#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MEGF8	1954	broad.mit.edu	37	19	42872754	42872755	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:42872754_42872755insG	ENST00000251268.6	+	36	6421_6422	c.6421_6422insG	c.(6421-6423)tggfs	p.W2141fs	MEGF8_ENST00000378073.4_5'Flank|MEGF8_ENST00000334370.4_Frame_Shift_Ins_p.W2074fs	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2141	PSI 7.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CTGGTGTGCCTGGGGGGGCCAG	0.713																																					p.W2074fs												.	.	0			c.6220_6221insG	19						.																																			47564595	SO:0001589	frameshift_variant	1954	exon35			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.6428dupG	19.37:g.42872761_42872761dupG	ENSP00000251268:p.Trp2141fs		47564594	NM_001410	A8KAY0|O75097	Frame_Shift_Ins	INS	ENST00000251268.6	37																																																																																					0.713	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
ADAM11	4185	broad.mit.edu	37	17	42837125	42837126	+	Frame_Shift_Ins	INS	-	-	G	rs373618121		TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:42837125_42837126insG	ENST00000200557.6	+	2	266_267	c.97_98insG	c.(97-99)tggfs	p.W33fs	ADAM11_ENST00000535346.1_5'UTR	NM_002390.4	NP_002381.2	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11	33					integrin-mediated signaling pathway (GO:0007229)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Prostate(33;0.0959)				AGCTCTGCGATGGGGGGGCTTA	0.663																																					p.W33fs												.	.	0			c.97_98insG	17						.																																			40192652	SO:0001589	frameshift_variant	4185	exon2			D17390	CCDS11486.1	17q21.3	2014-08-12	2005-08-18		ENSG00000073670			"""ADAM metallopeptidase domain containing"""	189	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, cysteine-rich protein"""	155120	"""a disintegrin and metalloproteinase domain 11"""	MDC		8252040	Standard	XM_005257373		Approved		uc002ihh.3	O75078	OTTHUMG00000179038	ENST00000200557.6:c.104dupG	17.37:g.42837132_42837132dupG	ENSP00000200557:p.Trp33fs		40192651	NM_002390	Q14808|Q14809|Q14810	Frame_Shift_Ins	INS	ENST00000200557.6	37	CCDS11486.1																																																																																				0.663	ADAM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444531.1	NM_002390	
CACUL1	143384	broad.mit.edu	37	10	120514109	120514110	+	Frame_Shift_Ins	INS	-	-	C	rs199927390		TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr10:120514109_120514110insC	ENST00000369151.3	-	1	648_649	c.165_166insG	c.(163-168)gggcagfs	p.Q56fs	CACUL1_ENST00000340214.4_Frame_Shift_Ins_p.Q56fs	NM_153810.4	NP_722517.3	Q86Y37	CACL1_HUMAN	CDK2-associated, cullin domain 1	56	Pro-rich.				G1/S transition of mitotic cell cycle (GO:0000082)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase activity (GO:0045860)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)	protein kinase binding (GO:0019901)	p.Q56fs*30(1)									GCCAGCAGCTGCCCCCCCGGAG	0.733																																					p.Q56fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.166_167insG	10						.			20,3416		1,18,1699						3.9	1.0			11	18,7588		0,18,3785	no	frameshift	C10orf46	NM_153810.4		1,36,5484	A1A1,A1R,RR		0.2367,0.5821,0.3441				38,11004				120504100	SO:0001589	frameshift_variant	143384	exon1			AK097728	CCDS41570.1	10q26.13	2012-06-12	2012-06-12	2012-06-12	ENSG00000151893	ENSG00000151893			23727	protein-coding gene	gene with protein product	"""Cdk-Associated Cullin1"""		"""chromosome 10 open reading frame 46"""	C10orf46		19829063	Standard	NM_153810		Approved	FLJ40409, MGC33215, CAC1	uc001lds.1	Q86Y37	OTTHUMG00000019138	ENST00000369151.3:c.166dupG	10.37:g.120514116_120514116dupC	ENSP00000358147:p.Gln56fs		120504099	NM_153810	Q5XPL7|Q8IY11|Q8N7S4	Frame_Shift_Ins	INS	ENST00000369151.3	37	CCDS41570.1																																																																																				0.733	CACUL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050612.2	NM_153810	
SEC14L1	6397	broad.mit.edu	37	17	75209703	75209704	+	Intron	INS	-	-	A	rs138018754	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:75209703_75209704insA	ENST00000413679.2	+	16	2345				SEC14L1_ENST00000436233.4_Intron|SEC14L1_ENST00000585618.1_Intron|SEC14L1_ENST00000431431.2_Intron|SEC14L1_ENST00000392476.2_Intron|SEC14L1_ENST00000591437.1_Intron|SEC14L1_ENST00000443798.4_Intron|SEC14L1_ENST00000430767.4_Intron	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)						transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						GGCCAGGAGGGAGTGGCTTTGG	0.619													A|A|AA|insertion	373	0.0744808	0.0053	0.1571	5008	,	,		17556	0.1042		0.0547	False		,,,				2504	0.0992				.												.	.	0			.	17						.																																			72721299	SO:0001627	intron_variant	6397	.			D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.2042+129->A	17.37:g.75209704_75209704dupA			72721298	.	A8K4E8|B4DDI5|D5G3K1|Q99780	Frame_Shift_Ins	INS	ENST00000413679.2	37	CCDS11752.1																																																																																				0.619	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003	
ZBTB14	7541	broad.mit.edu	37	18	5290595	5290596	+	3'UTR	INS	-	-	A	rs556351591|rs71749678|rs57522202|rs34214240	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr18:5290595_5290596insA	ENST00000357006.4	-	0	1949_1950					NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										attaaaataataaaaaaaaaaa	0.411													|||unknown(HR)	1621	0.323682	0.4024	0.2983	5008	,	,		16149	0.1042		0.3986	False		,,,				2504	0.3845				.												.	.	0			.	18						.																																			5280596	SO:0001624	3_prime_UTR_variant	7541	.			D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.*262->T	18.37:g.5290606_5290606dupA			5280595	.	O00403|Q2TB80	Splice_Site	INS	ENST00000357006.4	37	CCDS11837.1																																																																																				0.411	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409	
GET4	51608	broad.mit.edu	37	7	931981	931981	+	Silent	SNP	G	G	A	rs368468235		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr7:931981G>A	ENST00000265857.3	+	6	766	c.672G>A	c.(670-672)ccG>ccA	p.P224P	GET4_ENST00000407192.1_Silent_p.P171P	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)	224					tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)		p.P224P(1)		breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AGAAGCACCCGTCCATCGAGG	0.557																																					p.P224P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G672A	7						.	G		1,4405	2.1+/-5.4	0,1,2202	81.0	87.0	85.0		672	-5.6	1.0	7		85	0,8600		0,0,4300	no	coding-synonymous	GET4	NM_015949.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		224/328	931981	1,13005	2203	4300	6503	898507	SO:0001819	synonymous_variant	51608	exon6			AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.672G>A	7.37:g.931981G>A			898507	NM_015949	A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	Silent	SNP	ENST00000265857.3	37	CCDS5317.1																																																																																				0.557	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000231930.1	NM_015949	
SDK1	221935	broad.mit.edu	37	7	4272918	4272918	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr7:4272918C>A	ENST00000404826.2	+	41	5998	c.5859C>A	c.(5857-5859)gaC>gaA	p.D1953E	SDK1_ENST00000389531.3_Missense_Mutation_p.D1933E|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1953	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.D1953E(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTGTGAAGGACATCCCGCGGA	0.587																																					p.D1953E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5859A	7						.						94.0	81.0	86.0					7																	4272918		2203	4300	6503	4239444	SO:0001583	missense	221935	exon41			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5859C>A	7.37:g.4272918C>A	ENSP00000385899:p.Asp1953Glu		4239444	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.270518	0.80469	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.56776	0.44;0.44	4.9	4.01	0.46588	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.082111	0.48767	D	0.000171	T	0.55194	0.1905	L	0.35414	1.06	0.31276	N	0.691188	D;D;P;P	0.60160	0.982;0.987;0.932;0.881	P;P;P;B	0.57776	0.769;0.827;0.685;0.42	T	0.60979	-0.7155	10	0.56958	D	0.05	.	12.5734	0.56349	0.0:0.9196:0.0:0.0804	.	1933;13;440;1953	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	E	1953;201;1933	ENSP00000385899:D1953E;ENSP00000374182:D1933E	ENSP00000374182:D1933E	D	+	3	2	SDK1	4239444	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.407000	0.34657	2.252000	0.74401	0.655000	0.94253	GAC		0.587	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
DNAH11	8701	broad.mit.edu	37	7	21727129	21727129	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr7:21727129A>G	ENST00000409508.3	+	34	5939	c.5908A>G	c.(5908-5910)Aga>Gga	p.R1970G	DNAH11_ENST00000328843.6_Missense_Mutation_p.R1977G	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1977	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1977G(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TGATGCCATCAGAAACAGGAA	0.448									Kartagener syndrome																												p.Q1977R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5930G	7						.						54.0	55.0	55.0					7																	21727129		2186	4295	6481	21693654	SO:0001583	missense	8701	exon34	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5908A>G	7.37:g.21727129A>G	ENSP00000475939:p.Arg1970Gly		21693654	NM_003777	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	A	14.49	2.552316	0.45487	.	.	ENSG00000105877	ENST00000328843	T	0.38887	1.11	5.66	3.26	0.37387	ATPase, AAA+ type, core (1);	0.226531	0.46442	D	0.000298	T	0.58380	0.2118	.	.	.	0.48185	D	0.999607	D	0.76494	0.999	D	0.70487	0.969	T	0.56529	-0.7964	9	0.62326	D	0.03	.	7.1537	0.25624	0.6494:0.279:0.0716:0.0	.	1977	Q96DT5	DYH11_HUMAN	G	1977	ENSP00000330671:R1977G	ENSP00000330671:R1977G	R	+	1	2	DNAH11	21693654	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	2.464000	0.45067	0.419000	0.25927	-0.438000	0.05819	AGA		0.448	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
GNGT1	2792	broad.mit.edu	37	7	93540203	93540203	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr7:93540203G>T	ENST00000248572.5	+	3	346	c.198G>T	c.(196-198)gaG>gaT	p.E66D	GNGT1_ENST00000455502.1_3'UTR|GNGT1_ENST00000429473.1_Missense_Mutation_p.E66D	NM_021955.3	NP_068774.1	P63211	GBG1_HUMAN	guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1	66					cardiac muscle cell apoptotic process (GO:0010659)|cellular response to hypoxia (GO:0071456)|eye photoreceptor cell development (GO:0042462)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)	p.E66D(1)		endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	6	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CCTTCAAGGAGCTCAAAGGAG	0.343																																					p.E66D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G198T	7						.						60.0	58.0	58.0					7																	93540203		2203	4300	6503	93378139	SO:0001583	missense	2792	exon3				CCDS5633.1	7q21.3	2008-07-18			ENSG00000127928	ENSG00000127928			4411	protein-coding gene	gene with protein product		189970				8661128	Standard	NM_021955		Approved	GNG1	uc003unc.1	P63211	OTTHUMG00000022908	ENST00000248572.5:c.198G>T	7.37:g.93540203G>T	ENSP00000248572:p.Glu66Asp		93378139	NM_021955	A4D1H2|O43835|Q08447|Q16026|Q6LCP6	Missense_Mutation	SNP	ENST00000248572.5	37	CCDS5633.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116455	0.77323	.	.	ENSG00000127928	ENST00000248572;ENST00000429473	T;T	0.34275	1.37;1.37	5.75	-0.445	0.12242	G-protein gamma domain (5);	0.000000	0.85682	D	0.000000	T	0.52158	0.1717	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.47674	-0.9099	9	0.33141	T	0.24	-33.4741	11.4219	0.49987	0.3907:0.0:0.6093:0.0	.	66	P63211	GBG1_HUMAN	D	66	ENSP00000248572:E66D;ENSP00000388777:E66D	ENSP00000248572:E66D	E	+	3	2	GNGT1	93378139	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	1.723000	0.38053	-0.048000	0.13401	0.655000	0.94253	GAG		0.343	GNGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254718.2	NM_021955	
PDIA4	9601	broad.mit.edu	37	7	148700977	148700977	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr7:148700977T>A	ENST00000286091.4	-	10	2079	c.1847A>T	c.(1846-1848)aAa>aTa	p.K616I		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	616	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)	p.K616I(1)		large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			ACCCTCAAATTTAACTGGGTT	0.522																																					p.K616I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1847T	7						.						72.0	72.0	72.0					7																	148700977		2203	4300	6503	148331910	SO:0001583	missense	9601	exon10			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.1847A>T	7.37:g.148700977T>A	ENSP00000286091:p.Lys616Ile		148331910	NM_004911	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.182398	0.78677	.	.	ENSG00000155660	ENST00000286091	T	0.23950	1.88	5.81	3.47	0.39725	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.043280	0.85682	D	0.000000	T	0.48314	0.1493	M	0.70903	2.155	0.80722	D	1	P	0.38535	0.635	P	0.62491	0.903	T	0.34104	-0.9842	10	0.48119	T	0.1	.	11.2458	0.48996	0.0:0.0928:0.0:0.9072	.	616	P13667	PDIA4_HUMAN	I	616	ENSP00000286091:K616I	ENSP00000286091:K616I	K	-	2	0	PDIA4	148331910	1.000000	0.71417	0.220000	0.23810	0.994000	0.84299	4.868000	0.63021	0.482000	0.27582	0.454000	0.30748	AAA		0.522	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
