#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LTBP2	4053	broad.mit.edu	37	14	74970224	74970225	+	Frame_Shift_Ins	INS	-	-	G	rs137854866		TCGA-AG-3909-01	TCGA-AG-3909-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr14:74970224_74970225insG	ENST00000261978.4	-	32	5053_5054	c.4667_4668insC	c.(4666-4668)ccgfs	p.P1556fs	LTBP2_ENST00000556690.1_Frame_Shift_Ins_p.P1512fs	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1556	EGF-like 18; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.L1557fs*22(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCAGGGTGAGCGGGGGGCTGCA	0.649																																					p.P1556fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.4668_4669insC	14						.																																			74039978	SO:0001589	frameshift_variant	4053	exon32				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4668dupC	14.37:g.74970230_74970230dupG	ENSP00000261978:p.Pro1556fs		74039977	NM_000428	Q99907|Q9NS51	Frame_Shift_Ins	INS	ENST00000261978.4	37	CCDS9831.1																																																																																				0.649	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
PRIM2	5558	broad.mit.edu	37	6	57513140	57513141	+	3'UTR	INS	-	-	AACA	rs140765588|rs56224260|rs566383684	byFrequency	TCGA-AG-3909-01	TCGA-AG-3909-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr6:57513140_57513141insAACA	ENST00000389488.2	+	0	2055_2056				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTGAGGTAACGAGACTTTCAC	0.366																																					.												.	.	0			.	6						.																																			57621100	SO:0001624	3_prime_UTR_variant	5558	.				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*2053->AACA	6.37:g.57513140_57513141insAACA			57621099	.	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Splice_Site	INS	ENST00000389488.2	37																																																																																					0.366	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	protein_coding	OTTHUMT00000043468.3	NM_000947	
ZNF521	25925	broad.mit.edu	37	18	22642386	22642387	+	3'UTR	INS	-	-	T	rs60907023		TCGA-AG-3909-01	TCGA-AG-3909-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr18:22642386_22642387insT	ENST00000361524.3	-	0	4373_4374					NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TGGTCATAGTCTTTTTTTTTTT	0.312			T	PAX5	ALL																																.			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	0			.	18						.																																			20896385	SO:0001624	3_prime_UTR_variant	25925	.			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.*290->A	18.37:g.22642397_22642397dupT			20896384	.	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Splice_Site	INS	ENST00000361524.3	37	CCDS32806.1																																																																																				0.312	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
ADCY1	107	broad.mit.edu	37	7	45747980	45747980	+	Missense_Mutation	SNP	C	C	T	rs368928291		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr7:45747980C>T	ENST00000297323.7	+	18	2871	c.2849C>T	c.(2848-2850)aCg>aTg	p.T950M		NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	950					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.T950M(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CACCTGAGCACGCTGGCGGAC	0.517																																					p.T950M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2849T	7						.	C	MET/THR	0,4406		0,0,2203	204.0	159.0	174.0		2849	4.4	0.1	7		174	1,8599	1.2+/-3.3	0,1,4299	no	missense	ADCY1	NM_021116.2	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	950/1120	45747980	1,13005	2203	4300	6503	45714505	SO:0001583	missense	107	exon18			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.2849C>T	7.37:g.45747980C>T	ENSP00000297323:p.Thr950Met		45714505	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	C	18.04	3.535314	0.64972	0.0	1.16E-4	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.30182	1.54	5.34	4.42	0.53409	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.202759	0.52532	D	0.000065	T	0.41949	0.1181	L	0.46157	1.445	0.50467	D	0.999874	D	0.71674	0.998	P	0.61722	0.893	T	0.22452	-1.0216	10	0.48119	T	0.1	.	9.9422	0.41587	0.0:0.8945:0.0:0.1055	.	950	Q08828	ADCY1_HUMAN	M	950	ENSP00000297323:T950M	ENSP00000297323:T950M	T	+	2	0	ADCY1	45714505	1.000000	0.71417	0.095000	0.20976	0.683000	0.39861	5.486000	0.66856	1.389000	0.46526	0.609000	0.83330	ACG		0.517	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
SEMA3E	9723	broad.mit.edu	37	7	83036445	83036445	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr7:83036445C>T	ENST00000307792.3	-	7	1248	c.781G>A	c.(781-783)Gca>Aca	p.A261T	SEMA3E_ENST00000427262.1_Missense_Mutation_p.A201T	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	261	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.A261T(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GTGTAAATTGCGTGAGCATTG	0.403																																					p.A261T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G781A	7						.						114.0	107.0	109.0					7																	83036445		2203	4300	6503	82874381	SO:0001583	missense	9723	exon7			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.781G>A	7.37:g.83036445C>T	ENSP00000303212:p.Ala261Thr		82874381	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	37	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.419900	0.25552	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.10960	2.82;2.82	5.43	-1.45	0.08828	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.165821	0.52532	N	0.000062	T	0.05410	0.0143	N	0.17838	0.53	0.35394	D	0.790998	B	0.23854	0.092	B	0.20955	0.032	T	0.44065	-0.9352	10	0.10111	T	0.7	.	11.2273	0.48890	0.0:0.6108:0.0:0.3892	.	261	O15041	SEM3E_HUMAN	T	261;201;261	ENSP00000303212:A261T;ENSP00000405052:A201T	ENSP00000303212:A261T	A	-	1	0	SEMA3E	82874381	0.564000	0.26602	0.005000	0.12908	0.746000	0.42486	1.229000	0.32600	-0.187000	0.10516	-0.489000	0.04712	GCA		0.403	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
OR2A14	135941	broad.mit.edu	37	7	143826871	143826871	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr7:143826871C>T	ENST00000408899.2	+	1	721	c.666C>T	c.(664-666)gcC>gcT	p.A222A		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A222A(1)		large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					GCATCCTGGCCGCCATCTTGA	0.612																																					p.A222A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C666T	7						.						116.0	120.0	119.0					7																	143826871		2057	4206	6263	143457804	SO:0001819	synonymous_variant	135941	exon1				CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.666C>T	7.37:g.143826871C>T			143457804	NM_001001659	Q6IF41|Q8NGT8	Silent	SNP	ENST00000408899.2	37	CCDS43672.1																																																																																				0.612	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349980.1		
MMP9	4318	broad.mit.edu	37	20	44641960	44641960	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr20:44641960C>T	ENST00000372330.3	+	9	1416	c.1397C>T	c.(1396-1398)aCg>aTg	p.T466M	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	466					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.T466M(1)		breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	GCTCCCCCGACGGTCTGCCCC	0.682											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T466M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1397T	20						.						44.0	59.0	54.0					20																	44641960		2186	4273	6459	44075367	SO:0001583	missense	4318	exon9				CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1397C>T	20.37:g.44641960C>T	ENSP00000361405:p.Thr466Met	925	44075367	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	37	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938940	0.34189	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	T	0.22134	1.97	4.63	3.62	0.41486	.	.	.	.	.	T	0.19604	0.0471	N	0.14661	0.345	0.09310	N	1	D	0.69078	0.997	P	0.50231	0.635	T	0.11494	-1.0585	9	0.45353	T	0.12	.	13.8455	0.63466	0.1634:0.8366:0.0:0.0	.	466	P14780	MMP9_HUMAN	M	466;111	ENSP00000361405:T466M	ENSP00000361405:T466M	T	+	2	0	MMP9	44075367	0.002000	0.14202	0.027000	0.17364	0.157000	0.22087	0.842000	0.27627	2.376000	0.81061	0.655000	0.94253	ACG		0.682	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
ARFRP1	10139	broad.mit.edu	37	20	62338073	62338073	+	Silent	SNP	C	C	T	rs528376535		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr20:62338073C>T	ENST00000359715.5	-	2	677	c.111G>A	c.(109-111)tcG>tcA	p.S37S	ARFRP1_ENST00000440854.1_Silent_p.S37S|ZGPAT_ENST00000357119.4_5'Flank|ZGPAT_ENST00000369967.3_5'Flank|RP4-583P15.15_ENST00000490623.2_5'Flank|ZGPAT_ENST00000328969.5_5'Flank|ARFRP1_ENST00000324228.2_Silent_p.S37S|ARFRP1_ENST00000609142.1_Silent_p.S37S|ARFRP1_ENST00000607873.1_5'UTR|ZGPAT_ENST00000355969.6_5'Flank|ZGPAT_ENST00000448100.2_5'Flank			Q13795	ARFRP_HUMAN	ADP-ribosylation factor related protein 1	37					gastrulation (GO:0007369)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|protein localization to Golgi apparatus (GO:0034067)|retrograde transport, endosome to Golgi (GO:0042147)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S37S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(38;9.53e-13)|all_epithelial(29;2.64e-14)|Lung NSC(23;7e-10)|all_lung(23;2.53e-09)		Epithelial(9;4.09e-08)|all cancers(9;1.7e-07)|OV - Ovarian serous cystadenocarcinoma(5;0.0102)			ATCGGGTTTTCGACTGCTCCA	0.478													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20245	0.0		0.0	False		,,,				2504	0.0				p.S37S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G111A	20						.						208.0	189.0	196.0					20																	62338073		2203	4300	6503	61808517	SO:0001819	synonymous_variant	10139	exon3			X91504	CCDS13533.1, CCDS46630.1, CCDS68172.1, CCDS68173.1	20q13.3	2014-05-09			ENSG00000101246	ENSG00000101246		"""ADP-ribosylation factors"""	662	protein-coding gene	gene with protein product		604699				8530503	Standard	NM_003224		Approved	ARP, Arp1, ARL18	uc031rup.1	Q13795	OTTHUMG00000032993	ENST00000359715.5:c.111G>A	20.37:g.62338073C>T			61808517	NM_001134758	B7ZKX7|E1P5J9|Q6IBQ0	Silent	SNP	ENST00000359715.5	37	CCDS13533.1																																																																																				0.478	ARFRP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472024.1		
DIO2	1734	broad.mit.edu	37	14	80669214	80669214	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr14:80669214G>A	ENST00000557010.1	-	4	1025	c.640C>T	c.(640-642)Cgc>Tgc	p.R214C	DIO2_ENST00000555750.1_Missense_Mutation_p.R250C|DIO2_ENST00000557125.1_3'UTR|DIO2_ENST00000422005.3_3'UTR|DIO2_ENST00000438257.4_Missense_Mutation_p.R214C	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	214					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)	p.R214C(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		TTGTCCATGCGGTCAGCCACA	0.542											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R214C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C640T	14						.						83.0	85.0	85.0					14																	80669214		2055	4192	6247	79738967	SO:0001583	missense	1734	exon3			AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.640C>T	14.37:g.80669214G>A	ENSP00000451419:p.Arg214Cys	1200	79738967	NM_000793	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	ENST00000557010.1	37	CCDS45146.1	.	.	.	.	.	.	.	.	.	.	g	11.83	1.756453	0.31137	.	.	ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000555750	T;T;T	0.33438	1.41;1.41;1.41	5.77	2.6	0.31112	.	0.147221	0.45606	D	0.000345	T	0.05181	0.0138	N	0.00128	-2.045	0.80722	D	1	B;B;B	0.17667	0.001;0.001;0.023	B;B;B	0.08055	0.001;0.002;0.003	T	0.11131	-1.0600	10	0.32370	T	0.25	.	2.1007	0.03679	0.3678:0.0:0.3913:0.2409	.	250;214;250	Q92813-2;Q92813;G3V315	.;IOD2_HUMAN;.	C	214;214;250	ENSP00000405854:R214C;ENSP00000451419:R214C;ENSP00000450980:R250C	ENSP00000405854:R214C	R	-	1	0	DIO2	79738967	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.547000	0.45786	0.802000	0.34089	-0.127000	0.14921	CGC		0.542	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000413428.2		
AK7	122481	broad.mit.edu	37	14	96944928	96944928	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr14:96944928G>A	ENST00000267584.4	+	15	1726	c.1682G>A	c.(1681-1683)cGg>cAg	p.R561Q		NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	561	Adenylate kinase.				axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)	p.R561Q(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		AGCAACTACCGGGACATCAAT	0.453																																					p.R561Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1682A	14						.						99.0	87.0	91.0					14																	96944928		2203	4300	6503	96014681	SO:0001583	missense	122481	exon15			AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.1682G>A	14.37:g.96944928G>A	ENSP00000267584:p.Arg561Gln		96014681	NM_152327	Q8IYP6	Missense_Mutation	SNP	ENST00000267584.4	37	CCDS9945.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879111	0.91740	.	.	ENSG00000140057	ENST00000267584	D	0.93133	-3.17	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.96408	0.8828	M	0.74647	2.275	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.96357	0.9263	10	0.51188	T	0.08	-20.27	18.3825	0.90455	0.0:0.0:1.0:0.0	.	561	Q96M32	KAD7_HUMAN	Q	561	ENSP00000267584:R561Q	ENSP00000267584:R561Q	R	+	2	0	AK7	96014681	1.000000	0.71417	0.996000	0.52242	0.745000	0.42441	9.465000	0.97660	2.340000	0.79590	0.491000	0.48974	CGG		0.453	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413340.1		
TICAM1	148022	broad.mit.edu	37	19	4816756	4816756	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr19:4816756T>C	ENST00000248244.5	-	2	1863	c.1634A>G	c.(1633-1635)gAc>gGc	p.D545G		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	545	Sufficient to induce apoptosis.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.D545G(1)		NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GGCTCGGGTGTCCTGTTCCTT	0.627																																					p.D545G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1634G	19						.						74.0	52.0	59.0					19																	4816756		2203	4300	6503	4767756	SO:0001583	missense	148022	exon2			AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.1634A>G	19.37:g.4816756T>C	ENSP00000248244:p.Asp545Gly		4767756	NM_182919	B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	ENST00000248244.5	37	CCDS12136.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.889551	0.52014	.	.	ENSG00000127666	ENST00000248244	T	0.45276	0.9	4.45	3.34	0.38264	.	0.377447	0.19131	N	0.121924	T	0.29389	0.0732	L	0.57536	1.79	0.09310	N	1	P	0.43477	0.808	B	0.30855	0.121	T	0.37337	-0.9710	10	0.52906	T	0.07	-7.4014	5.356	0.16061	0.0:0.0978:0.1783:0.7239	.	545	Q8IUC6	TCAM1_HUMAN	G	545	ENSP00000248244:D545G	ENSP00000248244:D545G	D	-	2	0	TICAM1	4767756	0.753000	0.28349	0.114000	0.21550	0.570000	0.35934	1.325000	0.33724	1.766000	0.52107	0.260000	0.18958	GAC		0.627	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450435.1	NM_014261	
CATSPERG	57828	broad.mit.edu	37	19	38851275	38851275	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr19:38851275C>T	ENST00000409235.3	+	15	1870	c.1755C>T	c.(1753-1755)agC>agT	p.S585S	CATSPERG_ENST00000410018.1_Silent_p.S545S|CATSPERG_ENST00000215069.4_3'UTR|AC005625.1_ENST00000590304.1_RNA	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	585					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)		p.S225S(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						ACGAAGACAGCAAACTGTACC	0.602																																					p.S585S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1755T	19						.						107.0	102.0	104.0					19																	38851275		2203	4300	6503	43543115	SO:0001819	synonymous_variant	57828	exon15			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.1755C>T	19.37:g.38851275C>T			43543115	NM_021185	A6NEG6|Q659E1	Silent	SNP	ENST00000409235.3	37	CCDS12514.2																																																																																				0.602	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185	
CD177	57126	broad.mit.edu	37	19	43858092	43858092	+	RNA	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr19:43858092C>T	ENST00000607517.1	+	0	196				CD177_ENST00000378012.2_RNA|CD177_ENST00000378009.4_RNA			Q8N6Q3	CD177_HUMAN	CD177 molecule						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.T47I(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Prostate(69;0.00682)				CCTAAGAACACCAGCTGCGAC	0.632																																					p.T47I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C140T	19						.						57.0	57.0	57.0					19																	43858092		2047	4207	6254	48549932			57126	exon2			AF146747	CCDS62700.1	19q13.31	2013-10-02	2006-03-28		ENSG00000204936	ENSG00000204936		"""CD molecules"""	30072	protein-coding gene	gene with protein product	"""polycythemia rubra vera 1"""	162860	"""CD177 antigen"""			10753836, 5552408	Standard	NM_020406		Approved	PRV1, HNA2A, NB1	uc002owi.3	Q8N6Q3	OTTHUMG00000185320		19.37:g.43858092C>T			48549932	NM_020406	Q711Q2|Q8NCV9|Q96QH1|Q9HDA5	Missense_Mutation	SNP	ENST00000607517.1	37		.	.	.	.	.	.	.	.	.	.	c	4.812	0.150966	0.09185	.	.	ENSG00000204936	ENST00000378009;ENST00000378012;ENST00000457794	T;T;T	0.15017	3.07;2.46;2.46	3.75	-7.51	0.01346	.	.	.	.	.	T	0.10337	0.0253	L	0.42245	1.32	0.09310	N	1	P	0.36282	0.546	B	0.25759	0.063	T	0.01675	-1.1298	9	0.33141	T	0.24	.	11.0326	0.47783	0.1386:0.6106:0.0:0.2509	.	47	Q8N6Q3	CD177_HUMAN	I	47	ENSP00000367248:T47I;ENSP00000367251:T47I;ENSP00000388794:T47I	ENSP00000367248:T47I	T	+	2	0	CD177	48549932	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.639000	0.02011	-2.950000	0.00293	-3.016000	0.00074	ACC		0.632	CD177-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000470162.1	NM_020406	
