3.58|3.58	1.69|1.69	0.24217|0.24217	.|.	0.067496|.	0.64402|.	D|.	0.000011|.	T|T	0.48642|0.48642	0.1511|0.1511	M|M	0.77103|0.77103	2.36|2.36	0.09310|0.09310	N|N	1|1	D;D;D;D|.	0.58268|.	0.982;0.969;0.969;0.982|.	P;P;P;P|.	0.55055|.	0.713;0.45;0.52;0.767|.	T|T	0.40664|0.40664	-0.9551|-0.9551	10|5	0.42905|.	T|.	0.14|.	-23.1762|-23.1762	5.8374|5.8374	0.18615|0.18615	0.0:0.6143:0.0:0.3857|0.0:0.6143:0.0:0.3857	.|.	150;314;33;314|.	A6NFQ2-3;A6NFQ2;Q8N1I1;A6NFQ2-2|.	.;F115C_HUMAN;.;.|.	V|R	314;33;314;314;150;150;33|128	ENSP00000412724:L314V;ENSP00000349902:L314V;ENSP00000404265:L314V;ENSP00000389100:L150V;ENSP00000386405:L150V|.	ENSP00000349902:L314V|.	L|P	+|+	1|2	2|0	FAM115C|FAM115C	143048025|143048025	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.126000|0.126000	0.20510|0.20510	-0.169000|-0.169000	0.09911|0.09911	0.259000|0.259000	0.21709|0.21709	0.411000|0.411000	0.27672|0.27672	CTA|CCT		0.557	FAM115C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000330287.1	NM_173678	
FTSJ2	29960	broad.mit.edu	37	7	2279173	2279173	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr7:2279173G>A	ENST00000242257.8	-	2	206	c.178C>T	c.(178-180)Ctc>Ttc	p.L60F	FTSJ2_ENST00000440306.2_Missense_Mutation_p.L60F|NUDT1_ENST00000356714.1_5'Flank|NUDT1_ENST00000397049.1_5'Flank|FTSJ2_ENST00000486040.1_5'UTR|NUDT1_ENST00000397048.1_5'Flank|FTSJ2_ENST00000407040.1_5'Flank|NUDT1_ENST00000397046.1_5'Flank	NM_013393.1	NP_037525.1			FtsJ RNA methyltransferase homolog 2 (E. coli)									p.L60F(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.7e-14)		ACCTCCAGGAGCTTGAAGGCG	0.627																																					p.L60F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C178T	7						.						69.0	65.0	67.0					7																	2279173		2203	4300	6503	2245699	SO:0001583	missense	29960	exon2			AF093415	CCDS5328.1	7p22	2012-06-12	2012-06-12		ENSG00000122687	ENSG00000122687			16352	protein-coding gene	gene with protein product	"""rRNA (uridine-2'-O-)-methyltransferase"", ""MRM2 RNA methyltransferase homolog (S. cerevisiae)"""	606906				11827451	Standard	NM_013393		Approved	FJH1, MRM2	uc003slm.3	Q9UI43	OTTHUMG00000023866	ENST00000242257.8:c.178C>T	7.37:g.2279173G>A	ENSP00000242257:p.Leu60Phe		2245699	NM_013393		Missense_Mutation	SNP	ENST00000242257.8	37	CCDS5328.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.581482	0.86748	.	.	ENSG00000122687	ENST00000242257;ENST00000440306	T;T	0.64803	-0.12;-0.12	5.96	5.96	0.96718	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.000000	0.64402	D	0.000001	D	0.85234	0.5650	H	0.95884	3.735	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88912	0.3360	10	0.87932	D	0	-0.3659	14.0108	0.64495	0.0772:0.0:0.9228:0.0	.	60	Q9UI43	RRMJ2_HUMAN	F	60	ENSP00000242257:L60F;ENSP00000392343:L60F	ENSP00000242257:L60F	L	-	1	0	FTSJ2	2245699	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	5.201000	0.65163	2.832000	0.97577	0.655000	0.94253	CTC		0.627	FTSJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060187.1	NM_013393	
WDR60	55112	broad.mit.edu	37	7	158672383	158672383	+	Silent	SNP	C	C	T	rs368847195		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr7:158672383C>T	ENST00000407559.3	+	5	740	c.582C>T	c.(580-582)taC>taT	p.Y194Y		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	194					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.Y194Y(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		AGCTGCAGTACGGAGACAGCA	0.522																																					p.Y194Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C582T	7						.			1,3947		0,1,1973	48.0	50.0	50.0		582	-2.3	0.3	7		50	0,8340		0,0,4170	no	coding-synonymous	WDR60	NM_018051.4		0,1,6143	TT,TC,CC		0.0,0.0253,0.0081		194/1067	158672383	1,12287	1974	4170	6144	158365144	SO:0001819	synonymous_variant	55112	exon5				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.582C>T	7.37:g.158672383C>T			158365144	NM_018051	Q9NW58	Silent	SNP	ENST00000407559.3	37	CCDS47757.1																																																																																				0.522	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
TASP1	55617	broad.mit.edu	37	20	13463941	13463941	+	Silent	SNP	A	A	G			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr20:13463941A>G	ENST00000337743.4	-	11	1038	c.918T>C	c.(916-918)tgT>tgC	p.C306C	TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_Missense_Mutation_p.V109A	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	306					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)	p.C306C(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						AAGCATGTGAACATTCTCTAG	0.418																																					p.C306C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T918C	20						.						166.0	154.0	158.0					20																	13463941		2203	4300	6503	13411941	SO:0001819	synonymous_variant	55617	exon11			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.918T>C	20.37:g.13463941A>G			13411941	NM_017714	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Silent	SNP	ENST00000337743.4	37	CCDS13116.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.742900	0.30865	.	.	ENSG00000089123	ENST00000539805	.	.	.	5.72	3.47	0.39725	.	.	.	.	.	T	0.30854	0.0778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.11842	-1.0571	5	0.02654	T	1	-0.6388	9.9838	0.41830	0.8612:0.0:0.1388:0.0	.	.	.	.	A	109	.	ENSP00000444062:V109A	V	-	2	0	TASP1	13411941	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.501000	0.60393	0.520000	0.28426	-0.263000	0.10527	GTT		0.418	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
FLRT3	23767	broad.mit.edu	37	20	14307773	14307773	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr20:14307773A>T	ENST00000378053.3	-	2	636	c.380T>A	c.(379-381)aTt>aAt	p.I127N	MACROD2_ENST00000310348.4_Intron|MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000341420.4_Missense_Mutation_p.I127N|FLRT3_ENST00000462077.1_5'Flank	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	127					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.I127N(1)		breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		CAGATAGGGAATTTTTGAAAG	0.368																																					p.I127N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T380A	20						.						129.0	135.0	133.0					20																	14307773		2203	4300	6503	14255773	SO:0001583	missense	23767	exon3			AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.380T>A	20.37:g.14307773A>T	ENSP00000367292:p.Ile127Asn		14255773	NM_198391	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	ENST00000378053.3	37	CCDS13121.1	.	.	.	.	.	.	.	.	.	.	A	28.2	4.896384	0.91962	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.57107	0.42;0.42	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.55909	0.1950	N	0.19112	0.55	0.80722	D	1	D	0.54397	0.966	P	0.58620	0.842	T	0.59841	-0.7378	10	0.56958	D	0.05	-14.7729	16.6093	0.84858	1.0:0.0:0.0:0.0	.	127	Q9NZU0	FLRT3_HUMAN	N	127	ENSP00000367292:I127N;ENSP00000339912:I127N	ENSP00000339912:I127N	I	-	2	0	FLRT3	14255773	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.324000	0.78689	0.533000	0.62120	ATT		0.368	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	NM_013281	
CSRP2BP	57325	broad.mit.edu	37	20	18163911	18163911	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr20:18163911C>G	ENST00000435364.3	+	8	2294	c.1953C>G	c.(1951-1953)atC>atG	p.I651M	CSRP2BP_ENST00000489634.2_Missense_Mutation_p.I523M|CSRP2BP_ENST00000377681.3_Missense_Mutation_p.I650M	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	651	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.I651M(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TCCCAACGATCAACTCCATGT	0.498																																					p.I651M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1953G	20						.						137.0	129.0	132.0					20																	18163911		2203	4300	6503	18111911	SO:0001583	missense	57325	exon8			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.1953C>G	20.37:g.18163911C>G	ENSP00000392318:p.Ile651Met		18111911	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	37	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903271	0.72754	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	6.04	3.91	0.45181	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	0.048340	0.85682	D	0.000000	T	0.58906	0.2155	M	0.71581	2.175	0.49051	D	0.999749	D;P	0.55800	0.973;0.954	P;P	0.59889	0.865;0.736	T	0.59337	-0.7473	10	0.87932	D	0	-18.4013	6.2852	0.21029	0.3816:0.417:0.0:0.2014	.	523;651	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	M	651;650;651;523	ENSP00000278816:I651M;ENSP00000366909:I650M;ENSP00000392318:I651M;ENSP00000425909:I523M	ENSP00000278816:I651M	I	+	3	3	CSRP2BP	18111911	0.993000	0.37304	0.998000	0.56505	0.989000	0.77384	0.466000	0.22019	0.683000	0.31428	0.563000	0.77884	ATC		0.498	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
CSRP2BP	57325	broad.mit.edu	37	20	18165310	18165310	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr20:18165310C>T	ENST00000435364.3	+	9	2390	c.2049C>T	c.(2047-2049)gtC>gtT	p.V683V	CSRP2BP_ENST00000489634.2_Silent_p.V555V|CSRP2BP_ENST00000377681.3_Silent_p.V682V	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	683	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)	p.V683V(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						ATAAAAAAGTCATCATTGCCT	0.413																																					p.V683V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2049T	20						.						221.0	191.0	201.0					20																	18165310		2203	4300	6503	18113310	SO:0001819	synonymous_variant	57325	exon9			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2049C>T	20.37:g.18165310C>T			18113310	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Silent	SNP	ENST00000435364.3	37	CCDS13133.1																																																																																				0.413	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
CHMP4B	128866	broad.mit.edu	37	20	32439957	32439957	+	Silent	SNP	C	C	T	rs79766928	byFrequency	TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr20:32439957C>T	ENST00000217402.2	+	4	723	c.558C>T	c.(556-558)ccC>ccT	p.P186P		NM_176812.4	NP_789782.1	Q9H444	CHM4B_HUMAN	charged multivesicular body protein 4B	186					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|positive regulation of viral release from host cell (GO:1902188)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)	p.P186P(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13						TCAGTGGACCCGAAACAGTCC	0.478													C|||	46	0.0091853	0.0303	0.0072	5008	,	,		19331	0.0		0.0	False		,,,				2504	0.001				p.P186P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C558T	20						.	C		86,4320	73.1+/-111.1	4,78,2121	154.0	143.0	147.0		558	-7.0	1.0	20	dbSNP_131	147	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	CHMP4B	NM_176812.4		4,81,6418	TT,TC,CC		0.0349,1.9519,0.6843		186/225	32439957	89,12917	2203	4300	6503	31903618	SO:0001819	synonymous_variant	128866	exon4			AL050349	CCDS13228.1	20q11.22	2011-09-21	2011-09-21	2005-04-04	ENSG00000101421	ENSG00000101421		"""Charged multivesicular body proteins"""	16171	protein-coding gene	gene with protein product		610897	"""chromosome 20 open reading frame 178"", ""chromatin modifying protein 4B"""	C20orf178		14678797	Standard	NM_176812		Approved	dJ553F4.4, Shax1, SNF7-2, VPS32B	uc002xaa.3	Q9H444	OTTHUMG00000032272	ENST00000217402.2:c.558C>T	20.37:g.32439957C>T			31903618	NM_176812	E1P5N4|Q53ZD6	Silent	SNP	ENST00000217402.2	37	CCDS13228.1																																																																																				0.478	CHMP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078738.2		
YTHDF1	54915	broad.mit.edu	37	20	61835065	61835065	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr20:61835065G>T	ENST00000370339.3	-	4	568	c.227C>A	c.(226-228)tCt>tAt	p.S76Y	YTHDF1_ENST00000370333.4_Missense_Mutation_p.S26Y|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	76							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)	p.S76Y(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						CCCTGCAGTAGACCACGGAGC	0.537																																					p.S76Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C227A	20						.						98.0	104.0	102.0					20																	61835065		2203	4300	6503	61305510	SO:0001583	missense	54915	exon4			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.227C>A	20.37:g.61835065G>T	ENSP00000359364:p.Ser76Tyr		61305510	NM_017798	Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	ENST00000370339.3	37	CCDS13511.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469416	0.63625	.	.	ENSG00000149658	ENST00000370339;ENST00000370333	T;T	0.54279	0.58;0.58	5.24	5.24	0.73138	.	0.049239	0.85682	D	0.000000	T	0.74412	0.3713	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76575	-0.2909	10	0.54805	T	0.06	-18.0279	18.8357	0.92162	0.0:0.0:1.0:0.0	.	76	Q9BYJ9	YTHD1_HUMAN	Y	76;26	ENSP00000359364:S76Y;ENSP00000359358:S26Y	ENSP00000359358:S26Y	S	-	2	0	YTHDF1	61305510	1.000000	0.71417	0.942000	0.38095	0.403000	0.30841	9.725000	0.98778	2.448000	0.82819	0.561000	0.74099	TCT		0.537	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080110.2	NM_017798	
CECR5	27440	broad.mit.edu	37	22	17624004	17624004	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr22:17624004G>C	ENST00000336737.4	-	5	580	c.555C>G	c.(553-555)gaC>gaG	p.D185E	CECR5_ENST00000399852.3_Missense_Mutation_p.D48E|CECR5_ENST00000155674.5_Missense_Mutation_p.D155E	NM_033070.2	NP_149061.1	Q9BXW7	CECR5_HUMAN	cat eye syndrome chromosome region, candidate 5	185						mitochondrion (GO:0005739)		p.D185E(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(10)|pancreas(1)|prostate(1)	21		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)				TGCGGGGGAAGTCATTCCTCG	0.567																																					p.D185E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C555G	22						.						93.0	81.0	85.0					22																	17624004		2203	4300	6503	16004004	SO:0001583	missense	27440	exon5			AF273270	CCDS13741.1, CCDS33595.1	22q11.2	2008-06-12			ENSG00000069998	ENSG00000069998			1843	protein-coding gene	gene with protein product						11381032	Standard	NM_017829		Approved		uc002zmf.3	Q9BXW7	OTTHUMG00000150071	ENST00000336737.4:c.555C>G	22.37:g.17624004G>C	ENSP00000337358:p.Asp185Glu		16004004	NM_033070	B2RCK5|Q9BXW8|Q9NWA8|Q9NX41	Missense_Mutation	SNP	ENST00000336737.4	37	CCDS33595.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.931654	0.52866	.	.	ENSG00000069998	ENST00000155674;ENST00000336737;ENST00000399852	T;T;T	0.22539	2.0;2.0;1.95	5.62	4.6	0.57074	HAD-like domain (1);	0.289501	0.38111	N	0.001806	T	0.27205	0.0667	L	0.52266	1.64	0.27895	N	0.9392	B;P;B	0.48089	0.004;0.905;0.017	B;P;B	0.50860	0.008;0.652;0.009	T	0.07597	-1.0764	10	0.17369	T	0.5	-20.3512	12.5239	0.56075	0.078:0.0:0.922:0.0	.	155;48;185	Q9BXW7-2;A8MYZ9;Q9BXW7	.;.;CECR5_HUMAN	E	155;185;48	ENSP00000155674:D155E;ENSP00000337358:D185E;ENSP00000382745:D48E	ENSP00000155674:D155E	D	-	3	2	CECR5	16004004	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	3.046000	0.49846	1.389000	0.46526	0.561000	0.74099	GAC		0.567	CECR5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316100.1	NM_017829	
HKR1	284459	broad.mit.edu	37	19	37854172	37854172	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr19:37854172C>T	ENST00000324411.4	+	6	1744	c.1475C>T	c.(1474-1476)aCg>aTg	p.T492M	HKR1_ENST00000541583.2_Missense_Mutation_p.T431M|HKR1_ENST00000591471.1_Missense_Mutation_p.T219M|HKR1_ENST00000392153.3_Missense_Mutation_p.T473M|HKR1_ENST00000544914.1_Missense_Mutation_p.T219M|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000589392.1_Missense_Mutation_p.T474M	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	492					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T492M(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGTCACACACGGGGGAGAAG	0.537																																					p.T492M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1475T	19						.						82.0	80.0	81.0					19																	37854172		2203	4300	6503	42546012	SO:0001583	missense	284459	exon6			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1475C>T	19.37:g.37854172C>T	ENSP00000315505:p.Thr492Met		42546012	NM_181786	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926900	0.34002	.	.	ENSG00000181666	ENST00000544914;ENST00000414402;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	3.04	0.571	0.17352	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50820	0.1638	M	0.89601	3.045	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.991	D;D;D;P	0.81914	0.995;0.988;0.958;0.638	T	0.53648	-0.8409	9	0.87932	D	0	.	6.5745	0.22557	0.1766:0.7113:0.0:0.1121	.	431;473;492;474	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	M	219;271;473;528;492;431	ENSP00000437774:T219M;ENSP00000375994:T473M;ENSP00000315505:T492M;ENSP00000438261:T431M	ENSP00000315505:T492M	T	+	2	0	HKR1	42546012	0.002000	0.14202	0.460000	0.27093	0.360000	0.29518	0.173000	0.16724	0.604000	0.29930	-0.145000	0.13849	ACG		0.537	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458375.1	NM_181786	
SIGLEC11	114132	broad.mit.edu	37	19	50453238	50453239	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-AG-3898-01	TCGA-AG-3898-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr19:50453238_50453239CC>AA	ENST00000447370.2	-	11	2175_2176	c.2085_2086GG>TT	c.(2083-2088)atGGtt>atTTtt	p.695_696MV>IF	U3_ENST00000408198.1_RNA|CTC-326K19.6_ENST00000451973.1_Intron|SIGLEC11_ENST00000426971.2_Missense_Mutation_p.599_600MV>IF	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	695					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.M683>?(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CACTTTGGAACCATCCCTGACA	0.579																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1797_1798TT	19						.																																			55145051	SO:0001583	missense	114132	exon10			AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.2085_2086delinsAA	19.37:g.50453238_50453239delinsAA	ENSP00000412361:p.M695_V696delinsIF		55145050	NM_001135163		Missense_Mutation	DNP	ENST00000447370.2	37	CCDS12790.2																																																																																				0.579	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
ZNF578	147660	broad.mit.edu	37	19	53014180	53014180	+	Silent	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr19:53014180G>A	ENST00000421239.2	+	6	790	c.546G>A	c.(544-546)aaG>aaA	p.K182K	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K182K(1)							GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AAGTGGAGAAGTCTGTCAACG	0.368																																					p.K182K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G546A	19						.						89.0	93.0	92.0					19																	53014180		2202	4300	6502	57705992	SO:0001819	synonymous_variant	147660	exon6			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.546G>A	19.37:g.53014180G>A			57705992	NM_001099694	B4DR51|I3L1Y6	Silent	SNP	ENST00000421239.2	37	CCDS54310.1																																																																																				0.368	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
MUC16	94025	broad.mit.edu	37	19	9075143	9075143	+	Silent	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr19:9075143G>A	ENST00000397910.4	-	3	12506	c.12303C>T	c.(12301-12303)ggC>ggT	p.G4101G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4103	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G4101G(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGATGTAGCGCCAGGTGGAC	0.507																																					p.G4101G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C12303T	19						.						123.0	119.0	120.0					19																	9075143		2102	4229	6331	8936143	SO:0001819	synonymous_variant	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12303C>T	19.37:g.9075143G>A			8936143	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF415	55786	broad.mit.edu	37	19	53612947	53612947	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr19:53612947A>T	ENST00000500065.4	-	4	684	c.351T>A	c.(349-351)aaT>aaA	p.N117K	ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000601215.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.N117K|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.N129K|ZNF415_ENST00000455735.2_Missense_Mutation_p.N165K|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000448501.1_Missense_Mutation_p.N165K|ZNF415_ENST00000440291.1_Missense_Mutation_p.N104K	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N117K(1)		breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TACAAGTAAGATTTTCTTTTG	0.398																																					p.N117K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T351A	19						.						120.0	109.0	113.0					19																	53612947		2203	4300	6503	58304759	SO:0001583	missense	55786	exon4			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.351T>A	19.37:g.53612947A>T	ENSP00000439435:p.Asn117Lys		58304759	NM_001136038	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	ENST00000500065.4	37	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	A	3.918	-0.018721	0.07681	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11;3.11	2.74	-2.82	0.05787	.	.	.	.	.	T	0.04861	0.0131	N	0.12182	0.205	0.09310	N	1	B;D;B;B;B;B	0.60575	0.078;0.988;0.148;0.078;0.078;0.231	B;P;B;B;B;B	0.52343	0.06;0.696;0.027;0.06;0.06;0.06	T	0.07177	-1.0786	9	0.02654	T	1	.	4.1075	0.10043	0.3812:0.2073:0.4115:0.0	.	117;165;165;117;104;129	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	K	117;117;165;129;165;104	ENSP00000243643:N117K;ENSP00000439435:N117K;ENSP00000396492:N165K;ENSP00000395055:N129K;ENSP00000388787:N165K;ENSP00000414601:N104K	ENSP00000243643:N117K	N	-	3	2	ZNF415	58304759	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	0.088000	0.14979	-0.963000	0.03600	0.260000	0.18958	AAT		0.398	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