NINL	22981	broad.mit.edu	37	20	25459760	25459760	+	Missense_Mutation	SNP	C	C	T	rs370541015		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr20:25459760C>T	ENST00000278886.6	-	16	2073	c.2000G>A	c.(1999-2001)cGc>cAc	p.R667H	NINL_ENST00000422516.1_Missense_Mutation_p.R667H	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	667					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)	p.R667H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GCTGACCTCGCGCCTGCGAGC	0.552																																					p.R667H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2000A	20						.	C	HIS/ARG	0,4406		0,0,2203	75.0	72.0	73.0		2000	-6.2	0.0	20		73	1,8599	1.2+/-3.3	0,1,4299	no	missense	NINL	NM_025176.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	667/1383	25459760	1,13005	2203	4300	6503	25407760	SO:0001583	missense	22981	exon16				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2000G>A	20.37:g.25459760C>T	ENSP00000278886:p.Arg667His		25407760	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	C	0.891	-0.725448	0.03158	0.0	1.16E-4	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.29917	1.79;1.55	4.91	-6.24	0.02046	.	2.237540	0.01716	N	0.028024	T	0.13157	0.0319	N	0.03608	-0.345	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.001	T	0.19943	-1.0290	10	0.38643	T	0.18	8.0E-4	7.1438	0.25570	0.247:0.2738:0.0:0.4792	.	667;667	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	H	667	ENSP00000278886:R667H;ENSP00000410431:R667H	ENSP00000278886:R667H	R	-	2	0	NINL	25407760	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.341000	0.07811	-1.576000	0.01652	-0.812000	0.03155	CGC		0.552	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
MYH7B	57644	broad.mit.edu	37	20	33583377	33583378	+	Frame_Shift_Del	DEL	AC	AC	-	rs201712534	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01			AC	-	AC	-	Unknown	Valid	Germline	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr20:33583377_33583378delAC	ENST00000262873.7	+	26	3157_3158	c.3065_3066delAC	c.(3064-3066)aacfs	p.N1022fs		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	980						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GCCACTGAGAACAAGGTGTGGG	0.634																																					p.1022_1022del												.	.	0			c.3065_3066del	20						.																																			33047039	SO:0001589	frameshift_variant	57644	exon28			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3065_3066delAC	20.37:g.33583377_33583378delAC	ENSP00000262873:p.Asn1022fs		33047038	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Frame_Shift_Del	DEL	ENST00000262873.7	37	CCDS42869.1																																																																																				0.634	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
PRKD1	5587	broad.mit.edu	37	14	30068249	30068249	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr14:30068249G>A	ENST00000331968.5	-	15	2379	c.2150C>T	c.(2149-2151)gCt>gTt	p.A717V	PRKD1_ENST00000415220.2_Missense_Mutation_p.A725V	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	717	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.A717D(2)|p.A717V(2)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AAAAGGATCAGCTGAGGCTAG	0.428																																					p.A717V												.	.	4	Substitution - Missense(4)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(2)	c.C2150T	14						.						150.0	149.0	149.0					14																	30068249		2203	4300	6503	29138000	SO:0001583	missense	5587	exon15				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2150C>T	14.37:g.30068249G>A	ENSP00000333568:p.Ala717Val		29138000	NM_002742	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914934	0.72983	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.65549	-0.16;-0.16	5.78	5.78	0.91487	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.061537	0.64402	D	0.000008	T	0.58235	0.2108	L	0.38733	1.17	0.80722	D	1	B	0.22746	0.074	B	0.29524	0.103	T	0.49753	-0.8906	10	0.29301	T	0.29	-12.2893	20.3754	0.98918	0.0:0.0:1.0:0.0	.	717	Q15139	KPCD1_HUMAN	V	717;725	ENSP00000333568:A717V;ENSP00000390535:A725V	ENSP00000333568:A717V	A	-	2	0	PRKD1	29138000	1.000000	0.71417	0.971000	0.41717	0.998000	0.95712	7.882000	0.87258	2.894000	0.99253	0.591000	0.81541	GCT		0.428	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
TDRD9	122402	broad.mit.edu	37	14	104508489	104508489	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr14:104508489G>A	ENST00000409874.4	+	34	3987	c.3939G>A	c.(3937-3939)gcG>gcA	p.A1313A	TDRD9_ENST00000339063.5_Silent_p.A1122A	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	1313					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.A1313A(1)|p.A837A(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				AGAGAGTTGCGCAGCTTCAAG	0.468																																					p.A1313A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3939A	14						.						125.0	115.0	119.0					14																	104508489		2203	4300	6503	103578242	SO:0001819	synonymous_variant	122402	exon34			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.3939G>A	14.37:g.104508489G>A			103578242	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Silent	SNP	ENST00000409874.4	37	CCDS9987.2	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.319602	0.01320	.	.	ENSG00000156414	ENST00000557332	T	0.07114	3.22	4.5	-8.99	0.00751	.	0.483083	0.16726	U	0.202043	T	0.04407	0.0121	.	.	.	0.36944	D	0.892513	.	.	.	.	.	.	T	0.35525	-0.9785	6	.	.	.	.	0.5805	0.00711	0.3832:0.1232:0.2191:0.2745	.	.	.	.	T	849	ENSP00000451637:A849T	.	A	+	1	0	TDRD9	103578242	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-2.868000	0.00722	-2.066000	0.00886	-1.261000	0.01458	GCA		0.468	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
ZDHHC8	29801	broad.mit.edu	37	22	20128426	20128426	+	Missense_Mutation	SNP	C	C	T	rs548919026		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr22:20128426C>T	ENST00000334554.7	+	7	926	c.785C>T	c.(784-786)gCg>gTg	p.A262V	ZDHHC8_ENST00000320602.7_Missense_Mutation_p.A170V|ZDHHC8_ENST00000405930.3_Missense_Mutation_p.A262V|ZDHHC8_ENST00000468112.1_3'UTR	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	262					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.A262V(1)		breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CTGCCGCTCGCGGTGAGTTTG	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		15183	0.0		0.001	False		,,,				2504	0.0				p.A262V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C785T	22						.						42.0	46.0	45.0					22																	20128426		2202	4300	6502	18508426	SO:0001583	missense	29801	exon7			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.785C>T	22.37:g.20128426C>T	ENSP00000334490:p.Ala262Val		18508426	NM_013373	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	C	6.849	0.525939	0.13066	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.72394	1.34;-0.65;1.33	5.08	4.05	0.47172	.	829.068000	0.00166	N	0.000001	T	0.62865	0.2463	N	0.20685	0.6	0.09310	N	1	P;B;B	0.35774	0.519;0.132;0.005	B;B;B	0.32022	0.139;0.027;0.003	T	0.59511	-0.7441	10	0.51188	T	0.08	.	14.9631	0.71171	0.0:0.8564:0.1436:0.0	.	170;262;262	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	V	262;170;262	ENSP00000334490:A262V;ENSP00000317804:A170V;ENSP00000384716:A262V	ENSP00000317804:A170V	A	+	2	0	ZDHHC8	18508426	0.008000	0.16893	0.002000	0.10522	0.020000	0.10135	1.211000	0.32382	1.253000	0.44018	0.655000	0.94253	GCG		0.642	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318564.1	NM_013373	
CABIN1	23523	broad.mit.edu	37	22	24494116	24494116	+	Missense_Mutation	SNP	G	G	A	rs568317451		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr22:24494116G>A	ENST00000398319.2	+	26	4463	c.4078G>A	c.(4078-4080)Gtc>Atc	p.V1360I	CABIN1_ENST00000405822.2_Intron|CABIN1_ENST00000263119.5_Missense_Mutation_p.V1360I	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1360					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.V1360I(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CCACGATTACGTCAAATGTAA	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		8441	0.0		0.001	False		,,,				2504	0.0				p.V1360I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4078A	22						.						91.0	87.0	88.0					22																	24494116		2203	4300	6503	22824116	SO:0001583	missense	23523	exon26			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4078G>A	22.37:g.24494116G>A	ENSP00000381364:p.Val1360Ile		22824116	NM_001199281	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	ENST00000398319.2	37	CCDS13823.1	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860141	0.32884	.	.	ENSG00000099991	ENST00000263119;ENST00000398319	T;T	0.61742	0.08;0.08	4.77	2.63	0.31362	.	0.245918	0.41712	N	0.000821	T	0.38931	0.1059	L	0.31294	0.92	0.80722	D	1	B	0.26258	0.145	B	0.14023	0.01	T	0.17137	-1.0379	10	0.25751	T	0.34	.	8.778	0.34774	0.249:0.0:0.751:0.0	.	1360	Q9Y6J0	CABIN_HUMAN	I	1360	ENSP00000263119:V1360I;ENSP00000381364:V1360I	ENSP00000263119:V1360I	V	+	1	0	CABIN1	22824116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.868000	0.63021	1.159000	0.42565	0.650000	0.86243	GTC		0.627	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320161.2	NM_012295	
SGTA	6449	broad.mit.edu	37	19	2767633	2767633	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:2767633T>C	ENST00000221566.2	-	3	313	c.152A>G	c.(151-153)gAc>gGc	p.D51G		NM_003021.3	NP_003012.1	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha	51					viral process (GO:0016032)	cytoplasm (GO:0005737)		p.D51G(1)		endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGCGCAAGGTCACTGTCTTC	0.602																																					p.D51G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A152G	19						.						66.0	56.0	60.0					19																	2767633		2203	4300	6503	2718633	SO:0001583	missense	6449	exon3			AJ223828	CCDS12094.1	19p13	2013-01-10	2003-11-24	2003-11-26		ENSG00000104969		"""Tetratricopeptide (TTC) repeat domain containing"""	10819	protein-coding gene	gene with protein product		603419	"""small glutamine-rich tetratricopeptide repeat (TPR)-containing"""	SGT		9740675, 12735788	Standard	NM_003021		Approved		uc002lwi.1	O43765		ENST00000221566.2:c.152A>G	19.37:g.2767633T>C	ENSP00000221566:p.Asp51Gly		2718633	NM_003021	D6W610|Q6FIA9|Q9BTZ9	Missense_Mutation	SNP	ENST00000221566.2	37	CCDS12094.1	.	.	.	.	.	.	.	.	.	.	T	1.796	-0.478235	0.04414	.	.	ENSG00000104969	ENST00000221566	T	0.37058	1.22	4.36	2.21	0.28008	.	0.310538	0.35903	N	0.002904	T	0.23133	0.0559	L	0.33485	1.01	0.27324	N	0.95696	B	0.02656	0.0	B	0.01281	0.0	T	0.13980	-1.0489	10	0.27785	T	0.31	-3.422	7.3208	0.26526	0.0:0.1997:0.0:0.8003	.	51	O43765	SGTA_HUMAN	G	51	ENSP00000221566:D51G	ENSP00000221566:D51G	D	-	2	0	SGTA	2718633	0.240000	0.23847	0.045000	0.18777	0.012000	0.07955	0.716000	0.25836	0.547000	0.28938	0.402000	0.26972	GAC		0.602	SGTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451448.2	NM_003021	
ZNF536	9745	broad.mit.edu	37	19	31039805	31039805	+	Silent	SNP	C	C	T	rs147863190		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:31039805C>T	ENST00000355537.3	+	4	3426	c.3279C>T	c.(3277-3279)agC>agT	p.S1093S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1093					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.S1093S(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGCAGAAGAGCGGTGCATGGA	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		18334	0.001		0.0	False		,,,				2504	0.0				p.S1093S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3279T	19						.	C		0,4406		0,0,2203	75.0	85.0	81.0		3279	-4.1	0.0	19	dbSNP_134	81	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF536	NM_014717.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1093/1301	31039805	1,13005	2203	4300	6503	35731645	SO:0001819	synonymous_variant	9745	exon4				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3279C>T	19.37:g.31039805C>T			35731645	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	37	CCDS32984.1																																																																																				0.537	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