GRIN2D	2906	broad.mit.edu	37	19	48945180	48945180	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3909-01	TCGA-AG-3909-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr19:48945180A>G	ENST00000263269.3	+	11	2495	c.2407A>G	c.(2407-2409)Atc>Gtc	p.I803V		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	803					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.I803V(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GAAGCGGCCCATCGACCTGGC	0.672																																					p.I803V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2407G	19						.						37.0	34.0	35.0					19																	48945180		2203	4300	6503	53636992	SO:0001583	missense	2906	exon11			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2407A>G	19.37:g.48945180A>G	ENSP00000263269:p.Ile803Val		53636992	NM_000836		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	A	15.65	2.896692	0.52121	.	.	ENSG00000105464	ENST00000263269	T	0.49720	0.77	4.62	4.62	0.57501	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.067872	0.56097	D	0.000038	T	0.36331	0.0963	N	0.17872	0.535	0.38448	D	0.946879	P	0.40250	0.709	B	0.43445	0.42	T	0.21999	-1.0229	10	0.20519	T	0.43	.	13.4795	0.61328	1.0:0.0:0.0:0.0	.	803	O15399	NMDE4_HUMAN	V	803	ENSP00000263269:I803V	ENSP00000263269:I803V	I	+	1	0	GRIN2D	53636992	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.329000	0.52060	2.090000	0.63153	0.374000	0.22700	ATC		0.672	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466121.1		
ZNF578	147660	broad.mit.edu	37	19	53014805	53014805	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr19:53014805G>T	ENST00000421239.2	+	6	1415	c.1171G>T	c.(1171-1173)Gca>Tca	p.A391S	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A391S(1)							GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		AATTCATAAGGCAATTCATAC	0.378																																					p.A391S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1171T	19						.						88.0	94.0	92.0					19																	53014805		2203	4300	6503	57706617	SO:0001583	missense	147660	exon6			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.1171G>T	19.37:g.53014805G>T	ENSP00000459216:p.Ala391Ser		57706617	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	3.437	-0.114858	0.06881	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	-2.85	0.05734	.	.	.	.	.	T	0.13500	0.0327	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30327	-0.9982	7	.	.	.	.	6.4906	0.22113	0.5324:0.0:0.4676:0.0	.	391	G3V4F6	.	S	391	.	.	A	+	1	0	ZNF578	57706617	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-3.181000	0.00568	-0.712000	0.04988	-0.734000	0.03567	GCA		0.378	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
MCM4	4173	broad.mit.edu	37	8	48887410	48887410	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr8:48887410C>T	ENST00000262105.2	+	14	2462	c.2253C>T	c.(2251-2253)aaC>aaT	p.N751N	MCM4_ENST00000523944.1_Silent_p.N751N	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	751					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.N751N(1)		biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GATTGTCTAACAAAGTTGAAG	0.498																																					p.N751N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2253T	8						.						148.0	152.0	151.0					8																	48887410		2203	4300	6503	49049963	SO:0001819	synonymous_variant	4173	exon15				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.2253C>T	8.37:g.48887410C>T			49049963	NM_182746	Q8NEH1|Q99658	Silent	SNP	ENST00000262105.2	37	CCDS6143.1																																																																																				0.498	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
PXDNL	137902	broad.mit.edu	37	8	52396242	52396242	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr8:52396242G>A	ENST00000356297.4	-	6	585	c.485C>T	c.(484-486)cCa>cTa	p.P162L	PXDNL_ENST00000543296.1_Missense_Mutation_p.P162L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	162					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.P162L(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCTCCCAGCTGGAATTTTAGA	0.284																																					p.P162L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C485T	8						.						29.0	26.0	27.0					8																	52396242		1578	3669	5247	52558795	SO:0001583	missense	137902	exon6				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.485C>T	8.37:g.52396242G>A	ENSP00000348645:p.Pro162Leu		52558795	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	5.578	0.291369	0.10567	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.60672	0.17;0.17	4.6	-0.399	0.12415	.	.	.	.	.	T	0.52597	0.1744	L	0.55213	1.73	0.25823	N	0.98426	P	0.47910	0.902	P	0.46419	0.516	T	0.45131	-0.9282	9	0.29301	T	0.29	.	8.0724	0.30697	0.4475:0.0:0.5525:0.0	.	162	A1KZ92	PXDNL_HUMAN	L	162	ENSP00000348645:P162L;ENSP00000444865:P162L	ENSP00000348645:P162L	P	-	2	0	PXDNL	52558795	0.061000	0.20836	0.007000	0.13788	0.098000	0.18820	0.545000	0.23268	-0.355000	0.08199	-0.742000	0.03525	CCA		0.284	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
DENND3	22898	broad.mit.edu	37	8	142178177	142178177	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr8:142178177G>A	ENST00000262585.2	+	13	1866	c.1588G>A	c.(1588-1590)Gtg>Atg	p.V530M	DENND3_ENST00000519811.1_Missense_Mutation_p.V610M|DENND3_ENST00000424248.1_Missense_Mutation_p.V478M	NM_014957.2	NP_055772.2	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	530					cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.V530M(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(4)|stomach(2)|urinary_tract(1)	55	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GAGCAAGTGCGTGCAGGCATA	0.532																																					p.V530M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1588A	8						.						132.0	120.0	124.0					8																	142178177		2203	4300	6503	142247359	SO:0001583	missense	22898	exon13			AB020677	CCDS34947.1	8q24.3	2013-01-10				ENSG00000105339		"""DENN/MADD domain containing"", ""WD repeat domain containing"""	29134	protein-coding gene	gene with protein product						10048485	Standard	NM_014957		Approved	KIAA0870	uc003yvy.3	A2RUS2		ENST00000262585.2:c.1588G>A	8.37:g.142178177G>A	ENSP00000262585:p.Val530Met		142247359	NM_014957	B7ZM28|O94947|Q2TAM7|Q6ZMS6|Q96DK3	Missense_Mutation	SNP	ENST00000262585.2	37	CCDS34947.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.43|14.43	2.533069|2.533069	0.45073|0.45073	.|.	.|.	ENSG00000105339|ENSG00000105339	ENST00000518668|ENST00000262585;ENST00000424248;ENST00000519811	.|T;T;T	.|0.18338	.|2.69;2.22;2.67	5.36|5.36	3.56|3.56	0.40772|0.40772	.|.	.|0.251684	.|0.39909	.|N	.|0.001239	T|T	0.37461|0.37461	0.1004|0.1004	M|M	0.73598|0.73598	2.24|2.24	0.37110|0.37110	D|D	0.900328|0.900328	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|P;D;P	.|0.64042	.|0.835;0.921;0.835	T|T	0.44314|0.44314	-0.9336|-0.9336	5|10	.|0.87932	.|D	.|0	-11.4822|-11.4822	11.457|11.457	0.50187|0.50187	0.1465:0.0:0.8535:0.0|0.1465:0.0:0.8535:0.0	.|.	.|610;478;530	.|E9PF32;A2RUS2-2;A2RUS2	.|.;.;DEND3_HUMAN	H|M	534|530;478;610	.|ENSP00000262585:V530M;ENSP00000410594:V478M;ENSP00000428714:V610M	.|ENSP00000262585:V530M	R|V	+|+	2|1	0|0	DENND3|DENND3	142247359|142247359	1.000000|1.000000	0.71417|0.71417	0.036000|0.036000	0.18154|0.18154	0.003000|0.003000	0.03518|0.03518	4.456000|4.456000	0.60081|0.60081	0.638000|0.638000	0.30545|0.30545	0.462000|0.462000	0.41574|0.41574	CGT|GTG		0.532	DENND3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_014957	
CAPZA1	829	broad.mit.edu	37	1	113197127	113197127	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:113197127T>G	ENST00000263168.3	+	5	932	c.260T>G	c.(259-261)tTt>tGt	p.F87C	snoU13_ENST00000459345.1_RNA|CAPZA1_ENST00000476936.1_Intron	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	87					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)	p.F87C(1)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATAGCAGATTTTTAGATCCA	0.383																																					p.F87C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T260G	1						.						75.0	83.0	80.0					1																	113197127		2202	4300	6502	112998650	SO:0001583	missense	829	exon5			U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.260T>G	1.37:g.113197127T>G	ENSP00000263168:p.Phe87Cys		112998650	NM_006135	Q53FQ6|Q6FHD5	Missense_Mutation	SNP	ENST00000263168.3	37	CCDS30805.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.057762	0.76074	.	.	ENSG00000116489	ENST00000263168	.	.	.	4.69	4.69	0.59074	.	0.057902	0.64402	D	0.000001	T	0.66416	0.2787	M	0.89968	3.075	0.49389	D	0.99978	B	0.18013	0.025	B	0.28991	0.097	T	0.73553	-0.3946	9	0.87932	D	0	-19.5832	14.245	0.65983	0.0:0.0:0.0:1.0	.	87	P52907	CAZA1_HUMAN	C	87	.	ENSP00000263168:F87C	F	+	2	0	CAPZA1	112998650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.977000	0.70492	2.090000	0.63153	0.477000	0.44152	TTT		0.383	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032567.2	NM_006135	
KISS1	3814	broad.mit.edu	37	1	204159823	204159823	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:204159823G>T	ENST00000367194.4	-	3	354	c.206C>A	c.(205-207)aCc>aAc	p.T69N		NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	69					cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)		p.T69N(1)		large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		GGACAGCGAGGTCCCCCGACG	0.751																																					p.T69N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C206A	1						.						5.0	7.0	6.0					1																	204159823		1432	3382	4814	202426446	SO:0001583	missense	3814	exon3			U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060	ENST00000367194.4:c.206C>A	1.37:g.204159823G>T	ENSP00000356162:p.Thr69Asn		202426446	NM_002256	A8K6N0|Q9HBP1	Missense_Mutation	SNP	ENST00000367194.4	37	CCDS41454.1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.305143	0.23736	.	.	ENSG00000170498	ENST00000367194	D	0.81659	-1.52	4.83	3.87	0.44632	.	0.290042	0.24343	N	0.039346	T	0.67316	0.2880	N	0.24115	0.695	0.09310	N	1	B	0.21905	0.062	B	0.15052	0.012	T	0.61446	-0.7061	10	0.56958	D	0.05	-1.9756	10.4774	0.44674	0.0:0.0:0.8072:0.1928	.	69	Q15726	KISS1_HUMAN	N	69	ENSP00000356162:T69N	ENSP00000356162:T69N	T	-	2	0	KISS1	202426446	0.060000	0.20803	0.003000	0.11579	0.010000	0.07245	3.103000	0.50298	2.191000	0.70037	0.609000	0.83330	ACC		0.751	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087892.1	NM_002256	
KCNK1	3775	broad.mit.edu	37	1	233802421	233802421	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:233802421C>G	ENST00000366621.3	+	2	604	c.436C>G	c.(436-438)Ctc>Gtc	p.L146V	KCNK1_ENST00000472190.1_3'UTR|KCNK1_ENST00000366620.1_Missense_Mutation_p.L30V	NM_002245.3	NP_002236.1	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	146					potassium ion transport (GO:0006813)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)	p.L146V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	11		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)	TCCCTTCACCCTCCTGTTCCT	0.587																																					p.L146V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C436G	1						.						209.0	144.0	166.0					1																	233802421		2203	4300	6503	231869044	SO:0001583	missense	3775	exon2			U33632	CCDS1599.1	1q42-q43	2012-03-07			ENSG00000135750	ENSG00000135750		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6272	protein-coding gene	gene with protein product		601745				8661042, 16382106	Standard	NM_002245		Approved	K2p1.1, DPK, TWIK-1	uc010pxo.1	O00180	OTTHUMG00000037923	ENST00000366621.3:c.436C>G	1.37:g.233802421C>G	ENSP00000355580:p.Leu146Val		231869044	NM_002245	Q13307|Q5T5E8	Missense_Mutation	SNP	ENST00000366621.3	37	CCDS1599.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763552	0.89932	.	.	ENSG00000135750	ENST00000366621;ENST00000366620;ENST00000446915	T;T;T	0.30981	1.51;1.51;1.51	5.91	5.91	0.95273	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.52354	0.1729	M	0.62209	1.925	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.44034	-0.9354	10	0.44086	T	0.13	.	14.4428	0.67330	0.0:0.9303:0.0:0.0697	.	146	O00180	KCNK1_HUMAN	V	146;30;64	ENSP00000355580:L146V;ENSP00000355579:L30V;ENSP00000409626:L64V	ENSP00000355579:L30V	L	+	1	0	KCNK1	231869044	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.896000	0.69822	2.793000	0.96121	0.655000	0.94253	CTC		0.587	KCNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092565.1	NM_002245	
HEATR1	55127	broad.mit.edu	37	1	236721766	236721766	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:236721766C>T	ENST00000366582.3	-	36	5089	c.4975G>A	c.(4975-4977)Ggg>Agg	p.G1659R	HEATR1_ENST00000366581.2_Missense_Mutation_p.G1578R	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1659					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.G1659R(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TCTTCTTCCCCTTCCTTTTTC	0.428																																					p.G1659R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4975A	1						.						127.0	111.0	116.0					1																	236721766		2203	4300	6503	234788389	SO:0001583	missense	55127	exon36			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4975G>A	1.37:g.236721766C>T	ENSP00000355541:p.Gly1659Arg		234788389	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.843729	0.32606	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.05855	3.38;3.39	6.03	-2.61	0.06171	Armadillo-like helical (1);Armadillo-type fold (1);	1.238380	0.05810	N	0.613785	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	B;B	0.24823	0.044;0.112	B;B	0.19148	0.017;0.024	T	0.45571	-0.9252	10	0.16896	T	0.51	.	3.5187	0.07734	0.2851:0.4203:0.1767:0.1179	.	1578;1659	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	R	1659;1578	ENSP00000355541:G1659R;ENSP00000355540:G1578R	ENSP00000355540:G1578R	G	-	1	0	HEATR1	234788389	0.000000	0.05858	0.000000	0.03702	0.985000	0.73830	0.521000	0.22893	-0.325000	0.08577	0.655000	0.94253	GGG		0.428	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
RYR2	6262	broad.mit.edu	37	1	237777815	237777815	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:237777815C>A	ENST00000366574.2	+	37	5704	c.5387C>A	c.(5386-5388)aCa>aAa	p.T1796K	RYR2_ENST00000360064.6_Missense_Mutation_p.T1794K|RYR2_ENST00000542537.1_Missense_Mutation_p.T1780K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1796	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.T1794K(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGATGCTGACAGAAGCTGTT	0.463																																					p.T1796K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5387A	1						.						159.0	152.0	155.0					1																	237777815		1945	4144	6089	235844438	SO:0001583	missense	6262	exon37			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5387C>A	1.37:g.237777815C>A	ENSP00000355533:p.Thr1796Lys		235844438	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461575	0.26248	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.74947	-0.89;-0.89;-0.89	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000008	T	0.64843	0.2635	L	0.38838	1.175	0.80722	D	1	B	0.26672	0.156	B	0.24848	0.056	T	0.61787	-0.6991	10	0.06236	T	0.91	.	19.6609	0.95871	0.0:1.0:0.0:0.0	.	1796	Q92736	RYR2_HUMAN	K	1796;1794;1780	ENSP00000355533:T1796K;ENSP00000353174:T1794K;ENSP00000443798:T1780K	ENSP00000353174:T1794K	T	+	2	0	RYR2	235844438	1.000000	0.71417	0.962000	0.40283	0.400000	0.30750	7.776000	0.85560	2.665000	0.90641	0.650000	0.86243	ACA		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
DIO1	1733	broad.mit.edu	37	1	54371958	54371958	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:54371958C>T	ENST00000361921.3	+	3	696	c.672C>T	c.(670-672)atC>atT	p.I224I	DIO1_ENST00000525202.1_Silent_p.I160I|DIO1_ENST00000532493.1_Intron|DIO1_ENST00000524406.1_Silent_p.I95I|DIO1_ENST00000322679.6_Intron|DIO1_ENST00000388876.3_Silent_p.I176I	NM_000792.5|NM_213593.3	NP_000783.2|NP_998758.1	P49895	IOD1_HUMAN	deiodinase, iodothyronine, type I	224					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)	p.I224I(1)|p.I176I(1)		cervix(1)|endometrium(2)|large_intestine(3)|lung(2)|skin(1)	9						AGGGCAGGATCCTCTACAAGG	0.617																																					p.I176I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C528T	1						.						27.0	26.0	26.0					1																	54371958		2203	4300	6503	54144546	SO:0001819	synonymous_variant	1733	exon2				CCDS30722.1, CCDS41339.1, CCDS41340.1, CCDS53320.1	1p33-p32	2012-03-01			ENSG00000211452	ENSG00000211452	1.97.1.10		2883	protein-coding gene	gene with protein product		147892		TXDI1		8964838	Standard	NM_000792		Approved		uc001cwb.3	P49895	OTTHUMG00000008435	ENST00000361921.3:c.672C>T	1.37:g.54371958C>T			54144546	NM_001039715	Q1RN02|Q3KNP8|Q6Q4C1|Q6Q4C2|Q6Q4C3|Q6Q4C4|Q6Q4C5|Q6Q4C6|Q6Q4C7|Q6Q4C9|Q8WWC6	Silent	SNP	ENST00000361921.3	37	CCDS41339.1																																																																																				0.617	DIO1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000023247.3		