FAM167A	83648	broad.mit.edu	37	8	11281913	11281913	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:11281913T>A	ENST00000528897.1	-	3	1233	c.614A>T	c.(613-615)aAc>aTc	p.N205I	FAM167A_ENST00000284486.4_Missense_Mutation_p.N205I|FAM167A_ENST00000534308.1_Missense_Mutation_p.N205I|C8orf12_ENST00000529305.1_Intron|C8orf12_ENST00000284481.3_Intron|FAM167A_ENST00000531564.1_5'UTR			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	205								p.N205I(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						AGAGTTGATGTTCATCTTGGT	0.607																																					p.N205I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A614T	8						.						129.0	109.0	116.0					8																	11281913		2203	4300	6503	11319323	SO:0001583	missense	83648	exon3				CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.614A>T	8.37:g.11281913T>A	ENSP00000436655:p.Asn205Ile		11319323	NM_053279	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	ENST00000528897.1	37	CCDS5981.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.548913	0.86127	.	.	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897	T;T;T	0.51325	0.71;0.71;0.71	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.65186	0.2667	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69003	-0.5260	10	0.87932	D	0	-0.8951	13.6866	0.62520	0.0:0.0:0.0:1.0	.	205	Q96KS9	F167A_HUMAN	I	205	ENSP00000284486:N205I;ENSP00000432232:N205I;ENSP00000436655:N205I	ENSP00000284486:N205I	N	-	2	0	FAM167A	11319323	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.368000	0.79567	2.008000	0.58898	0.529000	0.55759	AAC		0.607	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000383901.1		
CSMD3	114788	broad.mit.edu	37	8	113323315	113323315	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:113323315G>T	ENST00000297405.5	-	50	8021	c.7777C>A	c.(7777-7779)Cgt>Agt	p.R2593S	CSMD3_ENST00000455883.2_Missense_Mutation_p.R2489S|CSMD3_ENST00000352409.3_Missense_Mutation_p.R2523S|CSMD3_ENST00000343508.3_Missense_Mutation_p.R2553S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2593	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2593S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAGGCCCAACGGACCACACTG	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R2593S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7777A	8						.						153.0	125.0	135.0					8																	113323315		2203	4300	6503	113392491	SO:0001583	missense	114788	exon50			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7777C>A	8.37:g.113323315G>T	ENSP00000297405:p.Arg2593Ser		113392491	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	34	5.323657	0.95708	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.70771	0.3262	L	0.38175	1.15	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.987	D;D;P	0.91635	0.998;0.999;0.875	T	0.62666	-0.6806	10	0.12430	T	0.62	.	19.6449	0.95773	0.0:0.0:1.0:0.0	.	2489;2593;2553	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	2553;2593;1863;2489;2523	ENSP00000345799:R2553S;ENSP00000297405:R2593S;ENSP00000341558:R1863S;ENSP00000412263:R2489S;ENSP00000343124:R2523S	ENSP00000297405:R2593S	R	-	1	0	CSMD3	113392491	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.750000	0.74888	2.628000	0.89032	0.655000	0.94253	CGT		0.468	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CSMD3	114788	broad.mit.edu	37	8	113564872	113564872	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:113564872T>C	ENST00000297405.5	-	26	4556	c.4312A>G	c.(4312-4314)Aac>Gac	p.N1438D	CSMD3_ENST00000455883.2_Missense_Mutation_p.N1334D|CSMD3_ENST00000352409.3_Missense_Mutation_p.N1438D|CSMD3_ENST00000343508.3_Missense_Mutation_p.N1398D	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1438	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.N1438D(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CAACGCAGGTTATTGTCATAT	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.N1438D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A4312G	8						.						84.0	79.0	81.0					8																	113564872		2203	4300	6503	113634048	SO:0001583	missense	114788	exon26			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4312A>G	8.37:g.113564872T>C	ENSP00000297405:p.Asn1438Asp		113634048	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453465	0.84209	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	4.74	4.74	0.60224	CUB (5);	0.000000	0.85682	D	0.000000	T	0.77184	0.4093	M	0.69823	2.125	0.38549	D	0.949405	D;D;D	0.76494	0.999;0.999;0.986	D;D;P	0.76071	0.978;0.987;0.814	T	0.80957	-0.1150	10	0.54805	T	0.06	.	14.7021	0.69162	0.0:0.0:0.0:1.0	.	1334;1438;1398	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	D	1398;1438;778;1334;1438	ENSP00000345799:N1398D;ENSP00000297405:N1438D;ENSP00000341558:N778D;ENSP00000412263:N1334D;ENSP00000343124:N1438D	ENSP00000297405:N1438D	N	-	1	0	CSMD3	113634048	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	7.825000	0.86693	2.115000	0.64714	0.533000	0.62120	AAC		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MTUS1	57509	broad.mit.edu	37	8	17573410	17573410	+	Splice_Site	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:17573410G>T	ENST00000262102.6	-	5	2674	c.2450C>A	c.(2449-2451)tCt>tAt	p.S817Y	MTUS1_ENST00000381861.3_Splice_Site_p.T64N|MTUS1_ENST00000544260.1_De_novo_Start_OutOfFrame|MTUS1_ENST00000381869.3_Splice_Site_p.A763D|MTUS1_ENST00000519263.1_Splice_Site_p.A763D	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	817					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T64N(1)|p.S817Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		GGCATTACCAGCTGTAATAAA	0.373																																					p.A763D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C2288A	8						.						98.0	96.0	97.0					8																	17573410		1847	4090	5937	17617690	SO:0001630	splice_region_variant	57509	exon4			AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2450-1C>A	8.37:g.17573410G>T			17617690	NM_001001925	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	11.11|11.11|11.11	1.543252|1.543252|1.543252	0.27563|0.27563|0.27563	.|.|.	.|.|.	ENSG00000129422|ENSG00000129422|ENSG00000129422	ENST00000381869;ENST00000519263|ENST00000262102|ENST00000381861	T;T|T|T	0.07800|0.37915|0.14766	3.16;3.16|1.17|2.48	4.85|4.85|4.85	3.95|3.95|3.95	0.45737|0.45737|0.45737	.|.|.	.|0.604741|.	.|0.16174|.	.|N|.	.|0.226180|.	T|T|T	0.17023|0.17023|0.17023	0.0409|0.0409|0.0409	L|L|L	0.51422|0.51422|0.51422	1.61|1.61|1.61	0.80722|0.80722|0.80722	D|D|D	1|1|1	B|P|B	0.20988|0.36315|0.33612	0.05|0.547|0.419	B|B|B	0.26202|0.40228|0.37239	0.067|0.323|0.244	T|T|T	0.03673|0.03673|0.03673	-1.1014|-1.1014|-1.1014	9|10|9	0.52906|0.72032|0.66056	T|D|D	0.07|0.01|0.02	.|.|.	13.8518|13.8518|13.8518	0.63501|0.63501|0.63501	0.0:0.1594:0.8406:0.0|0.0:0.1594:0.8406:0.0|0.0:0.1594:0.8406:0.0	.|.|.	763|817|64	Q9ULD2-2|Q9ULD2|Q9ULD2-6	.|MTUS1_HUMAN|.	D|Y|N	763|817|64	ENSP00000371293:A763D;ENSP00000430167:A763D|ENSP00000262102:S817Y|ENSP00000371285:T64N	ENSP00000371293:A763D|ENSP00000262102:S817Y|ENSP00000371285:T64N	A|S|T	-|-|-	2|2|2	0|0|0	MTUS1|MTUS1|MTUS1	17617690|17617690|17617690	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.914000|0.914000|0.914000	0.36105|0.36105|0.36105	0.203000|0.203000|0.203000	0.24098|0.24098|0.24098	2.996000|2.996000|2.996000	0.49449|0.49449|0.49449	1.314000|1.314000|1.314000	0.45095|0.45095|0.45095	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCT|TCT|ACT		0.373	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	Missense_Mutation
ZNF395	55893	broad.mit.edu	37	8	28210808	28210808	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:28210808T>G	ENST00000344423.5	-	5	832	c.701A>C	c.(700-702)cAc>cCc	p.H234P	ZNF395_ENST00000523202.1_Missense_Mutation_p.H234P|ZNF395_ENST00000523095.1_Missense_Mutation_p.H234P	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H234fs*19(1)|p.H234P(1)		cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		GGCCTGGGGGTGGGGGGGCGA	0.607																																					p.H234P												.	.	2	Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(2)	c.A701C	8						.						16.0	21.0	19.0					8																	28210808		2199	4291	6490	28266727	SO:0001583	missense	55893	exon5			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.701A>C	8.37:g.28210808T>G	ENSP00000340494:p.His234Pro		28266727	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	ENST00000344423.5	37	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620677	0.46736	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.54279	0.58;0.58;0.58	5.25	4.11	0.48088	.	0.377447	0.31909	N	0.006861	T	0.58018	0.2093	L	0.39633	1.23	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	T	0.55811	-0.8082	10	0.38643	T	0.18	-24.2445	8.5494	0.33442	0.0:0.0911:0.0:0.9089	.	234	Q9H8N7	ZN395_HUMAN	P	234	ENSP00000340494:H234P;ENSP00000429640:H234P;ENSP00000428452:H234P	ENSP00000340494:H234P	H	-	2	0	ZNF395	28266727	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.683000	0.46943	1.988000	0.58038	0.459000	0.35465	CAC		0.607	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		
ZFHX4	79776	broad.mit.edu	37	8	77768157	77768157	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:77768157C>T	ENST00000521891.2	+	10	9448	c.9000C>T	c.(8998-9000)ggC>ggT	p.G3000G	ZFHX4_ENST00000050961.6_Silent_p.G2955G|ZFHX4_ENST00000518282.1_Silent_p.G2974G|ZFHX4_ENST00000455469.2_Silent_p.G2955G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2955					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G2984G(3)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCAATCAAGGCGGAACGGAAG	0.468										HNSCC(33;0.089)																											p.G3000G												.	.	3	Substitution - coding silent(3)	ovary(1)|large_intestine(1)|endometrium(1)	c.C9000T	8						.						45.0	44.0	44.0					8																	77768157		1913	4126	6039	77930712	SO:0001819	synonymous_variant	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9000C>T	8.37:g.77768157C>T			77930712	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
KIAA0196	9897	broad.mit.edu	37	8	126088592	126088592	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr8:126088592A>C	ENST00000318410.7	-	7	1211	c.862T>G	c.(862-864)Tgg>Ggg	p.W288G	KIAA0196_ENST00000517845.1_Missense_Mutation_p.W140G	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	288					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)		p.W288G(1)		NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ATACTTGCCCAATTATCTGGA	0.378																																					p.W288G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T862G	8						.						126.0	123.0	124.0					8																	126088592		2203	4300	6503	126157774	SO:0001583	missense	9897	exon7				CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.862T>G	8.37:g.126088592A>C	ENSP00000318016:p.Trp288Gly		126157774	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Missense_Mutation	SNP	ENST00000318410.7	37	CCDS6355.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.278409	0.80692	.	.	ENSG00000164961	ENST00000318410;ENST00000517845;ENST00000523297	D;D;D	0.96073	-3.9;-3.9;-3.9	5.84	5.84	0.93424	.	0.054045	0.85682	D	0.000000	D	0.96383	0.8820	M	0.88105	2.93	0.80722	D	1	B	0.29481	0.245	B	0.35182	0.197	D	0.95749	0.8790	10	0.87932	D	0	-7.683	16.215	0.82206	1.0:0.0:0.0:0.0	.	288	Q12768	STRUM_HUMAN	G	288;140;140	ENSP00000318016:W288G;ENSP00000429676:W140G;ENSP00000427946:W140G	ENSP00000318016:W288G	W	-	1	0	KIAA0196	126157774	1.000000	0.71417	0.969000	0.41365	0.981000	0.71138	9.228000	0.95250	2.239000	0.73571	0.533000	0.62120	TGG		0.378	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
HSPA6	3310	broad.mit.edu	37	1	161496144	161496144	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:161496144G>A	ENST00000309758.4	+	1	2109	c.1696G>A	c.(1696-1698)Gaa>Aaa	p.E566K	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	566					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)	p.E566K(1)		endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CAAGATTCCCGAAGAGGACAG	0.542																																					p.E566K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1696A	1						.						28.0	27.0	27.0					1																	161496144		2203	4300	6503	159762768	SO:0001583	missense	3310	exon1				CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.1696G>A	1.37:g.161496144G>A	ENSP00000310219:p.Glu566Lys		159762768	NM_002155	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	37	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	12.77	2.036081	0.35893	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.16457	2.34	3.39	0.403	0.16350	.	0.000000	0.32736	U	0.005707	T	0.06462	0.0166	L	0.55017	1.72	0.26207	N	0.979351	P	0.47545	0.897	B	0.43658	0.426	T	0.18304	-1.0341	10	0.87932	D	0	.	4.1865	0.10400	0.2155:0.0:0.6025:0.182	.	566	P17066	HSP76_HUMAN	K	566;542	ENSP00000310219:E566K	ENSP00000310219:E566K	E	+	1	0	HSPA6	159762768	0.986000	0.35501	0.253000	0.24343	0.534000	0.34807	2.368000	0.44222	-0.122000	0.11766	-0.216000	0.12614	GAA		0.542	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
CFHR5	81494	broad.mit.edu	37	1	196953228	196953228	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:196953228G>T	ENST00000256785.4	+	3	500	c.391G>T	c.(391-393)Gaa>Taa	p.E131*	CFHR5_ENST00000367414.5_Nonsense_Mutation_p.E155*			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	131	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)		p.E131*(1)		NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						TTCGTGTGTAGAACGGGGCTG	0.363																																					p.E131X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G391T	1						.						90.0	81.0	84.0					1																	196953228		2203	4300	6503	195219851	SO:0001587	stop_gained	81494	exon3			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.391G>T	1.37:g.196953228G>T	ENSP00000256785:p.Glu131*		195219851	NM_030787	Q2NKK2	Nonsense_Mutation	SNP	ENST00000256785.4	37	CCDS1387.1	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569552	0.45798	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	.	.	.	3.66	2.39	0.29439	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	4.4322	0.11533	0.2438:0.0:0.7562:0.0	.	.	.	.	X	155;131	.	ENSP00000256785:E131X	E	+	1	0	CFHR5	195219851	0.053000	0.20554	0.010000	0.14722	0.004000	0.04260	0.869000	0.27996	1.769000	0.52152	0.467000	0.42956	GAA		0.363	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088814.2	NM_030787	
KIAA1804	84451	broad.mit.edu	37	1	233482308	233482308	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:233482308C>T	ENST00000366624.3	+	2	1187	c.926C>T	c.(925-927)gCc>gTc	p.A309V	MLK4_ENST00000366623.3_Missense_Mutation_p.A309V	NM_032435.2	NP_115811.2												p.A309V(1)									GGCACCTATGCCTGGATGGCC	0.478																																					p.A309V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C926T	1						.						95.0	90.0	92.0					1																	233482308		2203	4300	6503	231548931	SO:0001583	missense	84451	exon2																														ENST00000366624.3:c.926C>T	1.37:g.233482308C>T	ENSP00000355583:p.Ala309Val		231548931	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	37	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	C	32	5.185378	0.94885	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	D;D	0.82984	-1.67;-1.67	4.49	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.074602	0.56097	D	0.000031	D	0.86389	0.5921	L	0.31752	0.955	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.991;0.984	D	0.88581	0.3136	10	0.87932	D	0	.	17.3739	0.87386	0.0:1.0:0.0:0.0	.	309;309	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	V	309	ENSP00000355582:A309V;ENSP00000355583:A309V	ENSP00000355582:A309V	A	+	2	0	RP5-862P8.2	231548931	1.000000	0.71417	0.977000	0.42913	0.969000	0.65631	7.645000	0.83430	2.319000	0.78375	0.563000	0.77884	GCC		0.478	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
CEP170	9859	broad.mit.edu	37	1	243329021	243329021	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:243329021T>A	ENST00000366542.1	-	13	2292	c.2241A>T	c.(2239-2241)aaA>aaT	p.K747N	RP11-261C10.4_ENST00000437499.1_RNA|CEP170_ENST00000366543.1_Missense_Mutation_p.K649N|RP11-261C10.4_ENST00000422938.1_RNA|CEP170_ENST00000490813.1_5'Flank|CEP170_ENST00000366544.1_Missense_Mutation_p.K649N	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	747						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)		p.K747N(1)		NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTTGTTGAAGTTTTGCTAATG	0.388																																					p.K649N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1947T	1						.						240.0	231.0	234.0					1																	243329021		1866	4100	5966	241395644	SO:0001583	missense	9859	exon12			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.2241A>T	1.37:g.243329021T>A	ENSP00000355500:p.Lys747Asn		241395644	NM_001042405	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Missense_Mutation	SNP	ENST00000366542.1	37	CCDS44339.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.16|13.16	2.153847|2.153847	0.38021|0.38021	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000366542;ENST00000366544;ENST00000366543|ENST00000336415	T;T;T|.	0.51817|.	0.8;0.7;0.69|.	5.25|5.25	4.13|4.13	0.48395|0.48395	.|.	0.087564|.	0.49305|.	D|.	0.000157|.	T|T	0.40040|0.40040	0.1101|0.1101	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	P;P;P;B|.	0.46142|.	0.604;0.873;0.763;0.381|.	B;P;P;B|.	0.44897|.	0.433;0.447;0.463;0.115|.	T|T	0.17715|0.17715	-1.0360|-1.0360	10|5	0.22706|.	T|.	0.39|.	-8.9138|-8.9138	8.3988|8.3988	0.32572|0.32572	0.0:0.0884:0.0:0.9116|0.0:0.0884:0.0:0.9116	.|.	710;649;649;747|.	B1ARM6;Q5SW79-3;Q5SW79-2;Q5SW79|.	.;.;.;CE170_HUMAN|.	N|I	747;649;649|711	ENSP00000355500:K747N;ENSP00000355502:K649N;ENSP00000355501:K649N|.	ENSP00000355500:K747N|.	K|N	-|-	3|2	2|0	CEP170|CEP170	241395644|241395644	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.896000|0.896000	0.52359|0.52359	2.904000|2.904000	0.48719|0.48719	1.980000|1.980000	0.57719|0.57719	0.397000|0.397000	0.26171|0.26171	AAA|AAC		0.388	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096178.2	NM_014812	
OR1C1	26188	broad.mit.edu	37	1	247920899	247920899	+	Silent	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:247920899G>A	ENST00000408896.2	-	1	1083	c.810C>T	c.(808-810)agC>agT	p.S270S		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	270					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S270S(2)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			ACAGAGTGTCGCTCTCAGGCA	0.502																																					p.S270S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C810T	1						.						91.0	87.0	88.0					1																	247920899		2014	4202	6216	245987522	SO:0001819	synonymous_variant	26188	exon1			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.810C>T	1.37:g.247920899G>A			245987522	NM_012353	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Silent	SNP	ENST00000408896.2	37	CCDS41481.1																																																																																				0.502	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1		