FCGBP	8857	broad.mit.edu	37	19	40392360	40392360	+	Missense_Mutation	SNP	G	G	A	rs200977347	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:40392360G>A	ENST00000221347.6	-	16	8151	c.8144C>T	c.(8143-8145)gCa>gTa	p.A2715V		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2715						extracellular vesicular exosome (GO:0070062)		p.A2715V(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCTCCAGCTGCCTGGCAAGC	0.587													G|||	1248	0.249201	0.1619	0.3876	5008	,	,		13881	0.1935		0.33	False		,,,				2504	0.2434				p.A2715V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C8144T	19						.						5.0	6.0	6.0					19																	40392360		1980	3956	5936	45084200	SO:0001583	missense	8857	exon16			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.8144C>T	19.37:g.40392360G>A	ENSP00000221347:p.Ala2715Val		45084200	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082846	0.36758	.	.	ENSG00000090920	ENST00000221347	T	0.77620	-1.11	2.58	-0.163	0.13363	Uncharacterised domain, cysteine-rich (2);	0.292022	0.32244	N	0.006362	D	0.82323	0.5012	M	0.76574	2.34	0.23331	N	0.997894	D	0.76494	0.999	D	0.79108	0.992	T	0.69347	-0.5169	10	0.33940	T	0.23	.	5.3676	0.16123	0.0:0.1728:0.3161:0.5111	.	2715	Q9Y6R7	FCGBP_HUMAN	V	2715	ENSP00000221347:A2715V	ENSP00000221347:A2715V	A	-	2	0	FCGBP	45084200	0.000000	0.05858	0.984000	0.44739	0.668000	0.39293	-0.272000	0.08560	0.383000	0.24910	0.298000	0.19748	GCA		0.587	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
MEGF8	1954	broad.mit.edu	37	19	42880528	42880528	+	Silent	SNP	C	C	T	rs199681302	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:42880528C>T	ENST00000251268.6	+	42	8139	c.8139C>T	c.(8137-8139)tcC>tcT	p.S2713S	MEGF8_ENST00000378073.4_Silent_p.S307S|MEGF8_ENST00000334370.4_Silent_p.S2646S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2713					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)	p.S2254S(1)|p.S2646S(1)|p.S2713S(1)		breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCCCGGCCTCCGCCTGGAAGC	0.711													C|||	15	0.00299521	0.0	0.0	5008	,	,		12807	0.0		0.001	False		,,,				2504	0.0143				p.S2646S												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C7938T	19						.	C		2,4394		0,2,2196	28.0	28.0	28.0		7938	-6.7	0.0	19		28	1,8587		0,1,4293	no	coding-synonymous	MEGF8	NM_001410.2		0,3,6489	TT,TC,CC		0.0116,0.0455,0.0231		2646/2779	42880528	3,12981	2198	4294	6492	47572368	SO:0001819	synonymous_variant	1954	exon41			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.8139C>T	19.37:g.42880528C>T			47572368	NM_001410	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																					0.711	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
TSKS	60385	broad.mit.edu	37	19	50248605	50248605	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:50248605C>T	ENST00000246801.3	-	7	1123	c.1041G>A	c.(1039-1041)gcG>gcA	p.A347A	TSKS_ENST00000358830.3_Silent_p.A147A	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	347					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)	p.A347A(1)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		CTTCCTGCACCGCCCCCTCCT	0.706																																					p.A347A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1041A	19						.						11.0	12.0	12.0					19																	50248605		2194	4282	6476	54940417	SO:0001819	synonymous_variant	60385	exon7			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1041G>A	19.37:g.50248605C>T			54940417	NM_021733	Q8WXJ0	Silent	SNP	ENST00000246801.3	37	CCDS12780.1																																																																																				0.706	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465795.1	NM_021733	
NLRP5	126206	broad.mit.edu	37	19	56538575	56538575	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr19:56538575C>T	ENST00000390649.3	+	7	976	c.976C>T	c.(976-978)Cgg>Tgg	p.R326W		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	326	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.R326W(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AGAGATGCAGCGGAAGAAGGA	0.567																																					p.R326W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C976T	19						.						38.0	40.0	39.0					19																	56538575		2072	4209	6281	61230387	SO:0001583	missense	126206	exon7			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.976C>T	19.37:g.56538575C>T	ENSP00000375063:p.Arg326Trp		61230387	NM_153447	A8MTY4|Q86W29	Missense_Mutation	SNP	ENST00000390649.3	37	CCDS12938.1	.	.	.	.	.	.	.	.	.	.	C	4.088	0.014253	0.07959	.	.	ENSG00000171487	ENST00000390649	T	0.80653	-1.4	3.35	-6.71	0.01760	NACHT nucleoside triphosphatase (1);	2.741520	0.01259	N	0.009110	T	0.60996	0.2312	N	0.11131	0.1	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.56294	-0.8003	10	0.28530	T	0.3	.	6.5283	0.22312	0.1102:0.6213:0.1113:0.1572	.	326	P59047	NALP5_HUMAN	W	326	ENSP00000375063:R326W	ENSP00000375063:R326W	R	+	1	2	NLRP5	61230387	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.882000	0.04174	-3.381000	0.00175	-0.812000	0.03155	CGG		0.567	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313735.1	NM_153447	
ANGPT1	284	broad.mit.edu	37	8	108264121	108264121	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr8:108264121G>A	ENST00000520734.1	-	8	1144	c.859C>T	c.(859-861)Cgt>Tgt	p.R287C	ANGPT1_ENST00000520052.1_Missense_Mutation_p.R286C|ANGPT1_ENST00000518386.1_5'UTR|AP000428.1_ENST00000390706.1_RNA			Q15389	ANGP1_HUMAN	angiopoietin 1	487	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)	p.R487C(1)		NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			GTTGTGGAACGTAAGGAGTAA	0.433																																					p.R487C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1459T	8						.						190.0	175.0	180.0					8																	108264121		2203	4300	6503	108333297	SO:0001583	missense	284	exon9			D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.859C>T	8.37:g.108264121G>A	ENSP00000430750:p.Arg287Cys		108333297	NM_001146	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	37		.	.	.	.	.	.	.	.	.	.	G	21.2	4.111864	0.77210	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520734;ENST00000520052	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.9	5.9	0.94986	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.046380	0.85682	D	0.000000	T	0.64080	0.2566	M	0.88512	2.96	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67725	0.953;0.953	T	0.69316	-0.5177	10	0.87932	D	0	.	20.2768	0.98488	0.0:0.0:1.0:0.0	.	487;487	Q5HYA0;Q15389	.;ANGP1_HUMAN	C	487;486;287;286	ENSP00000428340:R487C;ENSP00000297450:R486C;ENSP00000430750:R287C;ENSP00000429349:R286C	ENSP00000297450:R486C	R	-	1	0	ANGPT1	108333297	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	9.869000	0.99810	2.808000	0.96608	0.650000	0.86243	CGT		0.433	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
NRBP2	340371	broad.mit.edu	37	8	144919461	144919461	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr8:144919461C>G	ENST00000442628.2	-	13	1226	c.1087G>C	c.(1087-1089)Gtc>Ctc	p.V363L	NRBP2_ENST00000327830.5_Missense_Mutation_p.V120L	NM_178564.3	NP_848659.2			nuclear receptor binding protein 2									p.V369L(1)		central_nervous_system(2)|kidney(1)|large_intestine(2)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ATGAAGGAGACTTCCGAGTAC	0.642																																					p.V363L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1087C	8						.						31.0	30.0	30.0					8																	144919461		2203	4299	6502	144991449	SO:0001583	missense	340371	exon13			BC037396	CCDS34959.1, CCDS34959.2	8q24.3	2005-01-24							19339	protein-coding gene	gene with protein product		615563				14702039	Standard	NM_178564		Approved	DKFZp434P086	uc011lkt.2	Q9NSY0		ENST00000442628.2:c.1087G>C	8.37:g.144919461C>G	ENSP00000414055:p.Val363Leu		144991449	NM_178564		Missense_Mutation	SNP	ENST00000442628.2	37	CCDS34959.2	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434912	0.25813	.	.	ENSG00000185189	ENST00000442628;ENST00000327830	T;T	0.20598	2.06;2.06	4.63	2.82	0.32997	.	0.254816	0.31963	U	0.006788	T	0.17831	0.0428	M	0.72118	2.19	0.39649	D	0.970436	B;P;B;B	0.42941	0.058;0.794;0.141;0.005	B;B;B;B	0.36030	0.029;0.216;0.073;0.006	T	0.06197	-1.0840	10	0.32370	T	0.25	-22.9627	4.3967	0.11367	0.177:0.6293:0.0:0.1937	.	363;155;155;120	Q9NSY0;Q9NSY0-4;Q9NSY0-2;D3DWK9	NRBP2_HUMAN;.;.;.	L	363;120	ENSP00000414055:V363L;ENSP00000330271:V120L	ENSP00000330271:V120L	V	-	1	0	NRBP2	144991449	0.952000	0.32445	0.760000	0.31359	0.802000	0.45316	2.560000	0.45896	0.406000	0.25560	0.579000	0.79373	GTC		0.642	NRBP2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382247.1	NM_178564	
PDPN	10630	broad.mit.edu	37	1	13940872	13940872	+	Missense_Mutation	SNP	G	G	A	rs377220172		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:13940872G>A	ENST00000509009.1	+	5	477	c.433G>A	c.(433-435)Gtt>Att	p.V145I	PDPN_ENST00000376061.4_Missense_Mutation_p.V108I|PDPN_ENST00000513143.1_Missense_Mutation_p.V108I|PDPN_ENST00000487038.1_Missense_Mutation_p.V108I|PDPN_ENST00000475043.1_Missense_Mutation_p.V108I|PDPN_ENST00000376057.4_Missense_Mutation_p.V226I|PDPN_ENST00000294489.6_Missense_Mutation_p.V226I					podoplanin									p.V226I(1)		endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		TGCAATCATCGTTGTGGTTAT	0.423																																					p.V108I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A	1						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	199.0	186.0	191.0		676,676,322,322	-6.1	0.0	1		191	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	PDPN	NM_198389.2,NM_006474.4,NM_001006625.1,NM_001006624.1	29,29,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	226/237,226/239,108/119,108/121	13940872	1,13005	2203	4300	6503	13813459	SO:0001583	missense	10630	exon5			AB127958, AY194238	CCDS30602.1, CCDS41266.1, CCDS44060.1, CCDS53270.1	1p36.21	2008-02-05			ENSG00000162493	ENSG00000162493			29602	protein-coding gene	gene with protein product	"""lung type I cell membrane associated glycoprotein"""	608863				10393083, 9651190	Standard	NM_006474		Approved	T1A-2, Gp38, aggrus, GP40, PA2.26	uc001avd.3	Q86YL7	OTTHUMG00000007912	ENST00000509009.1:c.433G>A	1.37:g.13940872G>A	ENSP00000422977:p.Val145Ile		13813459	NM_001006624		Missense_Mutation	SNP	ENST00000509009.1	37		.	.	.	.	.	.	.	.	.	.	G	2.798	-0.249812	0.05867	0.0	1.16E-4	ENSG00000162493	ENST00000294489;ENST00000376057;ENST00000510906;ENST00000509009;ENST00000376061;ENST00000513143;ENST00000487038;ENST00000475043	T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.93	-6.13	0.02118	.	0.570455	0.17214	N	0.182609	T	0.05227	0.0139	N	0.01228	-0.945	0.09310	N	1	B;B;B;B	0.18013	0.003;0.003;0.025;0.025	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.25916	-1.0118	10	0.02654	T	1	-5.211	9.4694	0.38833	0.2042:0.0:0.0712:0.7247	.	150;108;226;226	Q86YL7;E9PB68;Q86YL7-3;Q86YL7-4	PDPN_HUMAN;.;.;.	I	226;226;217;145;108;108;108;108	ENSP00000294489:V226I;ENSP00000365225:V226I;ENSP00000426302:V217I;ENSP00000422977:V145I;ENSP00000365229:V108I;ENSP00000425304:V108I;ENSP00000427537:V108I;ENSP00000426063:V108I	ENSP00000294489:V226I	V	+	1	0	PDPN	13813459	0.002000	0.14202	0.000000	0.03702	0.897000	0.52465	-1.148000	0.03185	-1.453000	0.01928	-0.302000	0.09304	GTT		0.423	PDPN-009	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367736.1	NM_006474	
FLG2	388698	broad.mit.edu	37	1	152324672	152324672	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:152324672G>T	ENST00000388718.5	-	3	5662	c.5590C>A	c.(5590-5592)Cag>Aag	p.Q1864K	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1864					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q1864K(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGGACTGTCCATGACCA	0.488																																					p.Q1864K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5590A	1						.						331.0	289.0	303.0					1																	152324672		2203	4300	6503	150591296	SO:0001583	missense	388698	exon3			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5590C>A	1.37:g.152324672G>T	ENSP00000373370:p.Gln1864Lys		150591296	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963415	0.53507	.	.	ENSG00000143520	ENST00000388718	T	0.06768	3.26	4.05	4.05	0.47172	.	.	.	.	.	T	0.05593	0.0147	M	0.70595	2.14	0.09310	N	1	P	0.47034	0.889	B	0.41036	0.346	T	0.19418	-1.0306	9	0.34782	T	0.22	-3.8616	12.0493	0.53498	0.0:0.0:1.0:0.0	.	1864	Q5D862	FILA2_HUMAN	K	1864	ENSP00000373370:Q1864K	ENSP00000373370:Q1864K	Q	-	1	0	FLG2	150591296	0.022000	0.18835	0.013000	0.15412	0.007000	0.05969	0.256000	0.18351	2.292000	0.77174	0.549000	0.68633	CAG		0.488	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
MNDA	4332	broad.mit.edu	37	1	158813175	158813175	+	Silent	SNP	G	G	A	rs144118208		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:158813175G>A	ENST00000368141.4	+	3	633	c.372G>A	c.(370-372)tcG>tcA	p.S124S		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	124					B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S124S(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					AACTGACATCGGAAGCAAGAG	0.463													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17411	0.0		0.0	False		,,,				2504	0.0				p.S124S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G372A	1						.	G		1,4405		0,1,2202	60.0	53.0	56.0		372	-1.9	0.0	1	dbSNP_134	56	0,8600		0,0,4300	no	coding-synonymous	MNDA	NM_002432.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		124/408	158813175	1,13005	2203	4300	6503	157079799	SO:0001819	synonymous_variant	4332	exon3			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.372G>A	1.37:g.158813175G>A			157079799	NM_002432		Silent	SNP	ENST00000368141.4	37	CCDS1177.1																																																																																				0.463	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059069.1	NM_002432	