DPYD	1806	broad.mit.edu	37	1	97544581	97544581	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:97544581G>T	ENST00000370192.3	-	23	3129	c.3029C>A	c.(3028-3030)cCt>cAt	p.P1010H		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	1010					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)	p.P1010H(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TGGTTCATAAGGTGTTGTCCT	0.463																																					p.P1010H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3029A	1						.						245.0	226.0	233.0					1																	97544581		2203	4300	6503	97317169	SO:0001583	missense	1806	exon23			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.3029C>A	1.37:g.97544581G>T	ENSP00000359211:p.Pro1010His		97317169	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	37	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002107	0.93227	.	.	ENSG00000188641	ENST00000370192	D	0.90620	-2.7	5.46	5.46	0.80206	.	0.057159	0.64402	D	0.000001	D	0.90913	0.7144	M	0.80422	2.495	0.80722	D	1	P	0.44195	0.828	B	0.43082	0.407	D	0.92369	0.5904	10	0.87932	D	0	-10.792	19.6731	0.95918	0.0:0.0:1.0:0.0	.	1010	Q12882	DPYD_HUMAN	H	1010	ENSP00000359211:P1010H	ENSP00000359211:P1010H	P	-	2	0	DPYD	97317169	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.849000	0.86908	2.735000	0.93741	0.561000	0.74099	CCT		0.463	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
OR2T8	343172	broad.mit.edu	37	1	248084470	248084470	+	Missense_Mutation	SNP	C	C	G	rs140846339|rs547311711	byFrequency	TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr1:248084470C>G	ENST00000319968.4	+	1	151	c.151C>G	c.(151-153)Cac>Gac	p.H51D		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.H51D(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCACTGGGACCACCGGCTCCA	0.532																																					p.H51D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C151G	1						.						61.0	60.0	60.0					1																	248084470		2201	4297	6498	246151093	SO:0001583	missense	343172	exon1				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.151C>G	1.37:g.248084470C>G	ENSP00000326225:p.His51Asp		246151093	NM_001005522		Missense_Mutation	SNP	ENST00000319968.4	37	CCDS31100.1	.	.	.	.	.	.	.	.	.	.	c	8.583	0.882849	0.17467	.	.	ENSG00000177462	ENST00000319968	T	0.00428	7.44	3.65	0.32	0.15878	GPCR, rhodopsin-like superfamily (1);	3.036110	0.01499	U	0.017405	T	0.00356	0.0011	L	0.41492	1.28	0.09310	N	1	B	0.09022	0.002	B	0.16289	0.015	T	0.48502	-0.9030	10	0.66056	D	0.02	.	2.7852	0.05372	0.0:0.3992:0.2448:0.3561	.	51	A6NH00	OR2T8_HUMAN	D	51	ENSP00000326225:H51D	ENSP00000326225:H51D	H	+	1	0	OR2T8	246151093	0.118000	0.22208	0.005000	0.12908	0.016000	0.09150	-0.265000	0.08644	0.228000	0.21019	0.603000	0.83216	CAC		0.532	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096862.1	NM_001005522	
PSMD13	5719	broad.mit.edu	37	11	244118	244118	+	Intron	SNP	T	T	C			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr11:244118T>C	ENST00000532097.1	+	4	713				PSMD13_ENST00000431206.2_Missense_Mutation_p.I58T|PSMD13_ENST00000352303.5_Intron	NM_002817.3	NP_002808.3	Q9UNM6	PSD13_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 13						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|meiosis I (GO:0007127)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)		p.I58T(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	10		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)		AATGAGTGCATTGATGCTCGG	0.418																																					p.I58T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T173C	11						.						59.0	64.0	63.0					11																	244118		2202	4298	6500	234118	SO:0001627	intron_variant	5719	exon2			AB009398	CCDS7692.1, CCDS44504.1	11p15.5	2008-05-22			ENSG00000185627	ENSG00000185627		"""Proteasome (prosome, macropain) subunits"""	9558	protein-coding gene	gene with protein product		603481				9714768, 8811196	Standard	NM_002817		Approved	p40.5, Rpn9	uc001loo.2	Q9UNM6	OTTHUMG00000119072	ENST00000532097.1:c.210-43T>C	11.37:g.244118T>C			234118	NM_175932	B3KT15|O75831|Q53XU2|Q9UNV3	Missense_Mutation	SNP	ENST00000532097.1	37	CCDS7692.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.531946	0.27387	.	.	ENSG00000185627	ENST00000431206	T	0.20332	2.08	5.94	0.788	0.18601	.	.	.	.	.	T	0.12220	0.0297	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	7	.	.	.	.	9.4574	0.38762	0.0:0.3031:0.0:0.6969	.	58	Q9UNM6-2	.	T	58	ENSP00000396937:I58T	.	I	+	2	0	PSMD13	234118	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.178000	0.16820	0.122000	0.18314	0.460000	0.39030	ATT		0.418	PSMD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239286.2	NM_002817	
OR5L1	219437	broad.mit.edu	37	11	55579241	55579241	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3909-01	TCGA-AG-3909-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr11:55579241A>G	ENST00000333973.2	+	1	388	c.299A>G	c.(298-300)cAa>cGa	p.Q100R		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Q100R(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TGCATGGTGCAATTCTACTTG	0.453																																					p.Q100R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A299G	11						.						236.0	211.0	219.0					11																	55579241		2200	4296	6496	55335817	SO:0001583	missense	219437	exon1			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.299A>G	11.37:g.55579241A>G	ENSP00000335529:p.Gln100Arg		55335817	NM_001004738	B2RNK6|Q6IFD0	Missense_Mutation	SNP	ENST00000333973.2	37	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	a	20.2	3.945117	0.73672	.	.	ENSG00000186117	ENST00000333973	T	0.00466	7.23	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000190	T	0.03390	0.0098	H	0.99379	4.54	0.42578	D	0.993203	D	0.89917	1.0	D	0.91635	0.999	T	0.00939	-1.1507	10	0.87932	D	0	-19.5197	12.1272	0.53922	1.0:0.0:0.0:0.0	.	100	Q8NGL2	OR5L1_HUMAN	R	100	ENSP00000335529:Q100R	ENSP00000335529:Q100R	Q	+	2	0	OR5L1	55335817	1.000000	0.71417	0.043000	0.18650	0.065000	0.16274	8.795000	0.91872	1.533000	0.49186	0.358000	0.22013	CAA		0.453	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
MPEG1	219972	broad.mit.edu	37	11	58979642	58979642	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr11:58979642G>A	ENST00000361050.3	-	1	782	c.697C>T	c.(697-699)Cgt>Tgt	p.R233C	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	233	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.					integral component of membrane (GO:0016021)		p.R233C(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				ACGGCACTACGACTGCTCTGG	0.542																																					p.R233C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C697T	11						.						50.0	49.0	49.0					11																	58979642		1943	4125	6068	58736218	SO:0001583	missense	219972	exon1			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.697C>T	11.37:g.58979642G>A	ENSP00000354335:p.Arg233Cys		58736218	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	37	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	G	8.861	0.946866	0.18356	.	.	ENSG00000197629	ENST00000361050	D	0.84442	-1.85	4.95	2.99	0.34606	Membrane attack complex component/perforin (MACPF) domain (3);	0.545245	0.20156	N	0.098042	D	0.86736	0.6004	M	0.61703	1.905	0.09310	N	1	D	0.67145	0.996	P	0.54815	0.761	T	0.78252	-0.2276	10	0.72032	D	0.01	0.7655	8.5853	0.33655	0.0:0.3133:0.525:0.1617	.	233	Q2M385	MPEG1_HUMAN	C	233	ENSP00000354335:R233C	ENSP00000354335:R233C	R	-	1	0	MPEG1	58736218	0.001000	0.12720	0.004000	0.12327	0.003000	0.03518	0.994000	0.29693	0.457000	0.26962	0.650000	0.86243	CGT		0.542	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
GRM5	2915	broad.mit.edu	37	11	88330413	88330413	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr11:88330413G>A	ENST00000305447.4	-	5	1651	c.1502C>T	c.(1501-1503)tCc>tTc	p.S501F	GRM5_ENST00000455756.2_Missense_Mutation_p.S501F|GRM5_ENST00000305432.5_Missense_Mutation_p.S501F|GRM5_ENST00000393297.1_Missense_Mutation_p.S501F|GRM5_ENST00000418177.2_Missense_Mutation_p.S501F	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	501					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)	p.S501F(2)		NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GCTTTTCTTGGACCATACTTC	0.338																																					p.S501F												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1502T	11						.						222.0	182.0	195.0					11																	88330413		2201	4298	6499	87970061	SO:0001583	missense	2915	exon6			D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1502C>T	11.37:g.88330413G>A	ENSP00000306138:p.Ser501Phe		87970061	NM_000842	Q6J164	Missense_Mutation	SNP	ENST00000305447.4	37	CCDS44694.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444305	0.43429	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.88741	-2.38;-2.38;-2.38;-2.38;-2.42	5.56	5.56	0.83823	.	0.393578	0.31821	N	0.007016	D	0.89146	0.6632	L	0.40543	1.245	0.44485	D	0.997429	D;P	0.59767	0.986;0.612	P;B	0.51135	0.66;0.259	D	0.87775	0.2608	9	.	.	.	.	19.5308	0.95228	0.0:0.0:1.0:0.0	.	501;501	P41594-2;P41594	.;GRM5_HUMAN	F	501	ENSP00000402912:S501F;ENSP00000405690:S501F;ENSP00000305905:S501F;ENSP00000306138:S501F;ENSP00000376975:S501F	.	S	-	2	0	GRM5	87970061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.556000	0.60775	2.621000	0.88768	0.650000	0.86243	TCC		0.338	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
ZBED9	114821	broad.mit.edu	37	6	28541599	28541599	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr6:28541599C>T	ENST00000452236.2	-	4	2684	c.2067G>A	c.(2065-2067)gcG>gcA	p.A689A	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.A689A(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						aagcttgtttcgccatctgaa	0.299																																					p.A689A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2067A	6						.						16.0	16.0	16.0					6																	28541599		2095	4173	6268	28649578	SO:0001819	synonymous_variant	114821	exon4																														ENST00000452236.2:c.2067G>A	6.37:g.28541599C>T			28649578	NM_052923		Silent	SNP	ENST00000452236.2	37	CCDS34355.1																																																																																				0.299	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
PTCRA	171558	broad.mit.edu	37	6	42890846	42890846	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr6:42890846G>T	ENST00000304672.1	+	2	221	c.140G>T	c.(139-141)tGc>tTc	p.C47F	PTCRA_ENST00000446507.1_Intron|PTCRA_ENST00000441198.1_Intron	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha	47					negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)		p.C47F(1)		large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GTGGTGGTCTGCCTGGTCCTT	0.597																																					p.C47F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G140T	6						.						150.0	129.0	136.0					6																	42890846		2203	4300	6503	42998824	SO:0001583	missense	171558	exon2			AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.140G>T	6.37:g.42890846G>T	ENSP00000304447:p.Cys47Phe		42998824	NM_138296	Q5TFZ7	Missense_Mutation	SNP	ENST00000304672.1	37	CCDS4874.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.086356|4.086356	0.76642|0.76642	.|.	.|.	ENSG00000171611|ENSG00000171611	ENST00000418903|ENST00000304672	.|T	.|0.79247	.|-1.25	5.84|5.84	5.84|5.84	0.93424|0.93424	.|Immunoglobulin-like fold (1);	.|0.000000	.|0.51477	.|D	.|0.000086	T|T	0.80292|0.80292	0.4596|0.4596	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	T|T	0.82460|0.82460	-0.0446|-0.0446	6|10	0.87932|0.87932	D|D	0|0	-27.204|-27.204	15.6455|15.6455	0.77046|0.77046	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|47	.|Q6ISU1	.|PTCRA_HUMAN	S|F	58|47	.|ENSP00000304447:C47F	ENSP00000407061:A58S|ENSP00000304447:C47F	A|C	+|+	1|2	0|0	PTCRA|PTCRA	42998824|42998824	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	5.199000|5.199000	0.65152|0.65152	2.748000|2.748000	0.94277|0.94277	0.650000|0.650000	0.86243|0.86243	GCC|TGC		0.597	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040565.2	NM_138296	
CUL7	9820	broad.mit.edu	37	6	43013368	43013368	+	Missense_Mutation	SNP	C	C	T	rs201130952		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr6:43013368C>T	ENST00000265348.3	-	14	2904	c.2819G>A	c.(2818-2820)cGc>cAc	p.R940H	CUL7_ENST00000535468.1_Missense_Mutation_p.R1024H|CUL7_ENST00000478630.1_5'UTR			Q14999	CUL7_HUMAN	cullin 7	940	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)		p.R940H(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGCCAGAAGCGGGTCAGGTT	0.622																																					p.R940H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2819A	6						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	71.0	66.0	68.0		3071,2819	1.2	0.7	6		68	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	CUL7	NM_001168370.1,NM_014780.4	29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign	1024/1783,940/1699	43013368	2,13004	2203	4300	6503	43121346	SO:0001583	missense	9820	exon14			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.2819G>A	6.37:g.43013368C>T	ENSP00000265348:p.Arg940His		43121346	NM_014780	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953766	0.53293	0.0	2.33E-4	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.64085	-0.08;-0.08	5.11	1.2	0.21068	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	0.350509	0.32578	N	0.005917	T	0.38427	0.1040	M	0.65975	2.015	0.80722	D	1	B;B;B	0.19445	0.017;0.036;0.02	B;B;B	0.16289	0.011;0.015;0.015	T	0.27839	-1.0062	10	0.49607	T	0.09	-5.2521	7.934	0.29918	0.0:0.6592:0.0:0.3408	.	1024;1024;940	F5H0L1;B4DYZ0;Q14999	.;.;CUL7_HUMAN	H	940;1024	ENSP00000265348:R940H;ENSP00000438788:R1024H	ENSP00000265348:R940H	R	-	2	0	CUL7	43121346	0.992000	0.36948	0.748000	0.31131	0.978000	0.69477	1.174000	0.31932	-0.069000	0.12931	-0.140000	0.14226	CGC		0.622	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
TP53	7157	broad.mit.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000455263.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R282W	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,central_nervous_system,brain,Substitution - Missense,-2	.	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	c.C844T	17	GRCh37	CM056413|CM920678	TP53	M	rs28934574	.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	7517819	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp		7517819	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH2	146754	broad.mit.edu	37	17	7690289	7690289	+	Missense_Mutation	SNP	G	G	A	rs147226714		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr17:7690289G>A	ENST00000572933.1	+	42	8001	c.6541G>A	c.(6541-6543)Gtc>Atc	p.V2181I	DNAH2_ENST00000389173.2_Missense_Mutation_p.V2181I			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2181	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.V2181I(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CATGAACTCCGTCATGGACGA	0.582													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19618	0.0		0.0	False		,,,				2504	0.0				p.V2181I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6541A	17						.	G	ILE/VAL	0,4406		0,0,2203	95.0	64.0	74.0		6541	5.2	1.0	17	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense	DNAH2	NM_020877.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2181/4428	7690289	1,13005	2203	4300	6503	7631014	SO:0001583	missense	146754	exon41			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.6541G>A	17.37:g.7690289G>A	ENSP00000458355:p.Val2181Ile		7631014	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	37	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	G	35	5.462838	0.96257	0.0	1.16E-4	ENSG00000183914	ENST00000360606;ENST00000389173	D	0.94092	-3.35	5.16	5.16	0.70880	ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	D	0.000001	D	0.97614	0.9218	H	0.94734	3.575	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	D	0.98541	1.0632	10	0.87932	D	0	.	17.5818	0.87970	0.0:0.0:1.0:0.0	.	2181	Q9P225	DYH2_HUMAN	I	2181	ENSP00000373825:V2181I	ENSP00000353818:V2181I	V	+	1	0	DNAH2	7631014	1.000000	0.71417	0.959000	0.39883	0.885000	0.51271	9.474000	0.97718	2.672000	0.90937	0.650000	0.86243	GTC		0.582	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
TIAM1	7074	broad.mit.edu	37	21	32525053	32525053	+	Silent	SNP	C	C	T	rs143851539		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr21:32525053C>T	ENST00000286827.3	-	20	3738	c.3267G>A	c.(3265-3267)acG>acA	p.T1089T	TIAM1_ENST00000541036.1_Silent_p.T1029T	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	1089	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T1089T(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTACCATTTCCGTTAAATTTC	0.333																																					p.T1089T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3267A	21						.	C		2,4404	4.2+/-10.8	0,2,2201	61.0	62.0	62.0		3267	-11.3	0.1	21	dbSNP_134	62	0,8600		0,0,4300	no	coding-synonymous	TIAM1	NM_003253.2		0,2,6501	TT,TC,CC		0.0,0.0454,0.0154		1089/1592	32525053	2,13004	2203	4300	6503	31446924	SO:0001819	synonymous_variant	7074	exon20				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.3267G>A	21.37:g.32525053C>T			31446924	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	ENST00000286827.3	37	CCDS13609.1																																																																																				0.333	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