PUM1	9698	broad.mit.edu	37	1	31441267	31441267	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:31441267G>A	ENST00000257075.5	-	11	1672	c.1579C>T	c.(1579-1581)Ctt>Ttt	p.L527F	PUM1_ENST00000373747.3_Missense_Mutation_p.L528F|PUM1_ENST00000424085.2_Missense_Mutation_p.L285F|PUM1_ENST00000373741.4_Missense_Mutation_p.L563F|PUM1_ENST00000373742.2_Missense_Mutation_p.L468F|PUM1_ENST00000426105.2_Missense_Mutation_p.L527F|PUM1_ENST00000440538.2_Missense_Mutation_p.L528F|PUM1_ENST00000490546.1_5'UTR|PUM1_ENST00000423018.2_Missense_Mutation_p.L431F|SNORD85_ENST00000363311.1_RNA	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	527	Ala-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)	p.L527F(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GCTGCCACAAGGGGATCCGTT	0.532																																					p.L527F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1579T	1						.						96.0	87.0	90.0					1																	31441267		2203	4300	6503	31213854	SO:0001583	missense	9698	exon11			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1579C>T	1.37:g.31441267G>A	ENSP00000257075:p.Leu527Phe		31213854	NM_001020658	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.0|25.0	4.587431|4.587431	0.86851|0.86851	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742|ENST00000525843;ENST00000498419;ENST00000532678	T;T;T;T;T;T;T;T|T;T;T	0.21031|0.44881	2.1;2.03;2.27;2.28;2.19;2.27;2.25;2.03|2.23;2.48;0.91	5.77|5.77	4.86|4.86	0.63082|0.63082	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51500|0.51500	0.1678|0.1678	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999996|0.999996	D;D;D;D;D;D;D;D|.	0.89917|.	1.0;0.995;1.0;0.997;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D;D;D|.	0.85130|.	0.997;0.979;0.997;0.991;0.997;0.997;0.997;0.997|.	T|T	0.48536|0.48536	-0.9027|-0.9027	10|7	0.30078|0.34782	T|T	0.28|0.22	-6.1257|-6.1257	12.2468|12.2468	0.54574|0.54574	0.1371:0.0:0.8629:0.0|0.1371:0.0:0.8629:0.0	.|.	468;431;563;528;527;527;528;527|.	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5|.	.;.;.;.;PUM1_HUMAN;.;.;.|.	F|L	285;527;528;265;527;528;563;431;468|544;238;214	ENSP00000400141:L285F;ENSP00000257075:L527F;ENSP00000362852:L528F;ENSP00000391723:L527F;ENSP00000401777:L528F;ENSP00000362846:L563F;ENSP00000399440:L431F;ENSP00000362847:L468F|ENSP00000435825:P544L;ENSP00000433850:P238L;ENSP00000435589:P214L	ENSP00000257075:L527F|ENSP00000433850:P238L	L|P	-|-	1|2	0|0	PUM1|PUM1	31213854|31213854	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.993000|0.993000	0.82548|0.82548	5.233000|5.233000	0.65337|0.65337	1.576000|1.576000	0.49790|0.49790	0.655000|0.655000	0.94253|0.94253	CTT|CCT		0.532	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
RNF19B	127544	broad.mit.edu	37	1	33413875	33413875	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:33413875A>T	ENST00000373456.7	-	3	933	c.934T>A	c.(934-936)Tgt>Agt	p.C312S	RNF19B_ENST00000356990.5_Missense_Mutation_p.C311S|RNF19B_ENST00000235150.4_Missense_Mutation_p.C311S	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	312					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.C311S(1)|p.C121S(1)		endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CAGAATTCACAGCCACACACT	0.428																																					p.C312S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T934A	1						.						205.0	159.0	175.0					1																	33413875		2203	4300	6503	33186462	SO:0001583	missense	127544	exon3			AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.934T>A	1.37:g.33413875A>T	ENSP00000362555:p.Cys312Ser		33186462	NM_153341	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	ENST00000373456.7	37	CCDS372.2	.	.	.	.	.	.	.	.	.	.	A	17.48	3.399648	0.62177	.	.	ENSG00000116514	ENST00000373456;ENST00000356990;ENST00000235150;ENST00000405457	T;T;T	0.80033	-1.33;-1.33;-1.33	5.71	5.71	0.89125	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	D	0.83972	0.5370	L	0.31664	0.95	0.80722	D	1	B;D;P	0.89917	0.376;1.0;0.785	B;D;P	0.87578	0.198;0.998;0.674	T	0.82930	-0.0213	10	0.33141	T	0.24	.	16.2911	0.82752	1.0:0.0:0.0:0.0	.	311;312;311	G3XA82;Q6ZMZ0;E9PAW6	.;RN19B_HUMAN;.	S	312;311;311;210	ENSP00000362555:C312S;ENSP00000349482:C311S;ENSP00000235150:C311S	ENSP00000235150:C311S	C	-	1	0	RNF19B	33186462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.334000	0.96470	2.302000	0.77476	0.533000	0.62120	TGT		0.428	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341	
ABCA4	24	broad.mit.edu	37	1	94474421	94474421	+	Silent	SNP	G	G	A	rs368502305		TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:94474421G>A	ENST00000370225.3	-	41	5807	c.5721C>T	c.(5719-5721)gcC>gcT	p.A1907A	ABCA4_ENST00000465352.1_5'UTR|ABCA4_ENST00000535881.1_Silent_p.A26A|ABCA4_ENST00000536513.1_Silent_p.A177A	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1907					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.A1907A(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TAGTGGGCTCGGCAATCCTAG	0.463																																					p.A1907A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C5721T	1						.	A		0,4406		0,0,2203	108.0	102.0	104.0		5721	-11.3	0.0	1		104	1,8599	819.2+/-406.8	0,1,4299	no	coding-synonymous	ABCA4	NM_000350.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1907/2274	94474421	1,13005	2203	4300	6503	94247009	SO:0001819	synonymous_variant	24	exon41			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5721C>T	1.37:g.94474421G>A			94247009	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	ENST00000370225.3	37	CCDS747.1																																																																																				0.463	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
OR1C1	26188	broad.mit.edu	37	1	247921116	247921116	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr1:247921116A>G	ENST00000408896.2	-	1	866	c.593T>C	c.(592-594)aTc>aCc	p.I198T		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	198					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I198T(1)		central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGCAAAAATGATCATTACATT	0.453																																					p.I198T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T593C	1						.						58.0	57.0	58.0					1																	247921116		2063	4214	6277	245987739	SO:0001583	missense	26188	exon1			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.593T>C	1.37:g.247921116A>G	ENSP00000386138:p.Ile198Thr		245987739	NM_012353	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	37	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	A	4.737	0.137050	0.09032	.	.	ENSG00000221888	ENST00000408896	T	0.38077	1.16	3.22	2.05	0.26809	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.21227	0.0511	N	0.05510	-0.035	0.09310	N	1	P	0.38729	0.644	B	0.43082	0.407	T	0.12502	-1.0545	9	0.72032	D	0.01	.	4.2077	0.10497	0.614:0.177:0.209:0.0	.	198	Q15619	OR1C1_HUMAN	T	198	ENSP00000386138:I198T	ENSP00000386138:I198T	I	-	2	0	OR1C1	245987739	0.002000	0.14202	0.013000	0.15412	0.017000	0.09413	1.617000	0.36943	0.423000	0.26033	0.482000	0.46254	ATC		0.453	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1		
OR2AG2	338755	broad.mit.edu	37	11	6789509	6789509	+	Missense_Mutation	SNP	C	C	T	rs569276635		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr11:6789509C>T	ENST00000338569.2	-	1	777	c.680G>A	c.(679-681)cGt>cAt	p.R227H		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R227H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGATGGCATACGAAGCACAGT	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		19355	0.001		0.0	False		,,,				2504	0.0				p.R227H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G680A	11						.						98.0	85.0	89.0					11																	6789509		2201	4296	6497	6746085	SO:0001583	missense	338755	exon1			AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.680G>A	11.37:g.6789509C>T	ENSP00000342697:p.Arg227His		6746085	NM_001004490		Missense_Mutation	SNP	ENST00000338569.2	37	CCDS31413.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.702188	0.00719	.	.	ENSG00000188124	ENST00000338569	T	0.00262	8.4	4.47	-3.56	0.04626	GPCR, rhodopsin-like superfamily (1);	0.499410	0.18634	N	0.135502	T	0.00109	0.0003	L	0.35854	1.095	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28996	-1.0026	10	0.13853	T	0.58	.	6.003	0.19531	0.1199:0.3487:0.0:0.5314	.	227	A6NM03	O2AG2_HUMAN	H	227	ENSP00000342697:R227H	ENSP00000342697:R227H	R	-	2	0	OR2AG2	6746085	0.000000	0.05858	0.103000	0.21229	0.008000	0.06430	-2.009000	0.01455	-0.688000	0.05155	-2.240000	0.00288	CGT		0.483	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386775.1	NM_001004490	
TNKS1BP1	85456	broad.mit.edu	37	11	57076324	57076324	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr11:57076324C>T	ENST00000532437.1	-	5	4172	c.3861G>A	c.(3859-3861)ctG>ctA	p.L1287L	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Silent_p.L1287L			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	1287	Acidic.|Gly-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)	p.L1287L(1)		breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				CCATGTTTCTCAGCCCAAGGT	0.597																																					p.L1287L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3861A	11						.						109.0	110.0	110.0					11																	57076324		2201	4296	6497	56832900	SO:0001819	synonymous_variant	85456	exon6			AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.3861G>A	11.37:g.57076324C>T			56832900	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	37	CCDS7951.1																																																																																				0.597	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
FADS2	9415	broad.mit.edu	37	11	61607828	61607828	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr11:61607828G>A	ENST00000278840.4	+	3	971	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	FADS2_ENST00000522056.1_Missense_Mutation_p.R83Q|FADS2_ENST00000257261.6_Missense_Mutation_p.R92Q|FADS2_ENST00000521849.1_Missense_Mutation_p.R114Q	NM_004265.2	NP_004256.1	O95864	FADS2_HUMAN	fatty acid desaturase 2	114					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)	p.R114Q(1)		breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	GAGGACTTCCGGGCCCTGAGG	0.552																																					p.R114Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G341A	11						.						108.0	101.0	104.0					11																	61607828		2202	4299	6501	61364404	SO:0001583	missense	9415	exon3			AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000278840.4:c.341G>A	11.37:g.61607828G>A	ENSP00000278840:p.Arg114Gln		61364404	NM_004265	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	ENST00000278840.4	37	CCDS8012.1	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866504	0.32977	.	.	ENSG00000134824	ENST00000257261;ENST00000522056;ENST00000278840;ENST00000521849	T;T;T;T	0.27104	1.69;1.69;1.74;1.69	4.65	2.79	0.32731	.	0.125201	0.34435	N	0.003963	T	0.21841	0.0526	L	0.55990	1.75	0.43777	D	0.996309	B;B;B;B	0.31859	0.343;0.136;0.053;0.322	B;B;B;B	0.24848	0.042;0.024;0.036;0.056	T	0.03717	-1.1010	10	0.42905	T	0.14	-5.6524	10.4506	0.44520	0.1609:0.0:0.8391:0.0	.	83;114;114;92	B7Z634;O95864;O95864-3;O95864-2	.;FADS2_HUMAN;.;.	Q	92;83;114;114	ENSP00000257261:R92Q;ENSP00000429500:R83Q;ENSP00000278840:R114Q;ENSP00000431091:R114Q	ENSP00000257261:R92Q	R	+	2	0	FADS2	61364404	1.000000	0.71417	0.992000	0.48379	0.512000	0.34134	4.497000	0.60367	0.592000	0.29728	0.436000	0.28706	CGG		0.552	FADS2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375586.2	NM_004265	
GRIA4	2893	broad.mit.edu	37	11	105774640	105774640	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr11:105774640G>A	ENST00000530497.1	+	7	986	c.986G>A	c.(985-987)gGg>gAg	p.G329E	GRIA4_ENST00000428631.2_Missense_Mutation_p.G329E|GRIA4_ENST00000282499.5_Missense_Mutation_p.G329E|GRIA4_ENST00000393125.2_Missense_Mutation_p.G329E|GRIA4_ENST00000393127.2_Missense_Mutation_p.G329E|GRIA4_ENST00000525187.1_Missense_Mutation_p.G329E			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	329					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.G329E(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GGAAATGCTGGGGATTGTCTG	0.438																																					p.G329E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G986A	11						.						110.0	112.0	111.0					11																	105774640		2202	4299	6501	105279850	SO:0001583	missense	2893	exon8			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.986G>A	11.37:g.105774640G>A	ENSP00000435775:p.Gly329Glu		105279850	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	34	5.344065	0.95807	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	T;T;T;T;T;T	0.19105	2.17;2.71;2.55;2.17;2.71;2.55	5.63	5.63	0.86233	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	T	0.49490	0.1560	M	0.71581	2.175	0.80722	D	1	P;D;D	0.89917	0.956;1.0;1.0	P;D;D	0.97110	0.67;1.0;0.992	T	0.45352	-0.9267	10	0.72032	D	0.01	.	20.0499	0.97621	0.0:0.0:1.0:0.0	.	329;329;329	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	E	329	ENSP00000376833:G329E;ENSP00000282499:G329E;ENSP00000376835:G329E;ENSP00000415551:G329E;ENSP00000435775:G329E;ENSP00000432180:G329E	ENSP00000282499:G329E	G	+	2	0	GRIA4	105279850	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	9.420000	0.97426	2.798000	0.96311	0.655000	0.94253	GGG		0.438	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
FAM184A	79632	broad.mit.edu	37	6	119337950	119337950	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr6:119337950G>A	ENST00000338891.7	-	5	1935	c.1492C>T	c.(1492-1494)Cac>Tac	p.H498Y	FAM184A_ENST00000352896.5_Missense_Mutation_p.H378Y|FAM184A_ENST00000368475.4_Missense_Mutation_p.H378Y|FAM184A_ENST00000522284.1_Missense_Mutation_p.H378Y|FAM184A_ENST00000521531.1_Missense_Mutation_p.H498Y|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	498						extracellular space (GO:0005615)		p.H498Y(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						GCATTACTGTGGACAGCTTCA	0.358																																					p.H498Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492T	6						.						130.0	120.0	123.0					6																	119337950		1825	4098	5923	119379649	SO:0001583	missense	79632	exon5			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1492C>T	6.37:g.119337950G>A	ENSP00000342604:p.His498Tyr		119379649	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026595	0.75390	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	T;T;T;T;T	0.00342	8.03;8.03;8.03;8.03;8.03	5.18	5.18	0.71444	.	0.125961	0.56097	D	0.000023	T	0.00300	0.0009	L	0.56769	1.78	0.41786	D	0.989847	P;P;D	0.53745	0.952;0.952;0.962	P;P;P	0.53490	0.636;0.536;0.727	D	0.87998	0.2754	10	0.59425	D	0.04	-12.1478	18.6868	0.91567	0.0:0.0:1.0:0.0	.	498;378;498	Q8NB25-2;F8W8D6;Q8NB25	.;.;F184A_HUMAN	Y	498;378;378;498;378	ENSP00000342604:H498Y;ENSP00000326608:H378Y;ENSP00000357460:H378Y;ENSP00000430442:H498Y;ENSP00000429826:H378Y	ENSP00000342604:H498Y	H	-	1	0	FAM184A	119379649	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.200000	0.77838	2.433000	0.82419	0.491000	0.48974	CAC		0.358	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
HSP90AB1	3326	broad.mit.edu	37	6	44219536	44219536	+	Silent	SNP	C	C	A	rs190938365	byFrequency	TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr6:44219536C>A	ENST00000371554.1	+	9	1591	c.1377C>A	c.(1375-1377)acC>acA	p.T459T	HSP90AB1_ENST00000353801.3_Silent_p.T459T|SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000371646.5_Silent_p.T459T|MIR4647_ENST00000583964.1_RNA			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	459					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)	p.T459T(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GCTATCATACCTCCCAGTCTG	0.498																																					p.T459T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1377A	6						.						109.0	108.0	108.0					6																	44219536		2203	4300	6503	44327514	SO:0001819	synonymous_variant	3326	exon9			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.1377C>A	6.37:g.44219536C>A			44327514	NM_007355	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Silent	SNP	ENST00000371554.1	37	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	C	9.431	1.085532	0.20390	.	.	ENSG00000096384	ENST00000435812;ENST00000415133;ENST00000428822	.	.	.	4.77	-5.18	0.02840	.	.	.	.	.	T	0.19248	0.0462	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40720	-0.9548	4	.	.	.	-14.7785	1.4246	0.02320	0.1776:0.1976:0.1829:0.4419	.	.	.	.	H	85	.	.	P	+	2	0	HSP90AB1	44327514	0.000000	0.05858	0.952000	0.39060	0.950000	0.60333	-2.277000	0.01160	-0.773000	0.04596	-0.230000	0.12252	CCT		0.498	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
GPR110	266977	broad.mit.edu	37	6	46996732	46996732	+	Silent	SNP	C	C	T	rs149265399		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr6:46996732C>T	ENST00000371253.2	-	2	281	c.66G>A	c.(64-66)ctG>ctA	p.L22L	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000371243.2_Silent_p.L22L	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	22					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L22L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						AACTCACCCCCAGGAAGCCAC	0.517																																					p.L22L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G66A	6						.	C	,	2,4404	4.2+/-10.8	0,2,2201	133.0	106.0	115.0		66,66	-2.4	0.0	6	dbSNP_134	115	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GPR110	NM_025048.2,NM_153840.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	22/219,22/911	46996732	2,13004	2203	4300	6503	47104691	SO:0001819	synonymous_variant	266977	exon2			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.66G>A	6.37:g.46996732C>T			47104691	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Silent	SNP	ENST00000371253.2	37	CCDS34471.1																																																																																				0.517	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
IRAK1BP1	134728	broad.mit.edu	37	6	79595106	79595106	+	Silent	SNP	A	A	T			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr6:79595106A>T	ENST00000369940.2	+	2	432	c.327A>T	c.(325-327)atA>atT	p.I109I	IRAK1BP1_ENST00000607739.1_Silent_p.I22I	NM_001010844.2	NP_001010844.1	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1 binding protein 1	109					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I109I(1)		endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(3)	12		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		CAGAAAATATAACTGTGACAA	0.313																																					p.I109I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A327T	6						.						97.0	106.0	103.0					6																	79595106		2203	4299	6502	79651825	SO:0001819	synonymous_variant	134728	exon2			AI478629	CCDS34488.1	6q14-q15	2006-04-12				ENSG00000146243			17368	protein-coding gene	gene with protein product		615375				11096118	Standard	XM_005248654		Approved	AIP70, SIMPL	uc003pim.4	Q5VVH5		ENST00000369940.2:c.327A>T	6.37:g.79595106A>T			79651825	NM_001010844		Silent	SNP	ENST00000369940.2	37	CCDS34488.1																																																																																				0.313	IRAK1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041296.2	XM_059729	
SYTL3	94120	broad.mit.edu	37	6	159178252	159178252	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr6:159178252G>A	ENST00000297239.9	+	13	1341	c.1147G>A	c.(1147-1149)Gcc>Acc	p.A383T	SYTL3_ENST00000360448.3_Missense_Mutation_p.A315T|SYTL3_ENST00000367081.3_Missense_Mutation_p.A109T			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	383	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)	p.A315T(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		GTATCAGGTGGCCCCTGCCCA	0.647																																					p.A315T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943A	6						.						28.0	27.0	28.0					6																	159178252		2203	4299	6502	159098240	SO:0001583	missense	94120	exon13			AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.1147G>A	6.37:g.159178252G>A	ENSP00000297239:p.Ala383Thr		159098240	NM_001009991	Q496J4|Q496J6|Q5U3B9	Missense_Mutation	SNP	ENST00000297239.9	37	CCDS56458.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695276	0.48202	.	.	ENSG00000164674	ENST00000360448;ENST00000543689;ENST00000297239;ENST00000367081	T;T;T	0.07444	3.19;3.19;3.19	5.07	5.07	0.68467	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.719506	0.13853	N	0.358226	T	0.02119	0.0066	N	0.05467	-0.045	0.37242	D	0.906182	B;B;B	0.15719	0.011;0.014;0.008	B;B;B	0.21151	0.02;0.033;0.012	T	0.46076	-0.9217	10	0.12430	T	0.62	.	18.4301	0.90622	0.0:0.0:1.0:0.0	.	109;383;315	F8W7H4;Q4VX76;Q4VX76-2	.;SYTL3_HUMAN;.	T	315;383;383;109	ENSP00000353631:A315T;ENSP00000297239:A383T;ENSP00000356048:A109T	ENSP00000297239:A383T	A	+	1	0	SYTL3	159098240	1.000000	0.71417	0.802000	0.32245	0.244000	0.25665	5.672000	0.68102	2.356000	0.79943	0.491000	0.48974	GCC		0.647	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		
NEK8	284086	broad.mit.edu	37	17	27064382	27064382	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr17:27064382G>A	ENST00000268766.6	+	5	711	c.677G>A	c.(676-678)cGg>cAg	p.R226Q	AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.R226Q(1)|p.R226L(1)		breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					ATCTCTGACCGGTACAGCCCT	0.587																																					p.R226Q	NSCLC(6;19 293 14866 25253 49845)											.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G677A	17						.						55.0	47.0	50.0					17																	27064382		2203	4300	6503	24088509	SO:0001583	missense	284086	exon5			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.677G>A	17.37:g.27064382G>A	ENSP00000268766:p.Arg226Gln		24088509	NM_178170	A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	ENST00000268766.6	37	CCDS32597.1	.	.	.	.	.	.	.	.	.	.	g	18.26	3.585426	0.66105	.	.	ENSG00000160602	ENST00000543014;ENST00000268766	T;T	0.63913	-0.07;-0.07	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47619	0.1455	N	0.16656	0.425	0.80722	D	1	B	0.25486	0.127	B	0.21546	0.035	T	0.39643	-0.9604	10	0.15066	T	0.55	.	19.2155	0.93776	0.0:0.0:1.0:0.0	.	226	Q86SG6	NEK8_HUMAN	Q	226	ENSP00000465859:R226Q;ENSP00000268766:R226Q	ENSP00000268766:R226Q	R	+	2	0	NEK8	24088509	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.787000	0.85759	2.779000	0.95612	0.651000	0.88453	CGG		0.587	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446467.2		