OR10J3	441911	broad.mit.edu	37	1	159284400	159284400	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:159284400A>G	ENST00000332217.5	-	1	49	c.50T>C	c.(49-51)tTc>tCc	p.F17S		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F17S(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GAAGCTGGAGAAACCTTCAAA	0.423																																					p.F17S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T50C	1						.						168.0	176.0	174.0					1																	159284400		2203	4300	6503	157551024	SO:0001583	missense	441911	exon1				CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.50T>C	1.37:g.159284400A>G	ENSP00000331789:p.Phe17Ser		157551024	NM_001004467		Missense_Mutation	SNP	ENST00000332217.5	37	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.146323	0.57044	.	.	ENSG00000196266	ENST00000332217	T	0.00551	6.65	5.13	3.99	0.46301	.	.	.	.	.	T	0.01695	0.0054	H	0.96633	3.855	0.22961	N	0.998502	D	0.89917	1.0	D	0.91635	0.999	T	0.39623	-0.9605	9	0.87932	D	0	.	9.6165	0.39694	0.8437:0.0:0.0:0.1563	.	17	Q5JRS4	O10J3_HUMAN	S	17	ENSP00000331789:F17S	ENSP00000331789:F17S	F	-	2	0	OR10J3	157551024	0.144000	0.22641	0.901000	0.35422	0.875000	0.50365	2.913000	0.48790	0.943000	0.37553	0.459000	0.35465	TTC		0.423	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1		
PADI6	353238	broad.mit.edu	37	1	17722085	17722085	+	RNA	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:17722085G>A	ENST00000434762.2	+	0	1595							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.R514Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AAACTGTTCCGAGAGAAACAG	0.527																																					p.P515P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1545A	1						.						26.0	28.0	27.0					1																	17722085		2020	4223	6243	17594672			353238	exon13			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17722085G>A			17594672	NM_207421	Q330K5|Q70SX3	Missense_Mutation	SNP	ENST00000434762.2	37																																																																																					0.527	PADI6-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000006804.4	NM_207421	
TBX19	9095	broad.mit.edu	37	1	168260608	168260608	+	Silent	SNP	T	T	A			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:168260608T>A	ENST00000367821.3	+	2	465	c.414T>A	c.(412-414)gcT>gcA	p.A138A		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	138					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A138A(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					GGATGAAAGCTCCCATCTCCT	0.632																																					p.A138A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T414A	1						.						88.0	98.0	94.0					1																	168260608		2203	4300	6503	166527232	SO:0001819	synonymous_variant	9095	exon2			AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.414T>A	1.37:g.168260608T>A			166527232	NM_005149	Q52M53	Silent	SNP	ENST00000367821.3	37	CCDS1272.1	.	.	.	.	.	.	.	.	.	.	T	8.633	0.894102	0.17613	.	.	ENSG00000143178	ENST00000431969	.	.	.	5.51	-11.0	0.00169	.	.	.	.	.	T	0.02649	0.0080	.	.	.	.	.	.	.	.	.	.	.	.	T	0.11060	-1.0603	3	.	.	.	.	1.7295	0.02928	0.1888:0.3294:0.2058:0.276	.	.	.	.	T	71	.	.	S	+	1	0	TBX19	166527232	0.000000	0.05858	0.033000	0.17914	0.938000	0.57974	-2.871000	0.00720	-3.546000	0.00143	-1.219000	0.01604	TCC		0.632	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
AXDND1	126859	broad.mit.edu	37	1	179364244	179364244	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:179364244T>A	ENST00000367618.3	+	11	1403	c.1016T>A	c.(1015-1017)cTa>cAa	p.L339Q	AXDND1_ENST00000461179.2_3'UTR|AXDND1_ENST00000457238.2_Missense_Mutation_p.L339Q	NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	339								p.L339Q(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						GAACTGTGTCTAGTTCGGGCA	0.338																																					p.L339Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1016A	1						.						111.0	122.0	118.0					1																	179364244		2203	4300	6503	177630867	SO:0001583	missense	126859	exon11			BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.1016T>A	1.37:g.179364244T>A	ENSP00000356590:p.Leu339Gln		177630867	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	T	11.98	1.799845	0.31869	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000457238;ENST00000434088	T;T;T	0.41065	2.31;1.01;2.34	5.65	5.65	0.86999	.	0.572784	0.18470	N	0.140258	T	0.48169	0.1485	L	0.35414	1.06	0.24922	N	0.991973	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.994	T	0.36553	-0.9743	10	0.15499	T	0.54	-19.2927	9.1732	0.37096	0.1622:0.0:0.0:0.8378	.	297;339;339	E9PCJ4;Q5T1B0;F5GWM2	.;AXDN1_HUMAN;.	Q	339;297;339;273	ENSP00000356590:L339Q;ENSP00000416712:L339Q;ENSP00000391716:L273Q	ENSP00000353471:L297Q	L	+	2	0	AXDND1	177630867	0.940000	0.31905	1.000000	0.80357	0.980000	0.70556	2.064000	0.41432	2.142000	0.66516	0.533000	0.62120	CTA		0.338	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
NCF2	4688	broad.mit.edu	37	1	183529276	183529276	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:183529276C>T	ENST00000367535.3	-	14	1674	c.1423G>A	c.(1423-1425)Gac>Aac	p.D475N	NCF2_ENST00000367536.1_Missense_Mutation_p.D475N|NCF2_ENST00000418089.1_Missense_Mutation_p.D394N|NCF2_ENST00000413720.1_Missense_Mutation_p.D430N|NCF2_ENST00000469280.1_5'Flank	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	475	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)	p.D475N(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	AACTCCAGGTCCTCTGGTTGG	0.428																																					p.D430N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1288A	1						.						198.0	193.0	195.0					1																	183529276		2203	4300	6503	181795899	SO:0001583	missense	4688	exon13			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.1423G>A	1.37:g.183529276C>T	ENSP00000356505:p.Asp475Asn		181795899	NM_001190794	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	ENST00000367535.3	37	CCDS1356.1	.	.	.	.	.	.	.	.	.	.	C	32	5.145310	0.94603	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.45	5.45	0.79879	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.81418	0.4818	H	0.94771	3.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.86585	0.1856	10	0.87932	D	0	-2.5811	19.2883	0.94087	0.0:1.0:0.0:0.0	.	394;430;475	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	N	475;547;430;394;475	ENSP00000356506:D475N;ENSP00000399294:D430N;ENSP00000407217:D394N;ENSP00000356505:D475N	ENSP00000356505:D475N	D	-	1	0	NCF2	181795899	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	6.511000	0.73733	2.555000	0.86185	0.655000	0.94253	GAC		0.428	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085483.1	NM_000433	
BRINP3	339479	broad.mit.edu	37	1	190067895	190067895	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:190067895G>A	ENST00000367462.3	-	8	1785	c.1554C>T	c.(1552-1554)gaC>gaT	p.D518D	BRINP3_ENST00000534846.1_Silent_p.D416D	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	518					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.D518D(1)									TGAGGCGCATGTCATTGCTGA	0.443																																					p.D518D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1554T	1						.						147.0	140.0	142.0					1																	190067895		2203	4300	6503	188334518	SO:0001819	synonymous_variant	339479	exon8			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1554C>T	1.37:g.190067895G>A			188334518	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	CCDS1373.1																																																																																				0.443	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
ADORA1	134	broad.mit.edu	37	1	203134704	203134704	+	Silent	SNP	C	C	T	rs201016113		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:203134704C>T	ENST00000367236.4	+	3	1578	c.657C>T	c.(655-657)tcC>tcT	p.S219S	ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000472535.1_3'UTR|ADORA1_ENST00000337894.4_Silent_p.S219S|ADORA1_ENST00000309502.3_Silent_p.S219S	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor	219					activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)	p.S219S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	CGGCCTCCTCCGGCGACCCGC	0.582																																					p.S219S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C657T	1						.						130.0	118.0	122.0					1																	203134704		2203	4300	6503	201401327	SO:0001819	synonymous_variant	134	exon3			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.657C>T	1.37:g.203134704C>T			201401327	NM_001048230	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	Missense_Mutation	SNP	ENST00000367236.4	37	CCDS1434.1																																																																																				0.582	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100273.1	NM_000674	
TGFB2	7042	broad.mit.edu	37	1	218609481	218609481	+	Silent	SNP	T	T	C			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:218609481T>C	ENST00000366930.4	+	5	1391	c.924T>C	c.(922-924)taT>taC	p.Y308Y	TGFB2_ENST00000366929.4_Silent_p.Y336Y|TGFB2_ENST00000479322.1_3'UTR	NM_003238.3	NP_003229.1	P61812	TGFB2_HUMAN	transforming growth factor, beta 2	308					activation of protein kinase activity (GO:0032147)|angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cardioblast differentiation (GO:0010002)|cartilage condensation (GO:0001502)|catagen (GO:0042637)|cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|collagen fibril organization (GO:0030199)|dopamine biosynthetic process (GO:0042416)|embryo development (GO:0009790)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|face morphogenesis (GO:0060325)|generation of neurons (GO:0048699)|glial cell migration (GO:0008347)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hemopoiesis (GO:0030097)|menstrual cycle phase (GO:0022601)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|neuron development (GO:0048666)|neuron fate commitment (GO:0048663)|neutrophil chemotaxis (GO:0030593)|odontogenesis (GO:0042476)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activation-induced cell death of T cells (GO:0070237)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of catagen (GO:0051795)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of gene expression (GO:0010628)|positive regulation of heart contraction (GO:0045823)|positive regulation of immune response (GO:0050778)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of ossification (GO:0045778)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein secretion (GO:0050714)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of transforming growth factor beta2 production (GO:0032909)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to progesterone (GO:0032570)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|signal transduction by phosphorylation (GO:0023014)|SMAD protein import into nucleus (GO:0007184)|somatic stem cell division (GO:0048103)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	axon (GO:0030424)|endosome (GO:0005768)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|platelet alpha granule lumen (GO:0031093)	beta-amyloid binding (GO:0001540)|cytokine activity (GO:0005125)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor binding (GO:0005160)|type II transforming growth factor beta receptor binding (GO:0005114)	p.Y308Y(1)|p.Y336Y(1)		breast(1)|endometrium(1)|large_intestine(11)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(1)	31				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		ATGCGGCCTATTGCTTTAGGT	0.448																																					p.Y308Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T924C	1						.						75.0	71.0	73.0					1																	218609481		2203	4300	6503	216676104	SO:0001819	synonymous_variant	7042	exon5			M19154	CCDS1521.1, CCDS44318.1	1q41	2014-01-30			ENSG00000092969	ENSG00000092969		"""Endogenous ligands"""	11768	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-2"""	190220					Standard	NM_003238		Approved		uc001hln.3	P61812	OTTHUMG00000039521	ENST00000366930.4:c.924T>C	1.37:g.218609481T>C			216676104	NM_003238	B4DKC5|P08112|Q15579|Q15581|Q4VAV9	Silent	SNP	ENST00000366930.4	37	CCDS1521.1																																																																																				0.448	TGFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095359.2	NM_003238	