CMTM2	146225	broad.mit.edu	37	16	66613533	66613533	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr16:66613533G>A	ENST00000268595.2	+	1	174	c.23G>A	c.(22-24)gGg>gAg	p.G8E	RP11-403P17.2_ENST00000568430.1_RNA|CMTM2_ENST00000379486.2_Missense_Mutation_p.G8E	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	8					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.G8E(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		GCGGCAAAGGGGGCCAAGCCA	0.597																																					p.G8E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G23A	16						.						68.0	67.0	67.0					16																	66613533		2201	4300	6501	65171034	SO:0001583	missense	146225	exon1			BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.23G>A	16.37:g.66613533G>A	ENSP00000268595:p.Gly8Glu		65171034	NM_001199317	Q5I2A4|Q8N7E5	Missense_Mutation	SNP	ENST00000268595.2	37	CCDS10814.1	.	.	.	.	.	.	.	.	.	.	G	8.908	0.957990	0.18507	.	.	ENSG00000140932	ENST00000379486;ENST00000268595	T;T	0.50001	0.76;1.36	1.79	-1.69	0.08186	.	2.408040	0.01571	N	0.020584	T	0.50582	0.1624	L	0.48642	1.525	0.09310	N	1	D;P	0.55172	0.97;0.724	P;P	0.53912	0.737;0.531	T	0.39941	-0.9589	10	0.87932	D	0	3.5381	2.6208	0.04916	0.3769:0.2651:0.358:0.0	.	8;8	Q5I2A4;Q8TAZ6	.;CKLF2_HUMAN	E	8	ENSP00000368800:G8E;ENSP00000268595:G8E	ENSP00000268595:G8E	G	+	2	0	CMTM2	65171034	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.249000	0.18216	-0.434000	0.07275	0.313000	0.20887	GGG		0.597	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268808.1		
ADAMTS18	170692	broad.mit.edu	37	16	77326991	77326991	+	Silent	SNP	G	G	A	rs187998780		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr16:77326991G>A	ENST00000282849.5	-	20	3589	c.3171C>T	c.(3169-3171)gtC>gtT	p.V1057V	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1057	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.V1057V(1)		NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						ACGAAGAAGCGACCCACTGTA	0.547													G|||	1	0.000199681	0.0	0.0014	5008	,	,		16785	0.0		0.0	False		,,,				2504	0.0				p.V1057V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3171T	16						.						77.0	71.0	73.0					16																	77326991		2198	4300	6498	75884492	SO:0001819	synonymous_variant	170692	exon20			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3171C>T	16.37:g.77326991G>A			75884492	NM_199355	Q6P4R5|Q6ZWJ9	Silent	SNP	ENST00000282849.5	37	CCDS10926.1																																																																																				0.547	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269037.1		
GRIN2A	2903	broad.mit.edu	37	16	9923459	9923459	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr16:9923459C>T	ENST00000396573.2	-	10	2137	c.1828G>A	c.(1828-1830)Ggc>Agc	p.G610S	GRIN2A_ENST00000535259.1_Missense_Mutation_p.G453S|GRIN2A_ENST00000562109.1_Missense_Mutation_p.G610S|GRIN2A_ENST00000404927.2_Missense_Mutation_p.G610S|GRIN2A_ENST00000396575.2_Missense_Mutation_p.G610S|GRIN2A_ENST00000330684.3_Missense_Mutation_p.G610S	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	610					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.G610S(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AACACCAGGCCCCAAAGAAGC	0.463																																					p.G610S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1828A	16						.						74.0	68.0	70.0					16																	9923459		2197	4300	6497	9830960	SO:0001583	missense	2903	exon9				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1828G>A	16.37:g.9923459C>T	ENSP00000379818:p.Gly610Ser		9830960	NM_001134408	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	34	5.329790	0.95733	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.27	5.27	0.74061	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.67933	0.2946	L	0.52364	1.645	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.99	D;D;D	0.83275	0.996;0.992;0.95	T	0.65837	-0.6071	9	.	.	.	.	17.9016	0.88906	0.0:1.0:0.0:0.0	.	453;610;610	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	S	610;610;453;610;610	ENSP00000379818:G610S;ENSP00000385872:G610S;ENSP00000441572:G453S;ENSP00000332549:G610S;ENSP00000379820:G610S	.	G	-	1	0	GRIN2A	9830960	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.681000	0.84073	2.465000	0.83290	0.655000	0.94253	GGC		0.463	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ATP2C2	9914	broad.mit.edu	37	16	84494312	84494312	+	Missense_Mutation	SNP	G	G	A	rs200530016		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr16:84494312G>A	ENST00000262429.4	+	24	2475	c.2386G>A	c.(2386-2388)Gtg>Atg	p.V796M	RP11-517C16.2_ENST00000565700.1_RNA|ATP2C2_ENST00000420010.2_3'UTR|ATP2C2_ENST00000416219.2_Missense_Mutation_p.V825M	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	796					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.V796M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						ACCACGGAGTGTGCGGGACAC	0.547																																					p.V796M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2386A	16						.						112.0	124.0	120.0					16																	84494312		2118	4243	6361	83051813	SO:0001583	missense	9914	exon24			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.2386G>A	16.37:g.84494312G>A	ENSP00000262429:p.Val796Met		83051813	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	G	5.594	0.294430	0.10567	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.95788	-3.81;-3.81	5.41	-1.83	0.07833	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.872740	0.10077	N	0.718988	D	0.93220	0.7840	M	0.71296	2.17	0.09310	N	1	B;B;B;B;B	0.24675	0.079;0.029;0.02;0.109;0.011	B;B;B;B;B	0.32762	0.152;0.098;0.087;0.094;0.098	D	0.84215	0.0458	10	0.32370	T	0.25	.	5.922	0.19088	0.3568:0.2242:0.419:0.0	.	825;645;645;813;796	E7ES94;B3KR57;F8WAA5;O75185-2;O75185	.;.;.;.;AT2C2_HUMAN	M	825;796;645	ENSP00000397925:V825M;ENSP00000262429:V796M	ENSP00000262429:V796M	V	+	1	0	ATP2C2	83051813	0.005000	0.15991	0.000000	0.03702	0.016000	0.09150	-0.242000	0.08928	-0.445000	0.07159	0.655000	0.94253	GTG		0.547	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
COLEC12	81035	broad.mit.edu	37	18	357502	357502	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-3909-01	TCGA-AG-3909-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr18:357502A>G	ENST00000400256.3	-	3	286	c.79T>C	c.(79-81)Tgt>Cgt	p.C27R		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	27					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)	p.C27R(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				CATTTGGTACATTGTGTTCCT	0.294																																					p.C27R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T79C	18						.						120.0	117.0	118.0					18																	357502		2202	4298	6500	347502	SO:0001583	missense	81035	exon3			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.79T>C	18.37:g.357502A>G	ENSP00000383115:p.Cys27Arg		347502	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	37	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.363542	0.61513	.	.	ENSG00000158270	ENST00000400256	D	0.95137	-3.62	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.95497	0.8537	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96302	0.9222	10	0.87932	D	0	-11.8381	16.3127	0.82898	1.0:0.0:0.0:0.0	.	27	Q5KU26	COL12_HUMAN	R	27	ENSP00000383115:C27R	ENSP00000383115:C27R	C	-	1	0	COLEC12	347502	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.904000	0.92590	2.246000	0.74042	0.533000	0.62120	TGT		0.294	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
MC5R	4161	broad.mit.edu	37	18	13826480	13826480	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr18:13826480C>T	ENST00000324750.3	+	1	938	c.716C>T	c.(715-717)aCc>aTc	p.T239I	AP001525.1_ENST00000390194.2_RNA	NM_005913.2	NP_005904.1	P33032	MC5R_HUMAN	melanocortin 5 receptor	239					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|melanocortin receptor activity (GO:0004977)	p.T239I(2)		NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|upper_aerodigestive_tract(1)	41						GGCGCGGTCACCGTCACCATG	0.617																																					p.T239I												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C716T	18						.						216.0	174.0	188.0					18																	13826480		2203	4300	6503	13816480	SO:0001583	missense	4161	exon1			AY268429	CCDS11868.1	18p11.2	2012-08-10			ENSG00000176136	ENSG00000176136		"""GPCR / Class A : Melanocortin receptors"""	6933	protein-coding gene	gene with protein product		600042				8396929	Standard	NM_005913		Approved		uc010xaf.2	P33032	OTTHUMG00000131720	ENST00000324750.3:c.716C>T	18.37:g.13826480C>T	ENSP00000318077:p.Thr239Ile		13816480	NM_005913	B0YJ34|Q502V1	Missense_Mutation	SNP	ENST00000324750.3	37	CCDS11868.1	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133428	0.37630	.	.	ENSG00000176136	ENST00000324750	T	0.39056	1.1	4.88	4.88	0.63580	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55194	0.1905	M	0.87456	2.885	0.80722	D	1	P	0.34639	0.461	B	0.38264	0.269	T	0.65207	-0.6224	10	0.87932	D	0	.	17.0064	0.86394	0.0:1.0:0.0:0.0	.	239	P33032	MC5R_HUMAN	I	239	ENSP00000318077:T239I	ENSP00000318077:T239I	T	+	2	0	MC5R	13816480	1.000000	0.71417	0.999000	0.59377	0.068000	0.16541	7.423000	0.80229	2.246000	0.74042	0.305000	0.20034	ACC		0.617	MC5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254638.1	NM_005913	
GUCA1C	9626	broad.mit.edu	37	3	108672582	108672582	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:108672582C>T	ENST00000261047.3	-	1	160	c.28G>A	c.(28-30)Gat>Aat	p.D10N	GUCA1C_ENST00000471108.1_Missense_Mutation_p.D10N|GUCA1C_ENST00000393963.3_Missense_Mutation_p.D10N	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	10					phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)	p.D10N(1)		endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						GCTTTCTGATCACCAGCTATA	0.418																																					p.D10N	NSCLC(157;1360 1999 30631 40189 44208)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G28A	3						.						141.0	142.0	141.0					3																	108672582		2203	4300	6503	110155272	SO:0001583	missense	9626	exon1			AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.28G>A	3.37:g.108672582C>T	ENSP00000261047:p.Asp10Asn		110155272	NM_005459	O95844|Q9UNM0	Missense_Mutation	SNP	ENST00000261047.3	37	CCDS2954.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604986	0.28623	.	.	ENSG00000138472	ENST00000393963;ENST00000261047;ENST00000471108	T;T;T	0.72505	-0.4;-0.66;-0.28	5.6	2.75	0.32379	.	2.645310	0.01387	N	0.013129	T	0.67804	0.2932	L	0.59436	1.845	0.09310	N	1	P;P	0.34462	0.454;0.454	B;B	0.32677	0.15;0.107	T	0.53215	-0.8470	10	0.49607	T	0.09	.	6.1526	0.20320	0.1538:0.6829:0.0:0.1633	.	10;10	C9JNI2;O95843	.;GUC1C_HUMAN	N	10	ENSP00000377535:D10N;ENSP00000261047:D10N;ENSP00000417761:D10N	ENSP00000261047:D10N	D	-	1	0	GUCA1C	110155272	0.003000	0.15002	0.004000	0.12327	0.007000	0.05969	0.633000	0.24598	0.808000	0.34231	0.650000	0.86243	GAT		0.418	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353819.1	NM_005459	
ARHGAP31	57514	broad.mit.edu	37	3	119121090	119121090	+	Silent	SNP	C	C	T	rs61747387	byFrequency	TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:119121090C>T	ENST00000264245.4	+	10	2023	c.1491C>T	c.(1489-1491)cgC>cgT	p.R497R		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	497					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.R497R(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TGCCGCTCCGCGTGTCCGCAG	0.597																																					p.R497R	Pancreas(7;176 297 5394 51128 51241)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1491T	3						.						58.0	65.0	62.0					3																	119121090		2085	4220	6305	120603780	SO:0001819	synonymous_variant	57514	exon10				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1491C>T	3.37:g.119121090C>T			120603780	NM_020754	Q9ULL6	Silent	SNP	ENST00000264245.4	37	CCDS43135.1																																																																																				0.597	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
CAND2	23066	broad.mit.edu	37	3	12858310	12858310	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:12858310C>T	ENST00000456430.2	+	10	1920	c.1879C>T	c.(1879-1881)Cgg>Tgg	p.R627W	CAND2_ENST00000295989.5_Missense_Mutation_p.R534W	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	627					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)		p.R534W(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TGAGATCACCCGGCTGCCCGC	0.632																																					p.R627W	GBM(43;676 868 1633 6395 37496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1879T	3						.						67.0	76.0	73.0					3																	12858310		2100	4217	6317	12833310	SO:0001583	missense	23066	exon10				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1879C>T	3.37:g.12858310C>T	ENSP00000387641:p.Arg627Trp		12833310	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386485	0.61956	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.71341	-0.56;-0.56	4.82	4.82	0.62117	Armadillo-like helical (1);Armadillo-type fold (1);	0.068282	0.56097	D	0.000033	D	0.87884	0.6290	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.91089	0.4905	10	0.87932	D	0	-35.2501	15.7833	0.78281	0.0:1.0:0.0:0.0	.	627;534	O75155;O75155-2	CAND2_HUMAN;.	W	534;627	ENSP00000295989:R534W;ENSP00000387641:R627W	ENSP00000295989:R534W	R	+	1	2	CAND2	12833310	0.317000	0.24589	1.000000	0.80357	0.837000	0.47467	0.913000	0.28611	2.395000	0.81488	0.561000	0.74099	CGG		0.632	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
FBXO40	51725	broad.mit.edu	37	3	121340299	121340299	+	Missense_Mutation	SNP	C	C	T	rs141957650		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:121340299C>T	ENST00000338040.4	+	3	437	c.23C>T	c.(22-24)cCg>cTg	p.P8L		NM_016298.3	NP_057382.2	Q9UH90	FBX40_HUMAN	F-box protein 40	8					muscle cell differentiation (GO:0042692)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P8L(1)		NS(1)|breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(11)|lung(19)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	46				GBM - Glioblastoma multiforme(114;0.189)		CGCAGATCCCCGCCAGGGCAC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		16862	0.001		0.0	False		,,,				2504	0.0				p.P8L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C23T	3						.						72.0	74.0	73.0					3																	121340299		2203	4300	6503	122822989	SO:0001583	missense	51725	exon3			AF204674	CCDS33835.1	3q21.1	2004-08-24			ENSG00000163833	ENSG00000163833		"""F-boxes /  ""other"""""	29816	protein-coding gene	gene with protein product		609107				10574462	Standard	NM_016298		Approved	KIAA1195, Fbx40	uc003eeg.2	Q9UH90	OTTHUMG00000159410	ENST00000338040.4:c.23C>T	3.37:g.121340299C>T	ENSP00000337510:p.Pro8Leu		122822989	NM_016298	B2RAX7|Q32M70|Q9ULM5	Missense_Mutation	SNP	ENST00000338040.4	37	CCDS33835.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	0.082	-1.181803	0.01633	.	.	ENSG00000163833	ENST00000338040	T	0.40225	1.04	5.73	3.89	0.44902	.	0.609592	0.17228	N	0.182079	T	0.25827	0.0629	N	0.22421	0.69	0.09310	N	0.999999	B	0.15719	0.014	B	0.11329	0.006	T	0.16541	-1.0399	10	0.14656	T	0.56	0.2054	9.1779	0.37123	0.0:0.8191:0.0:0.1809	.	8	Q9UH90	FBX40_HUMAN	L	8	ENSP00000337510:P8L	ENSP00000337510:P8L	P	+	2	0	FBXO40	122822989	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	1.113000	0.31184	1.372000	0.46190	0.655000	0.94253	CCG		0.532	FBXO40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355158.1	NM_016298	
MCF2L2	23101	broad.mit.edu	37	3	183145690	183145690	+	Splice_Site	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:183145690C>T	ENST00000328913.3	-	1	373	c.76G>A	c.(76-78)Gat>Aat	p.D26N	MCF2L2_ENST00000473233.1_Splice_Site_p.D26N|MCF2L2_ENST00000414362.2_Splice_Site_p.D26N|MCF2L2_ENST00000447025.2_Splice_Site_p.D26N	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	26	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.D26N(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CTTCGTTTACCGACATGAGTG	0.522																																					p.D26N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G76A	3						.						87.0	91.0	90.0					3																	183145690		2203	4300	6503	184628384	SO:0001630	splice_region_variant	23101	exon1			AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.76+1G>A	3.37:g.183145690C>T			184628384	NM_015078	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026540	0.93518	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.06933	4.35;4.4;3.54;3.24	5.31	5.31	0.75309	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.000000	0.64402	U	0.000020	T	0.21550	0.0519	L	0.61387	1.9	0.44890	D	0.997909	D;D	0.76494	0.984;0.999	P;P	0.58970	0.671;0.849	T	0.00180	-1.1948	9	.	.	.	.	14.4771	0.67554	0.0:1.0:0.0:0.0	.	26;26	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	N	26	ENSP00000328118:D26N;ENSP00000420070:D26N;ENSP00000388190:D26N;ENSP00000414131:D26N	.	D	-	1	0	MCF2L2	184628384	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.065000	0.57513	2.474000	0.83562	0.655000	0.94253	GAT		0.522	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	Missense_Mutation