LASP1	3927	broad.mit.edu	37	17	37074956	37074956	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr17:37074956C>T	ENST00000318008.6	+	7	1042	c.711C>T	c.(709-711)gaC>gaT	p.D237D	LASP1_ENST00000435347.3_Silent_p.D237D|RP1-56K13.3_ENST00000580121.1_RNA|LASP1_ENST00000433206.2_Silent_p.D181D	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	237	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)	p.D237D(1)		breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						AGATCGACGACGGCTGGATGT	0.657			T	MLL	AML																																p.D237D			Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C711T	17						.						114.0	99.0	104.0					17																	37074956		2203	4300	6503	34328482	SO:0001819	synonymous_variant	3927	exon7				CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.711C>T	17.37:g.37074956C>T			34328482	NM_006148	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	ENST00000318008.6	37	CCDS11331.1																																																																																				0.657	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256890.3	NM_006148	
ERBB2	2064	broad.mit.edu	37	17	37881332	37881332	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr17:37881332G>A	ENST00000269571.5	+	21	2683	c.2524G>A	c.(2524-2526)Gta>Ata	p.V842I	ERBB2_ENST00000584601.1_Missense_Mutation_p.V812I|ERBB2_ENST00000406381.2_Missense_Mutation_p.V812I|ERBB2_ENST00000445658.2_Missense_Mutation_p.V566I|ERBB2_ENST00000540147.1_Missense_Mutation_p.V812I|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000584450.1_Missense_Mutation_p.V842I|ERBB2_ENST00000541774.1_Missense_Mutation_p.V827I			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.V842I(6)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TGTGCGGCTCGTACACAGGGA	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.V812I			Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	ERBB2,stomach,NS,Substitution - Missense,0	.	6	Substitution - Missense(6)	large_intestine(5)|stomach(1)	c.G2434A	17						.						70.0	61.0	64.0					17																	37881332		2203	4300	6503	35134858	SO:0001583	missense	2064	exon24			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2524G>A	17.37:g.37881332G>A	ENSP00000269571:p.Val842Ile		35134858	NM_001005862	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	37	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241303	0.58995	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69	5.09	5.09	0.68999	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.85106	0.5621	N	0.21142	0.635	0.80722	D	1	D;D;D	0.76494	0.997;0.979;0.999	D;P;D	0.64506	0.92;0.559;0.926	D	0.87344	0.2333	9	0.87932	D	0	.	18.2846	0.90110	0.0:0.0:1.0:0.0	.	566;827;842	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	I	812;827;566;842;812	ENSP00000385185:V812I;ENSP00000446466:V827I;ENSP00000404047:V566I;ENSP00000269571:V842I;ENSP00000443562:V812I	ENSP00000269571:V842I	V	+	1	0	ERBB2	35134858	1.000000	0.71417	0.919000	0.36401	0.900000	0.52787	9.657000	0.98554	2.651000	0.90000	0.563000	0.77884	GTA		0.597	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
KRT38	8687	broad.mit.edu	37	17	39593678	39593678	+	Missense_Mutation	SNP	C	C	T	rs148086126	byFrequency	TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr17:39593678C>T	ENST00000246646.3	-	7	1356	c.1357G>A	c.(1357-1359)Gga>Aga	p.G453R		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	453	Tail.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.G453R(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				AATCGGCTTCCGGTGGTGCTG	0.592													C|||	9	0.00179712	0.0	0.0	5008	,	,		17678	0.0		0.007	False		,,,				2504	0.002				p.G453R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1357A	17						.	C	ARG/GLY	0,4406		0,0,2203	20.0	20.0	20.0		1357	1.2	0.0	17	dbSNP_134	20	3,8595		0,3,4296	yes	missense	KRT38	NM_006771.3	125	0,3,6499	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	453/457	39593678	3,13001	2203	4299	6502	36847204	SO:0001583	missense	8687	exon7			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.1357G>A	17.37:g.39593678C>T	ENSP00000246646:p.Gly453Arg		36847204	NM_006771	A2RRM5|Q6A164	Missense_Mutation	SNP	ENST00000246646.3	37	CCDS11392.1	5	0.0022893772893772895	0	0.0	0	0.0	0	0.0	5	0.006596306068601583	.	10.38	1.333283	0.24167	0.0	3.49E-4	ENSG00000171360	ENST00000246646	D	0.81659	-1.52	2.25	1.25	0.21368	.	0.722437	0.11102	N	0.599518	T	0.61949	0.2388	N	0.08118	0	0.09310	N	1	D	0.57899	0.981	P	0.53146	0.719	T	0.56932	-0.7897	10	0.54805	T	0.06	.	4.8148	0.13362	0.0:0.8159:0.0:0.1841	.	453	O76015	KRT38_HUMAN	R	453	ENSP00000246646:G453R	ENSP00000246646:G453R	G	-	1	0	KRT38	36847204	0.000000	0.05858	0.008000	0.14137	0.072000	0.16883	0.008000	0.13197	0.521000	0.28445	0.555000	0.69702	GGA		0.592	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257307.2	NM_006771	
TNRC6C	57690	broad.mit.edu	37	17	76046266	76046266	+	Missense_Mutation	SNP	G	G	A	rs202206566		TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr17:76046266G>A	ENST00000588061.1	+	5	1850	c.1123G>A	c.(1123-1125)Gta>Ata	p.V375I	TNRC6C_ENST00000541771.1_Missense_Mutation_p.V375I|TNRC6C_ENST00000588847.1_Missense_Mutation_p.V375I|TNRC6C_ENST00000301624.4_Missense_Mutation_p.V375I|TNRC6C_ENST00000335749.4_Missense_Mutation_p.V375I|TNRC6C_ENST00000544502.1_Missense_Mutation_p.V375I			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	375	Gly-rich.|Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V375I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GAACCCTACCGTACAGCCTGG	0.522																																					p.V375I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1123A	17						.						59.0	59.0	59.0					17																	76046266		1988	4154	6142	73557861	SO:0001583	missense	57690	exon4			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1123G>A	17.37:g.76046266G>A	ENSP00000468647:p.Val375Ile		73557861	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	9.211	1.030999	0.19590	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.12	-9.34	0.00636	.	1.100860	0.07055	N	0.832741	T	0.05227	0.0139	N	0.14661	0.345	0.19300	N	0.999977	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.0	T	0.35525	-0.9785	10	0.21014	T	0.42	1.9699	4.9047	0.13793	0.5787:0.2184:0.0926:0.1103	.	375;375;375	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	I	375	ENSP00000336783:V375I;ENSP00000301624:V375I;ENSP00000440310:V375I;ENSP00000442421:V375I	ENSP00000301624:V375I	V	+	1	0	TNRC6C	73557861	0.376000	0.25098	0.244000	0.24202	0.880000	0.50808	-0.586000	0.05787	-1.757000	0.01316	0.655000	0.94253	GTA		0.522	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
HSF2BP	11077	broad.mit.edu	37	21	44949838	44949838	+	Silent	SNP	T	T	C			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr21:44949838T>C	ENST00000291560.2	-	9	1132	c.801A>G	c.(799-801)ccA>ccG	p.P267P	HSF2BP_ENST00000542962.1_Silent_p.P192P	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	267					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)		p.P267P(1)		kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		CCTCTGCATCTGGATCTAGGG	0.458																																					p.P267P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A801G	21						.						44.0	45.0	45.0					21																	44949838		2203	4300	6503	43774266	SO:0001819	synonymous_variant	11077	exon9			AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.801A>G	21.37:g.44949838T>C			43774266	NM_007031	B4DX36	Silent	SNP	ENST00000291560.2	37	CCDS13697.1																																																																																				0.458	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195620.1	NM_007031	
RNPS1	10921	broad.mit.edu	37	16	2312776	2312776	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr16:2312776C>T	ENST00000565678.1	-	5	1032	c.487G>A	c.(487-489)Gtg>Atg	p.V163M	RNPS1_ENST00000569598.2_Missense_Mutation_p.V69M|RNPS1_ENST00000561718.1_De_novo_Start_InFrame|RNPS1_ENST00000397086.2_Missense_Mutation_p.V163M|RNPS1_ENST00000301730.8_Missense_Mutation_p.V163M|RNPS1_ENST00000566397.1_De_novo_Start_InFrame|RNPS1_ENST00000568631.1_Missense_Mutation_p.V163M|RNPS1_ENST00000567147.1_Missense_Mutation_p.V140M|RNPS1_ENST00000566458.1_Missense_Mutation_p.V140M|RNPS1_ENST00000320225.5_Missense_Mutation_p.V163M			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	163	Interaction with SAP18 and ACIN1.|Necessary for interaction with PNN and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V163M(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						CCAATGTGCACTTTGGTGGGC	0.498																																					p.V163M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G487A	16						.						137.0	114.0	122.0					16																	2312776		2198	4300	6498	2252777	SO:0001583	missense	10921	exon5			AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.487G>A	16.37:g.2312776C>T	ENSP00000457723:p.Val163Met		2252777	NM_080594	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Missense_Mutation	SNP	ENST00000565678.1	37	CCDS10465.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.460290	0.63401	.	.	ENSG00000205937	ENST00000320225;ENST00000397086;ENST00000301730	T;T;T	0.54279	0.58;0.58;0.58	5.95	5.95	0.96441	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.437565	0.24303	N	0.039710	T	0.72104	0.3419	M	0.66560	2.04	0.50039	D	0.999841	D;D	0.71674	0.997;0.998	D;D	0.75484	0.984;0.986	T	0.72646	-0.4230	10	0.72032	D	0.01	-10.323	17.8666	0.88796	0.0:1.0:0.0:0.0	.	140;163	Q15287-2;Q15287	.;RNPS1_HUMAN	M	163	ENSP00000315859:V163M;ENSP00000380275:V163M;ENSP00000301730:V163M	ENSP00000301730:V163M	V	-	1	0	RNPS1	2252777	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	4.387000	0.59626	2.826000	0.97356	0.579000	0.79373	GTG		0.498	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435415.1	NM_080594	
POLR3E	55718	broad.mit.edu	37	16	22326413	22326413	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr16:22326413C>T	ENST00000299853.5	+	9	693	c.526C>T	c.(526-528)Cgg>Tgg	p.R176W	POLR3E_ENST00000564209.1_Missense_Mutation_p.R176W|POLR3E_ENST00000359210.4_Missense_Mutation_p.R176W|POLR3E_ENST00000418581.2_Missense_Mutation_p.R140W	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	176					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.R176W(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		ACCGCAGGTGCGGTTCTCCCG	0.637																																					p.R176W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C526T	16						.						44.0	40.0	41.0					16																	22326413		2197	4300	6497	22233914	SO:0001583	missense	55718	exon9			AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.526C>T	16.37:g.22326413C>T	ENSP00000299853:p.Arg176Trp		22233914	NM_018119	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Missense_Mutation	SNP	ENST00000299853.5	37	CCDS10605.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333288	0.81801	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	T;T;T	0.52057	0.68;0.68;0.68	5.47	5.47	0.80525	.	0.052732	0.85682	D	0.000000	T	0.67011	0.2848	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.997;0.994;0.998;0.995;0.997;0.997	T	0.69669	-0.5083	10	0.87932	D	0	-25.3685	14.9971	0.71439	0.143:0.857:0.0:0.0	.	120;140;176;176;176;176	B4DDR0;B4DL24;B4DUP6;Q9NVU0-2;Q9NVU0;Q9NVU0-3	.;.;.;.;RPC5_HUMAN;.	W	176;176;140	ENSP00000299853:R176W;ENSP00000352140:R176W;ENSP00000399254:R140W	ENSP00000299853:R176W	R	+	1	2	POLR3E	22233914	0.999000	0.42202	0.998000	0.56505	0.879000	0.50718	3.020000	0.49643	2.553000	0.86117	0.655000	0.94253	CGG		0.637	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119	
USP10	9100	broad.mit.edu	37	16	84806210	84806210	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr16:84806210C>T	ENST00000219473.7	+	12	2175	c.2062C>T	c.(2062-2064)Cga>Tga	p.R688*	USP10_ENST00000570191.1_Nonsense_Mutation_p.R692*	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	688	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.R688*(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						GCACCTGAAACGATTCGTTTA	0.443																																					p.R688X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2062T	16						.						176.0	171.0	173.0					16																	84806210		1952	4155	6107	83363711	SO:0001587	stop_gained	9100	exon12			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.2062C>T	16.37:g.84806210C>T	ENSP00000219473:p.Arg688*		83363711	NM_005153	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Nonsense_Mutation	SNP	ENST00000219473.7	37	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656867	0.47467	.	.	ENSG00000103194	ENST00000219473	.	.	.	4.38	4.38	0.52667	.	0.133168	0.48767	D	0.000161	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3595	13.0564	0.58982	0.161:0.839:0.0:0.0	.	.	.	.	X	688	.	ENSP00000219473:R688X	R	+	1	2	USP10	83363711	0.983000	0.35010	0.829000	0.32907	0.204000	0.24138	2.270000	0.43355	2.157000	0.67596	0.563000	0.77884	CGA		0.443	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
TATDN2	9797	broad.mit.edu	37	3	10302277	10302277	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr3:10302277C>T	ENST00000287652.4	+	3	1922	c.871C>T	c.(871-873)Cga>Tga	p.R291*	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Nonsense_Mutation_p.R291*	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	291					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)	p.R291*(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CCTTGGGGACCGAAGGACTGT	0.488																																					p.R291X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C871T	3						.						84.0	87.0	86.0					3																	10302277		2203	4300	6503	10277277	SO:0001587	stop_gained	9797	exon3			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.871C>T	3.37:g.10302277C>T	ENSP00000287652:p.Arg291*		10277277	NM_014760	Q3MIL9|Q5BKU0	Nonsense_Mutation	SNP	ENST00000287652.4	37	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	C	35	5.462442	0.96240	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	.	.	.	5.15	3.34	0.38264	.	0.359136	0.16607	N	0.207078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.9973	6.5947	0.22666	0.1773:0.7322:0.0:0.0905	.	.	.	.	X	291	.	ENSP00000287652:R291X	R	+	1	2	TATDN2	10277277	0.017000	0.18338	0.448000	0.26945	0.964000	0.63967	0.332000	0.19751	0.852000	0.35287	0.655000	0.94253	CGA		0.488	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
CFAP44	55779	broad.mit.edu	37	3	113138965	113138965	+	Missense_Mutation	SNP	C	C	T	rs370318076		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr3:113138965C>T	ENST00000295868.2	-	5	631	c.469G>A	c.(469-471)Gcc>Acc	p.A157T	WDR52-AS1_ENST00000498480.1_RNA|WDR52_ENST00000393845.2_Missense_Mutation_p.A157T|WDR52-AS1_ENST00000473329.1_RNA	NM_018338.3	NP_060808.2												p.A157T(2)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						ATGTATATGGCGATACTGTCG	0.428																																					p.A157T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G469A	3						.	C	THR/ALA,THR/ALA	0,4406		0,0,2203	133.0	122.0	126.0		469,469	-8.0	0.0	3		126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	WDR52	NM_001164496.1,NM_018338.3	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	157/1855,157/983	113138965	1,13005	2203	4300	6503	114621655	SO:0001583	missense	55779	exon5																														ENST00000295868.2:c.469G>A	3.37:g.113138965C>T	ENSP00000295868:p.Ala157Thr		114621655	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	37	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.314456	0.23908	0.0	1.16E-4	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.42513	5.04;0.97	5.44	-8.02	0.01118	.	.	.	.	.	T	0.15955	0.0384	L	0.29908	0.895	0.09310	N	1	P	0.36768	0.569	B	0.19148	0.024	T	0.16247	-1.0409	9	0.41790	T	0.15	.	0.1572	0.00099	0.2433:0.241:0.2158:0.2999	.	157	Q96MT7	WDR52_HUMAN	T	157	ENSP00000377428:A157T;ENSP00000295868:A157T	ENSP00000295868:A157T	A	-	1	0	WDR52	114621655	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.367000	0.02583	-0.990000	0.03481	-0.140000	0.14226	GCC		0.428	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
ACAD9	28976	broad.mit.edu	37	3	128627864	128627864	+	Silent	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr3:128627864G>A	ENST00000308982.7	+	14	1488	c.1407G>A	c.(1405-1407)cgG>cgA	p.R469R	ACAD9_ENST00000511526.1_3'UTR	NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	469						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)	p.R469R(1)		central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						CCGTTGGCCGGAGGCTTCGGG	0.597																																					p.R469R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1407A	3						.						66.0	62.0	64.0					3																	128627864		2203	4300	6503	130110554	SO:0001819	synonymous_variant	28976	exon14			AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.1407G>A	3.37:g.128627864G>A			130110554	NM_014049	D3DNB8|Q8WXX3	Silent	SNP	ENST00000308982.7	37	CCDS3053.1																																																																																				0.597	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	
IL17RD	54756	broad.mit.edu	37	3	57136546	57136546	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr3:57136546C>T	ENST00000296318.7	-	10	1028	c.940G>A	c.(940-942)Gcg>Acg	p.A314T	IL17RD_ENST00000320057.5_Missense_Mutation_p.A170T|IL17RD_ENST00000427856.2_Missense_Mutation_p.A290T|IL17RD_ENST00000463523.1_Missense_Mutation_p.A170T	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	314					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A170T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		AAGAGCGTCGCGAATGCCGAT	0.557																																					p.A314T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G940A	3						.						70.0	69.0	69.0					3																	57136546		2203	4300	6503	57111586	SO:0001583	missense	54756	exon10			AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.940G>A	3.37:g.57136546C>T	ENSP00000296318:p.Ala314Thr		57111586	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629876	0.87660	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.13778	2.56;2.58;2.57;2.58	5.48	5.48	0.80851	.	0.052258	0.85682	D	0.000000	T	0.17365	0.0417	L	0.29908	0.895	0.80722	D	1	D;D;D	0.62365	0.976;0.991;0.974	B;P;P	0.47251	0.432;0.532;0.542	T	0.00426	-1.1746	10	0.66056	D	0.02	-14.5417	19.5489	0.95310	0.0:1.0:0.0:0.0	.	170;314;290	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	T	314;170;290;170	ENSP00000296318:A314T;ENSP00000322250:A170T;ENSP00000399209:A290T;ENSP00000417516:A170T	ENSP00000296318:A314T	A	-	1	0	IL17RD	57111586	1.000000	0.71417	0.853000	0.33588	0.420000	0.31355	7.273000	0.78527	2.850000	0.98022	0.655000	0.94253	GCG		0.557	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
IGSF10	285313	broad.mit.edu	37	3	151156169	151156169	+	Silent	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr3:151156169G>A	ENST00000282466.3	-	6	6179	c.6180C>T	c.(6178-6180)tgC>tgT	p.C2060C	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2060	Ig-like C2-type 7.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.C2060C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CGGAAGCTTTGCAATCTACTT	0.458																																					p.C87C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C261T	3						.						126.0	121.0	123.0					3																	151156169		2203	4300	6503	152638859	SO:0001819	synonymous_variant	285313	exon2			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6180C>T	3.37:g.151156169G>A			152638859	NM_001178145	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																				0.458	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
KCNA6	3742	broad.mit.edu	37	12	4919894	4919894	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr12:4919894C>T	ENST00000280684.3	+	1	1553	c.687C>T	c.(685-687)gaC>gaT	p.D229D	KCNA6_ENST00000433855.1_Silent_p.D229D|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	229					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.D229D(1)		NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	AGGATGAAGACGATTCCTACA	0.557										HNSCC(72;0.22)																											p.D229D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C687T	12						.						91.0	91.0	91.0					12																	4919894		2203	4300	6503	4790155	SO:0001819	synonymous_variant	3742	exon1			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.687C>T	12.37:g.4919894C>T			4790155	NM_002235		Silent	SNP	ENST00000280684.3	37	CCDS8534.1																																																																																				0.557	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235	