PTPRU	10076	broad.mit.edu	37	1	29587280	29587280	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:29587280G>A	ENST00000345512.3	+	7	1138	c.1009G>A	c.(1009-1011)Gtc>Atc	p.V337I	PTPRU_ENST00000323874.8_Missense_Mutation_p.V337I|PTPRU_ENST00000373779.3_Missense_Mutation_p.V337I|PTPRU_ENST00000428026.2_Missense_Mutation_p.V337I|PTPRU_ENST00000356870.3_Missense_Mutation_p.V337I|PTPRU_ENST00000460170.2_Missense_Mutation_p.V337I	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	337	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.V337I(2)		breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GGTGCACGCCGTCAGCCTGCA	0.657																																					p.V337I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1009A	1						.						63.0	60.0	61.0					1																	29587280		2203	4300	6503	29459867	SO:0001583	missense	10076	exon7			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1009G>A	1.37:g.29587280G>A	ENSP00000334941:p.Val337Ile		29459867	NM_005704	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	ENST00000345512.3	37	CCDS334.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659797	0.67586	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37	5.22	5.22	0.72569	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000003	T	0.56978	0.2022	M	0.83312	2.635	0.58432	D	0.999998	B;B;B;B;B	0.28552	0.179;0.179;0.179;0.215;0.215	B;B;B;B;B	0.21360	0.02;0.02;0.02;0.034;0.034	T	0.58222	-0.7674	9	.	.	.	.	17.7715	0.88494	0.0:0.0:1.0:0.0	.	337;337;337;337;337	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	I	337	ENSP00000334941:V337I;ENSP00000362884:V337I;ENSP00000349333:V337I;ENSP00000314987:V337I;ENSP00000392332:V337I;ENSP00000432906:V337I	.	V	+	1	0	PTPRU	29459867	1.000000	0.71417	0.998000	0.56505	0.451000	0.32288	9.860000	0.99555	2.418000	0.82041	0.462000	0.41574	GTC		0.657	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010447.1		
CSMD2	114784	broad.mit.edu	37	1	34164354	34164354	+	Splice_Site	SNP	G	G	A	rs543673574	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:34164354G>A	ENST00000373380.1	-	3	763	c.543C>T	c.(541-543)gtC>gtT	p.V181V	CSMD2_ENST00000373381.4_Splice_Site_p.V1308V|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1268	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V1268V(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCCTCCTACCGACACAGGTGG	0.612													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18447	0.0		0.0	False		,,,				2504	0.0				p.V1268V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3804T	1						.						58.0	60.0	59.0					1																	34164354		2203	4300	6503	33936941	SO:0001630	splice_region_variant	114784	exon24			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.544+1C>T	1.37:g.34164354G>A			33936941	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373380.1	37																																																																																					0.612	CSMD2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000030635.4	NM_052896	Silent
ZMYM1	79830	broad.mit.edu	37	1	35570063	35570063	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:35570063C>T	ENST00000373330.1	+	6	761	c.587C>T	c.(586-588)aCt>aTt	p.T196I	ZMYM1_ENST00000359858.4_Missense_Mutation_p.T196I|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	196						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.T196I(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TGCCAGAAGACTGCTATTGTA	0.328																																					p.T196I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C587T	1						.						65.0	60.0	62.0					1																	35570063		1844	4106	5950	35342650	SO:0001583	missense	79830	exon5			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.587C>T	1.37:g.35570063C>T	ENSP00000362427:p.Thr196Ile		35342650	NM_024772	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	37	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622304	0.28889	.	.	ENSG00000197056	ENST00000417119;ENST00000359858;ENST00000373329;ENST00000373330	T;T;T;T	0.18174	2.23;2.5;2.24;2.5	4.86	1.78	0.24846	TRASH (1);	0.387955	0.22770	N	0.055843	T	0.14527	0.0351	L	0.53249	1.67	0.21861	N	0.999503	B;B	0.26195	0.138;0.144	B;B	0.25987	0.065;0.022	T	0.18147	-1.0346	10	0.59425	D	0.04	-6.1195	4.6926	0.12788	0.3189:0.4965:0.0:0.1846	.	196;196	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	I	196;196;121;196	ENSP00000394233:T196I;ENSP00000352920:T196I;ENSP00000362426:T121I;ENSP00000362427:T196I	ENSP00000352920:T196I	T	+	2	0	ZMYM1	35342650	0.998000	0.40836	0.748000	0.31131	0.844000	0.47949	1.582000	0.36568	0.770000	0.33336	-0.150000	0.13652	ACT		0.328	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772	
DAB1	1600	broad.mit.edu	37	1	57602312	57602312	+	Silent	SNP	G	G	A	rs143307821		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:57602312G>A	ENST00000371231.1	-	3	244	c.210C>T	c.(208-210)ggC>ggT	p.G70G	DAB1_ENST00000414851.2_Silent_p.G70G|DAB1_ENST00000439789.2_Silent_p.G70G|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371236.2_Silent_p.G70G|DAB1_ENST00000420954.2_Silent_p.G70G|DAB1_ENST00000371230.1_Silent_p.G70G|DAB1_ENST00000371234.4_Silent_p.G70G			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	70	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)		p.G70G(2)		central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						CAGCAACAACGCCCTGTTGAA	0.408																																					p.G70G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C210T	1						.	G		0,4406		0,0,2203	61.0	60.0	60.0		210	-2.6	1.0	1	dbSNP_134	60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DAB1	NM_021080.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		70/556	57602312	1,13005	2203	4300	6503	57374900	SO:0001819	synonymous_variant	1600	exon6			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.210C>T	1.37:g.57602312G>A			57374900	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37																																																																																					0.408	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
MYSM1	114803	broad.mit.edu	37	1	59156062	59156062	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:59156062C>T	ENST00000472487.1	-	4	285	c.246G>A	c.(244-246)ccG>ccA	p.P82P	MYSM1_ENST00000493821.1_5'Flank	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	82					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.P82P(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					AGACTTTTTCCGGTTGTGATT	0.249																																					p.P82P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G246A	1						.						70.0	63.0	65.0					1																	59156062		1781	4054	5835	58928650	SO:0001819	synonymous_variant	114803	exon4			AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.246G>A	1.37:g.59156062C>T			58928650	NM_001085487	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Silent	SNP	ENST00000472487.1	37	CCDS41343.1																																																																																				0.249	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026343.2	XM_055481	
ERICH3	127254	broad.mit.edu	37	1	75139186	75139186	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:75139186G>A	ENST00000326665.5	-	1	236	c.18C>T	c.(16-18)ccC>ccT	p.P6P		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		6								p.P6P(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTTACCCAGCGGGGTGAGAAT	0.672																																					p.P6P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C18T	1						.						67.0	63.0	65.0					1																	75139186		2203	4300	6503	74911774	SO:0001819	synonymous_variant	127254	exon1																														ENST00000326665.5:c.18C>T	1.37:g.75139186G>A			74911774	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	37	CCDS30755.1																																																																																				0.672	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
TRIM67	440730	broad.mit.edu	37	1	231344894	231344894	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr1:231344894G>T	ENST00000366653.5	+	8	2021	c.2021G>T	c.(2020-2022)aGc>aTc	p.S674I	TRIM67_ENST00000449018.3_Missense_Mutation_p.S612I|TRIM67_ENST00000444294.3_Missense_Mutation_p.S672I|TRIM67_ENST00000366652.2_Missense_Mutation_p.S674I			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	674	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)	p.S674I(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GCCAGGGCCAGCGTGGTCAAG	0.622																																					p.S674I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2021T	1						.						86.0	94.0	91.0					1																	231344894		2195	4298	6493	229411517	SO:0001583	missense	440730	exon8			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2021G>T	1.37:g.231344894G>T	ENSP00000355613:p.Ser674Ile		229411517	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	ENST00000366653.5	37	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618192	0.66787	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.73	3.7	0.42460	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.135532	0.64402	D	0.000004	T	0.67608	0.2911	L	0.32530	0.975	0.40037	D	0.975607	B	0.30634	0.288	B	0.40038	0.317	T	0.63862	-0.6541	10	0.51188	T	0.08	.	2.2842	0.04122	0.3901:0.2934:0.3166:0.0	.	674	Q6ZTA4	TRI67_HUMAN	I	672;674;612;674	ENSP00000412124:S672I;ENSP00000355612:S674I;ENSP00000400163:S612I;ENSP00000355613:S674I	ENSP00000355612:S674I	S	+	2	0	TRIM67	229411517	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.539000	0.82063	0.754000	0.32968	0.655000	0.94253	AGC		0.622	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
UBASH3B	84959	broad.mit.edu	37	11	122672021	122672021	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:122672021A>T	ENST00000284273.5	+	11	1951	c.1576A>T	c.(1576-1578)Agt>Tgt	p.S526C		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	526	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.S526C(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		AGCCAACCTGAGTGTTGATAC	0.517																																					p.S526C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1576T	11						.						152.0	141.0	145.0					11																	122672021		2202	4299	6501	122177231	SO:0001583	missense	84959	exon11			AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1576A>T	11.37:g.122672021A>T	ENSP00000284273:p.Ser526Cys		122177231	NM_032873	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	37	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	A	16.76	3.211427	0.58343	.	.	ENSG00000154127	ENST00000284273	T	0.72615	-0.67	5.47	4.27	0.50696	Histidine phosphatase superfamily, clade-1 (1);	0.038489	0.85682	D	0.000000	T	0.60971	0.2310	L	0.32530	0.975	0.58432	D	0.999997	B	0.26902	0.163	B	0.32211	0.142	T	0.62487	-0.6844	10	0.52906	T	0.07	-3.9306	11.0744	0.48023	0.8612:0.0:0.0:0.1388	.	526	Q8TF42	UBS3B_HUMAN	C	526	ENSP00000284273:S526C	ENSP00000284273:S526C	S	+	1	0	UBASH3B	122177231	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.273000	0.51623	2.058000	0.61347	0.533000	0.62120	AGT		0.517	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873	
OR52B4	143496	broad.mit.edu	37	11	4388604	4388604	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:4388604A>C	ENST00000408920.2	-	1	1012	c.922T>G	c.(922-924)Ttt>Gtt	p.F308V		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	308					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F308V(1)		NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATAAACAAAAACTGAACCACC	0.408																																					p.F308V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T922G	11						.						45.0	45.0	45.0					11																	4388604		1848	4088	5936	4345180	SO:0001583	missense	143496	exon1			AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.922T>G	11.37:g.4388604A>C	ENSP00000386160:p.Phe308Val		4345180	NM_001005161	A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	37	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	A	4.474	0.087778	0.08583	.	.	ENSG00000221996	ENST00000408920	T	0.35421	1.31	5.17	-5.42	0.02640	.	2.593500	0.01875	N	0.037463	T	0.15262	0.0368	N	0.10645	0.015	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14559	-1.0468	10	0.11182	T	0.66	.	4.862	0.13588	0.3075:0.2822:0.0:0.4103	.	308	Q8NGK2	O52B4_HUMAN	V	308	ENSP00000386160:F308V	ENSP00000386160:F308V	F	-	1	0	OR52B4	4345180	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.100000	0.00604	-0.957000	0.03627	-0.418000	0.06021	TTT		0.408	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
NAT10	55226	broad.mit.edu	37	11	34156800	34156801	+	Missense_Mutation	DNP	CT	CT	TC			TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:34156800_34156801CT>TC	ENST00000257829.3	+	19	2196_2197	c.1990_1991CT>TC	c.(1990-1992)CTt>TCt	p.L664S	NAT10_ENST00000531159.2_Missense_Mutation_p.L592S|NAT10_ENST00000527971.1_Intron	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	664	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)	p.L664>?(1)		endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GGAAAAGGTCCTTGAGACACCA	0.51																																					.												.	.	1	Complex(1)	large_intestine(1)	c.1774_1775TC	11						.																																			34113377	SO:0001583	missense	55226	exon17			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	Exception_encountered	11.37:g.34156800_34156801delinsTC	ENSP00000257829:p.Leu664Ser		34113376	NM_001144030	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	DNP	ENST00000257829.3	37	CCDS7889.1																																																																																				0.510	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