SGOL1	151648	broad.mit.edu	37	3	20212291	20212291	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:20212291C>T	ENST00000263753.4	-	8	1628	c.1489G>A	c.(1489-1491)Gac>Aac	p.D497N	SGOL1_ENST00000443724.1_Intron|SGOL1_ENST00000421451.1_Missense_Mutation_p.D497N|SGOL1_ENST00000425061.1_Missense_Mutation_p.D245N|SGOL1_ENST00000412997.1_Missense_Mutation_p.D497N|SGOL1_ENST00000306698.2_Missense_Mutation_p.D228N|SGOL1_ENST00000437051.1_Missense_Mutation_p.D245N|SGOL1_ENST00000417364.1_Missense_Mutation_p.D245N|SGOL1_ENST00000419233.2_Missense_Mutation_p.D245N|SGOL1_ENST00000429446.3_Missense_Mutation_p.D228N|SGOL1_ENST00000383774.1_Intron|SGOL1_ENST00000442720.1_Missense_Mutation_p.D228N|SGOL1_ENST00000452020.1_Missense_Mutation_p.D228N|SGOL1_ENST00000412868.1_Missense_Mutation_p.D497N|SGOL1_ENST00000460637.1_5'UTR	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)	497					attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)	p.D497N(1)		kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						GTAAAAGGGTCCCCTCTTCTC	0.338																																					p.D497N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1489A	3						.						61.0	61.0	61.0					3																	20212291		2203	4300	6503	20187295	SO:0001583	missense	151648	exon8			BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.1489G>A	3.37:g.20212291C>T	ENSP00000263753:p.Asp497Asn		20187295	NM_001012409	Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	Missense_Mutation	SNP	ENST00000263753.4	37	CCDS33716.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532295	0.85812	.	.	ENSG00000129810	ENST00000306698;ENST00000419233;ENST00000263753;ENST00000425061;ENST00000421451;ENST00000452020;ENST00000442720;ENST00000412997;ENST00000437051;ENST00000412868;ENST00000429446;ENST00000417364	T;T;T;T;T;T;T;T	0.73897	-0.79;-0.75;-0.79;-0.75;-0.33;-0.69;-0.33;-0.69	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.82296	0.5006	L	0.41492	1.28	0.29813	N	0.831446	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.99;0.99;0.99;0.999;0.976;0.991	T	0.79624	-0.1726	10	0.87932	D	0	.	18.235	0.89947	0.0:1.0:0.0:0.0	.	497;228;245;245;497;228	B5BUA4;Q5FBB7-5;Q5FBB7-4;Q5FBB7-2;Q5FBB7;Q5FBB7-3	.;.;.;.;SGOL1_HUMAN;.	N	228;245;497;245;497;228;228;497;245;497;228;245	ENSP00000394625:D245N;ENSP00000263753:D497N;ENSP00000414960:D245N;ENSP00000414129:D497N;ENSP00000410458:D497N;ENSP00000389034:D245N;ENSP00000406880:D497N;ENSP00000394613:D245N	ENSP00000263753:D497N	D	-	1	0	SGOL1	20187295	0.999000	0.42202	1.000000	0.80357	0.808000	0.45660	4.798000	0.62510	2.746000	0.94184	0.591000	0.81541	GAC		0.338	SGOL1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340498.1	NM_138484	
COL7A1	1294	broad.mit.edu	37	3	48621941	48621941	+	Missense_Mutation	SNP	G	G	A	rs147089666	byFrequency	TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:48621941G>A	ENST00000328333.8	-	35	4203	c.4096C>T	c.(4096-4098)Cgg>Tgg	p.R1366W	COL7A1_ENST00000454817.1_Missense_Mutation_p.R1366W	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1366	Interrupted collagenous region.|Triple-helical region.		R -> W (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1366W(2)		NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCCCTTTCCGCCCAGGAAGC	0.617																																					p.R1366W												COL7A1,breast,NS,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.C4096T	3						.	G	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	167.0	171.0	170.0		4096	2.3	0.0	3	dbSNP_134	170	1,8599	1.2+/-3.3	0,1,4299	yes	missense	COL7A1	NM_000094.3	101	0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308	probably-damaging	1366/2945	48621941	4,13002	2203	4300	6503	48596945	SO:0001583	missense	1294	exon35			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.4096C>T	3.37:g.48621941G>A	ENSP00000332371:p.Arg1366Trp		48596945	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351467	0.24512	6.81E-4	1.16E-4	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93659	-3.26;-3.26	5.62	2.3	0.28687	.	0.767870	0.11135	N	0.595954	D	0.91348	0.7271	M	0.64404	1.975	0.09310	N	1	D	0.62365	0.991	B	0.40410	0.328	T	0.82649	-0.0353	10	0.66056	D	0.02	.	13.2901	0.60267	0.0:0.0:0.5165:0.4835	.	1366	Q02388	CO7A1_HUMAN	W	1366	ENSP00000332371:R1366W;ENSP00000412569:R1366W	ENSP00000332371:R1366W	R	-	1	2	COL7A1	48596945	0.008000	0.16893	0.005000	0.12908	0.964000	0.63967	1.644000	0.37228	0.637000	0.30526	0.655000	0.94253	CGG		0.617	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
PROS1	5627	broad.mit.edu	37	3	93617367	93617367	+	Silent	SNP	A	A	G			TCGA-AG-3909-01	TCGA-AG-3909-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:93617367A>G	ENST00000394236.3	-	8	1090	c.774T>C	c.(772-774)aaT>aaC	p.N258N	PROS1_ENST00000407433.1_Silent_p.N127N	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	258	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.		N -> S (in THPH5; produces around 30% of PROS1 levels compared to wild-type; has impaired secretion; intracellular degradation of unsecreted material is found). {ECO:0000269|PubMed:11858485, ECO:0000269|PubMed:7545463, ECO:0000269|Ref.14}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)	p.N258N(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	CTCCAGGGTAATTGACACAAA	0.373																																					p.N258N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T774C	3						.						99.0	91.0	94.0					3																	93617367		2203	4300	6503	95100057	SO:0001819	synonymous_variant	5627	exon8				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.774T>C	3.37:g.93617367A>G			95100057	NM_000313	A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Silent	SNP	ENST00000394236.3	37	CCDS2923.1																																																																																				0.373	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317762.1	NM_000313	
ABCC5	10057	broad.mit.edu	37	3	183670905	183670905	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr3:183670905C>T	ENST00000334444.6	-	18	2876	c.2636G>A	c.(2635-2637)tGg>tAg	p.W879*	ABCC5_ENST00000265586.6_Nonsense_Mutation_p.W879*	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	879	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.W879*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GTAACTCAACCACCAGGTGCT	0.507																																					p.W879X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2636A	3						.						104.0	102.0	103.0					3																	183670905		1917	4120	6037	185153599	SO:0001587	stop_gained	10057	exon18			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2636G>A	3.37:g.183670905C>T	ENSP00000333926:p.Trp879*		185153599	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Nonsense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	C	40	8.246463	0.98724	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	.	.	.	5.62	5.62	0.85841	.	0.059276	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7591	19.69	0.95996	0.0:1.0:0.0:0.0	.	.	.	.	X	879	.	ENSP00000265586:W879X	W	-	2	0	ABCC5	185153599	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	7.380000	0.79704	2.648000	0.89879	0.650000	0.86243	TGG		0.507	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
DNAH10	196385	broad.mit.edu	37	12	124267807	124267807	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr12:124267807C>T	ENST00000409039.3	+	7	837	c.812C>T	c.(811-813)cCt>cTt	p.P271L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	271	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P271L(1)|p.P89L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGAAGACACCTCAGGTAGTT	0.542																																					p.P271L												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C812T	12						.						83.0	79.0	80.0					12																	124267807		2203	4300	6503	122833760	SO:0001583	missense	196385	exon7			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.812C>T	12.37:g.124267807C>T	ENSP00000386770:p.Pro271Leu		122833760	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	10.09	1.254858	0.22965	.	.	ENSG00000197653	ENST00000409039	T	0.50548	0.74	6.01	6.01	0.97437	Dynein heavy chain, domain-1 (1);	0.000000	0.64402	D	0.000001	T	0.64227	0.2579	M	0.82630	2.6	0.80722	D	1	D	0.53151	0.958	P	0.51170	0.661	T	0.61603	-0.7029	10	0.27785	T	0.31	.	20.1162	0.97934	0.0:1.0:0.0:0.0	.	271	Q8IVF4	DYH10_HUMAN	L	271	ENSP00000386770:P271L	ENSP00000386770:P271L	P	+	2	0	DNAH10	122833760	1.000000	0.71417	0.794000	0.32065	0.064000	0.16182	7.234000	0.78134	2.861000	0.98227	0.650000	0.86243	CCT		0.542	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
KRAS	3845	broad.mit.edu	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	T	rs121913527		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr12:25378562C>T	ENST00000256078.4	-	4	499	c.436G>A	c.(436-438)Gca>Aca	p.A146T	AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000557334.1_Intron|KRAS_ENST00000311936.3_Missense_Mutation_p.A146T	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146T	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,large_intestine,NS,Substitution - Missense,0	.	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436A	12						.						207.0	188.0	195.0					12																	25378562		2203	4300	6503	25269829	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>A	12.37:g.25378562C>T	ENSP00000256078:p.Ala146Thr		25269829	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234460	0.95207	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88741	-2.42;-2.42	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.963	D;P	0.76071	0.987;0.876	D	0.97524	1.0075	10	0.72032	D	0.01	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	T	146	ENSP00000308495:A146T;ENSP00000256078:A146T	ENSP00000256078:A146T	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA		0.323	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TIMELESS	8914	broad.mit.edu	37	12	56817487	56817487	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr12:56817487C>T	ENST00000553532.1	-	17	2121	c.1971G>A	c.(1969-1971)caG>caA	p.Q657Q	TIMELESS_ENST00000554616.1_Intron|TIMELESS_ENST00000229201.4_Silent_p.Q656Q					timeless circadian clock									p.Q657Q(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CTGGGCCCTGCTGCCCTATAG	0.522																																					p.Q657Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1971A	12						.						50.0	51.0	51.0					12																	56817487		2203	4300	6503	55103754	SO:0001819	synonymous_variant	8914	exon17			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.1971G>A	12.37:g.56817487C>T			55103754	NM_003920		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																				0.522	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
TMEM132D	121256	broad.mit.edu	37	12	129822278	129822278	+	Silent	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr12:129822278C>T	ENST00000422113.2	-	4	1526	c.1200G>A	c.(1198-1200)acG>acA	p.T400T		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	400					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.T400T(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CGACCTGCCACGTGACCAGCT	0.577																																					p.T400T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1200A	12						.						155.0	138.0	143.0					12																	129822278		2203	4300	6503	128388231	SO:0001819	synonymous_variant	121256	exon4			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1200G>A	12.37:g.129822278C>T			128388231	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	ENST00000422113.2	37	CCDS9266.1																																																																																				0.577	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
POTEB2	100287399	broad.mit.edu	37	15	21066451	21066451	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr15:21066451G>T	ENST00000454856.4	-	3	651	c.619C>A	c.(619-621)Cac>Aac	p.H207N		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	207								p.H207N(1)									ATAGCATAGTGTAGAGCGGTA	0.378																																					p.H244N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C730A	15						.						1.0	1.0	1.0					15																	21066451		41	183	224	19331030	SO:0001583	missense	339010	exon3				CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.619C>A	15.37:g.21066451G>T	ENSP00000456953:p.His207Asn		19331030	NM_207355		Missense_Mutation	SNP	ENST00000454856.4	37	CCDS59248.1																																																																																				0.378	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471435.1		
HERC2	8924	broad.mit.edu	37	15	28492013	28492013	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-3909-01	TCGA-AG-3909-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr15:28492013A>T	ENST00000261609.7	-	22	3374	c.3266T>A	c.(3265-3267)cTg>cAg	p.L1089Q		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.L1089Q(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GTACTTCTTCAGCAAGGAACC	0.473																																					p.L1089Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3266A	15						.						95.0	80.0	85.0					15																	28492013		2203	4300	6503	26165608	SO:0001583	missense	8924	exon22			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.3266T>A	15.37:g.28492013A>T	ENSP00000261609:p.Leu1089Gln		26165608	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.036197	0.75617	.	.	ENSG00000128731	ENST00000261609	T	0.64438	-0.1	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000002	T	0.78136	0.4236	M	0.72353	2.195	0.58432	D	0.999999	D	0.65815	0.995	D	0.75484	0.986	T	0.80544	-0.1335	10	0.66056	D	0.02	.	15.4668	0.75406	1.0:0.0:0.0:0.0	.	1089	O95714	HERC2_HUMAN	Q	1089	ENSP00000261609:L1089Q	ENSP00000261609:L1089Q	L	-	2	0	HERC2	26165608	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	9.339000	0.96797	2.059000	0.61396	0.528000	0.53228	CTG		0.473	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
IGDCC3	9543	broad.mit.edu	37	15	65621838	65621838	+	Missense_Mutation	SNP	G	G	A	rs369729407		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr15:65621838G>A	ENST00000327987.4	-	13	2346	c.2095C>T	c.(2095-2097)Cgg>Tgg	p.R699W	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	699					neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)		p.R699W(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CGCTGTCCCCGTCTCGCCCCA	0.647																																					p.R699W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2095T	15						.	G	TRP/ARG	0,4384		0,0,2192	37.0	45.0	42.0		2095	4.9	0.0	15		42	1,8577		0,1,4288	no	missense	IGDCC3	NM_004884.3	101	0,1,6480	AA,AG,GG		0.0117,0.0,0.0077	benign	699/815	65621838	1,12961	2192	4289	6481	63408891	SO:0001583	missense	9543	exon13			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.2095C>T	15.37:g.65621838G>A	ENSP00000332773:p.Arg699Trp		63408891	NM_004884	O95215	De_novo_Start_OutOfFrame	SNP	ENST00000327987.4	37	CCDS10205.1	.	.	.	.	.	.	.	.	.	.	G	9.735	1.163384	0.21538	0.0	1.17E-4	ENSG00000174498	ENST00000327987	T	0.68025	-0.3	5.82	4.91	0.64330	.	0.453489	0.20641	N	0.088402	T	0.54515	0.1863	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.50800	-0.8785	10	0.52906	T	0.07	-3.5926	13.4469	0.61146	0.0726:0.0:0.9274:0.0	.	699	Q8IVU1	IGDC3_HUMAN	W	699	ENSP00000332773:R699W	ENSP00000332773:R699W	R	-	1	2	IGDCC3	63408891	0.035000	0.19736	0.002000	0.10522	0.111000	0.19643	2.213000	0.42844	1.473000	0.48159	-0.254000	0.11334	CGG		0.647	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
SPATA8	145946	broad.mit.edu	37	15	97327474	97327474	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr15:97327474T>C	ENST00000328504.3	+	2	448	c.181T>C	c.(181-183)Tgg>Cgg	p.W61R	SPATA8_ENST00000558553.1_Missense_Mutation_p.V20A|SPATA8-AS1_ENST00000560888.1_RNA|SPATA8-AS1_ENST00000558722.1_RNA	NM_173499.3	NP_775770.1	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8	61								p.W61R(1)		large_intestine(4)|lung(8)|ovary(1)|skin(3)	16	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			GGGCCCGGTGTGGCCTGCAAA	0.567																																					p.W61R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T181C	15						.						59.0	54.0	56.0					15																	97327474		2197	4298	6495	95128478	SO:0001583	missense	145946	exon2			AY489187	CCDS10376.1	15q26	2008-02-05			ENSG00000185594	ENSG00000185594			28676	protein-coding gene	gene with protein product		613948					Standard	NM_173499		Approved	MGC44294	uc002bue.3	Q6RVD6	OTTHUMG00000149847	ENST00000328504.3:c.181T>C	15.37:g.97327474T>C	ENSP00000328149:p.Trp61Arg		95128478	NM_173499	Q2KJ07	Missense_Mutation	SNP	ENST00000328504.3	37	CCDS10376.1	.	.	.	.	.	.	.	.	.	.	T	7.008	0.556172	0.13436	.	.	ENSG00000185594	ENST00000328504	T	0.49432	0.78	3.28	-2.4	0.06583	.	.	.	.	.	T	0.21062	0.0507	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.14023	0.01	T	0.13415	-1.0510	9	0.87932	D	0	.	1.1833	0.01849	0.1709:0.1186:0.2928:0.4177	.	61	Q6RVD6	SPAT8_HUMAN	R	61	ENSP00000328149:W61R	ENSP00000328149:W61R	W	+	1	0	SPATA8	95128478	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.257000	0.08745	-0.940000	0.03705	-1.139000	0.01908	TGG		0.567	SPATA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313533.1	NM_173499	
LRRK1	79705	broad.mit.edu	37	15	101601396	101601396	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr15:101601396C>A	ENST00000388948.3	+	30	5059	c.4700C>A	c.(4699-4701)aCa>aAa	p.T1567K	LRRK1_ENST00000284395.5_Missense_Mutation_p.T1564K|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1									p.T1567K(1)|p.T1579K(1)		breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTGGTGAACACAGAGAAGGGC	0.622																																					p.T1567K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4700A	15						.						82.0	94.0	90.0					15																	101601396		2100	4232	6332	99418919	SO:0001583	missense	79705	exon30			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4700C>A	15.37:g.101601396C>A	ENSP00000373600:p.Thr1567Lys		99418919	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.747708	0.69533	.	.	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.73363	-0.73;-0.74	5.46	5.46	0.80206	.	0.376116	0.30383	N	0.009744	T	0.58892	0.2154	N	0.24115	0.695	0.27751	N	0.944159	P	0.38922	0.651	B	0.35240	0.198	T	0.59984	-0.7351	10	0.46703	T	0.11	.	10.8074	0.46527	0.0:0.8533:0.0:0.1467	.	1567	Q38SD2	LRRK1_HUMAN	K	1567;1564;258;121	ENSP00000373600:T1567K;ENSP00000284395:T1564K	ENSP00000284395:T1564K	T	+	2	0	LRRK1	99418919	1.000000	0.71417	0.984000	0.44739	0.953000	0.61014	4.382000	0.59594	2.576000	0.86940	0.555000	0.69702	ACA		0.622	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