SLC38A1	81539	broad.mit.edu	37	12	46601356	46601356	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr12:46601356C>T	ENST00000398637.5	-	7	1131	c.437G>A	c.(436-438)gGg>gAg	p.G146E	SLC38A1_ENST00000439706.1_Missense_Mutation_p.G146E|SLC38A1_ENST00000552197.1_Missense_Mutation_p.G146E|SLC38A1_ENST00000546893.1_Missense_Mutation_p.G146E|SLC38A1_ENST00000549049.1_Missense_Mutation_p.G146E|SLC38A1_ENST00000549633.1_5'UTR	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	146					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)	p.G146E(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			TACGAACTTCCCTGTGGTGCC	0.403																																					p.G146E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437A	12						.						125.0	123.0	124.0					12																	46601356		1843	4089	5932	44887623	SO:0001583	missense	81539	exon7			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.437G>A	12.37:g.46601356C>T	ENSP00000381634:p.Gly146Glu		44887623	NM_001077484	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	ENST00000398637.5	37	CCDS41774.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042850	0.93685	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.02631	4.22;4.22;4.22;4.22;4.22	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	T	0.20740	0.0499	M	0.87900	2.915	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.994;0.986	T	0.00525	-1.1689	10	0.87932	D	0	-10.9887	19.6512	0.95812	0.0:1.0:0.0:0.0	.	146;146;146	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	E	146	ENSP00000449607:G146E;ENSP00000398142:G146E;ENSP00000381634:G146E;ENSP00000447853:G146E;ENSP00000449756:G146E	ENSP00000381634:G146E	G	-	2	0	SLC38A1	44887623	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.435000	0.80391	2.646000	0.89796	0.563000	0.77884	GGG		0.403	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404218.2		
CEP290	80184	broad.mit.edu	37	12	88524943	88524943	+	Splice_Site	SNP	T	T	A			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr12:88524943T>A	ENST00000552810.1	-	7	837	c.494A>T	c.(493-495)gAg>gTg	p.E165V	CEP290_ENST00000309041.7_Splice_Site_p.E165V|CEP290_ENST00000397838.3_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	165					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.E165V(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						ATTTTTTACCTCTCTTCTTAA	0.279																																					p.E165V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A494T	12						.						93.0	88.0	90.0					12																	88524943		1768	4039	5807	87049074	SO:0001630	splice_region_variant	80184	exon7			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.495+1A>T	12.37:g.88524943T>A			87049074	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	37	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.949217	0.92660	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.70282	-0.47;-0.47	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.74245	0.3691	L	0.27053	0.805	0.80722	D	1	D	0.67145	0.996	D	0.64410	0.925	T	0.76088	-0.3087	10	0.48119	T	0.1	.	15.555	0.76187	0.0:0.0:0.0:1.0	.	165	O15078	CE290_HUMAN	V	165;165;165;67	ENSP00000448012:E165V;ENSP00000308021:E165V	ENSP00000308021:E165V	E	-	2	0	CEP290	87049074	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.293000	0.72731	2.081000	0.62600	0.460000	0.39030	GAG		0.279	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	Missense_Mutation
TMPO	7112	broad.mit.edu	37	12	98927741	98927741	+	Intron	SNP	T	T	G			TCGA-AG-3898-01	TCGA-AG-3898-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr12:98927741T>G	ENST00000556029.1	+	3	921				TMPO_ENST00000261210.5_Intron|TMPO_ENST00000266732.4_Missense_Mutation_p.L569R|TMPO_ENST00000393053.2_Intron|TMPO_ENST00000343315.5_Intron	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)	p.L569R(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GACTTAGCACTCTGTAGAGCA	0.468																																					p.L569R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1706G	12						.						75.0	66.0	69.0					12																	98927741		2203	4300	6503	97451872	SO:0001627	intron_variant	7112	exon4				CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.565+2125T>G	12.37:g.98927741T>G			97451872	NM_003276	A2T926|Q14861	Missense_Mutation	SNP	ENST00000556029.1	37	CCDS31879.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.119622	0.56613	.	.	ENSG00000120802	ENST00000266732	T	0.64618	-0.11	5.96	5.96	0.96718	.	0.388184	0.28279	N	0.015929	T	0.66665	0.2812	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.70208	-0.4935	10	0.66056	D	0.02	-2.9727	12.8402	0.57797	0.0:0.0:0.0:1.0	.	569	P42166	LAP2A_HUMAN	R	569	ENSP00000266732:L569R	ENSP00000266732:L569R	L	+	2	0	TMPO	97451872	0.994000	0.37717	0.465000	0.27155	0.932000	0.56968	3.640000	0.54350	2.285000	0.76669	0.533000	0.62120	CTC		0.468	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	
FAM109A	144717	broad.mit.edu	37	12	111801236	111801236	+	5'UTR	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr12:111801236G>A	ENST00000547838.2	-	0	93				FAM109A_ENST00000392658.5_5'UTR|FAM109A_ENST00000548163.1_5'UTR|FAM109A_ENST00000450786.2_5'UTR|FAM109A_ENST00000361483.3_Missense_Mutation_p.A12V			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A						endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.A12V(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						CTTCATGGTGGCAATCGCGGG	0.652																																					p.A12V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C35T	12						.						13.0	16.0	15.0					12																	111801236		2192	4274	6466	110285619	SO:0001623	5_prime_UTR_variant	144717	exon4			BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.-5C>T	12.37:g.111801236G>A			110285619	NM_001177996	J3KP50|Q6PJL9|Q96MH8	Missense_Mutation	SNP	ENST00000547838.2	37	CCDS9152.1	.	.	.	.	.	.	.	.	.	.	G	8.996	0.978988	0.18812	.	.	ENSG00000198324	ENST00000361483	T	0.30714	1.52	4.2	-0.249	0.13011	.	.	.	.	.	T	0.24774	0.0601	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	6	0.38643	T	0.18	.	6.2364	0.20766	0.2024:0.5076:0.29:0.0	.	.	.	.	V	12	ENSP00000354461:A12V	ENSP00000354461:A12V	A	-	2	0	FAM109A	110285619	0.001000	0.12720	0.000000	0.03702	0.032000	0.12392	0.708000	0.25719	-0.448000	0.07128	-0.304000	0.09214	GCC		0.652	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
MKRN3	7681	broad.mit.edu	37	15	23811699	23811699	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr15:23811699G>T	ENST00000314520.3	+	1	1246	c.770G>T	c.(769-771)aGc>aTc	p.S257I	MKRN3_ENST00000568252.1_Intron|MKRN3_ENST00000568945.1_3'UTR|MKRN3_ENST00000564592.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	257					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S257I(1)		breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CGTGGGGAGAGCTGTATGTAC	0.542																																					p.S257I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G770T	15						.						106.0	110.0	109.0					15																	23811699		2203	4300	6503	21362792	SO:0001583	missense	7681	exon1			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.770G>T	15.37:g.23811699G>T	ENSP00000313881:p.Ser257Ile		21362792	NM_005664		Missense_Mutation	SNP	ENST00000314520.3	37	CCDS10013.1	.	.	.	.	.	.	.	.	.	.	G	11.65	1.703121	0.30232	.	.	ENSG00000179455	ENST00000314520	T	0.48522	0.81	4.07	1.09	0.20402	Zinc finger, CCCH-type (2);	0.198500	0.52532	D	0.000066	T	0.43055	0.1230	M	0.73217	2.22	0.26912	N	0.966869	P	0.44578	0.838	B	0.41691	0.364	T	0.37174	-0.9717	10	0.51188	T	0.08	.	6.805	0.23772	0.3743:0.0:0.6257:0.0	.	257	Q13064	MKRN3_HUMAN	I	257	ENSP00000313881:S257I	ENSP00000313881:S257I	S	+	2	0	MKRN3	21362792	1.000000	0.71417	0.429000	0.26710	0.075000	0.17131	2.761000	0.47589	0.258000	0.21686	0.655000	0.94253	AGC		0.542	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251225.1	NM_005664	
ATP10A	57194	broad.mit.edu	37	15	25947069	25947069	+	Silent	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr15:25947069G>T	ENST00000356865.6	-	13	2865	c.2754C>A	c.(2752-2754)acC>acA	p.T918T		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	918					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.T918T(1)		NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CTACCTGGGAGGTGGCATTCA	0.552																																					p.T918T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2754A	15						.						151.0	130.0	137.0					15																	25947069		2203	4300	6503	23498162	SO:0001819	synonymous_variant	57194	exon13			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2754C>A	15.37:g.25947069G>T			23498162	NM_024490	Q4G0S9|Q969I4	Silent	SNP	ENST00000356865.6	37	CCDS32178.1																																																																																				0.552	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414830.1	NM_024490	
SEMA6D	80031	broad.mit.edu	37	15	48063804	48063804	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr15:48063804C>A	ENST00000316364.5	+	19	3483	c.3044C>A	c.(3043-3045)aCa>aAa	p.T1015K	SEMA6D_ENST00000389428.3_Missense_Mutation_p.T940K|SEMA6D_ENST00000389432.2_Missense_Mutation_p.T972K|SEMA6D_ENST00000536845.2_Missense_Mutation_p.T1015K|SEMA6D_ENST00000389433.2_Missense_Mutation_p.T996K|SEMA6D_ENST00000558014.1_Missense_Mutation_p.T953K|SEMA6D_ENST00000537942.1_Missense_Mutation_p.T953K|SEMA6D_ENST00000354744.4_Missense_Mutation_p.T959K|SEMA6D_ENST00000358066.4_Missense_Mutation_p.T953K|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000558816.1_3'UTR	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	1015					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.T1015K(1)		biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		ATTCAGGGAACACCAGTGAGT	0.517																																					p.T940K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2819A	15						.						125.0	118.0	121.0					15																	48063804		2198	4297	6495	45851096	SO:0001583	missense	80031	exon17			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.3044C>A	15.37:g.48063804C>A	ENSP00000324857:p.Thr1015Lys		45851096	NM_153616	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	37	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.228819	0.39399	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.17854	2.26;2.29;2.29;2.28;2.25;2.25;2.26;2.26	5.8	5.8	0.92144	.	0.282280	0.39615	N	0.001320	T	0.14960	0.0361	L	0.29908	0.895	0.80722	D	1	B;B;B;P	0.35684	0.056;0.099;0.381;0.515	B;B;B;B	0.29267	0.033;0.075;0.046;0.1	T	0.02526	-1.1146	10	0.42905	T	0.14	.	20.0693	0.97712	0.0:1.0:0.0:0.0	.	940;959;1015;953	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	K	953;1015;1015;996;972;959;953;940	ENSP00000442040:T953K;ENSP00000446152:T1015K;ENSP00000324857:T1015K;ENSP00000374084:T996K;ENSP00000374083:T972K;ENSP00000346786:T959K;ENSP00000350770:T953K;ENSP00000374079:T940K	ENSP00000324857:T1015K	T	+	2	0	SEMA6D	45851096	1.000000	0.71417	0.996000	0.52242	0.865000	0.49528	3.520000	0.53465	2.758000	0.94735	0.563000	0.77884	ACA		0.517	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
ADH7	131	broad.mit.edu	37	4	100349246	100349246	+	Silent	SNP	G	G	A	rs141541308	byFrequency	TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr4:100349246G>A	ENST00000209665.4	-	4	621	c.381C>T	c.(379-381)agC>agT	p.S127S	ADH7_ENST00000437033.2_Silent_p.S115S|ADH7_ENST00000476959.1_Silent_p.S135S|ADH7_ENST00000482593.1_Silent_p.S58S	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	127					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)	p.S127S(1)		breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		AAACCTACTCGCTCCTAATGC	0.343																																					p.S127S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C381T	4						.						141.0	140.0	140.0					4																	100349246		2203	4300	6503	100568269	SO:0001819	synonymous_variant	131	exon4			X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.381C>T	4.37:g.100349246G>A			100568269	NM_000673	A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Silent	SNP	ENST00000209665.4	37	CCDS34034.1																																																																																				0.343	ADH7-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_000673	
TRPC3	7222	broad.mit.edu	37	4	122828635	122828635	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr4:122828635G>A	ENST00000379645.3	-	7	1953	c.1880C>T	c.(1879-1881)gCg>gTg	p.A627V	TRPC3_ENST00000264811.5_Missense_Mutation_p.A554V|TRPC3_ENST00000513531.1_Missense_Mutation_p.A499V	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	542					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.A554V(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						GAGGATGTACGCAATCCGAGA	0.453																																					p.A554V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1661T	4						.						110.0	108.0	109.0					4																	122828635		2203	4299	6502	123048085	SO:0001583	missense	7222	exon6			Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1880C>T	4.37:g.122828635G>A	ENSP00000368966:p.Ala627Val		123048085	NM_003305	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.596481	0.86953	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98329	-4.87;-4.87;-4.87	5.5	5.5	0.81552	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97870	0.9300	L	0.39467	1.215	0.80722	D	1	P;P;D	0.89917	0.801;0.796;1.0	P;P;D	0.81914	0.59;0.49;0.995	D	0.95404	0.8492	10	0.02654	T	1	-40.157	19.4029	0.94637	0.0:0.0:1.0:0.0	.	542;499;627	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	V	554;627;499	ENSP00000264811:A554V;ENSP00000368966:A627V;ENSP00000426899:A499V	ENSP00000264811:A554V	A	-	2	0	TRPC3	123048085	1.000000	0.71417	0.930000	0.37139	0.929000	0.56500	9.753000	0.98904	2.571000	0.86741	0.655000	0.94253	GCG		0.453	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
LRBA	987	broad.mit.edu	37	4	151356760	151356760	+	Missense_Mutation	SNP	C	C	T	rs371873204		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr4:151356760C>T	ENST00000357115.3	-	47	7298	c.7055G>A	c.(7054-7056)cGt>cAt	p.R2352H	LRBA_ENST00000507224.1_Missense_Mutation_p.R2341H|LRBA_ENST00000510413.1_Missense_Mutation_p.R2341H|LRBA_ENST00000503716.1_5'UTR|LRBA_ENST00000535741.1_Missense_Mutation_p.R2341H	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	2352	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R2352H(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGAGGTATCACGCTGACTGTT	0.358																																					p.R2352H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G7055A	4						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	95.0	103.0	100.0		7055,7055	5.2	1.0	4		100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LRBA	NM_001199282.2,NM_006726.4	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	2352/2864,2352/2864	151356760	2,13004	2203	4300	6503	151576210	SO:0001583	missense	987	exon47			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7055G>A	4.37:g.151356760C>T	ENSP00000349629:p.Arg2352His		151576210	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	37	CCDS3773.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.159784|5.159784	0.94727|0.94727	2.27E-4|2.27E-4	1.16E-4|1.16E-4	ENSG00000198589|ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224|ENST00000509835	T;T;T;T|.	0.80393|.	-1.37;-1.37;-1.37;-1.37|.	5.2|5.2	5.2|5.2	0.72013|0.72013	BEACH domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74772|0.74772	0.3760|0.3760	M|M	0.66560|0.66560	2.04|2.04	0.80722|0.80722	D|D	1|1	D;P;D|.	0.89917|.	1.0;0.688;0.999|.	D;B;D|.	0.78314|.	0.991;0.258;0.953|.	T|T	0.73235|0.73235	-0.4047|-0.4047	10|5	0.44086|.	T|.	0.13|.	.|.	19.0835|19.0835	0.93192|0.93192	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2352;2341;242|.	P50851;P50851-2;Q68D03|.	LRBA_HUMAN;.;.|.	H|M	2341;2341;2352;2341|994	ENSP00000446299:R2341H;ENSP00000421552:R2341H;ENSP00000349629:R2352H;ENSP00000422180:R2341H|.	ENSP00000349629:R2352H|.	R|V	-|-	2|1	0|0	LRBA|LRBA	151576210|151576210	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.701000|7.701000	0.84566|0.84566	2.574000|2.574000	0.86865|0.86865	0.591000|0.591000	0.81541|0.81541	CGT|GTG		0.358	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
LPHN3	23284	broad.mit.edu	37	4	62910254	62910254	+	Silent	SNP	G	G	A	rs182596389	byFrequency	TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr4:62910254G>A	ENST00000514591.1	+	24	3926	c.3597G>A	c.(3595-3597)gcG>gcA	p.A1199A	LPHN3_ENST00000506746.1_Silent_p.A1258A|LPHN3_ENST00000508946.1_Silent_p.A1199A|LPHN3_ENST00000506700.1_Silent_p.A1190A|LPHN3_ENST00000509896.1_Silent_p.A1267A|LPHN3_ENST00000512091.2_Silent_p.A1199A|LPHN3_ENST00000506720.1_Silent_p.A1267A|LPHN3_ENST00000504896.1_Silent_p.A1199A|LPHN3_ENST00000507164.1_Silent_p.A1258A|LPHN3_ENST00000508693.1_Silent_p.A1267A|LPHN3_ENST00000514996.1_Silent_p.A1190A|LPHN3_ENST00000514157.1_Silent_p.A1190A|LPHN3_ENST00000545650.1_Silent_p.A1199A|LPHN3_ENST00000511324.1_Silent_p.A1258A|LPHN3_ENST00000507625.1_Silent_p.A1258A			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1177					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.A1199A(5)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ACAGTTCAGCGTCACTCAACA	0.368													G|||	6	0.00119808	0.0045	0.0	5008	,	,		16079	0.0		0.0	False		,,,				2504	0.0				p.A1199A												.	.	5	Substitution - coding silent(5)	large_intestine(5)	c.G3597A	4						.	G		16,3770		0,16,1877	45.0	42.0	43.0		3597	-5.4	0.9	4		43	1,8249		0,1,4124	no	coding-synonymous	LPHN3	NM_015236.4		0,17,6001	AA,AG,GG		0.0121,0.4226,0.1412		1199/1470	62910254	17,12019	1893	4125	6018	62592849	SO:0001819	synonymous_variant	23284	exon22			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3597G>A	4.37:g.62910254G>A			62592849	NM_015236	E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	37	CCDS54768.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	G	7.943	0.743102	0.15642	0.004226	1.21E-4	ENSG00000150471	ENST00000502815	.	.	.	5.95	-5.37	0.02681	.	.	.	.	.	T	0.46852	0.1414	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46162	-0.9211	4	.	.	.	.	5.8064	0.18442	0.6148:0.0803:0.1569:0.148	.	.	.	.	I	648	.	.	V	+	1	0	LPHN3	62592849	0.001000	0.12720	0.919000	0.36401	0.993000	0.82548	-1.345000	0.02637	-0.951000	0.03654	-0.244000	0.11960	GTC		0.368	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
STPG2	285555	broad.mit.edu	37	4	98893481	98893481	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr4:98893481A>C	ENST00000295268.3	-	7	972	c.883T>G	c.(883-885)Ttc>Gtc	p.F295V		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	295								p.F295V(1)									TGAACCGAGAAGAAAGTCCGA	0.348																																					p.F295V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T883G	4						.						84.0	83.0	83.0					4																	98893481		2203	4300	6503	99112504	SO:0001583	missense	285555	exon7			BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.883T>G	4.37:g.98893481A>C	ENSP00000295268:p.Phe295Val		99112504	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	37	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	A	1.538	-0.542494	0.04053	.	.	ENSG00000163116	ENST00000522676;ENST00000295268	T;T	0.43688	0.94;2.71	5.45	0.206	0.15208	.	0.585021	0.17397	N	0.175693	T	0.22437	0.0541	L	0.34521	1.04	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.11743	-1.0575	10	0.15952	T	0.53	-8.6868	1.8653	0.03197	0.5767:0.1472:0.1333:0.1428	.	295	Q8N412	CD037_HUMAN	V	9;295	ENSP00000428346:F9V;ENSP00000295268:F295V	ENSP00000295268:F295V	F	-	1	0	C4orf37	99112504	0.000000	0.05858	0.003000	0.11579	0.450000	0.32258	-0.256000	0.08757	0.314000	0.23086	0.455000	0.32223	TTC		0.348	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
FBXW7	55294	broad.mit.edu	37	4	153249385	153249385	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr4:153249385G>A	ENST00000281708.4	-	9	2622	c.1393C>T	c.(1393-1395)Cgt>Tgt	p.R465C	FBXW7_ENST00000603841.1_Missense_Mutation_p.R465C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465C|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385C|FBXW7_ENST00000393956.3_Missense_Mutation_p.R289C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465C(71)|p.R226C(11)|p.R385C(11)|p.R347C(3)|p.R465Y(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGCATACAACGCACAGTGGAA	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.R385C			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	FBXW7,large_intestine,NS,Substitution - Missense,+1	.	99	Substitution - Missense(98)|Unknown(1)	haematopoietic_and_lymphoid_tissue(41)|large_intestine(27)|endometrium(20)|stomach(6)|biliary_tract(4)|pancreas(1)	c.C1153T	4						.						260.0	223.0	235.0					4																	153249385		2203	4300	6503	153468835	SO:0001583	missense	55294	exon8			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1393C>T	4.37:g.153249385G>A	ENSP00000281708:p.Arg465Cys		153468835	NM_018315	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	ENST00000281708.4	37	CCDS3777.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909959	0.92107	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.71206	2.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67130	-0.5748	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:0.0:1.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	465;347;385;289	ENSP00000281708:R465C;ENSP00000296555:R347C;ENSP00000263981:R385C;ENSP00000377528:R289C	ENSP00000263981:R385C	R	-	1	0	FBXW7	153468835	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	CGT		0.413	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