OR5B21	219968	broad.mit.edu	37	11	58274728	58274728	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:58274728G>A	ENST00000360374.2	-	1	850	c.851C>T	c.(850-852)cCc>cTc	p.P284L		NM_001005218.1	NP_001005218.1	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B, member 21	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P284L(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTATATCAAGGGATTCAGCAT	0.418																																					p.P284L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C851T	11						.						148.0	145.0	146.0					11																	58274728		2201	4295	6496	58031304	SO:0001583	missense	219968	exon1				CCDS31552.1	11q12.1	2012-08-09			ENSG00000198283	ENSG00000198283		"""GPCR / Class A : Olfactory receptors"""	19616	protein-coding gene	gene with protein product							Standard	NM_001005218		Approved		uc010rki.2	A6NL26	OTTHUMG00000167519	ENST00000360374.2:c.851C>T	11.37:g.58274728G>A	ENSP00000353537:p.Pro284Leu		58031304	NM_001005218		Missense_Mutation	SNP	ENST00000360374.2	37	CCDS31552.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622855	0.66901	.	.	ENSG00000198283	ENST00000360374	T	0.63417	-0.04	5.11	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36703	U	0.002444	D	0.83216	0.5206	H	0.94964	3.605	0.51767	D	0.999935	D	0.76494	0.999	D	0.76071	0.987	D	0.87195	0.2237	10	0.87932	D	0	-10.3482	12.1723	0.54165	0.083:0.0:0.9169:0.0	.	284	A6NL26	OR5BL_HUMAN	L	284	ENSP00000353537:P284L	ENSP00000353537:P284L	P	-	2	0	OR5B21	58031304	1.000000	0.71417	0.102000	0.21198	0.979000	0.70002	7.729000	0.84864	1.371000	0.46172	0.655000	0.94253	CCC		0.418	OR5B21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394891.1	NM_001005218	
OR5A1	219982	broad.mit.edu	37	11	59210836	59210836	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:59210836C>T	ENST00000302030.2	+	1	220	c.195C>T	c.(193-195)ttC>ttT	p.F65F		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F65F(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						TGTACTTCTTCCTAAGCAACT	0.483																																					p.F65F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C195T	11						.						156.0	151.0	152.0					11																	59210836		2201	4295	6496	58967412	SO:0001819	synonymous_variant	219982	exon1			AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.195C>T	11.37:g.59210836C>T			58967412	NM_001004728	B9EH58|Q6IFF2|Q96RB1	Silent	SNP	ENST00000302030.2	37	CCDS31561.1																																																																																				0.483	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728	
OR5A1	219982	broad.mit.edu	37	11	59211280	59211280	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:59211280G>A	ENST00000302030.2	+	1	664	c.639G>A	c.(637-639)tcG>tcA	p.S213S		NM_001004728.1	NP_001004728.1	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A, member 1	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S213S(2)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	28						GAGGAACATCGTTCCTCCAAC	0.547																																					p.S213S												.	.	2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	c.G639A	11						.						224.0	209.0	214.0					11																	59211280		2201	4295	6496	58967856	SO:0001819	synonymous_variant	219982	exon1			AB065804	CCDS31561.1	11q12.1	2012-08-09			ENSG00000172320	ENSG00000172320		"""GPCR / Class A : Olfactory receptors"""	8319	protein-coding gene	gene with protein product				OR5A1P			Standard	NM_001004728		Approved	OST181	uc001nnx.1	Q8NGJ0	OTTHUMG00000167339	ENST00000302030.2:c.639G>A	11.37:g.59211280G>A			58967856	NM_001004728	B9EH58|Q6IFF2|Q96RB1	Silent	SNP	ENST00000302030.2	37	CCDS31561.1																																																																																				0.547	OR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394233.1	NM_001004728	
ESRRA	2101	broad.mit.edu	37	11	64083421	64083421	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:64083421G>A	ENST00000405666.1	+	7	1489	c.1255G>A	c.(1255-1257)Gag>Aag	p.E419K	PRDX5_ENST00000265462.4_5'Flank|ESRRA_ENST00000406310.1_Missense_Mutation_p.E418K|PRDX5_ENST00000352435.4_5'Flank|PRDX5_ENST00000347941.4_5'Flank|ESRRA_ENST00000000442.6_Missense_Mutation_p.E419K	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	419	AF-2 domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.E419K(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GGAGATGCTCGAGGCCATGAT	0.642																																					p.E419K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1255A	11						.						36.0	38.0	38.0					11																	64083421		2013	4172	6185	63839997	SO:0001583	missense	2101	exon7			X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.1255G>A	11.37:g.64083421G>A	ENSP00000384851:p.Glu419Lys		63839997	NM_004451	Q14514	Missense_Mutation	SNP	ENST00000405666.1	37	CCDS41667.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611047	0.66558	.	.	ENSG00000173153	ENST00000406310;ENST00000000442;ENST00000405666	T;T;T	0.36520	1.25;1.25;1.25	4.58	4.58	0.56647	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	T	0.59932	0.2230	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.78314	0.922;0.991	T	0.64605	-0.6368	10	0.87932	D	0	.	15.2562	0.73588	0.0:0.0:1.0:0.0	.	418;419	P11474-2;P11474	.;ERR1_HUMAN	K	418;419;419	ENSP00000385971:E418K;ENSP00000000442:E419K;ENSP00000384851:E419K	ENSP00000000442:E419K	E	+	1	0	ESRRA	63839997	1.000000	0.71417	0.994000	0.49952	0.914000	0.54420	9.587000	0.98229	2.554000	0.86153	0.561000	0.74099	GAG		0.642	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451	
OPCML	4978	broad.mit.edu	37	11	132290088	132290088	+	Nonstop_Mutation	SNP	C	C	G			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr11:132290088C>G	ENST00000331898.7	-	7	1615	c.1037G>C	c.(1036-1038)tGa>tCa	p.*346S	OPCML_ENST00000541867.1_Nonstop_Mutation_p.*355S|OPCML_ENST00000524381.1_Nonstop_Mutation_p.*339S|OPCML_ENST00000374778.4_Nonstop_Mutation_p.*305S|OPCML_ENST00000529038.1_5'UTR	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	0					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)	p.*346S(1)		endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GATTTCTTATCAAAACTTGAT	0.488																																					p.X339S												.	.	1	Nonstop extension(1)	large_intestine(1)	c.G1016C	11						.						94.0	87.0	89.0					11																	132290088		2201	4297	6498	131795298	SO:0001578	stop_lost	4978	exon8			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.1037G>C	11.37:g.132290088C>G			131795298	NM_001012393	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Read-through	SNP	ENST00000331898.7	37	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931083	0.92389	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.20196	N	0.999925	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8403	0.85967	0.0:1.0:0.0:0.0	.	.	.	.	S	346;339;305;313;355	.	.	X	-	2	2	OPCML	131795298	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.621000	0.61233	2.504000	0.84457	0.563000	0.77884	TGA		0.488	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
FAM184A	79632	broad.mit.edu	37	6	119337983	119337983	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr6:119337983C>A	ENST00000338891.7	-	5	1902	c.1459G>T	c.(1459-1461)Gct>Tct	p.A487S	RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000368475.4_Missense_Mutation_p.A367S|FAM184A_ENST00000522284.1_Missense_Mutation_p.A367S|FAM184A_ENST00000352896.5_Missense_Mutation_p.A367S|FAM184A_ENST00000521531.1_Missense_Mutation_p.A487S	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	487						extracellular space (GO:0005615)		p.A487S(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TGCTTCCAAGCTAATTCTTCC	0.358																																					p.A487S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1459T	6						.						137.0	130.0	132.0					6																	119337983		1828	4086	5914	119379682	SO:0001583	missense	79632	exon5			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1459G>T	6.37:g.119337983C>A	ENSP00000342604:p.Ala487Ser		119379682	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	37	CCDS43499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.47|14.47	2.544693|2.544693	0.45280|0.45280	.|.	.|.	ENSG00000111879|ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284|ENST00000448815	T;T;T;T;T|.	0.00333|.	8.07;8.07;8.07;8.07;8.07|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.193514|.	0.44902|.	D|.	0.000405|.	T|.	0.40094|.	0.1103|.	L|L	0.27053|0.27053	0.805|0.805	0.47276|0.47276	D|D	0.999372|0.999372	B;B;B|.	0.32365|.	0.312;0.084;0.367|.	B;B;B|.	0.28232|.	0.064;0.028;0.087|.	T|.	0.30966|.	-0.9960|.	10|.	0.12430|.	T|.	0.62|.	-6.2951|-6.2951	13.6357|13.6357	0.62221|0.62221	0.155:0.845:0.0:0.0|0.155:0.845:0.0:0.0	.|.	487;367;487|.	Q8NB25-2;F8W8D6;Q8NB25|.	.;.;F184A_HUMAN|.	S|Y	487;367;367;487;367|72	ENSP00000342604:A487S;ENSP00000326608:A367S;ENSP00000357460:A367S;ENSP00000430442:A487S;ENSP00000429826:A367S|.	ENSP00000342604:A487S|.	A|X	-|-	1|3	0|2	FAM184A|FAM184A	119379682|119379682	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.227000|3.227000	0.51262|0.51262	2.433000|2.433000	0.82419|0.82419	0.491000|0.491000	0.48974|0.48974	GCT|TAG		0.358	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
C4B	721	broad.mit.edu	37	6	31995115	31995115	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr6:31995115T>C	ENST00000435363.2	+	21	2779	c.2695T>C	c.(2695-2697)Ttc>Ctc	p.F899L	C4B_ENST00000425700.2_Missense_Mutation_p.F899L	NM_001002029.3	NP_001002029.3	P0C0L5	CO4B_HUMAN	complement component 4B (Chido blood group)	899					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|detection of molecule of bacterial origin (GO:0032490)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|complement binding (GO:0001848)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	GCCTGTTGCCTTCTCTGTGGT	0.677																																					p.F899L												.	.	0			c.T2695C	6						.						5.0	13.0	11.0					6																	31995115		644	1682	2326	32103093	SO:0001583	missense	721	exon21			AF019413	CCDS47405.1	6p21.3	2014-09-17	2009-01-06		ENSG00000224389	ENSG00000224389		"""Blood group antigens"", ""Complement system"""	1324	protein-coding gene	gene with protein product		120820	"""complement component 4B"""				Standard	NM_001002029		Approved	CPAMD3, C4F, CO4, C4B1, C4B3, CH	uc011jpm.2	P0C0L5	OTTHUMG00000031187	ENST00000435363.2:c.2695T>C	6.37:g.31995115T>C	ENSP00000415941:p.Phe899Leu		32103093	NM_007293	A2BHY4|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q6U2E9|Q6U2G1|Q6U2I5|Q6U2L1|Q6U2L7|Q6U2L9|Q6U2M5|Q6VCV8|Q96SA7|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	ENST00000435363.2	37	CCDS47405.1	.	.	.	.	.	.	.	.	.	.	t	25.0	4.589608	0.86851	.	.	ENSG00000224389	ENST00000435363;ENST00000425700	T;T	0.46063	0.88;0.88	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.50446	0.1616	M	0.65975	2.015	0.51012	D	0.9999	D;P	0.89917	1.0;0.723	D;P	0.83275	0.996;0.465	T	0.56679	-0.7939	10	0.72032	D	0.01	.	10.1615	0.42855	0.0:0.0:0.0:1.0	.	899;899	F5GXS0;Q6U2E9	.;.	L	899	ENSP00000415941:F899L;ENSP00000391933:F899L	ENSP00000391933:F899L	F	+	1	0	C4B	32103093	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	2.934000	0.48956	1.638000	0.50547	0.456000	0.33151	TTC		0.677	C4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076368.5	NM_001002029	
PLG	5340	broad.mit.edu	37	6	161155034	161155034	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr6:161155034G>A	ENST00000308192.9	+	13	1658	c.1595G>A	c.(1594-1596)cGt>cAt	p.R532H		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	532	Kringle 5. {ECO:0000255|PROSITE- ProRule:PRU00121}.		R -> H (in PLGD). {ECO:0000269|PubMed:10233898}.		blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R532H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CAGTACTGCCGTAACCCTGAT	0.498																																					p.R532H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1595A	6	GRCh37	CM991052	PLG	M		.						219.0	154.0	176.0					6																	161155034		2203	4300	6503	161075024	SO:0001583	missense	5340	exon13			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1595G>A	6.37:g.161155034G>A	ENSP00000308938:p.Arg532His		161075024	NM_000301	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	.	17.22	3.332901	0.60853	.	.	ENSG00000122194	ENST00000308192	D	0.93906	-3.31	3.98	3.98	0.46160	Kringle (4);Kringle-like fold (1);Kringle, conserved site (1);	0.000000	0.34110	U	0.004247	D	0.95999	0.8697	H	0.98802	4.335	0.58432	D	0.999998	P	0.43024	0.798	P	0.44990	0.466	D	0.97234	0.9886	10	0.87932	D	0	.	13.0592	0.58997	0.0:0.0:1.0:0.0	.	532	P00747	PLMN_HUMAN	H	532	ENSP00000308938:R532H	ENSP00000308938:R532H	R	+	2	0	PLG	161075024	1.000000	0.71417	0.677000	0.29947	0.220000	0.24768	5.951000	0.70273	2.037000	0.60232	0.462000	0.41574	CGT		0.498	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