BANK1	55024	broad.mit.edu	37	4	102946615	102946615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr4:102946615C>T	ENST00000322953.4	+	9	1817	c.1543C>T	c.(1543-1545)Cga>Tga	p.R515*	BANK1_ENST00000510950.1_3'UTR|BANK1_ENST00000504592.1_Nonsense_Mutation_p.R500*|RP11-498M5.2_ENST00000505091.1_RNA|BANK1_ENST00000428908.1_Nonsense_Mutation_p.R382*|BANK1_ENST00000444316.2_Nonsense_Mutation_p.R485*|BANK1_ENST00000508653.1_Nonsense_Mutation_p.R382*	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	515					B cell activation (GO:0042113)			p.R515*(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		CCCCCCGCCGCGACCTGTAGC	0.438																																					p.R515X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1543T	4						.						57.0	58.0	57.0					4																	102946615		2203	4300	6503	103165638	SO:0001587	stop_gained	55024	exon9			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1543C>T	4.37:g.102946615C>T	ENSP00000320509:p.Arg515*		103165638	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Nonsense_Mutation	SNP	ENST00000322953.4	37	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	C	31	5.104110	0.94245	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	.	.	.	4.9	3.0	0.34707	.	0.211219	0.31507	N	0.007539	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8154	0.46573	0.3423:0.6577:0.0:0.0	.	.	.	.	X	500;515;382;382;485	.	ENSP00000320509:R515X	R	+	1	2	BANK1	103165638	0.200000	0.23398	0.008000	0.14137	0.018000	0.09664	0.745000	0.26259	1.029000	0.39812	0.591000	0.81541	CGA		0.438	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
DRD5	1816	broad.mit.edu	37	4	9784488	9784488	+	Missense_Mutation	SNP	G	G	A	rs200800209		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr4:9784488G>A	ENST00000304374.2	+	1	1231	c.835G>A	c.(835-837)Gcg>Acg	p.A279T		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	279					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.A279T(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CGCAGCCTGCGCGCCCGACAC	0.647																																					p.A279T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G835A	4						.						23.0	23.0	23.0					4																	9784488		2198	4276	6474	9393586	SO:0001583	missense	1816	exon1			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.835G>A	4.37:g.9784488G>A	ENSP00000306129:p.Ala279Thr		9393586	NM_000798	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	g	5.695	0.312861	0.10789	.	.	ENSG00000169676	ENST00000304374	T	0.66638	-0.22	4.6	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	0.604659	0.17158	N	0.184820	T	0.37679	0.1012	N	0.16368	0.405	0.09310	N	1	P	0.41159	0.74	B	0.31812	0.136	T	0.14839	-1.0458	10	0.13470	T	0.59	.	4.9841	0.14182	0.2099:0.2482:0.5419:0.0	.	279	P21918	DRD5_HUMAN	T	279	ENSP00000306129:A279T	ENSP00000306129:A279T	A	+	1	0	DRD5	9393586	0.014000	0.17966	0.002000	0.10522	0.569000	0.35902	2.182000	0.42556	1.152000	0.42452	0.305000	0.20034	GCG		0.647	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
TRIML2	205860	broad.mit.edu	37	4	189012782	189012782	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr4:189012782C>G	ENST00000512729.1	-	7	1283	c.909G>C	c.(907-909)tgG>tgC	p.W303C	TRIML2_ENST00000326754.3_Missense_Mutation_p.W328C	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	303	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)	p.W303C(1)		central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GGGGGAAGACCCAGAGAGTCC	0.552																																					p.W303C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G909C	4						.						132.0	148.0	143.0					4																	189012782		2203	4300	6503	189249776	SO:0001583	missense	205860	exon7			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.909G>C	4.37:g.189012782C>G	ENSP00000422581:p.Trp303Cys		189249776	NM_173553	B7Z6J6	Missense_Mutation	SNP	ENST00000512729.1	37	CCDS3850.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783874	0.31593	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.61980	0.06;0.06	5.85	4.09	0.47781	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.47455	D	0.000222	T	0.69387	0.3105	L	0.48935	1.535	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	T	0.69978	-0.4998	10	0.54805	T	0.06	.	8.8899	0.35427	0.1517:0.7705:0.0:0.0778	.	328;303	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	C	303;328	ENSP00000422581:W303C;ENSP00000317498:W328C	ENSP00000317498:W328C	W	-	3	0	TRIML2	189249776	0.042000	0.20092	1.000000	0.80357	0.104000	0.19210	1.557000	0.36299	1.610000	0.50200	0.655000	0.94253	TGG		0.552	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553	
HCCS	3052	broad.mit.edu	37	X	11139860	11139860	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chrX:11139860G>A	ENST00000321143.4	+	7	939	c.737G>A	c.(736-738)cGt>cAt	p.R246H	HCCS_ENST00000380762.4_Missense_Mutation_p.R246H|ARHGAP6_ENST00000534860.1_Intron|HCCS_ENST00000380763.3_Missense_Mutation_p.R246H	NM_001122608.2|NM_001171991.2|NM_005333.4	NP_001116080.1|NP_001165462.1|NP_005324.3	P53701	CCHL_HUMAN	holocytochrome c synthase	246					organ morphogenesis (GO:0009887)|oxidation-reduction process (GO:0055114)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	holocytochrome-c synthase activity (GO:0004408)|metal ion binding (GO:0046872)	p.R246H(1)		kidney(1)|large_intestine(3)|lung(3)	7						CTGGACGTCCGTCCTGCCTTA	0.443																																					p.R246H	Ovarian(86;1338 1347 1462 10340 37882)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G737A	X						.						149.0	116.0	127.0					X																	11139860		2203	4300	6503	11049781	SO:0001583	missense	3052	exon7				CCDS14139.1	Xp22	2014-01-31	2010-05-11		ENSG00000004961	ENSG00000004961	4.4.1.17		4837	protein-coding gene	gene with protein product	"""cytochrome c heme-lyase"""	300056	"""holocytochrome c synthase (cytochrome c heme-lyase)"", ""microphthalamia with linear skin defects"""	MLS		8364577, 12444108	Standard	NM_001122608		Approved	CCHL	uc004cuj.3	P53701	OTTHUMG00000021128	ENST00000321143.4:c.737G>A	X.37:g.11139860G>A	ENSP00000326579:p.Arg246His		11049781	NM_005333	B3KUS1|Q502X8	Missense_Mutation	SNP	ENST00000321143.4	37	CCDS14139.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295180	0.81025	.	.	ENSG00000004961	ENST00000321143;ENST00000380763;ENST00000380762	D;D;D	0.92699	-3.09;-3.09;-3.09	5.83	4.07	0.47477	.	0.048205	0.85682	N	0.000000	D	0.97052	0.9037	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96207	0.9150	10	0.87932	D	0	-13.546	9.8221	0.40889	0.1705:0.0:0.8295:0.0	.	246	P53701	CCHL_HUMAN	H	246	ENSP00000326579:R246H;ENSP00000370140:R246H;ENSP00000370139:R246H	ENSP00000326579:R246H	R	+	2	0	HCCS	11049781	1.000000	0.71417	0.046000	0.18839	0.960000	0.62799	9.239000	0.95389	0.613000	0.30089	0.594000	0.82650	CGT		0.443	HCCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055742.1		
DMD	1756	broad.mit.edu	37	X	32867868	32867868	+	Missense_Mutation	SNP	C	C	T	rs398123864		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chrX:32867868C>T	ENST00000357033.4	-	3	369	c.163G>A	c.(163-165)Gaa>Aaa	p.E55K	DMD_ENST00000288447.4_Missense_Mutation_p.E47K|snoU13_ENST00000459244.1_RNA|DMD_ENST00000378677.2_Missense_Mutation_p.E51K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	55	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.		Missing (in BMD).		cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E50K(1)|p.E51K(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTCAGGCCTTCGAGGAGGTCT	0.378																																					p.E55K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G163A	X						.						80.0	76.0	77.0					X																	32867868		2202	4300	6502	32777789	SO:0001583	missense	1756	exon3			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.163G>A	X.37:g.32867868C>T	ENSP00000354923:p.Glu55Lys		32777789	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	32	5.107550	0.94292	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000288447;ENST00000447523	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	5.63	5.63	0.86233	Calponin homology domain (5);	0.000000	0.35805	U	0.002969	D	0.98874	0.9619	M	0.93150	3.385	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.986;0.984;0.992	D	0.99737	1.1014	10	0.87932	D	0	.	17.2721	0.87105	0.0:1.0:0.0:0.0	.	47;47;55;51	Q4G0X0;P11532-4;P11532;E9PDN5	.;.;DMD_HUMAN;.	K	47;51;55;55;47;18	ENSP00000367948:E51K;ENSP00000354923:E55K;ENSP00000288447:E47K;ENSP00000395904:E18K	ENSP00000288447:E47K	E	-	1	0	DMD	32777789	1.000000	0.71417	0.942000	0.38095	0.985000	0.73830	6.051000	0.71072	2.346000	0.79739	0.600000	0.82982	GAA		0.378	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
TEX11	56159	broad.mit.edu	37	X	69749016	69749016	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chrX:69749016G>T	ENST00000395889.2	-	31	2907	c.2752C>A	c.(2752-2754)Ctt>Att	p.L918I	TEX11_ENST00000344304.3_Missense_Mutation_p.L918I|TEX11_ENST00000374333.2_Missense_Mutation_p.L903I|TEX11_ENST00000374320.2_Missense_Mutation_p.L593I	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	918					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)		p.L903I(1)		breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GCTTCCACAAGCTGACTATAC	0.443																																					p.L918I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2752A	X						.						119.0	84.0	96.0					X																	69749016		2203	4300	6503	69665741	SO:0001583	missense	56159	exon31			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2752C>A	X.37:g.69749016G>T	ENSP00000379226:p.Leu918Ile		69665741	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	37	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	G	2.255	-0.370661	0.05069	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.37584	1.75;1.73;1.19;1.73	4.35	-1.42	0.08913	.	0.394763	0.23072	N	0.052246	T	0.22551	0.0544	L	0.32530	0.975	0.09310	N	1	P;P	0.46064	0.872;0.798	P;B	0.45856	0.495;0.3	T	0.10917	-1.0609	9	.	.	.	-0.8473	1.1711	0.01826	0.212:0.3172:0.3076:0.1632	.	903;918	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	I	903;918;593;918	ENSP00000363453:L903I;ENSP00000379226:L918I;ENSP00000363440:L593I;ENSP00000340995:L918I	.	L	-	1	0	TEX11	69665741	0.046000	0.20272	0.000000	0.03702	0.003000	0.03518	0.073000	0.14640	-0.214000	0.10078	0.589000	0.80489	CTT		0.443	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
KIAA2022	340533	broad.mit.edu	37	X	73960374	73960374	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chrX:73960374G>T	ENST00000055682.6	-	3	4629	c.4018C>A	c.(4018-4020)Ccc>Acc	p.P1340T		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1340					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)	p.P1340T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TCCCAAAGGGGCTCTATGGAG	0.473																																					p.P1340T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4018A	X						.						75.0	72.0	73.0					X																	73960374		2203	4300	6503	73877099	SO:0001583	missense	340533	exon3				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4018C>A	X.37:g.73960374G>T	ENSP00000055682:p.Pro1340Thr		73877099	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	37	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424208	0.62733	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.34072	1.38;1.38	5.55	5.55	0.83447	.	0.097492	0.64402	D	0.000001	T	0.52058	0.1711	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55211	-0.8176	10	0.87932	D	0	-9.5638	18.5251	0.90969	0.0:0.0:1.0:0.0	.	1340	Q5QGS0	K2022_HUMAN	T	1340	ENSP00000362567:P1340T;ENSP00000055682:P1340T	ENSP00000055682:P1340T	P	-	1	0	KIAA2022	73877099	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.317000	0.78254	0.544000	0.68410	CCC		0.473	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
DCAF12L2	340578	broad.mit.edu	37	X	125299059	125299059	+	Silent	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chrX:125299059G>A	ENST00000360028.2	-	1	875	c.849C>T	c.(847-849)gaC>gaT	p.D283D	DCAF12L2_ENST00000538699.1_Silent_p.D283D			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	283								p.D283D(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GGAAGTAGCCGTCCAAGGACA	0.627																																					p.D283D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C849T	X						.						66.0	70.0	69.0					X																	125299059		2203	4300	6503	125126740	SO:0001819	synonymous_variant	340578	exon1			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.849C>T	X.37:g.125299059G>A			125126740	NM_001013628	B2RN42	Silent	SNP	ENST00000360028.2	37	CCDS43991.1																																																																																				0.627	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
CFAP221	200373	broad.mit.edu	37	2	120369269	120369269	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:120369269G>A	ENST00000413369.3	+	13	1349	c.1262G>A	c.(1261-1263)cGa>cAa	p.R421Q	PCDP1_ENST00000602047.1_Missense_Mutation_p.R135Q|PCDP1_ENST00000597189.1_3'UTR	NM_001271049.1	NP_001257978												p.R135Q(1)				Colorectal(110;0.196)					GAATTTCAGCGACTTAAAACA	0.338																																					p.R135Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G404A	2						.						87.0	88.0	88.0					2																	120369269		2203	4300	6503	120085739	SO:0001583	missense	200373	exon14																														ENST00000413369.3:c.1262G>A	2.37:g.120369269G>A	ENSP00000393222:p.Arg421Gln		120085739	NM_001029996		Missense_Mutation	SNP	ENST00000413369.3	37	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141068	0.77775	.	.	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.19938	2.11	4.39	4.39	0.52855	.	0.234819	0.28453	N	0.015299	T	0.42086	0.1187	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.33854	-0.9852	10	0.87932	D	0	-13.7282	13.815	0.63285	0.0:0.0:1.0:0.0	.	265;421	Q4G0U5-3;Q4G0U5	.;PCDP1_HUMAN	Q	135;421	ENSP00000393222:R421Q	ENSP00000295220:R135Q	R	+	2	0	AC069154.2	120085739	1.000000	0.71417	0.998000	0.56505	0.787000	0.44495	5.567000	0.67378	2.253000	0.74438	0.650000	0.86243	CGA		0.338	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
LRP1B	53353	broad.mit.edu	37	2	141806753	141806753	+	Missense_Mutation	SNP	G	G	A	rs371410109		TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:141806753G>A	ENST00000389484.3	-	11	2562	c.1591C>T	c.(1591-1593)Cgc>Tgc	p.R531C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	531					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.R531C(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATTCCTGGGCGTCCTTTCCCA	0.398										TSP Lung(27;0.18)																											p.R531C	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1591T	2						.	G	CYS/ARG	0,4406		0,0,2203	107.0	109.0	108.0		1591	4.6	1.0	2		108	1,8599	1.2+/-3.3	0,1,4299	no	missense	LRP1B	NM_018557.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	531/4600	141806753	1,13005	2203	4300	6503	141523223	SO:0001583	missense	53353	exon11			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1591C>T	2.37:g.141806753G>A	ENSP00000374135:p.Arg531Cys		141523223	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262951	0.39995	0.0	1.16E-4	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90676	-2.71	5.49	4.61	0.57282	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	U	0.000001	D	0.89626	0.6769	M	0.84082	2.675	0.58432	D	0.999999	B	0.25809	0.135	B	0.17722	0.019	D	0.87612	0.2504	10	0.87932	D	0	.	9.1244	0.36805	0.0739:0.0:0.7802:0.1458	.	531	Q9NZR2	LRP1B_HUMAN	C	531;469	ENSP00000374135:R531C	ENSP00000374135:R531C	R	-	1	0	LRP1B	141523223	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	4.314000	0.59166	1.295000	0.44724	0.563000	0.77884	CGC		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
COBLL1	22837	broad.mit.edu	37	2	165584560	165584560	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:165584560G>C	ENST00000392717.2	-	5	698	c.694C>G	c.(694-696)Caa>Gaa	p.Q232E	COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000375458.2_Missense_Mutation_p.Q194E|COBLL1_ENST00000409184.3_Missense_Mutation_p.Q232E|COBLL1_ENST00000194871.6_Missense_Mutation_p.Q247E|COBLL1_ENST00000342193.4_Missense_Mutation_p.Q194E			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	232						extracellular vesicular exosome (GO:0070062)		p.Q194*(1)|p.Q194E(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TCCTGCGATTGATAATCTTTC	0.393																																					p.Q194E												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)	c.C580G	2						.						124.0	121.0	122.0					2																	165584560		2203	4300	6503	165292806	SO:0001583	missense	22837	exon4			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.694C>G	2.37:g.165584560G>C	ENSP00000376478:p.Gln232Glu		165292806	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.29|17.29	3.351725|3.351725	0.61183|0.61183	.|.	.|.	ENSG00000082438|ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871;ENST00000456693|ENST00000452626	D;D;D;D;D;D|.	0.91740|.	-2.9;-2.9;-2.9;-2.9;-2.9;-2.9|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Cordon-bleu domain (1);|.	0.331824|.	0.34906|.	N|.	0.003597|.	T|.	0.76630|.	0.4014|.	M|M	0.67953|0.67953	2.075|2.075	0.50039|0.50039	D|D	0.999843|0.999843	D;D;D|.	0.89917|.	1.0;1.0;0.999|.	D;D;D|.	0.87578|.	0.998;0.998;0.997|.	T|.	0.72050|.	-0.4407|.	10|.	0.35671|.	T|.	0.21|.	-14.2422|-14.2422	20.8794|20.8794	0.99867|0.99867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	232;247;232|.	Q53SF7;B7Z2P5;Q53SF7-2|.	COBL1_HUMAN;.;.|.	E|X	194;194;232;232;247;169|196	ENSP00000364607:Q194E;ENSP00000341360:Q194E;ENSP00000387326:Q232E;ENSP00000376478:Q232E;ENSP00000194871:Q247E;ENSP00000397520:Q169E|.	ENSP00000194871:Q247E|.	Q|S	-|-	1|2	0|0	COBLL1|COBLL1	165292806|165292806	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.082000|0.082000	0.17680|0.17680	6.557000|6.557000	0.73937|0.73937	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CAA|TCA		0.393	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