SHROOM2	357	broad.mit.edu	37	X	9862668	9862668	+	Silent	SNP	C	C	A			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:9862668C>A	ENST00000380913.3	+	4	810	c.720C>A	c.(718-720)ggC>ggA	p.G240G		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	240					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.G240G(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACACTGTGGGCCTCTGGGAGG	0.662																																					p.G240G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C720A	X						.						42.0	34.0	36.0					X																	9862668		2202	4300	6502	9822668	SO:0001819	synonymous_variant	357	exon4			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.720C>A	X.37:g.9862668C>A			9822668	NM_001649	B9EIQ7	Silent	SNP	ENST00000380913.3	37	CCDS14135.1																																																																																				0.662	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
CNKSR2	22866	broad.mit.edu	37	X	21488902	21488902	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:21488902A>G	ENST00000379510.3	+	5	574	c.538A>G	c.(538-540)Aca>Gca	p.T180A	CNKSR2_ENST00000543067.1_Missense_Mutation_p.T180A|CNKSR2_ENST00000425654.2_Missense_Mutation_p.T180A|CNKSR2_ENST00000279451.4_Missense_Mutation_p.T180A	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	180					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)		p.T180A(1)		breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						TGTATATGAAACAGAGAATAA	0.254																																					p.T180A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A538G	X						.						48.0	55.0	53.0					X																	21488902		2187	4270	6457	21398823	SO:0001583	missense	22866	exon5			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.538A>G	X.37:g.21488902A>G	ENSP00000368824:p.Thr180Ala		21398823	NM_001168649	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.533958	0.45073	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.19105	2.45;2.22;2.17;2.44	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	N	0.22421	0.69	0.53005	D	0.999961	D;P;B	0.89917	1.0;0.573;0.222	D;B;B	0.83275	0.996;0.119;0.085	T	0.05582	-1.0876	10	0.36615	T	0.2	0.0583	12.4401	0.55619	1.0:0.0:0.0:0.0	.	180;180;180	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	A	180	ENSP00000397906:T180A;ENSP00000444633:T180A;ENSP00000279451:T180A;ENSP00000368824:T180A	ENSP00000279451:T180A	T	+	1	0	CNKSR2	21398823	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.315000	0.72853	1.844000	0.53588	0.441000	0.28932	ACA		0.254	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
POLA1	5422	broad.mit.edu	37	X	24830827	24830827	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:24830827G>A	ENST00000379059.3	+	29	3140	c.3125G>A	c.(3124-3126)gGg>gAg	p.G1042E	POLA1_ENST00000379068.3_Missense_Mutation_p.G1048E	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1042					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)	p.G1042E(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GACATTGATGGGGTTTTCAAG	0.373																																					p.G1042E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3125A	X						.						88.0	86.0	87.0					X																	24830827		2203	4300	6503	24740748	SO:0001583	missense	5422	exon29				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3125G>A	X.37:g.24830827G>A	ENSP00000368349:p.Gly1042Glu		24740748	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768651	0.69878	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.16897	2.31;2.31	4.81	3.94	0.45596	DNA polymerase, palm domain (1);DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.051519	0.85682	D	0.000000	T	0.45196	0.1330	M	0.84585	2.705	0.80722	D	1	D	0.69078	0.997	D	0.70487	0.969	T	0.54016	-0.8356	10	0.72032	D	0.01	-8.8542	14.5572	0.68109	0.0:0.1427:0.8573:0.0	.	1042	P09884	DPOLA_HUMAN	E	1048;1042	ENSP00000368358:G1048E;ENSP00000368349:G1042E	ENSP00000368349:G1042E	G	+	2	0	POLA1	24740748	1.000000	0.71417	0.849000	0.33467	0.906000	0.53458	7.432000	0.80349	1.011000	0.39340	0.513000	0.50165	GGG		0.373	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
ZNF630	57232	broad.mit.edu	37	X	47918364	47918364	+	Silent	SNP	A	A	G			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:47918364A>G	ENST00000409324.3	-	5	1693	c.1467T>C	c.(1465-1467)tgT>tgC	p.C489C	ZNF630_ENST00000442455.3_Silent_p.C475C|ZNF630_ENST00000276054.4_Silent_p.C365C|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C489C(1)		endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						CACATTCAGTACACATATAAG	0.418																																					p.C475C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1425C	X						.						72.0	69.0	70.0					X																	47918364		2195	4289	6484	47803308	SO:0001819	synonymous_variant	57232	exon5			AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1467T>C	X.37:g.47918364A>G			47803308	NM_001190255	F8WAG4|Q5H8Z5	Silent	SNP	ENST00000409324.3	37	CCDS35237.2																																																																																				0.418	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735	
AR	367	broad.mit.edu	37	X	66905930	66905930	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:66905930G>A	ENST00000374690.3	+	3	2371	c.1847G>A	c.(1846-1848)cGt>cAt	p.R616H	AR_ENST00000504326.1_Missense_Mutation_p.R616H|AR_ENST00000396044.3_Missense_Mutation_p.R616H|AR_ENST00000396043.2_Missense_Mutation_p.R84H|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	615	Interaction with HIPK3. {ECO:0000250}.|Interaction with LPXN.		L -> P (in AIS). {ECO:0000269|PubMed:8647313}.|L -> R (in PAIS). {ECO:0000269|PubMed:8126121}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R616H(1)|p.R426H(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CCATCTTGTCGTCTTCGGAAA	0.438									Androgen Insensitivity Syndrome																												p.R84H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G251A	X	GRCh37	CD942043|CM910043|CM930035	AR	D|M		.						129.0	108.0	115.0					X																	66905930		2203	4300	6503	66822655	SO:0001583	missense	367	exon3	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1847G>A	X.37:g.66905930G>A	ENSP00000363822:p.Arg616His		66822655	NM_001011645	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	G	30	5.055738	0.93793	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000396043	D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01	5.42	5.42	0.78866	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (4);	0.000000	0.85682	D	0.000000	D	0.99378	0.9781	H	0.98111	4.15	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	D	0.98457	1.0594	10	0.87932	D	0	.	15.3078	0.74008	0.0:0.0:1.0:0.0	.	616;616;84;615	E7EVX6;D3YPQ2;F1D8N5;P10275	.;.;.;ANDR_HUMAN	H	426;616;616;616;84	ENSP00000363822:R616H;ENSP00000421155:R616H;ENSP00000379359:R616H;ENSP00000379358:R84H	ENSP00000363822:R616H	R	+	2	0	AR	66822655	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.054000	0.93866	2.499000	0.84300	0.594000	0.82650	CGT		0.438	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
ZCCHC5	203430	broad.mit.edu	37	X	77913213	77913213	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-3898-01	TCGA-AG-3898-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:77913213A>C	ENST00000321110.1	-	2	1000	c.705T>G	c.(703-705)gaT>gaG	p.D235E		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	235							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.D235E(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						GCAGGGGGAAATCTGTAGCCT	0.502																																					p.D235E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T705G	X						.						27.0	26.0	27.0					X																	77913213		2203	4300	6503	77799869	SO:0001583	missense	203430	exon2			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.705T>G	X.37:g.77913213A>C	ENSP00000316794:p.Asp235Glu		77799869	NM_152694	B2RMZ0|Q5JQE9	Missense_Mutation	SNP	ENST00000321110.1	37	CCDS14440.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.945262	0.00052	.	.	ENSG00000179300	ENST00000321110	T	0.16073	2.37	3.29	3.29	0.37713	.	.	.	.	.	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.41142	-0.9525	9	0.02654	T	1	.	5.1713	0.15112	0.7365:0.0:0.0:0.2634	.	235	Q8N8U3	ZCHC5_HUMAN	E	235	ENSP00000316794:D235E	ENSP00000316794:D235E	D	-	3	2	ZCCHC5	77799869	0.031000	0.19500	0.014000	0.15608	0.008000	0.06430	1.797000	0.38804	1.525000	0.49052	0.417000	0.27973	GAT		0.502	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057319.1	NM_152694	
PCDH19	57526	broad.mit.edu	37	X	99551715	99551715	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:99551715C>T	ENST00000373034.4	-	6	4682	c.3007G>A	c.(3007-3009)Gag>Aag	p.E1003K	PCDH19_ENST00000255531.7_Missense_Mutation_p.E956K|PCDH19_ENST00000464981.1_5'Flank|PCDH19_ENST00000420881.2_Missense_Mutation_p.E955K	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	1003					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E456K(1)|p.E1003K(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TCATAAGCCTCGACATCAGCA	0.577																																					p.E956K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2866A	X						.						81.0	80.0	80.0					X																	99551715		2107	4218	6325	99438371	SO:0001583	missense	57526	exon5			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.3007G>A	X.37:g.99551715C>T	ENSP00000362125:p.Glu1003Lys		99438371	NM_001105243	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	37	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985339	0.74474	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.56776	0.44;0.5;0.44	5.84	5.84	0.93424	.	0.122561	0.56097	D	0.000026	T	0.65228	0.2671	L	0.59436	1.845	0.53688	D	0.999978	P;D;D	0.69078	0.902;0.997;0.994	B;P;P	0.55871	0.207;0.786;0.616	T	0.62779	-0.6782	10	0.38643	T	0.18	.	19.1326	0.93413	0.0:1.0:0.0:0.0	.	1003;956;955	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	K	955;1003;956	ENSP00000400327:E955K;ENSP00000362125:E1003K;ENSP00000255531:E956K	ENSP00000255531:E956K	E	-	1	0	PCDH19	99438371	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.347000	0.65998	2.469000	0.83416	0.600000	0.82982	GAG		0.577	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
ARHGAP36	158763	broad.mit.edu	37	X	130217770	130217770	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chrX:130217770C>T	ENST00000276211.5	+	4	727	c.382C>T	c.(382-384)Cgc>Tgc	p.R128C	ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R116C|ARHGAP36_ENST00000370921.1_5'UTR	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	128					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.R128C(2)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GTTTACCCGCCGCAAGCATCT	0.562																																					p.R128C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C382T	X						.						134.0	132.0	133.0					X																	130217770		2203	4300	6503	130045451	SO:0001583	missense	158763	exon4				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.382C>T	X.37:g.130217770C>T	ENSP00000276211:p.Arg128Cys		130045451	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535966	0.27475	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000423277;ENST00000412432	T;T;T	0.13307	2.6;2.6;2.63	4.3	3.43	0.39272	.	0.137816	0.34156	N	0.004215	T	0.09992	0.0245	N	0.24115	0.695	0.80722	D	1	D;D;D	0.58620	0.957;0.983;0.971	B;B;B	0.43950	0.437;0.437;0.253	T	0.09530	-1.0670	10	0.51188	T	0.08	.	8.4459	0.32841	0.2315:0.7685:0.0:0.0	.	97;116;128	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	C	128;116;80;97	ENSP00000276211:R128C;ENSP00000359960:R116C;ENSP00000408515:R97C	ENSP00000276211:R128C	R	+	1	0	ARHGAP36	130045451	0.999000	0.42202	0.996000	0.52242	0.044000	0.14063	1.640000	0.37186	1.134000	0.42165	0.600000	0.82982	CGC		0.562	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
PXDN	7837	broad.mit.edu	37	2	1652579	1652579	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:1652579C>A	ENST00000252804.4	-	17	3023	c.2973G>T	c.(2971-2973)tgG>tgT	p.W991C		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	991					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.W991C(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GCTCGCGGAACCACAGCGTGT	0.647																																					p.W991C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2973T	2						.						27.0	28.0	28.0					2																	1652579		2168	4263	6431	1631586	SO:0001583	missense	7837	exon17			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2973G>T	2.37:g.1652579C>A	ENSP00000252804:p.Trp991Cys		1631586	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.068284	0.76301	.	.	ENSG00000130508	ENST00000252804	T	0.71934	-0.61	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.89846	0.6833	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92722	0.6192	10	0.87932	D	0	-31.1989	19.4416	0.94823	0.0:1.0:0.0:0.0	.	991	Q92626	PXDN_HUMAN	C	991	ENSP00000252804:W991C	ENSP00000252804:W991C	W	-	3	0	PXDN	1631586	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	6.015000	0.70791	2.596000	0.87737	0.558000	0.71614	TGG		0.647	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
TUBA4A	7277	broad.mit.edu	37	2	220115325	220115325	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:220115325C>T	ENST00000248437.4	-	4	1269	c.1096G>A	c.(1096-1098)Ggt>Agt	p.G366S	TUBA4A_ENST00000498660.1_5'Flank|TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000392088.2_Missense_Mutation_p.G351S	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	366					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G351S(1)|p.G366S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	GCCAGGTCACCCCCAGGCACC	0.617																																					p.G366S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1096A	2						.						62.0	51.0	54.0					2																	220115325		2203	4300	6503	219823569	SO:0001583	missense	7277	exon4			AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.1096G>A	2.37:g.220115325C>T	ENSP00000248437:p.Gly366Ser		219823569	NM_006000	A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	ENST00000248437.4	37	CCDS2438.1	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033360	0.54896	.	.	ENSG00000127824	ENST00000248437;ENST00000392088	T;T	0.79454	-1.27;-1.27	5.11	5.11	0.69529	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81823	0.4904	L	0.43554	1.36	0.80722	D	1	P	0.34757	0.467	P	0.48677	0.586	T	0.82829	-0.0264	10	0.87932	D	0	.	18.7287	0.91726	0.0:1.0:0.0:0.0	.	366	P68366	TBA4A_HUMAN	S	366;351	ENSP00000248437:G366S;ENSP00000375938:G351S	ENSP00000248437:G366S	G	-	1	0	TUBA4A	219823569	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.622000	0.83099	2.644000	0.89710	0.650000	0.86243	GGT		0.617	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256816.3	NM_006000	
ATAD2B	54454	broad.mit.edu	37	2	23977531	23977531	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:23977531G>A	ENST00000238789.5	-	26	4535	c.4192C>T	c.(4192-4194)Cgt>Tgt	p.R1398C	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	1398						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)	p.R1398C(1)		central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATCTCTCACGATCAACTATA	0.398																																					p.R1398C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4192T	2						.						87.0	90.0	89.0					2																	23977531		1858	4089	5947	23831035	SO:0001583	missense	54454	exon26			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.4192C>T	2.37:g.23977531G>A	ENSP00000238789:p.Arg1398Cys		23831035	NM_017552	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	ENST00000238789.5	37	CCDS46227.1	.	.	.	.	.	.	.	.	.	.	G	18.52	3.641578	0.67244	.	.	ENSG00000119778	ENST00000238789;ENST00000546030	D	0.91686	-2.89	5.39	5.39	0.77823	.	0.279593	0.29438	N	0.012153	D	0.82412	0.5031	N	0.08118	0	0.37928	D	0.931901	P;D	0.54772	0.83;0.968	B;B	0.36719	0.116;0.231	D	0.87211	0.2247	10	0.54805	T	0.06	.	16.6994	0.85344	0.0:0.0:1.0:0.0	.	1398;1393	Q9ULI0;Q9ULI0-2	ATD2B_HUMAN;.	C	1398;566	ENSP00000238789:R1398C	ENSP00000238789:R1398C	R	-	1	0	ATAD2B	23831035	1.000000	0.71417	0.967000	0.41034	0.991000	0.79684	6.011000	0.70760	2.712000	0.92718	0.650000	0.86243	CGT		0.398	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324333.1	NM_017552	
DAW1	164781	broad.mit.edu	37	2	228758615	228758615	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:228758615C>A	ENST00000309931.2	+	5	505	c.422C>A	c.(421-423)gCa>gAa	p.A141E	DAW1_ENST00000373666.2_Missense_Mutation_p.A141E|DAW1_ENST00000545118.1_Missense_Mutation_p.A126E|DAW1_ENST00000472604.1_3'UTR	NM_178821.1	NP_849143.1	Q8N136	DAW1_HUMAN	dynein assembly factor with WDR repeat domains 1	141						cilium (GO:0005929)		p.A141E(1)									TATGCCATAGCATTCAACAAT	0.468																																					p.A141E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C422A	2						.						104.0	95.0	98.0					2																	228758615		2203	4300	6503	228466859	SO:0001583	missense	164781	exon5				CCDS2470.1	2q36.3	2013-09-03	2013-02-19	2013-02-19	ENSG00000123977	ENSG00000123977		"""WD repeat domain containing"""	26383	protein-coding gene	gene with protein product	"""outer row dynein assembly 16 homolog (Chlamydomonas)"""		"""WD repeat domain 69"""	WDR69		20568242, 21953912	Standard	NM_178821		Approved	FLJ25955, ODA16	uc002vpn.1	Q8N136	OTTHUMG00000133190	ENST00000309931.2:c.422C>A	2.37:g.228758615C>A	ENSP00000311899:p.Ala141Glu		228466859	NM_178821	Q6ZRY1|Q8N776	Missense_Mutation	SNP	ENST00000309931.2	37	CCDS2470.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.761661	0.69763	.	.	ENSG00000123977	ENST00000373666;ENST00000309931;ENST00000545118	T;T;T	0.63913	-0.07;-0.07;-0.07	5.74	5.74	0.90152	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.113903	0.64402	D	0.000016	T	0.69033	0.3066	L	0.41710	1.295	0.48511	D	0.999667	D	0.58970	0.984	P	0.61275	0.886	T	0.71119	-0.4685	10	0.87932	D	0	.	13.4576	0.61208	0.1566:0.8433:0.0:0.0	.	141	Q8N136	WDR69_HUMAN	E	141;141;126	ENSP00000362770:A141E;ENSP00000311899:A141E;ENSP00000437887:A126E	ENSP00000311899:A141E	A	+	2	0	WDR69	228466859	1.000000	0.71417	0.970000	0.41538	0.618000	0.37518	5.033000	0.64146	2.692000	0.91855	0.650000	0.86243	GCA		0.468	DAW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331745.1	NM_178821	
TP53I3	9540	broad.mit.edu	37	2	24305898	24305898	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:24305898G>A	ENST00000238721.4	-	2	1117	c.263C>T	c.(262-264)gCt>gTt	p.A88V	TP53I3_ENST00000313482.4_Missense_Mutation_p.A88V|TP53I3_ENST00000417886.1_5'UTR|TP53I3_ENST00000407482.1_Missense_Mutation_p.A88V|TP53I3_ENST00000335934.4_Missense_Mutation_p.A88V|FAM228B_ENST00000461972.1_Intron	NM_004881.4	NP_004872.2	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	88					NADP metabolic process (GO:0006739)	extracellular vesicular exosome (GO:0070062)	NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)	p.A88V(1)		endometrium(1)|kidney(4)|large_intestine(2)|lung(3)|urinary_tract(2)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGAGCAGAGCCATGGCTGT	0.632																																					p.A88V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C263T	2						.						63.0	64.0	64.0					2																	24305898		2203	4300	6503	24159402	SO:0001583	missense	9540	exon3			AF010309	CCDS1708.1, CCDS56112.1	2p23.3	2009-06-12			ENSG00000115129	ENSG00000115129			19373	protein-coding gene	gene with protein product		605171				11919562, 10840161, 19349281	Standard	NM_004881		Approved	PIG3	uc002rez.2	Q53FA7	OTTHUMG00000090817	ENST00000238721.4:c.263C>T	2.37:g.24305898G>A	ENSP00000238721:p.Ala88Val		24159402	NM_147184	D6W533|O14679|O14685|Q38G78|Q6JLE7|Q9BWB8	Missense_Mutation	SNP	ENST00000238721.4	37	CCDS1708.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.272406	0.80580	.	.	ENSG00000115129	ENST00000335934;ENST00000238721;ENST00000313482;ENST00000407482;ENST00000413037	T;T;T;T;T	0.16743	3.78;3.78;2.32;2.32;2.37	4.98	3.06	0.35304	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.114905	0.64402	N	0.000018	T	0.17238	0.0414	L	0.48986	1.54	0.42869	D	0.99413	B;P	0.39551	0.318;0.678	B;B	0.39027	0.134;0.288	T	0.02132	-1.1208	10	0.62326	D	0.03	-0.9857	10.4747	0.44657	0.1343:0.0:0.8657:0.0	.	88;88	Q53FA7;Q53FA7-2	QORX_HUMAN;.	V	88;88;88;88;83	ENSP00000337834:A88V;ENSP00000238721:A88V;ENSP00000322298:A88V;ENSP00000384414:A88V;ENSP00000389620:A83V	ENSP00000238721:A88V	A	-	2	0	TP53I3	24159402	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.412000	0.52679	0.524000	0.28502	0.655000	0.94253	GCT		0.632	TP53I3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207618.2	NM_004881	