MPRIP	23164	broad.mit.edu	37	17	17077244	17077244	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:17077244C>T	ENST00000341712.4	+	18	2444	c.2444C>T	c.(2443-2445)tCg>tTg	p.S815L	MPRIP_ENST00000444976.1_Missense_Mutation_p.S777L|RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000395804.3_Missense_Mutation_p.S815L|MPRIP_ENST00000395811.5_Missense_Mutation_p.S815L			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	815	Interaction with RHOA.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.S815L(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						GAGCTGCAGTCGGTGCAGCGG	0.657																																					p.S815L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2444T	17						.						56.0	52.0	53.0					17																	17077244		2202	4300	6502	17017969	SO:0001583	missense	23164	exon18			BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2444C>T	17.37:g.17077244C>T	ENSP00000342379:p.Ser815Leu		17017969	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	37	CCDS32578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.143078|5.143078	0.94560|0.94560	.|.	.|.	ENSG00000133030|ENSG00000133030	ENST00000414263|ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712;ENST00000429184	.|T;T;T;T	.|0.26373	.|1.74;1.74;1.74;1.74	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.208516	.|0.42420	.|D	.|0.000719	T|T	0.50463|0.50463	0.1617|0.1617	M|M	0.66939|0.66939	2.045|2.045	0.58432|0.58432	D|D	0.999994|0.999994	.|D;D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.996;0.999	.|P;D;D;D;D	.|0.73380	.|0.908;0.98;0.92;0.941;0.954	T|T	0.22347|0.22347	-1.0219|-1.0219	5|10	.|0.25751	.|T	.|0.34	-22.84|-22.84	20.0263|20.0263	0.97523|0.97523	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|814;777;1179;815;815	.|B9EGI2;Q6WCQ1-3;Q9Y6X7;Q6WCQ1-2;Q6WCQ1	.|.;.;.;.;MPRIP_HUMAN	W|L	881|777;815;815;815;11	.|ENSP00000400189:S777L;ENSP00000379156:S815L;ENSP00000379149:S815L;ENSP00000342379:S815L	.|ENSP00000342379:S815L	R|S	+|+	1|2	2|0	MPRIP|MPRIP	17017969|17017969	1.000000|1.000000	0.71417|0.71417	0.975000|0.975000	0.42487|0.42487	0.794000|0.794000	0.44872|0.44872	6.044000|6.044000	0.71012|0.71012	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	CGG|TCG		0.657	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
TEFM	79736	broad.mit.edu	37	17	29231161	29231161	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:29231161G>A	ENST00000581216.1	-	2	1039	c.418C>T	c.(418-420)Cgg>Tgg	p.R140W	TEFM_ENST00000580840.1_Missense_Mutation_p.R140W	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial	140					DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)	p.R140W(2)									CTTTTTTCCCGTCCAGTCTTT	0.378																																					p.R140W												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C418T	17						.						68.0	62.0	64.0					17																	29231161		1815	4081	5896	26255287	SO:0001583	missense	79736	exon2				CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.418C>T	17.37:g.29231161G>A	ENSP00000462963:p.Arg140Trp		26255287	NM_024683	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	Missense_Mutation	SNP	ENST00000581216.1	37	CCDS42291.1	.	.	.	.	.	.	.	.	.	.	G	4.013	-0.000170	0.07819	.	.	ENSG00000172171	ENST00000306049;ENST00000541382	.	.	.	5.68	-5.78	0.02362	.	1.107800	0.06616	N	0.756446	T	0.18045	0.0433	L	0.29908	0.895	0.09310	N	1	P;P;P	0.52842	0.926;0.956;0.926	B;B;B	0.39152	0.153;0.292;0.182	T	0.38436	-0.9661	9	0.66056	D	0.02	-9.3796	8.1614	0.31201	0.0:0.237:0.2013:0.5617	.	140;140;140	B4DPU1;Q96QE5-4;Q96QE5	.;.;TEFM_HUMAN	W	140	.	ENSP00000306574:R140W	R	-	1	2	C17orf42	26255287	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.255000	0.18333	-0.748000	0.04753	-1.552000	0.00895	CGG		0.378	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444498.1	NM_024683	
AOC3	8639	broad.mit.edu	37	17	41004707	41004707	+	Silent	SNP	G	G	A	rs115107156	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:41004707G>A	ENST00000308423.2	+	1	1507	c.1347G>A	c.(1345-1347)tcG>tcA	p.S449S	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	449					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)	p.S449S(2)		breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	ATCTCTACTCGCACTACTTTG	0.542													G|||	4	0.000798722	0.003	0.0	5008	,	,		19486	0.0		0.0	False		,,,				2504	0.0				p.S449S	NSCLC(3;192 220 10664 11501 16477)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1347A	17						.	G		11,4395	17.9+/-39.9	0,11,2192	124.0	110.0	114.0		1347	-4.8	0.0	17	dbSNP_132	114	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	AOC3	NM_003734.2		0,12,6491	AA,AG,GG		0.0116,0.2497,0.0923		449/764	41004707	12,12994	2203	4300	6503	38258233	SO:0001819	synonymous_variant	8639	exon1			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1347G>A	17.37:g.41004707G>A			38258233	NM_003734	B2RCI5|K7ESB3|L0L8N9|Q45F94	Silent	SNP	ENST00000308423.2	37	CCDS11444.1																																																																																				0.542	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452444.1	NM_003734	
AXIN2	8313	broad.mit.edu	37	17	63554543	63554543	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:63554543C>T	ENST00000375702.5	-	1	304	c.196G>A	c.(196-198)Gag>Aag	p.E66K	AXIN2_ENST00000307078.5_Missense_Mutation_p.E66K|CTD-2535L24.2_ENST00000577662.1_3'UTR			Q9Y2T1	AXIN2_HUMAN	axin 2	66					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.E66K(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GCCCGCCCCTCCGGCTCCCCC	0.612									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.E66K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G196A	17						.						64.0	66.0	65.0					17																	63554543		2203	4300	6503	60985005	SO:0001583	missense	8313	exon2	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.196G>A	17.37:g.63554543C>T	ENSP00000364854:p.Glu66Lys		60985005	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	37		.	.	.	.	.	.	.	.	.	.	C	12.95	2.090795	0.36855	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.79247	-0.39;-1.25;-0.39	4.74	3.77	0.43336	.	0.055186	0.64402	D	0.000001	D	0.86994	0.6067	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	D	0.87005	0.2119	10	0.52906	T	0.07	-25.8748	11.8019	0.52133	0.0:0.9127:0.0:0.0873	.	66;66;66	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	K	66	ENSP00000302625:E66K;ENSP00000441151:E66K;ENSP00000364854:E66K	ENSP00000302625:E66K	E	-	1	0	AXIN2	60985005	1.000000	0.71417	0.901000	0.35422	0.831000	0.47069	7.667000	0.83888	0.980000	0.38523	0.561000	0.74099	GAG		0.612	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
CD300C	10871	broad.mit.edu	37	17	72539113	72539113	+	Silent	SNP	T	T	C			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:72539113T>C	ENST00000330793.1	-	3	774	c.414A>G	c.(412-414)acA>acG	p.T138T		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	138	Pro-rich.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.T138T(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						GGCTGGAGGCTGTGGTCGTCC	0.592																																					p.T138T	Esophageal Squamous(66;421 1121 20537 25337 27468)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A414G	17						.						117.0	101.0	106.0					17																	72539113		2203	4300	6503	70050708	SO:0001819	synonymous_variant	10871	exon3			BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.414A>G	17.37:g.72539113T>C			70050708	NM_006678		Silent	SNP	ENST00000330793.1	37	CCDS11701.1																																																																																				0.592	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
ZBTB4	57659	broad.mit.edu	37	17	7366544	7366544	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:7366544G>C	ENST00000311403.4	-	4	2096	c.1757C>G	c.(1756-1758)aCa>aGa	p.T586R	ZBTB4_ENST00000380599.4_Missense_Mutation_p.T586R	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	586					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)	p.T586R(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		GCCAGCCCCTGTGGGGGGACC	0.657																																					p.T586R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1757G	17						.						12.0	14.0	13.0					17																	7366544		2202	4295	6497	7307268	SO:0001583	missense	57659	exon4			AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.1757C>G	17.37:g.7366544G>C	ENSP00000307858:p.Thr586Arg		7307268	NM_020899	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	ENST00000311403.4	37	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	G	1.127	-0.653614	0.03480	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.03920	3.76;3.76	4.87	1.66	0.24008	.	0.872989	0.09942	N	0.735822	T	0.03348	0.0097	N	0.22421	0.69	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.43065	-0.9414	10	0.32370	T	0.25	-0.2593	3.6784	0.08301	0.2697:0.1965:0.5337:0.0	.	586	Q9P1Z0	ZBTB4_HUMAN	R	586	ENSP00000307858:T586R;ENSP00000369973:T586R	ENSP00000307858:T586R	T	-	2	0	ZBTB4	7307268	0.000000	0.05858	0.445000	0.26908	0.032000	0.12392	0.636000	0.24644	1.268000	0.44264	0.462000	0.41574	ACA		0.657	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
TP53	7157	broad.mit.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R306X	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,large_intestine,rectum,Substitution - Nonsense,0	.	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	c.C916T	17	GRCh37	CM971506	TP53	M	rs121913344	.						120.0	106.0	110.0					17																	7577022		2203	4300	6503	7517747	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	17.37:g.7577022G>A	ENSP00000269305:p.Arg306*		7517747	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NUP85	79902	broad.mit.edu	37	17	73205962	73205962	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:73205962C>T	ENST00000245544.4	+	3	243	c.172C>T	c.(172-174)Cgt>Tgt	p.R58C	NUP85_ENST00000579324.1_5'UTR|NUP85_ENST00000447371.2_5'UTR|NUP85_ENST00000579298.1_Missense_Mutation_p.R58C|NUP85_ENST00000541827.1_Missense_Mutation_p.R12C|NUP85_ENST00000449421.2_3'UTR	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	58					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)		p.R58C(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CTATATCATCCGTAAGGATGT	0.368																																					p.R58C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C172T	17						.						54.0	58.0	57.0					17																	73205962		2203	4300	6503	70717557	SO:0001583	missense	79902	exon3			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.172C>T	17.37:g.73205962C>T	ENSP00000245544:p.Arg58Cys		70717557	NM_024844	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Missense_Mutation	SNP	ENST00000245544.4	37	CCDS32730.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939963	0.52972	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000449421	.	.	.	5.43	3.4	0.38934	.	0.095884	0.64402	D	0.000001	T	0.74199	0.3685	M	0.74881	2.28	0.80722	D	1	D;D	0.67145	0.996;0.996	P;P	0.59643	0.803;0.861	T	0.77027	-0.2740	9	0.66056	D	0.02	-13.2029	13.3096	0.60371	0.2869:0.7131:0.0:0.0	.	12;58	B4DMQ3;Q9BW27	.;NUP85_HUMAN	C	58;12;12	.	ENSP00000245544:R58C	R	+	1	0	NUP85	70717557	1.000000	0.71417	0.656000	0.29637	0.396000	0.30629	1.207000	0.32333	0.753000	0.32945	0.650000	0.86243	CGT		0.368	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446619.1	NM_024844	
SPHK1	8877	broad.mit.edu	37	17	74382047	74382048	+	Intron	DEL	TT	TT	-			TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr17:74382047_74382048delTT	ENST00000545180.1	+	5	819				SPHK1_ENST00000592299.1_Intron|SPHK1_ENST00000392496.3_Intron|SPHK1_ENST00000590959.1_Frame_Shift_Del_p.F12fs|SPHK1_ENST00000323374.4_Intron			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1						'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	ACGTGGCCTCTTTGGTTTTGTT	0.673											OREG0024750	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.12_12del	GBM(90;966 1307 27369 33775 44498)											.	.	0			c.34_35del	17						.		,,,	8,3760		3,2,1879					,,,	-3.7	0.0			25	20,7872		4,12,3930	no	intron,frameshift,intron,intron	SPHK1	NM_182965.2,NM_021972.3,NM_001142602.1,NM_001142601.1	,,,	7,14,5809	A1A1,A1R,RR		0.2534,0.2123,0.2401	,,,	,,,		28,11632				71893643	SO:0001627	intron_variant	8877	exon3			BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.11-18TT>-	17.37:g.74382047_74382048delTT		1152	71893642	NM_021972	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Frame_Shift_Del	DEL	ENST00000545180.1	37	CCDS45785.1																																																																																				0.673	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