CHRNA1	1134	broad.mit.edu	37	2	175624081	175624081	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:175624081G>T	ENST00000261007.5	-	3	278	c.212C>A	c.(211-213)aCa>aAa	p.T71K	CHRNA1_ENST00000409219.1_Missense_Mutation_p.T71K|CHRNA1_ENST00000348749.5_Missense_Mutation_p.T71K|CHRNA1_ENST00000409323.1_Missense_Mutation_p.T71K|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Missense_Mutation_p.T71K	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	71					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)	p.T71K(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CACATTGGTTGTCACGATCTG	0.443																																					p.T71K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C212A	2						.						108.0	102.0	104.0					2																	175624081		2203	4300	6503	175332327	SO:0001583	missense	1134	exon3			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.212C>A	2.37:g.175624081G>T	ENSP00000261007:p.Thr71Lys		175332327	NM_000079	B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	37	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580264	0.86645	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel ligand-binding (3);	0.091297	0.85682	D	0.000000	D	0.88187	0.6369	L	0.61218	1.895	0.58432	D	0.999999	D;D;D	0.60160	0.987;0.96;0.958	P;B;P	0.62560	0.754;0.387;0.904	D	0.87581	0.2484	10	0.59425	D	0.04	.	20.3789	0.98926	0.0:0.0:1.0:0.0	.	71;71;71	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	K	71	ENSP00000261008:T71K;ENSP00000261007:T71K;ENSP00000387026:T71K;ENSP00000386611:T71K;ENSP00000386684:T71K	ENSP00000261007:T71K	T	-	2	0	CHRNA1	175332327	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.498000	0.60373	2.826000	0.97356	0.563000	0.77884	ACA		0.443	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1		
TTN	7273	broad.mit.edu	37	2	179440531	179440531	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:179440531C>T	ENST00000591111.1	-	276	65629	c.65405G>A	c.(65404-65406)cGg>cAg	p.R21802Q	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R23443Q|TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R14503Q|TTN_ENST00000460472.2_Missense_Mutation_p.R14378Q|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R14570Q|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R20875Q|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21802	Fibronectin type-III 58. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R20873Q(1)|p.R14503Q(1)|p.R14378Q(1)|p.R14570Q(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTGTAGGCCGCAGGTTGAG	0.502																																					p.G14378S												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.G43132A	2						.						94.0	99.0	97.0					2																	179440531		2103	4239	6342	179148777	SO:0001583	missense	7273	exon154			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.65405G>A	2.37:g.179440531C>T	ENSP00000465570:p.Arg21802Gln		179148777	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	11.88	1.770101	0.31320	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.66	3.88	0.44766	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.32346	0.0826	N	0.12887	0.27	0.31869	N	0.619964	B;B;B;B	0.30179	0.271;0.271;0.271;0.271	B;B;B;B	0.28139	0.086;0.086;0.086;0.086	T	0.38972	-0.9636	9	0.87932	D	0	.	6.9044	0.24301	0.0:0.6193:0.0:0.3807	.	14378;14503;14570;21802	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	20875;14378;14570;14503;14376	ENSP00000343764:R20875Q;ENSP00000434586:R14378Q;ENSP00000340554:R14570Q;ENSP00000352154:R14503Q	ENSP00000340554:R14570Q	R	-	2	0	TTN	179148777	1.000000	0.71417	0.880000	0.34516	0.782000	0.44232	2.760000	0.47581	0.770000	0.33336	0.650000	0.86243	CGG		0.502	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179473120	179473120	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:179473120T>C	ENST00000591111.1	-	225	47791	c.47567A>G	c.(47566-47568)aAt>aGt	p.N15856S	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.N17497S|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.N8557S|TTN_ENST00000460472.2_Missense_Mutation_p.N8432S|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.N8624S|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.N14929S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15856	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.N8432S(1)|p.N8624S(1)|p.N8557S(1)|p.N14929S(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGGCTTCCATTATCTTTTGG	0.408																																					p.N8432S												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.A25295G	2						.						44.0	40.0	41.0					2																	179473120		1863	4098	5961	179181365	SO:0001583	missense	7273	exon103			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.47567A>G	2.37:g.179473120T>C	ENSP00000465570:p.Asn15856Ser		179181365	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	11.26	1.586406	0.28268	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.72	4.55	0.56014	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68742	0.3034	M	0.63208	1.945	0.48341	D	0.999635	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.71115	-0.4686	9	0.87932	D	0	.	13.0115	0.58733	0.0:0.0:0.1348:0.8652	.	8432;8557;8624;15856	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	14929;8432;8624;8557;8432	ENSP00000343764:N14929S;ENSP00000434586:N8432S;ENSP00000340554:N8624S;ENSP00000352154:N8557S	ENSP00000340554:N8624S	N	-	2	0	TTN	179181365	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	6.255000	0.72466	0.974000	0.38366	0.460000	0.39030	AAT		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179486705	179486705	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:179486705T>A	ENST00000591111.1	-	194	40245	c.40021A>T	c.(40021-40023)Aaa>Taa	p.K13341*	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.K14982*|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.K6042*|TTN_ENST00000460472.2_Nonsense_Mutation_p.K5917*|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.K6109*|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.K12414*|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13341	Ig-like 89.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K6042*(1)|p.K6109*(1)|p.K12414*(1)|p.K5917*(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCCCTTTTTAATTTCAGCA	0.343																																					p.K5917X												.	.	4	Substitution - Nonsense(4)	large_intestine(4)	c.A17749T	2						.						148.0	128.0	135.0					2																	179486705		1872	4100	5972	179194950	SO:0001587	stop_gained	7273	exon72			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40021A>T	2.37:g.179486705T>A	ENSP00000465570:p.Lys13341*		179194950	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	58	31.686368	0.99979	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.0568	0.58984	0.0:0.0:0.1339:0.8661	.	.	.	.	X	12414;5917;6109;6042;5917	.	ENSP00000340554:K6109X	K	-	1	0	TTN	179194950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.186000	0.72026	2.323000	0.78572	0.528000	0.53228	AAA		0.343	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NRXN1	9378	broad.mit.edu	37	2	50149358	50149358	+	Silent	SNP	C	C	T	rs151195816		TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:50149358C>T	ENST00000406316.2	-	22	5634	c.4158G>A	c.(4156-4158)ccG>ccA	p.P1386P	NRXN1_ENST00000406859.3_Silent_p.P1386P|NRXN1_ENST00000401710.1_Silent_p.P404P|NRXN1_ENST00000402717.3_Silent_p.P1408P|NRXN1_ENST00000404971.1_Silent_p.P1456P|NRXN1_ENST00000401669.2_Silent_p.P1416P|NRXN1_ENST00000342183.5_Silent_p.P351P|NRXN1_ENST00000405472.3_Silent_p.P1408P	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1386					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.P1386P(1)|p.P351P(1)|p.P1457P(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AGCCTGGATACGGCTCTCTGC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		16427	0.0		0.0	False		,,,				2504	0.001				p.P351P												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.G1053A	2						.	C	,,	0,4406		0,0,2203	48.0	42.0	44.0		4368,4158,1053	-11.9	0.0	2	dbSNP_134	44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	NRXN1	NM_001135659.1,NM_004801.4,NM_138735.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	1456/1548,1386/1478,351/443	50149358	1,13005	2203	4300	6503	50002862	SO:0001819	synonymous_variant	9378	exon6			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4158G>A	2.37:g.50149358C>T			50002862	NM_138735	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	37	CCDS54360.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.933|0.933	-0.712039|-0.712039	0.03206|0.03206	0.0|0.0	1.16E-4|1.16E-4	ENSG00000179915|ENSG00000179915	ENST00000412315|ENST00000378262	.|.	.|.	.|.	5.95|5.95	-11.9|-11.9	0.00025|0.00025	.|.	.|.	.|.	.|.	.|.	T|T	0.23451|0.23451	0.0567|0.0567	.|.	.|.	.|.	0.27274|0.27274	N|N	0.958287|0.958287	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.32402|0.32402	-0.9908|-0.9908	4|4	.|.	.|.	.|.	.|.	7.8463|7.8463	0.29426|0.29426	0.1256:0.51:0.2001:0.1642|0.1256:0.51:0.2001:0.1642	.|.	.|.	.|.	.|.	H|I	119|53	.|.	.|.	R|V	-|-	2|1	0|0	NRXN1|NRXN1	50002862|50002862	0.000000|0.000000	0.05858|0.05858	0.005000|0.005000	0.12908|0.12908	0.787000|0.787000	0.44495|0.44495	-2.706000|-2.706000	0.00821|0.00821	-5.262000|-5.262000	0.00018|0.00018	-0.986000|-0.986000	0.02555|0.02555	CGT|GTA		0.527	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
NRXN1	9378	broad.mit.edu	37	2	50847278	50847278	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:50847278G>A	ENST00000406316.2	-	8	2678	c.1202C>T	c.(1201-1203)aCg>aTg	p.T401M	NRXN1_ENST00000406859.3_Missense_Mutation_p.T401M|NRXN1_ENST00000402717.3_Missense_Mutation_p.T393M|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000404971.1_Missense_Mutation_p.T441M|NRXN1_ENST00000401669.2_Missense_Mutation_p.T401M|NRXN1_ENST00000405472.3_Missense_Mutation_p.T393M	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	401	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.T442M(1)|p.T401M(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATCTTCTTGCGTGTAGCCCGT	0.468																																					p.T441M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1322T	2						.						64.0	65.0	65.0					2																	50847278		2058	4234	6292	50700782	SO:0001583	missense	9378	exon9			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1202C>T	2.37:g.50847278G>A	ENSP00000384311:p.Thr401Met		50700782	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704527	0.68615	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.79749	-1.12;-1.12;-1.3;-1.12;-1.3;-1.12	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.91129	0.7207	M	0.83774	2.66	0.54753	D	0.999982	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.90074	0.4165	10	0.52906	T	0.07	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	441;401;393	Q9ULB1-3;F8WB18;A7E294	.;.;.	M	441;401;393;401;442;393;401	ENSP00000385142:T441M;ENSP00000384311:T401M;ENSP00000434015:T393M;ENSP00000385017:T401M;ENSP00000385434:T393M;ENSP00000385681:T401M	ENSP00000385017:T401M	T	-	2	0	NRXN1	50700782	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	ACG		0.468	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
SLC4A5	57835	broad.mit.edu	37	2	74483058	74483058	+	Splice_Site	SNP	C	C	T			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:74483058C>T	ENST00000377634.4	-	13	1268	c.869G>A	c.(868-870)cGg>cAg	p.R290Q	SLC4A5_ENST00000377632.1_Splice_Site_p.R290Q|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000394019.2_Splice_Site_p.R290Q|SLC4A5_ENST00000346834.4_Splice_Site_p.R290Q|SLC4A5_ENST00000358683.4_Splice_Site_p.R226Q|RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000359484.4_Splice_Site_p.R226Q|SLC4A5_ENST00000357822.5_Splice_Site_p.R290Q|SLC4A5_ENST00000423644.1_Splice_Site_p.R290Q					solute carrier family 4 (sodium bicarbonate cotransporter), member 5									p.R290Q(1)		breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						TTTGTTTTTCCGCTGGACAGG	0.527																																					p.R290Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G869A	2						.						111.0	82.0	92.0					2																	74483058		2203	4300	6503	74336566	SO:0001630	splice_region_variant	57835	exon8			AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.868-1G>A	2.37:g.74483058C>T			74336566	NM_021196		Missense_Mutation	SNP	ENST00000377634.4	37	CCDS1936.1	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639759	0.47153	.	.	ENSG00000188687	ENST00000394019;ENST00000451608;ENST00000346834;ENST00000359484;ENST00000423644;ENST00000358683;ENST00000357822;ENST00000377632;ENST00000377634;ENST00000425249	T;T;T;T;T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28;-1.28;-1.28;-1.28;-1.28	4.92	2.96	0.34315	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.281578	0.34700	N	0.003745	T	0.62097	0.2400	N	0.20483	0.58	0.80722	D	1	P;P;B;P;B	0.50943	0.634;0.94;0.04;0.566;0.019	B;B;B;B;B	0.41332	0.103;0.354;0.011;0.084;0.017	T	0.57991	-0.7715	10	0.28530	T	0.3	.	5.4941	0.16793	0.286:0.6131:0.0:0.1009	.	290;290;226;290;290	Q9BY07-4;E7EQT3;Q9BY07-7;Q9BY07;Q9BY07-3	.;.;.;S4A5_HUMAN;.	Q	290;290;290;226;290;226;290;290;290;290	ENSP00000377587:R290Q;ENSP00000251768:R290Q;ENSP00000352461:R226Q;ENSP00000395804:R290Q;ENSP00000351513:R226Q;ENSP00000350475:R290Q;ENSP00000366859:R290Q;ENSP00000366861:R290Q;ENSP00000405678:R290Q	ENSP00000251768:R290Q	R	-	2	0	SLC4A5	74336566	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.557000	0.60782	1.307000	0.44944	0.655000	0.94253	CGG		0.527	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206583.3		Missense_Mutation
GPAT2	150763	broad.mit.edu	37	2	96688929	96688929	+	Missense_Mutation	SNP	G	G	A	rs201647131	byFrequency	TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:96688929G>A	ENST00000434632.1	-	20	2533	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	GPAT2_ENST00000377137.3_Intron|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.R621C|GPAT2_ENST00000359548.4_Missense_Mutation_p.R692C			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	692					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.R692C(3)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGAGCAGGCGGCAGAGGAAA	0.652																																					p.R692C												.	.	3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)	c.C2074T	2						.						14.0	17.0	16.0					2																	96688929		1816	4045	5861	96052656	SO:0001583	missense	150763	exon19			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2074C>T	2.37:g.96688929G>A	ENSP00000389395:p.Arg692Cys		96052656	NM_207328	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	ENST00000434632.1	37	CCDS42714.1	152	0.0695970695970696	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	101	0.13324538258575197	g	16.45	3.127649	0.56721	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.80480	-1.38;-1.38;-0.41	5.44	5.44	0.79542	.	0.381151	0.27411	N	0.019488	T	0.02727	0.0082	L	0.50333	1.59	0.80722	D	1	P;D;P;B	0.54207	0.584;0.965;0.953;0.354	B;B;B;B	0.42062	0.093;0.374;0.267;0.065	T	0.41840	-0.9486	10	0.66056	D	0.02	-11.9956	16.7485	0.85479	0.0:0.0:1.0:0.0	.	621;698;692;621	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	C	692;692;621	ENSP00000352547:R692C;ENSP00000389395:R692C;ENSP00000393770:R621C	ENSP00000352547:R692C	R	-	1	0	GPAT2	96052656	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.041000	0.49807	2.569000	0.86673	0.637000	0.83480	CGC		0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338786.1	NM_207328	
ABCA12	26154	broad.mit.edu	37	2	215876238	215876238	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr2:215876238G>T	ENST00000272895.7	-	17	2476	c.2257C>A	c.(2257-2259)Cac>Aac	p.H753N	ABCA12_ENST00000389661.4_Missense_Mutation_p.H435N	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	753					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.H753N(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCCTTGGTGTGGTTGCCTTTT	0.368																																					p.H753N	Ovarian(66;664 1488 5121 34295)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2257A	2						.						101.0	106.0	104.0					2																	215876238		2203	4300	6503	215584483	SO:0001583	missense	26154	exon17			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2257C>A	2.37:g.215876238G>T	ENSP00000272895:p.His753Asn		215584483	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144862	0.57044	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.87571	-2.27;-2.26	5.11	5.11	0.69529	.	0.284014	0.30639	N	0.009188	D	0.87200	0.6118	N	0.22421	0.69	0.80722	D	1	D;P	0.63880	0.993;0.735	D;B	0.70227	0.968;0.319	T	0.82824	-0.0266	10	0.11485	T	0.65	.	15.8141	0.78586	0.0:0.0:1.0:0.0	.	753;435	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	753;435	ENSP00000272895:H753N;ENSP00000374312:H435N	ENSP00000272895:H753N	H	-	1	0	ABCA12	215584483	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.024000	0.41049	2.530000	0.85305	0.655000	0.94253	CAC		0.368	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SPATA31E1	286234	broad.mit.edu	37	9	90503556	90503556	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr9:90503556G>A	ENST00000325643.5	+	4	4220	c.4154G>A	c.(4153-4155)gGc>gAc	p.G1385D		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1385					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G1385D(1)									ACCCCCAAGGGCCACCACTGT	0.617																																					p.G1385D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4154A	9						.						56.0	52.0	53.0					9																	90503556		2203	4300	6503	89693376	SO:0001583	missense	286234	exon4			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.4154G>A	9.37:g.90503556G>A	ENSP00000322640:p.Gly1385Asp		89693376	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	g	1.547	-0.540248	0.04053	.	.	ENSG00000177992	ENST00000325643	T	0.03553	3.89	2.05	-0.0152	0.13977	.	1.765340	0.03105	N	0.161626	T	0.03136	0.0092	L	0.38175	1.15	0.09310	N	1	P	0.35745	0.518	B	0.32533	0.147	T	0.40496	-0.9560	10	0.15066	T	0.55	.	2.6183	0.04909	0.1759:0.0:0.5439:0.2802	.	1385	Q6ZUB1	CI079_HUMAN	D	1385	ENSP00000322640:G1385D	ENSP00000322640:G1385D	G	+	2	0	C9orf79	89693376	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	-0.313000	0.08103	-0.010000	0.14271	-0.291000	0.09656	GGC		0.617	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