PPM1B	5495	broad.mit.edu	37	2	44428909	44428909	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:44428909C>T	ENST00000282412.4	+	2	983	c.571C>T	c.(571-573)Cgt>Tgt	p.R191C	PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000345249.4_Intron|PPM1B_ENST00000409432.3_Missense_Mutation_p.R191C|PPM1B_ENST00000409895.4_Missense_Mutation_p.R191C|PPM1B_ENST00000378551.2_Missense_Mutation_p.R191C	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	191					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)	p.R191S(3)|p.R191C(1)		kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GATGATACAACGTGTTAATGG	0.468																																					p.R191C												.	.	4	Substitution - Missense(4)	kidney(3)|large_intestine(1)	c.C571T	2						.						182.0	169.0	173.0					2																	44428909		2203	4300	6503	44282413	SO:0001583	missense	5495	exon2			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.571C>T	2.37:g.44428909C>T	ENSP00000282412:p.Arg191Cys		44282413	NM_002706	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Missense_Mutation	SNP	ENST00000282412.4	37	CCDS1817.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611873	0.66558	.	.	ENSG00000138032	ENST00000419807;ENST00000409895;ENST00000409432;ENST00000282412;ENST00000378551;ENST00000409473	T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38	5.68	5.68	0.88126	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.79811	0.4510	H	0.99746	4.745	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999	D	0.89014	0.3430	10	0.87932	D	0	-14.9137	19.8002	0.96504	0.0:1.0:0.0:0.0	.	191;191;191;191;191	Q4J6C0;O75688-2;Q4J6C1;O75688;Q4J6C2	.;.;.;PPM1B_HUMAN;.	C	191	ENSP00000390087:R191C;ENSP00000387341:R191C;ENSP00000387287:R191C;ENSP00000282412:R191C;ENSP00000367813:R191C;ENSP00000386982:R191C	ENSP00000282412:R191C	R	+	1	0	PPM1B	44282413	1.000000	0.71417	0.948000	0.38648	0.900000	0.52787	3.804000	0.55568	2.674000	0.91012	0.655000	0.94253	CGT		0.468	PPM1B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250672.1	NM_002706	
USP39	10713	broad.mit.edu	37	2	85872186	85872186	+	Missense_Mutation	SNP	C	C	T	rs143344250		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:85872186C>T	ENST00000323701.6	+	11	1553	c.1543C>T	c.(1543-1545)Cgg>Tgg	p.R515W	USP39_ENST00000409470.1_Missense_Mutation_p.R515W|USP39_ENST00000459775.1_3'UTR|USP39_ENST00000409766.3_Intron|USP39_ENST00000450066.2_Missense_Mutation_p.R412W|USP39_ENST00000409025.1_Missense_Mutation_p.R515W	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	515	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)	p.R515W(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						GGGCTCCTACCGGATCCACGT	0.517																																					p.R515W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1543T	2						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	99.0	86.0	90.0		1543	5.2	1.0	2	dbSNP_134	90	0,8600		0,0,4300	no	missense	USP39	NM_006590.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	515/566	85872186	1,13005	2203	4300	6503	85725697	SO:0001583	missense	10713	exon11			AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.1543C>T	2.37:g.85872186C>T	ENSP00000312981:p.Arg515Trp		85725697	NM_006590	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	ENST00000323701.6	37	CCDS33234.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114049	0.77210	2.27E-4	0.0	ENSG00000168883	ENST00000450066;ENST00000409268;ENST00000409025;ENST00000409470;ENST00000323701	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	6.13	5.24	0.73138	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.59032	0.2164	M	0.84082	2.675	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.991;0.997;0.997	T	0.65586	-0.6132	10	0.72032	D	0.01	-24.9534	14.3044	0.66375	0.1543:0.8457:0.0:0.0	.	412;437;515;515	B4DHT4;B7Z7L9;B9A018;Q53GS9	.;.;.;SNUT2_HUMAN	W	412;452;515;515;515	ENSP00000396133:R412W;ENSP00000386572:R515W;ENSP00000386864:R515W;ENSP00000312981:R515W	ENSP00000312981:R515W	R	+	1	2	USP39	85725697	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.220000	0.32491	1.560000	0.49568	0.650000	0.86243	CGG		0.517	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329892.1	NM_006590	
FAHD2B	151313	broad.mit.edu	37	2	97749739	97749739	+	Silent	SNP	T	T	C	rs374707075		TCGA-AG-3898-01	TCGA-AG-3898-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:97749739T>C	ENST00000414820.1	-	8	1098	c.828A>G	c.(826-828)ctA>ctG	p.L276L	FAHD2B_ENST00000440566.2_Silent_p.L276L|FAHD2B_ENST00000468548.1_5'Flank|FAHD2B_ENST00000272610.3_Silent_p.L276L			Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing 2B	276							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.L276L(2)		kidney(5)|large_intestine(2)|lung(3)|skin(2)	12						GGGTCCCAGTTAGGATGACAT	0.557																																					p.L276L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A828G	2						.						34.0	34.0	34.0					2																	97749739		2203	4299	6502	97113466	SO:0001819	synonymous_variant	151313	exon7				CCDS2030.1	2q11.2	2012-06-29			ENSG00000144199	ENSG00000144199			25318	protein-coding gene	gene with protein product							Standard	NM_199336		Approved	DKFZp434N062	uc002sxm.3	Q6P2I3	OTTHUMG00000130533	ENST00000414820.1:c.828A>G	2.37:g.97749739T>C			97113466	NM_199336	D3DXH7|Q8NDK1	Silent	SNP	ENST00000414820.1	37	CCDS2030.1																																																																																				0.557	FAHD2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339482.1	NM_199336	
NDUFA10	4705	broad.mit.edu	37	2	240960762	240960762	+	Silent	SNP	G	G	A	rs145407882		TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr2:240960762G>A	ENST00000252711.2	-	3	412	c.312C>T	c.(310-312)ctC>ctT	p.L104L	NDUFA10_ENST00000404554.1_Silent_p.L104L|NDUFA10_ENST00000307300.4_Silent_p.L104L|NDUFA10_ENST00000407129.3_Silent_p.L104L	NM_004544.3	NP_004535.1	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa	104					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|nucleoside kinase activity (GO:0019206)	p.L104L(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)	16		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)		AGTCGGTGGCGAGGGGCTTCC	0.488											OREG0015348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0008	0.0	5008	,	,		20148	0.0		0.0	False		,,,				2504	0.0				p.L104L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C312T	2						.	G		1,4405	2.1+/-5.4	0,1,2202	89.0	89.0	89.0		312	-3.2	0.0	2	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NDUFA10	NM_004544.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		104/356	240960762	2,13004	2203	4300	6503	240609435	SO:0001819	synonymous_variant	4705	exon3			AF087661	CCDS2531.1	2q37.3	2011-07-04	2002-08-29		ENSG00000130414	ENSG00000130414		"""Mitochondrial respiratory chain complex / Complex I"""	7684	protein-coding gene	gene with protein product	"""complex I 42kDa subunit"""	603835	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10 (42kD)"""			9878551	Standard	NM_004544		Approved	CI-42k	uc002vyn.3	O95299	OTTHUMG00000133350	ENST00000252711.2:c.312C>T	2.37:g.240960762G>A		2423	240609435	NM_004544	Q8WXC9	Silent	SNP	ENST00000252711.2	37	CCDS2531.1																																																																																				0.488	NDUFA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257180.2	NM_004544	
NTNG2	84628	broad.mit.edu	37	9	135073918	135073918	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr9:135073918C>T	ENST00000393229.3	+	3	1555	c.779C>T	c.(778-780)gCg>gTg	p.A260V	NTNG2_ENST00000393228.4_Missense_Mutation_p.A260V|NTNG2_ENST00000372179.3_Missense_Mutation_p.A260V|NTNG2_ENST00000360670.3_Missense_Mutation_p.A260V	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	260	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)		p.A260V(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		CTGCGCCCGGCGCTGGGCGGC	0.637																																					p.A260V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C779T	9						.						37.0	43.0	41.0					9																	135073918		2202	4296	6498	134063739	SO:0001583	missense	84628	exon3			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.779C>T	9.37:g.135073918C>T	ENSP00000376921:p.Ala260Val		134063739	NM_032536	Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	ENST00000393229.3	37	CCDS6946.1	.	.	.	.	.	.	.	.	.	.	C	33	5.236627	0.95240	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670;ENST00000372179	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	5.34	5.34	0.76211	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.84624	0.5513	M	0.65975	2.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.71414	0.973	D	0.83855	0.0265	10	0.40728	T	0.16	.	18.0304	0.89282	0.0:1.0:0.0:0.0	.	260	Q96CW9	NTNG2_HUMAN	V	260	ENSP00000376921:A260V;ENSP00000376920:A260V;ENSP00000353888:A260V;ENSP00000361252:A260V	ENSP00000353888:A260V	A	+	2	0	NTNG2	134063739	1.000000	0.71417	0.991000	0.47740	0.882000	0.50991	6.084000	0.71335	2.485000	0.83878	0.491000	0.48974	GCG		0.637	NTNG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054779.1	NM_032536	
LRCH1	23143	broad.mit.edu	37	13	47260087	47260087	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr13:47260087G>A	ENST00000389798.3	+	5	930	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	LRCH1_ENST00000389797.3_Missense_Mutation_p.V245M|LRCH1_ENST00000311191.6_Missense_Mutation_p.V245M	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	245								p.V245M(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		CTGCAACAAAGTGCTCGTGAT	0.363																																					p.V245M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G733A	13						.						62.0	58.0	59.0					13																	47260087		2203	4300	6503	46158088	SO:0001583	missense	23143	exon5			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.733G>A	13.37:g.47260087G>A	ENSP00000374448:p.Val245Met		46158088	NM_001164211	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	ENST00000389798.3	37	CCDS31972.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419222	0.83559	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.18960	2.18;2.18;2.18	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	M	0.66439	2.03	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.994	D;D;D;D	0.97110	0.999;1.0;0.999;0.972	T	0.38520	-0.9657	10	0.87932	D	0	-20.2544	19.3421	0.94347	0.0:0.0:1.0:0.0	.	245;245;245;245	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	M	245	ENSP00000308493:V245M;ENSP00000374448:V245M;ENSP00000374447:V245M	ENSP00000308493:V245M	V	+	1	0	LRCH1	46158088	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.192000	0.72069	2.826000	0.97356	0.655000	0.94253	GTG		0.363	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044824.2	NM_015116	
PCDH17	27253	broad.mit.edu	37	13	58208285	58208285	+	Silent	SNP	C	C	T	rs143619660		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr13:58208285C>T	ENST00000377918.3	+	1	1631	c.1605C>T	c.(1603-1605)taC>taT	p.Y535Y		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	535	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y535Y(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GGGCCATCTACGCCCTGCGCT	0.587																																					p.Y535Y	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1605T	13						.	C		0,4406		0,0,2203	52.0	51.0	51.0		1605	-0.6	1.0	13	dbSNP_134	51	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	PCDH17	NM_001040429.2		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		535/1160	58208285	3,13003	2203	4300	6503	57106286	SO:0001819	synonymous_variant	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1605C>T	13.37:g.58208285C>T			57106286	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	ENST00000377918.3	37	CCDS31986.1																																																																																				0.587	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
ARHGEF7	8874	broad.mit.edu	37	13	111926252	111926252	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr13:111926252C>T	ENST00000375741.2	+	11	1478	c.1228C>T	c.(1228-1230)Ctg>Ttg	p.L410L	ARHGEF7_ENST00000375723.1_Silent_p.L232L|ARHGEF7_ENST00000375737.5_Silent_p.L307L|ARHGEF7_ENST00000375736.4_Silent_p.L232L|ARHGEF7_ENST00000478679.1_Silent_p.L154L|ARHGEF7_ENST00000544132.1_Intron|ARHGEF7_ENST00000218789.5_Silent_p.L232L|ARHGEF7_ENST00000375739.2_Silent_p.L360L|ARHGEF7_ENST00000483189.1_3'UTR|ARHGEF7_ENST00000317133.5_Silent_p.L389L|ARHGEF7_ENST00000370623.3_Silent_p.L317L|ARHGEF7_ENST00000426073.2_Silent_p.L232L	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	410	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L232L(1)|p.L389L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CTTCATGCGCCTGGATAAATA	0.552																																					p.L360L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1078T	13						.						87.0	78.0	81.0					13																	111926252		2203	4300	6503	110724253	SO:0001819	synonymous_variant	8874	exon9			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1228C>T	13.37:g.111926252C>T			110724253	NM_001113512	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000375741.2	37	CCDS45068.1																																																																																				0.552	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
TCF7L2	6934	broad.mit.edu	37	10	114901075	114901075	+	Splice_Site	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr10:114901075G>A	ENST00000355995.4	+	6	1192	c.685G>A	c.(685-687)Gga>Aga	p.G229R	TCF7L2_ENST00000538897.1_Splice_Site_p.G229R|TCF7L2_ENST00000542695.1_5'UTR|TCF7L2_ENST00000349937.2_Splice_Site_p.G229R|TCF7L2_ENST00000543371.1_Splice_Site_p.G229R|TCF7L2_ENST00000534894.1_Splice_Site_p.G229R|TCF7L2_ENST00000369395.1_Splice_Site_p.G254R|TCF7L2_ENST00000545257.1_Splice_Site_p.G229R|TCF7L2_ENST00000352065.5_Splice_Site_p.G206R|TCF7L2_ENST00000536810.1_Splice_Site_p.G229R|TCF7L2_ENST00000369389.1_5'Flank|TCF7L2_ENST00000355717.4_Splice_Site_p.G253R|TCF7L2_ENST00000369397.4_Splice_Site_p.G206R			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	229	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G206R(1)|p.G229R(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CCCCAAAACAGGTAGGCTGTG	0.602			T	VTI1A	colorectal																																p.G206R			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G616A	10						.						103.0	89.0	93.0					10																	114901075		2203	4300	6503	114891065	SO:0001630	splice_region_variant	6934	exon5			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.685+1G>A	10.37:g.114901075G>A			114891065	NM_001146284	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	g	36	5.664229	0.96745	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000349937;ENST00000352065;ENST00000369395	D;D;D;D;D;D;D;D;D	0.99769	-6.14;-6.17;-6.25;-6.25;-6.52;-6.7;-6.57;-6.17;-6.56	5.45	5.45	0.79879	CTNNB1 binding, N-teminal (1);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	M	0.83384	2.64	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.998;0.999;1.0;1.0;1.0;1.0;0.999;1.0;0.999;0.999;0.999;0.999;1.0;1.0;0.999;0.999;0.999;1.0	D	0.97374	0.9978	10	0.87932	D	0	-6.0561	19.2979	0.94131	0.0:0.0:1.0:0.0	.	86;46;123;229;100;148;206;206;206;172;229;206;206;206;253;206;229;206;206	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	R	229;229;229;229;253;229;229;206;229;206;254	ENSP00000348274:G229R;ENSP00000440547:G229R;ENSP00000444972:G229R;ENSP00000446238:G229R;ENSP00000347949:G253R;ENSP00000446172:G229R;ENSP00000443626:G229R;ENSP00000358404:G206R;ENSP00000344823:G206R	ENSP00000298692:G229R	G	+	1	0	TCF7L2	114891065	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.864000	0.99589	2.559000	0.86315	0.650000	0.86243	GGA		0.602	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	Missense_Mutation
PNLIPRP3	119548	broad.mit.edu	37	10	118220738	118220738	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr10:118220738C>T	ENST00000369230.3	+	7	890	c.744C>T	c.(742-744)caC>caT	p.H248H		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	248					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.H248H(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		GAGGGAAGCACATGCCAGGAT	0.353																																					p.H248H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C744T	10						.						159.0	152.0	154.0					10																	118220738		2203	4300	6503	118210728	SO:0001819	synonymous_variant	119548	exon7			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.744C>T	10.37:g.118220738C>T			118210728	NM_001011709		Silent	SNP	ENST00000369230.3	37	CCDS31292.1																																																																																				0.353	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050520.1	XM_058404	
CUBN	8029	broad.mit.edu	37	10	16916455	16916455	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr10:16916455C>A	ENST00000377833.4	-	58	9219	c.9154G>T	c.(9154-9156)Gcc>Tcc	p.A3052S		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3052	CUB 23. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.A3052S(1)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TATGAATAGGCAGGACTTGTG	0.448																																					p.A3052S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9154T	10						.						185.0	148.0	161.0					10																	16916455		2203	4300	6503	16956461	SO:0001583	missense	8029	exon58			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9154G>T	10.37:g.16916455C>A	ENSP00000367064:p.Ala3052Ser		16956461	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	3.514	-0.099089	0.07010	.	.	ENSG00000107611	ENST00000377833	T	0.26957	1.7	5.44	-0.323	0.12709	CUB (5);	1.471140	0.04665	N	0.409585	T	0.10165	0.0249	N	0.02412	-0.56	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.31194	-0.9952	10	0.07175	T	0.84	.	9.2745	0.37692	0.606:0.2775:0.0:0.1166	.	3052	O60494	CUBN_HUMAN	S	3052	ENSP00000367064:A3052S	ENSP00000367064:A3052S	A	-	1	0	CUBN	16956461	0.036000	0.19791	0.001000	0.08648	0.007000	0.05969	0.005000	0.13129	-0.587000	0.05890	-0.808000	0.03180	GCC		0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
TLL2	7093	broad.mit.edu	37	10	98156950	98156950	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr10:98156950C>T	ENST00000357947.3	-	11	1602	c.1377G>A	c.(1375-1377)gcG>gcA	p.A459A	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	459	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.A459A(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AACCTTCGTACGCTGCAAAGA	0.622																																					p.A459A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1377A	10						.						75.0	62.0	66.0					10																	98156950		2203	4300	6503	98146940	SO:0001819	synonymous_variant	7093	exon11			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1377G>A	10.37:g.98156950C>T			98146940	NM_012465	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Silent	SNP	ENST00000357947.3	37	CCDS7449.1																																																																																				0.622	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049608.1		
GOLGA7B	401647	broad.mit.edu	37	10	99623944	99623944	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr10:99623944G>A	ENST00000370602.1	+	4	376	c.311G>A	c.(310-312)cGc>cAc	p.R104H		NM_001010917.2	NP_001010917.1	Q2TAP0	GOG7B_HUMAN	golgin A7 family, member B	104						Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.R104H(1)		endometrium(1)|large_intestine(3)|prostate(1)	5						AAGATTTCCCGCTACATCCAG	0.562																																					p.R104H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G311A	10						.						81.0	74.0	76.0					10																	99623944		2203	4300	6503	99613934	SO:0001583	missense	401647	exon4			BC008047	CCDS31265.1	10q24.2	2011-10-25	2010-02-12	2008-10-03	ENSG00000155265	ENSG00000155265			31668	protein-coding gene	gene with protein product		614189	"""chromosome 10 open reading frame 133"", ""chromosome 10 open reading frame 132"", ""golgi autoantigen, golgin subfamily a, 7B"""	C10orf133, C10orf132			Standard	NM_001010917		Approved	bA459F3.4, bA451M19.3	uc001kos.3	Q2TAP0	OTTHUMG00000018869	ENST00000370602.1:c.311G>A	10.37:g.99623944G>A	ENSP00000359634:p.Arg104His		99613934	NM_001010917	Q5T4F5	Missense_Mutation	SNP	ENST00000370602.1	37	CCDS31265.1	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875259	0.33162	.	.	ENSG00000155265	ENST00000370602	.	.	.	5.31	3.48	0.39840	Golgin subfamily A member 7/ERF4 (1);	0.114380	0.56097	D	0.000036	T	0.36054	0.0953	L	0.59436	1.845	0.24039	N	0.996086	D	0.60575	0.988	P	0.46389	0.515	T	0.29518	-1.0009	9	0.72032	D	0.01	-45.8472	6.7581	0.23526	0.3365:0.0:0.6635:0.0	.	104	Q2TAP0	GOG7B_HUMAN	H	104	.	ENSP00000359634:R104H	R	+	2	0	GOLGA7B	99613934	0.986000	0.35501	0.985000	0.45067	0.034000	0.12701	2.375000	0.44283	0.841000	0.35020	-0.136000	0.14681	CGC		0.562	GOLGA7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049752.1	NM_001010917	