PCDH9	5101	broad.mit.edu	37	13	67801923	67801923	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr13:67801923G>T	ENST00000377865.2	-	1	784	c.650C>A	c.(649-651)aCc>aAc	p.T217N	PCDH9_ENST00000377861.3_Missense_Mutation_p.T217N|PCDH9_ENST00000544246.1_Missense_Mutation_p.T217N|PCDH9_ENST00000328454.5_Missense_Mutation_p.T217N|PCDH9_ENST00000456367.1_Missense_Mutation_p.T217N			Q9HC56	PCDH9_HUMAN	protocadherin 9	217	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T217N(2)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CATCACATAGGTATCTTTCTG	0.453																																					p.T217N												.	.	2	Substitution - Missense(2)	large_intestine(1)|kidney(1)	c.C650A	13						.						145.0	139.0	141.0					13																	67801923		2203	4300	6503	66699924	SO:0001583	missense	5101	exon2			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.650C>A	13.37:g.67801923G>T	ENSP00000367096:p.Thr217Asn		66699924	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062885	0.36373	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	6.17	5.32	0.75619	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.59128	0.2171	L	0.31065	0.9	0.58432	D	0.999997	B;D;D;D	0.89917	0.392;1.0;1.0;1.0	B;D;D;D	0.85130	0.374;0.995;0.991;0.997	T	0.63862	-0.6541	10	0.72032	D	0.01	.	16.966	0.86286	0.0:0.0:0.8712:0.1288	.	217;217;217;217	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	N	217	ENSP00000442186:T217N;ENSP00000367096:T217N;ENSP00000401699:T217N;ENSP00000332060:T217N;ENSP00000367092:T217N	ENSP00000332060:T217N	T	-	2	0	PCDH9	66699924	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.062000	0.89475	1.607000	0.50170	-0.181000	0.13052	ACC		0.453	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
WDR36	134430	broad.mit.edu	37	5	110428046	110428046	+	Silent	SNP	G	G	T			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:110428046G>T	ENST00000513710.2	+	1	64	c.60G>T	c.(58-60)gtG>gtT	p.V20V	WDR36_ENST00000506538.2_Silent_p.V20V|WDR36_ENST00000505303.1_5'UTR|CTC-551A13.2_ENST00000507269.3_RNA			Q8NI36	WDR36_HUMAN	WD repeat domain 36	20					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.V20V(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CGGAAGCGGTGTTGTGTCTGC	0.587																																					p.V20V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G60T	5						.						75.0	83.0	80.0					5																	110428046		2202	4300	6502	110455945	SO:0001819	synonymous_variant	134430	exon1			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.60G>T	5.37:g.110428046G>T			110455945	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Silent	SNP	ENST00000513710.2	37	CCDS4102.1																																																																																				0.587	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
APC	324	broad.mit.edu	37	5	112178583	112178583	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:112178583G>A	ENST00000457016.1	+	16	7672	c.7292G>A	c.(7291-7293)aGa>aAa	p.R2431K	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.R2431K|APC_ENST00000508376.2_Missense_Mutation_p.R2431K			P25054	APC_HUMAN	adenomatous polyposis coli	2431	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R2431K(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAATCTGATAGATCAGAAAGA	0.363		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R2413K	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|skin(1)	c.G7238A	5						.						72.0	73.0	73.0					5																	112178583		2202	4300	6502	112206482	SO:0001583	missense	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.7292G>A	5.37:g.112178583G>A	ENSP00000413133:p.Arg2431Lys		112206482	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043513	0.36085	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.89875	-2.58;-2.58;-2.58	6.06	5.19	0.71726	Adenomatous polyposis coli protein basic domain (1);	0.089706	0.85682	D	0.000000	D	0.86920	0.6049	L	0.51422	1.61	0.43412	D	0.995558	B;B	0.23735	0.09;0.09	B;B	0.31442	0.089;0.13	T	0.82739	-0.0308	9	.	.	.	-16.5528	15.3394	0.74284	0.0665:0.0:0.9335:0.0	.	2433;2431	Q4LE70;P25054	.;APC_HUMAN	K	2431	ENSP00000413133:R2431K;ENSP00000257430:R2431K;ENSP00000427089:R2431K	.	R	+	2	0	APC	112206482	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	7.842000	0.86851	1.585000	0.49928	-0.136000	0.14681	AGA		0.363	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TRPC7	57113	broad.mit.edu	37	5	135692752	135692752	+	Silent	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:135692752G>A	ENST00000513104.1	-	2	606	c.324C>T	c.(322-324)gaC>gaT	p.D108D	TRPC7_ENST00000426057.2_Silent_p.D108D|TRPC7_ENST00000355180.3_Silent_p.D108D	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	108					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.D108D(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCAGCAGCGCGTCCCCCACCC	0.667																																					p.D108D												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C324T	5						.						56.0	65.0	62.0					5																	135692752		2203	4300	6503	135720651	SO:0001819	synonymous_variant	57113	exon2			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.324C>T	5.37:g.135692752G>A			135720651	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	De_novo_Start_OutOfFrame	SNP	ENST00000513104.1	37	CCDS47267.2	.	.	.	.	.	.	.	.	.	.	G	8.425	0.847192	0.17034	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	5.0	-0.142	0.13448	.	.	.	.	.	T	0.56046	0.1959	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50189	-0.8857	4	.	.	.	-29.7479	9.6183	0.39706	0.5936:0.0:0.4064:0.0	.	.	.	.	C	108	.	.	R	-	1	0	TRPC7	135720651	0.924000	0.31332	0.998000	0.56505	0.988000	0.76386	0.115000	0.15540	0.050000	0.15949	0.561000	0.74099	CGC		0.667	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHA2	56146	broad.mit.edu	37	5	140175915	140175915	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:140175915G>A	ENST00000526136.1	+	1	1366	c.1366G>A	c.(1366-1368)Gca>Aca	p.A456T	PCDHA2_ENST00000520672.2_Missense_Mutation_p.A456T|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.A456T|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	456	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A456T(2)		NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCGGCGTTCGCACAGCCTGA	0.657																																					p.A456T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1366A	5						.						77.0	78.0	77.0					5																	140175915		2203	4300	6503	140156099	SO:0001583	missense	56146	exon1			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1366G>A	5.37:g.140175915G>A	ENSP00000431748:p.Ala456Thr		140156099	NM_018905	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	37	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	4.798	0.148314	0.09134	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.59906	0.23;0.23;0.23	3.98	3.98	0.46160	Cadherin (3);Cadherin-like (1);	0.409515	0.17250	U	0.181211	T	0.26702	0.0653	N	0.01417	-0.88	0.09310	N	1	P;B;P	0.35656	0.514;0.072;0.514	B;B;B	0.29077	0.098;0.079;0.098	T	0.14980	-1.0453	10	0.44086	T	0.13	.	12.6262	0.56630	0.0:0.3099:0.6901:0.0	.	456;456;456	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	T	456	ENSP00000430584:A456T;ENSP00000367372:A456T;ENSP00000431748:A456T	ENSP00000367372:A456T	A	+	1	0	PCDHA2	140156099	0.000000	0.05858	0.977000	0.42913	0.178000	0.23041	-0.575000	0.05861	1.920000	0.55613	0.650000	0.86243	GCA		0.657	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
FAT2	2196	broad.mit.edu	37	5	150932903	150932903	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:150932903G>A	ENST00000261800.5	-	5	4003	c.3991C>T	c.(3991-3993)Cgg>Tgg	p.R1331W		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1331	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R1331W(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATGTGTAGCCGGACACTGGCT	0.572																																					p.R1331W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3991T	5						.						81.0	63.0	69.0					5																	150932903		2203	4300	6503	150913096	SO:0001583	missense	2196	exon5			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3991C>T	5.37:g.150932903G>A	ENSP00000261800:p.Arg1331Trp		150913096	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907779	0.72868	.	.	ENSG00000086570	ENST00000261800	T	0.53206	0.63	5.49	4.54	0.55810	Cadherin (4);Cadherin-like (1);	0.000000	0.53938	D	0.000043	T	0.67988	0.2952	M	0.73598	2.24	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.68232	-0.5463	10	0.41790	T	0.15	.	16.3383	0.83074	0.0:0.0:0.816:0.184	.	1331	Q9NYQ8	FAT2_HUMAN	W	1331	ENSP00000261800:R1331W	ENSP00000261800:R1331W	R	-	1	2	FAT2	150913096	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	3.614000	0.54160	2.583000	0.87209	0.561000	0.74099	CGG		0.572	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
MYO10	4651	broad.mit.edu	37	5	16680134	16680134	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-3909-01	TCGA-AG-3909-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:16680134C>A	ENST00000513610.1	-	33	4918	c.4464G>T	c.(4462-4464)tgG>tgT	p.W1488C	MYO10_ENST00000274203.9_Missense_Mutation_p.W845C|MYO10_ENST00000427430.2_Missense_Mutation_p.W845C|MYO10_ENST00000515803.1_Missense_Mutation_p.W827C|MYO10_ENST00000505695.1_Missense_Mutation_p.W827C	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1488	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.W1488C(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TGGCACTGGACCACCGGGTGG	0.582																																					p.W1488C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4464T	5						.						88.0	88.0	88.0					5																	16680134		2038	4189	6227	16733134	SO:0001583	missense	4651	exon33			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.4464G>T	5.37:g.16680134C>A	ENSP00000421280:p.Trp1488Cys		16733134	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794413	0.90453	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430	D;D;D;D;D	0.99882	-7.48;-7.48;-7.48;-7.48;-7.48	5.46	5.46	0.80206	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	D	0.99910	0.9957	M	0.90977	3.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.96411	0.9304	9	0.87932	D	0	.	19.6953	0.96022	0.0:1.0:0.0:0.0	.	367;1128;1488	B4DIJ5;Q69YP8;Q9HD67	.;.;MYO10_HUMAN	C	1488;827;845;827;845	ENSP00000421280:W1488C;ENSP00000425051:W827C;ENSP00000274203:W845C;ENSP00000421170:W827C;ENSP00000391106:W845C	ENSP00000274203:W845C	W	-	3	0	MYO10	16733134	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.798000	0.85924	2.741000	0.93983	0.655000	0.94253	TGG		0.582	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
PAPD4	167153	broad.mit.edu	37	5	78938706	78938706	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-3909-01	TCGA-AG-3909-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:78938706G>A	ENST00000296783.3	+	8	1023	c.724G>A	c.(724-726)Gtc>Atc	p.V242I	PAPD4_ENST00000453514.1_Missense_Mutation_p.V242I|PAPD4_ENST00000428308.2_Missense_Mutation_p.V242I|PAPD4_ENST00000423041.2_Missense_Mutation_p.V238I|PAPD4_ENST00000504233.1_Missense_Mutation_p.V242I			Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	242					hematopoietic progenitor cell differentiation (GO:0002244)|histone mRNA catabolic process (GO:0071044)|mRNA processing (GO:0006397)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|nuclear RNA-directed RNA polymerase complex (GO:0031380)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)	p.V242I(1)		biliary_tract(1)|breast(2)|endometrium(4)|kidney(3)|large_intestine(9)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)		ACTCACCTTAGTCCATAAACA	0.323																																					p.V242I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G724A	5						.						96.0	85.0	89.0					5																	78938706		2203	4300	6503	78974462	SO:0001583	missense	167153	exon7			AL833136	CCDS4048.1, CCDS75265.1, CCDS75266.1	5q14.1	2014-03-21			ENSG00000164329	ENSG00000164329			26776	protein-coding gene	gene with protein product	"""TUTase2"""	614121				12477932	Standard	NM_173797		Approved	FLJ38499, GLD2, TUT2	uc003kgb.2	Q6PIY7	OTTHUMG00000108163	ENST00000296783.3:c.724G>A	5.37:g.78938706G>A	ENSP00000296783:p.Val242Ile		78974462	NM_001114394	Q86WZ2|Q8N927	Missense_Mutation	SNP	ENST00000296783.3	37	CCDS4048.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.531509	0.45073	.	.	ENSG00000164329	ENST00000453514;ENST00000423041;ENST00000504233;ENST00000428308;ENST00000296783	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.88	5.0	0.66597	.	0.175573	0.49916	D	0.000131	T	0.32376	0.0827	L	0.35723	1.085	0.40164	D	0.977097	B;B;B	0.30406	0.047;0.078;0.278	B;B;B	0.27887	0.018;0.041;0.084	T	0.09773	-1.0659	10	0.13108	T	0.6	-2.9437	15.6317	0.76917	0.0:0.3855:0.6145:0.0	.	242;238;242	Q6PIY7;Q6PIY7-2;D6RAF2	GLD2_HUMAN;.;.	I	242;238;242;242;242	ENSP00000397563:V242I;ENSP00000393412:V238I;ENSP00000421966:V242I;ENSP00000396861:V242I;ENSP00000296783:V242I	ENSP00000296783:V242I	V	+	1	0	PAPD4	78974462	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.958000	0.49145	1.468000	0.48064	-0.291000	0.09656	GTC		0.323	PAPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226967.1	NM_173797	
APC	324	broad.mit.edu	37	5	112173780	112173780	+	Frame_Shift_Del	DEL	T	T	-			TCGA-AG-3909-01	TCGA-AG-3909-01			T	-	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:112173780delT	ENST00000457016.1	+	16	2869	c.2489delT	c.(2488-2490)gtgfs	p.V830fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.V830fs|APC_ENST00000508376.2_Frame_Shift_Del_p.V830fs			P25054	APC_HUMAN	adenomatous polyposis coli	830	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.V830fs*12(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AATACTACAGTGTTACCCAGC	0.393		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.V812fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Unknown(1)|Deletion - Frameshift(1)	large_intestine(1)|skin(1)	c.2435delT	5						.						63.0	64.0	64.0					5																	112173780		2202	4300	6502	112201679	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2489delT	5.37:g.112173780delT	ENSP00000413133:p.Val830fs		112201679	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.393	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175168	112175169	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-AG-3909-01	TCGA-AG-3909-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:112175168_112175169delAC	ENST00000457016.1	+	16	4257_4258	c.3877_3878delAC	c.(3877-3879)acafs	p.T1293fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.T1293fs|APC_ENST00000508376.2_Frame_Shift_Del_p.T1293fs			P25054	APC_HUMAN	adenomatous polyposis coli	1293	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1294fs*6(2)|p.T1293fs*2(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TAATCAGACGACACAGGAAGCA	0.381		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.1275_1275del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	5	Deletion - Frameshift(4)|Unknown(1)	large_intestine(3)|soft_tissue(1)|skin(1)	c.3823_3824del	5						.																																			112203068	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3877_3878delAC	5.37:g.112175170_112175171delAC	ENSP00000413133:p.Thr1293fs		112203067	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.381	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
FAT2	2196	broad.mit.edu	37	5	150946724	150946724	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-3909-01	TCGA-AG-3909-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-3909-01	TCGA-AG-3909-01	g.chr5:150946724T>C	ENST00000261800.5	-	1	1781	c.1769A>G	c.(1768-1770)gAt>gGt	p.D590G		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	590	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D590G(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTCATCCACATCTATGGCTGA	0.418																																					p.D590G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1769G	5						.						95.0	98.0	97.0					5																	150946724		2203	4300	6503	150926917	SO:0001583	missense	2196	exon1			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1769A>G	5.37:g.150946724T>C	ENSP00000261800:p.Asp590Gly		150926917	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	T	19.05	3.751940	0.69533	.	.	ENSG00000086570	ENST00000261800	T	0.61627	0.09	5.75	5.75	0.90469	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000003	D	0.83769	0.5326	H	0.96239	3.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89089	0.3481	10	0.87932	D	0	.	16.0518	0.80769	0.0:0.0:0.0:1.0	.	590	Q9NYQ8	FAT2_HUMAN	G	590	ENSP00000261800:D590G	ENSP00000261800:D590G	D	-	2	0	FAT2	150926917	1.000000	0.71417	0.994000	0.49952	0.896000	0.52359	7.975000	0.88055	2.191000	0.70037	0.533000	0.62120	GAT		0.418	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