LHPP	64077	broad.mit.edu	37	10	126176996	126176996	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr10:126176996C>T	ENST00000368842.5	+	3	347	c.319C>T	c.(319-321)Cgc>Tgc	p.R107C	LHPP_ENST00000392757.4_Missense_Mutation_p.R107C|LHPP_ENST00000368839.1_Missense_Mutation_p.R107C	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	107					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)	p.R107C(1)		large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		TCCAGGAGTCCGCTCAGAATT	0.507																																					p.R107C	GBM(165;1980 2715 15999 18454)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C319T	10						.						85.0	85.0	85.0					10																	126176996		2203	4300	6503	126166986	SO:0001583	missense	64077	exon3			AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.319C>T	10.37:g.126176996C>T	ENSP00000357835:p.Arg107Cys		126166986	NM_001167880	B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Missense_Mutation	SNP	ENST00000368842.5	37	CCDS7640.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.490540	0.64074	.	.	ENSG00000107902	ENST00000392757;ENST00000368842;ENST00000368839	T;T;T	0.23754	1.89;1.89;1.89	5.04	5.04	0.67666	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);Nitrophenylphosphatase-like  domain (1);	0.244845	0.35151	N	0.003411	T	0.44519	0.1297	M	0.66506	2.035	0.51482	D	0.999928	D;D;P	0.76494	0.999;0.998;0.945	P;P;P	0.59357	0.856;0.695;0.762	T	0.23547	-1.0185	10	0.37606	T	0.19	-18.4755	15.4244	0.75041	0.0:0.8511:0.1488:0.0	.	107;107;107	Q5T1Z0;Q9H008-2;Q9H008	.;.;LHPP_HUMAN	C	107	ENSP00000376512:R107C;ENSP00000357835:R107C;ENSP00000357832:R107C	ENSP00000357832:R107C	R	+	1	0	LHPP	126166986	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	2.296000	0.43584	2.512000	0.84698	0.655000	0.94253	CGC		0.507	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050870.1	NM_022126	
APC	324	broad.mit.edu	37	5	112173704	112173704	+	Nonsense_Mutation	SNP	C	C	T	rs587779783		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:112173704C>T	ENST00000457016.1	+	16	2793	c.2413C>T	c.(2413-2415)Cga>Tga	p.R805*	APC_ENST00000508376.2_Nonsense_Mutation_p.R805*|APC_ENST00000257430.4_Nonsense_Mutation_p.R805*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	805	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R805*(10)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGACACCAATCGACATGATGA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R787X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0	.	11	Substitution - Nonsense(10)|Unknown(1)	large_intestine(10)|skin(1)	c.C2359T	5	GRCh37	CM960067	APC	M		.						77.0	78.0	78.0					5																	112173704		2202	4300	6502	112201603	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2413C>T	5.37:g.112173704C>T	ENSP00000413133:p.Arg805*		112201603	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.853935	0.97030	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.16	4.36	0.52297	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-10.8016	14.7295	0.69372	0.4961:0.5038:0.0:0.0	.	.	.	.	X	805;787;805;805;805	.	ENSP00000257430:R805X	R	+	1	2	APC	112201603	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.615000	0.36922	0.896000	0.36366	-0.188000	0.12872	CGA		0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112174412	112174412	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:112174412C>G	ENST00000457016.1	+	16	3501	c.3121C>G	c.(3121-3123)Caa>Gaa	p.Q1041E	APC_ENST00000508376.2_Missense_Mutation_p.Q1041E|APC_ENST00000257430.4_Missense_Mutation_p.Q1041E|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1041	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1041E(1)|p.Q1041*(1)|p.?(1)|p.S1042fs*6(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTCTGGAAGGCAAAGTCCTTC	0.338		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1023E	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,soft_tissue,fibrous_tissue_and_uncertain_origin,Substitution - Nonsense,0	.	4	Substitution - Nonsense(1)|Unknown(1)|Insertion - Frameshift(1)|Substitution - Missense(1)	large_intestine(2)|soft_tissue(1)|skin(1)	c.C3067G	5	GRCh37	CM920045	APC	M		.						65.0	66.0	66.0					5																	112174412		2202	4300	6502	112202311	SO:0001583	missense	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3121C>G	5.37:g.112174412C>G	ENSP00000413133:p.Gln1041Glu		112202311	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077596	0.55753	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.94576	-2.71;-3.46;-2.71;-2.71;-2.89	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.94291	0.8166	L	0.27053	0.805	0.51482	D	0.999923	D;D	0.54964	0.969;0.969	D;D	0.64877	0.93;0.93	D	0.92953	0.6382	10	0.30854	T	0.27	-12.6463	15.141	0.72609	0.0:0.9305:0.0:0.0695	.	1043;1041	Q4LE70;P25054	.;APC_HUMAN	E	1041;1023;1041;1041;1041	ENSP00000413133:Q1041E;ENSP00000423224:Q1023E;ENSP00000257430:Q1041E;ENSP00000427089:Q1041E;ENSP00000423828:Q1041E	ENSP00000257430:Q1041E	Q	+	1	0	APC	112202311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.294000	0.78760	2.726000	0.93360	0.655000	0.94253	CAA		0.338	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FEM1C	56929	broad.mit.edu	37	5	114860764	114860764	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:114860764C>T	ENST00000274457.3	-	3	1656	c.1095G>A	c.(1093-1095)ttG>ttA	p.L365L		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	365					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)		p.L365L(1)		breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		GCTGCATATCCAAAGCATACT	0.413																																					p.L365L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1095A	5						.						95.0	92.0	93.0					5																	114860764		2202	4300	6502	114888663	SO:0001819	synonymous_variant	56929	exon3				CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1095G>A	5.37:g.114860764C>T			114888663	NM_020177	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Silent	SNP	ENST00000274457.3	37	CCDS4118.1																																																																																				0.413	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250857.3	NM_020177	
FTMT	94033	broad.mit.edu	37	5	121188027	121188027	+	Silent	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:121188027C>T	ENST00000321339.1	+	1	378	c.369C>T	c.(367-369)acC>acT	p.T123T		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	123	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.T123T(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GGGAGGAGACCGAGCACGCGG	0.592																																					p.T123T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C369T	5						.						59.0	58.0	58.0					5																	121188027		2203	4300	6503	121215926	SO:0001819	synonymous_variant	94033	exon1			BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.369C>T	5.37:g.121188027C>T			121215926	NM_177478		Silent	SNP	ENST00000321339.1	37	CCDS4128.1																																																																																				0.592	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
TRPC7	57113	broad.mit.edu	37	5	135692763	135692763	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:135692763G>A	ENST00000513104.1	-	2	595	c.313C>T	c.(313-315)Cgg>Tgg	p.R105W	TRPC7_ENST00000355180.3_Missense_Mutation_p.R105W|TRPC7_ENST00000426057.2_Missense_Mutation_p.R105W	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	105					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R105W(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCCCCCACCCGTGCCAGGTTC	0.652																																					p.R105W												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C313T	5						.						56.0	65.0	62.0					5																	135692763		2203	4300	6503	135720662	SO:0001583	missense	57113	exon2			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.313C>T	5.37:g.135692763G>A	ENSP00000426070:p.Arg105Trp		135720662	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.06|18.06	3.540262|3.540262	0.65085|0.65085	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	T;T;T|.	0.71103|.	-0.54;-0.54;-0.54|.	5.0|5.0	4.06|4.06	0.47325|0.47325	Ankyrin repeat-containing domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71854|0.71854	0.3389|0.3389	M|M	0.78637|0.78637	2.42|2.42	0.33398|0.33398	D|D	0.576973|0.576973	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.91635|.	0.993;0.982;0.999;0.998|.	T|T	0.79364|0.79364	-0.1834|-0.1834	10|5	0.87932|.	D|.	0|.	-15.3684|-15.3684	16.0147|16.0147	0.80427|0.80427	0.0:0.0:0.8568:0.1432|0.0:0.0:0.8568:0.1432	.|.	105;105;105;105|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	W|M	105|104	ENSP00000347312:R105W;ENSP00000441628:R105W;ENSP00000426070:R105W|.	ENSP00000265193:R105W|.	R|T	-|-	1|2	2|0	TRPC7|TRPC7	135720662|135720662	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.980000|0.980000	0.70556|0.70556	3.406000|3.406000	0.52637|0.52637	2.608000|2.608000	0.88229|0.88229	0.561000|0.561000	0.74099|0.74099	CGG|ACG		0.652	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHB3	56132	broad.mit.edu	37	5	140481822	140481822	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:140481822G>A	ENST00000231130.2	+	1	1589	c.1589G>A	c.(1588-1590)cGc>cAc	p.R530H	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	530	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.R530H(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGAGTTCCGCGTGGGCGCC	0.667																																					p.R530H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1589A	5						.						59.0	63.0	62.0					5																	140481822		2203	4300	6503	140462006	SO:0001583	missense	56132	exon1			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1589G>A	5.37:g.140481822G>A	ENSP00000231130:p.Arg530His		140462006	NM_018937	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	G	0.185	-1.058176	0.01950	.	.	ENSG00000113205	ENST00000231130	T	0.01767	4.65	4.14	1.03	0.20045	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.01092	0.0036	N	0.11064	0.09	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.48854	-0.8998	9	0.15499	T	0.54	.	6.6896	0.23163	0.1992:0.224:0.5769:0.0	.	530	Q9Y5E6	PCDB3_HUMAN	H	530	ENSP00000231130:R530H	ENSP00000231130:R530H	R	+	2	0	PCDHB3	140462006	0.000000	0.05858	0.989000	0.46669	0.065000	0.16274	-0.362000	0.07602	0.834000	0.34852	0.650000	0.86243	CGC		0.667	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
TNIP1	10318	broad.mit.edu	37	5	150407549	150407549	+	IGR	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:150407549G>A	ENST00000389378.2	-	0	3268				GPX3_ENST00000388825.4_Missense_Mutation_p.R180H|GPX3_ENST00000517973.1_3'UTR	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1						defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.R180H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACGACATCCGCTGGAACTTT	0.572																																					p.R180H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G539A	5						.						53.0	56.0	55.0					5																	150407549		2034	4218	6252	150387742	SO:0001628	intergenic_variant	2878	exon5			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025			5.37:g.150407549G>A			150387742	NM_002084	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	ENST00000389378.2	37	CCDS34280.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710208	0.89018	.	.	ENSG00000211445	ENST00000388825	T	0.04194	3.68	5.33	3.51	0.40186	Thioredoxin-like fold (2);	0.124148	0.50627	D	0.000119	T	0.12561	0.0305	M	0.89534	3.04	0.80722	D	1	D	0.58620	0.983	P	0.48425	0.577	T	0.00939	-1.1507	10	0.72032	D	0.01	.	4.0691	0.09874	0.2916:0.1795:0.529:0.0	.	180	P22352	GPX3_HUMAN	H	180	ENSP00000373477:R180H	ENSP00000373477:R180H	R	+	2	0	GPX3	150387742	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.555000	0.60767	0.587000	0.29643	0.655000	0.94253	CGC		0.572	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374914.1	NM_006058	
CDHR2	54825	broad.mit.edu	37	5	176011567	176011567	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:176011567C>T	ENST00000510636.1	+	19	2559	c.2285C>T	c.(2284-2286)cCg>cTg	p.P762L	CDHR2_ENST00000261944.5_Missense_Mutation_p.P762L|CDHR2_ENST00000506348.1_Missense_Mutation_p.P762L	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	762	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P762L(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						CGGCTGCCCCCGGACGTGAGC	0.622																																					p.P762L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2285T	5						.						67.0	70.0	69.0					5																	176011567		2203	4300	6503	175944173	SO:0001583	missense	54825	exon19			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2285C>T	5.37:g.176011567C>T	ENSP00000424565:p.Pro762Leu		175944173	NM_001171976	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	ENST00000510636.1	37	CCDS34297.1	.	.	.	.	.	.	.	.	.	.	C	7.204	0.593983	0.13875	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.44881	0.91;0.91;0.91	5.12	2.12	0.27331	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.33089	0.0851	L	0.41415	1.275	0.23325	N	0.997907	B	0.23316	0.083	B	0.21546	0.035	T	0.22243	-1.0222	9	0.44086	T	0.13	-0.3685	9.0917	0.36614	0.0:0.7348:0.0:0.2652	.	762	Q9BYE9	CDHR2_HUMAN	L	762	ENSP00000424565:P762L;ENSP00000261944:P762L;ENSP00000421078:P762L	ENSP00000261944:P762L	P	+	2	0	CDHR2	175944173	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.819000	0.27308	0.175000	0.19841	0.549000	0.68633	CCG		0.622	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372201.1	NM_017675	
CDH12	1010	broad.mit.edu	37	5	21751945	21751945	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:21751945G>T	ENST00000382254.1	-	15	3372	c.2286C>A	c.(2284-2286)gaC>gaA	p.D762E	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Missense_Mutation_p.D722E|CDH12_ENST00000504376.2_Missense_Mutation_p.D762E	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	762					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D762E(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CATAGTCCTGGTCGGCTTCTG	0.512										HNSCC(59;0.17)																											p.D762E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2286A	5						.						124.0	116.0	119.0					5																	21751945		2203	4300	6503	21787702	SO:0001583	missense	1010	exon15			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2286C>A	5.37:g.21751945G>T	ENSP00000371689:p.Asp762Glu		21787702	NM_004061	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	ENST00000382254.1	37	CCDS3890.1	.	.	.	.	.	.	.	.	.	.	G	9.230	1.035613	0.19590	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.75704	-0.96;-0.96;-0.96	5.18	4.3	0.51218	Cadherin, cytoplasmic domain (1);	0.102346	0.64402	D	0.000002	T	0.59101	0.2169	L	0.31578	0.945	0.36707	D	0.880413	B;B	0.17038	0.02;0.002	B;B	0.25405	0.06;0.001	T	0.55211	-0.8176	10	0.20046	T	0.44	.	6.7287	0.23371	0.1518:0.0:0.7056:0.1425	.	722;762	B7Z2U6;P55289	.;CAD12_HUMAN	E	762;762;722	ENSP00000423577:D762E;ENSP00000371689:D762E;ENSP00000428786:D722E	ENSP00000371689:D762E	D	-	3	2	CDH12	21787702	1.000000	0.71417	0.999000	0.59377	0.880000	0.50808	1.672000	0.37523	1.179000	0.42884	0.467000	0.42956	GAC		0.512	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207139.1	NM_004061	
CDH9	1007	broad.mit.edu	37	5	26881462	26881462	+	Missense_Mutation	SNP	C	C	T	rs535692550		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:26881462C>T	ENST00000231021.4	-	12	2325	c.2153G>A	c.(2152-2154)cGa>cAa	p.R718Q		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	718					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R718Q(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TTTTAATCTTCGATGGATAAA	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		18360	0.0		0.0	False		,,,				2504	0.001				p.R718Q	Melanoma(8;187 585 15745 40864 52829)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2153A	5						.						151.0	144.0	146.0					5																	26881462		2203	4300	6503	26917219	SO:0001583	missense	1007	exon12			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2153G>A	5.37:g.26881462C>T	ENSP00000231021:p.Arg718Gln		26917219	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	C	6.509	0.462107	0.12342	.	.	ENSG00000113100	ENST00000231021	T	0.75938	-0.98	5.06	4.19	0.49359	Cadherin, cytoplasmic domain (1);	0.430312	0.25581	N	0.029685	T	0.40040	0.1101	N	0.00750	-1.22	0.32895	D	0.512351	B;B	0.13594	0.008;0.0	B;B	0.14023	0.01;0.001	T	0.44236	-0.9341	9	.	.	.	.	8.8413	0.35144	0.0:0.8274:0.0:0.1726	.	311;718	B4DFP0;Q9ULB4	.;CADH9_HUMAN	Q	718	ENSP00000231021:R718Q	.	R	-	2	0	CDH9	26917219	0.781000	0.28676	0.955000	0.39395	0.957000	0.61999	1.501000	0.35693	1.260000	0.44134	0.557000	0.71058	CGA		0.418	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
BHMT2	23743	broad.mit.edu	37	5	78376648	78376648	+	Nonsense_Mutation	SNP	C	C	T	rs374028274		TCGA-AG-3898-01	TCGA-AG-3898-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:78376648C>T	ENST00000255192.3	+	4	463	c.397C>T	c.(397-399)Cga>Tga	p.R133*	DMGDH_ENST00000520388.1_Intron|BHMT2_ENST00000521567.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	133	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)	p.R133*(2)		endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	AAAACTTTTTCGACAACAGCT	0.418																																					p.R133X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|skin(1)	c.C397T	5						.	C	,stop/ARG	0,4406		0,0,2203	86.0	88.0	88.0		,397	4.4	0.0	5		88	1,8599	1.2+/-3.3	0,1,4299	no	intron,stop-gained	BHMT2	NM_001178005.1,NM_017614.4	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,133/364	78376648	1,13005	2203	4300	6503	78412404	SO:0001587	stop_gained	23743	exon4				CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.397C>T	5.37:g.78376648C>T	ENSP00000255192:p.Arg133*		78412404	NM_017614	B7Z516|Q9NXX7	Nonsense_Mutation	SNP	ENST00000255192.3	37	CCDS4045.1	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322087	0.41096	0.0	1.16E-4	ENSG00000132840	ENST00000255192	.	.	.	6.16	4.41	0.53225	.	0.304797	0.34802	N	0.003679	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.4616	7.8641	0.29526	0.1311:0.7366:0.0:0.1323	.	.	.	.	X	133	.	ENSP00000255192:R133X	R	+	1	2	BHMT2	78412404	0.998000	0.40836	0.022000	0.16811	0.248000	0.25809	4.618000	0.61211	0.948000	0.37687	0.650000	0.86243	CGA		0.418	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
ERAP2	64167	broad.mit.edu	37	5	96253166	96253166	+	Splice_Site	SNP	G	G	A			TCGA-AG-3898-01	TCGA-AG-3898-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:96253166G>A	ENST00000437043.3	+	19	3451	c.2740G>A	c.(2740-2742)Gtg>Atg	p.V914M	ERAP2_ENST00000379904.4_Splice_Site_p.V869M|CTD-2260A17.2_ENST00000501338.1_Intron	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	914					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.V914M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		TATTTTACAGGTGAAACTATT	0.398																																					p.V914M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2740A	5						.						60.0	65.0	63.0					5																	96253166		2203	4300	6503	96278922	SO:0001630	splice_region_variant	64167	exon19			AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.2740-1G>A	5.37:g.96253166G>A			96278922	NM_022350	Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Missense_Mutation	SNP	ENST00000437043.3	37	CCDS4086.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286184	0.80803	.	.	ENSG00000164308	ENST00000437043;ENST00000379904	T;T	0.08282	3.11;3.11	4.6	4.6	0.57074	.	0.000000	0.64402	D	0.000004	T	0.22126	0.0533	L	0.53729	1.69	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.72338	0.977;0.968	T	0.00333	-1.1810	9	.	.	.	.	13.269	0.60150	0.0:0.0:1.0:0.0	.	869;914	Q6P179-3;Q6P179	.;ERAP2_HUMAN	M	914;869	ENSP00000400376:V914M;ENSP00000369235:V869M	.	V	+	1	0	ERAP2	96278922	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.575000	0.60908	2.280000	0.76307	0.557000	0.71058	GTG		0.398	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250623.2	NM_022350	Missense_Mutation
RNF130	55819	broad.mit.edu	37	5	179405271	179405271	+	Silent	SNP	G	G	A	rs145652271		TCGA-AG-3898-01	TCGA-AG-3898-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3898-01	TCGA-AG-3898-01	g.chr5:179405271G>A	ENST00000261947.4	-	5	1178	c.780C>T	c.(778-780)gaC>gaT	p.D260D	RNF130_ENST00000522208.2_Silent_p.D260D|RNF130_ENST00000521389.1_Silent_p.D260D	NM_001280801.1	NP_001267730.1			ring finger protein 130									p.D260D(1)		breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AATGATCAAAGTCTGGGTCAG	0.393																																					p.D260D	GBM(24;432 554 38471 39699 51728)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C780T	5						.	G		0,4406		0,0,2203	115.0	104.0	108.0		780	1.9	1.0	5	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	RNF130	NM_018434.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		260/420	179405271	1,13005	2203	4300	6503	179337877	SO:0001819	synonymous_variant	55819	exon5			AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.780C>T	5.37:g.179405271G>A			179337877	NM_018434		Silent	SNP	ENST00000261947.4	37																																																																																					0.393	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374205.1	NM_018434	