NCAM2	4685	broad.mit.edu	37	21	22881329	22881329	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr21:22881329C>T	ENST00000400546.1	+	16	2484	c.2235C>T	c.(2233-2235)ggC>ggT	p.G745G	NCAM2_ENST00000284894.7_Silent_p.G603G	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	745					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G745G(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AGAAAAGTGGCTCCAGTGGCA	0.443																																					p.G745G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2235T	21						.						114.0	109.0	110.0					21																	22881329		1952	4169	6121	21803200	SO:0001819	synonymous_variant	4685	exon16				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2235C>T	21.37:g.22881329C>T			21803200	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	37	CCDS42910.1																																																																																				0.443	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
PTX4	390667	broad.mit.edu	37	16	1537807	1537807	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr16:1537807C>T	ENST00000447419.2	-	2	331	c.306G>A	c.(304-306)gcG>gcA	p.A102A	PTX4_ENST00000440447.2_Silent_p.A102A|PTX4_ENST00000293922.1_Silent_p.A97A			Q96A99	PTX4_HUMAN	pentraxin 4, long	102						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.A97A(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CCTTGAGCTGCGCCAGCTCCC	0.682																																					p.A97A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G291A	16						.						53.0	57.0	56.0					16																	1537807		2199	4298	6497	1477808	SO:0001819	synonymous_variant	390667	exon2				CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.306G>A	16.37:g.1537807C>T			1477808	NM_001013658		Silent	SNP	ENST00000447419.2	37																																																																																					0.682	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432526.1	NM_001013658	
CHST9	83539	broad.mit.edu	37	18	24496749	24496749	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr18:24496749C>T	ENST00000284224.8	-	6	1083	c.806G>A	c.(805-807)cGc>cAc	p.R269H	AQP4-AS1_ENST00000568797.1_RNA|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000581714.1_Missense_Mutation_p.R269H|AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000579964.1_RNA	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	269					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)	p.R184H(1)|p.R269H(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					AGTATTTAAGCGGGTATATAT	0.413																																					p.R269H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G806A	18						.						141.0	130.0	134.0					18																	24496749		1864	4095	5959	22750747	SO:0001583	missense	83539	exon6			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.806G>A	18.37:g.24496749C>T	ENSP00000284224:p.Arg269His		22750747	NM_031422	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.076065	0.55646	.	.	ENSG00000154080	ENST00000284224	T	0.75260	-0.92	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.89121	0.6625	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89295	0.3622	10	0.87932	D	0	-13.6533	20.8794	0.99867	0.0:1.0:0.0:0.0	.	269	Q7L1S5	CHST9_HUMAN	H	269	ENSP00000284224:R269H	ENSP00000284224:R269H	R	-	2	0	CHST9	22750747	1.000000	0.71417	0.958000	0.39756	0.116000	0.19942	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CGC		0.413	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422	
ST8SIA5	29906	broad.mit.edu	37	18	44260284	44260284	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr18:44260284G>A	ENST00000315087.7	-	7	1512	c.852C>T	c.(850-852)aaC>aaT	p.N284N	ST8SIA5_ENST00000536490.1_Silent_p.N253N|ST8SIA5_ENST00000590497.1_5'UTR|ST8SIA5_ENST00000538168.1_Silent_p.N320N	NM_013305.4	NP_037437.2	O15466	SIA8E_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5	284					carbohydrate metabolic process (GO:0005975)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialyltransferase activity (GO:0008373)	p.N284N(1)		kidney(1)|large_intestine(10)|lung(7)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	22						AGCGCGACACGTTGACCAGGT	0.627																																					p.N284N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C852T	18						.						112.0	81.0	92.0					18																	44260284		2203	4300	6503	42514282	SO:0001819	synonymous_variant	29906	exon7			U91641	CCDS11930.1	18q12.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000101638	ENSG00000101638		"""Sialyltransferases"""	17827	protein-coding gene	gene with protein product	"""ST8Sia V"""	607162	"""sialyltransferase 8E (alpha-2, 8-polysialytransferase)"""	SIAT8E		9199191	Standard	XM_005258250		Approved		uc002lcj.1	O15466	OTTHUMG00000132643	ENST00000315087.7:c.852C>T	18.37:g.44260284G>A			42514282	NM_013305	B7Z1K9|Q6IAW7	Silent	SNP	ENST00000315087.7	37	CCDS11930.1																																																																																				0.627	ST8SIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255892.1	NM_013305	
SMAD4	4089	broad.mit.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																					p.R361H												SMAD4,small_intestine,duodenum,Substitution - Missense,+1	.	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	c.G1082A	18	GRCh37	CM004254	SMAD4	M		.						167.0	138.0	148.0					18																	48591919		2203	4300	6503	46845917	SO:0001583	missense	4089	exon9			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	18.37:g.48591919G>A	ENSP00000341551:p.Arg361His		46845917	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
DCBLD2	131566	broad.mit.edu	37	3	98518393	98518393	+	Silent	SNP	T	T	A			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:98518393T>A	ENST00000326840.6	-	16	2513	c.2151A>T	c.(2149-2151)acA>acT	p.T717T	DCBLD2_ENST00000326857.9_Silent_p.T731T	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	717					cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.T717T(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						TGGAGAGAAGTGTATTGTAAG	0.562																																					p.T717T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2151T	3						.						183.0	184.0	184.0					3																	98518393		1966	4162	6128	100001083	SO:0001819	synonymous_variant	131566	exon16				CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.2151A>T	3.37:g.98518393T>A			100001083	NM_080927	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Silent	SNP	ENST00000326840.6	37	CCDS46878.1																																																																																				0.562	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927	
GAP43	2596	broad.mit.edu	37	3	115394917	115394917	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:115394917A>T	ENST00000305124.6	+	2	454	c.88A>T	c.(88-90)Aaa>Taa	p.K30*	GAP43_ENST00000393780.3_Nonsense_Mutation_p.K66*	NM_002045.3	NP_002036.1	P17677	NEUM_HUMAN	growth associated protein 43	30					axon choice point recognition (GO:0016198)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of filopodium assembly (GO:0051489)|regulation of growth (GO:0040008)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.K30*(1)		endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	32				GBM - Glioblastoma multiforme(114;0.164)		ACCAGAAGATAAAGCTCATAA	0.413																																					p.K66X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A196T	3						.						90.0	93.0	92.0					3																	115394917		2203	4300	6503	116877607	SO:0001587	stop_gained	2596	exon3				CCDS33830.1, CCDS46890.1	3q13.31	2013-09-19			ENSG00000172020	ENSG00000172020			4140	protein-coding gene	gene with protein product	"""neuron growth-associated protein 43"", ""neuromodulin"", ""nerve growth-related peptide GAP43"", ""axonal membrane protein GAP-43"", ""protein F1"", ""calmodulin-binding protein P-57"", ""neural phosphoprotein B-50"""	162060				3272162, 8231732	Standard	NM_002045		Approved	B-50, PP46	uc003ebr.2	P17677	OTTHUMG00000133758	ENST00000305124.6:c.88A>T	3.37:g.115394917A>T	ENSP00000305010:p.Lys30*		116877607	NM_001130064	A8K0Y4	Nonsense_Mutation	SNP	ENST00000305124.6	37	CCDS33830.1	.	.	.	.	.	.	.	.	.	.	A	41	8.627007	0.98890	.	.	ENSG00000172020	ENST00000305124;ENST00000393780	.	.	.	4.75	4.75	0.60458	.	0.047299	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.6529	14.721	0.69305	1.0:0.0:0.0:0.0	.	.	.	.	X	30;66	.	ENSP00000305010:K30X	K	+	1	0	GAP43	116877607	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.698000	0.91311	2.117000	0.64856	0.460000	0.39030	AAA		0.413	GAP43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258216.2	NM_002045	
PAQR9	344838	broad.mit.edu	37	3	142681728	142681728	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:142681728C>T	ENST00000340634.3	-	1	450	c.451G>A	c.(451-453)Gcc>Acc	p.A151T	RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	151						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.A151T(1)		endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						AAGAAGGCGGCGCGCAGACGC	0.627																																					p.A151T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G451A	3						.						42.0	40.0	41.0					3																	142681728		2203	4300	6503	144164418	SO:0001583	missense	344838	exon1			AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.451G>A	3.37:g.142681728C>T	ENSP00000341564:p.Ala151Thr		144164418	NM_198504	Q147T6	Missense_Mutation	SNP	ENST00000340634.3	37	CCDS3128.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608676	0.87258	.	.	ENSG00000188582	ENST00000340634	T	0.30182	1.54	4.8	4.8	0.61643	.	0.257041	0.31784	N	0.007064	T	0.42720	0.1215	L	0.50333	1.59	0.49130	D	0.999753	D	0.63880	0.993	P	0.56127	0.792	T	0.12811	-1.0533	10	0.17369	T	0.5	-24.4567	18.2419	0.89970	0.0:1.0:0.0:0.0	.	151	Q6ZVX9	PAQR9_HUMAN	T	151	ENSP00000341564:A151T	ENSP00000341564:A151T	A	-	1	0	PAQR9	144164418	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.597000	0.61062	2.369000	0.80426	0.462000	0.41574	GCC		0.627	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504	
ARHGEF26	26084	broad.mit.edu	37	3	153840411	153840411	+	Silent	SNP	T	T	A			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:153840411T>A	ENST00000356448.4	+	2	914	c.630T>A	c.(628-630)tcT>tcA	p.S210S	ARHGEF26-AS1_ENST00000479270.1_RNA|ARHGEF26_ENST00000465817.1_Silent_p.S210S|ARHGEF26_ENST00000465093.1_Silent_p.S210S|ARHGEF26-AS1_ENST00000467912.1_RNA|ARHGEF26-AS1_ENST00000480639.1_RNA|ARHGEF26-AS1_ENST00000491862.1_RNA	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	210					endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S210S(2)		endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						AGAAAAGTTCTTCGGAACAAA	0.597																																					p.S210S	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T630A	3						.						21.0	23.0	22.0					3																	153840411		1818	4075	5893	155323101	SO:0001819	synonymous_variant	26084	exon2			BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.630T>A	3.37:g.153840411T>A			155323101	NM_015595	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Silent	SNP	ENST00000356448.4	37	CCDS46938.1																																																																																				0.597	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	
FNDC3B	64778	broad.mit.edu	37	3	172115036	172115036	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:172115036G>A	ENST00000336824.4	+	26	3485	c.3386G>A	c.(3385-3387)cGt>cAt	p.R1129H	FNDC3B_ENST00000416957.1_Missense_Mutation_p.R1129H|FNDC3B_ENST00000415807.2_Missense_Mutation_p.R1129H	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	1129	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)	p.R1129H(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGTGCGTGTCGTCGCTGTTTA	0.522																																					p.R1129H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3386A	3						.						90.0	88.0	89.0					3																	172115036		2203	4300	6503	173597730	SO:0001583	missense	64778	exon26			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.3386G>A	3.37:g.172115036G>A	ENSP00000338523:p.Arg1129His		173597730	NM_001135095	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Missense_Mutation	SNP	ENST00000336824.4	37	CCDS3217.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876106	0.72180	.	.	ENSG00000075420	ENST00000415807;ENST00000336824;ENST00000416957	T;T;T	0.53857	0.6;0.6;0.6	6.02	5.14	0.70334	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76744	0.4030	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81861	-0.0738	10	0.72032	D	0.01	-17.9503	16.5632	0.84572	0.0:0.0:0.8684:0.1316	.	1129	Q53EP0	FND3B_HUMAN	H	1129	ENSP00000411242:R1129H;ENSP00000338523:R1129H;ENSP00000389094:R1129H	ENSP00000338523:R1129H	R	+	2	0	FNDC3B	173597730	1.000000	0.71417	0.675000	0.29917	0.737000	0.42083	9.307000	0.96226	1.525000	0.49052	0.655000	0.94253	CGT		0.522	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
FBXL2	25827	broad.mit.edu	37	3	33420182	33420182	+	Silent	SNP	C	C	T	rs377078642		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:33420182C>T	ENST00000484457.1	+	13	991	c.900C>T	c.(898-900)acC>acT	p.T300T	FBXL2_ENST00000538892.1_Silent_p.T232T|FBXL2_ENST00000542085.1_Silent_p.T10T|FBXL2_ENST00000538181.1_Silent_p.T216T|FBXL2_ENST00000507198.1_Silent_p.T232T|FBXL2_ENST00000446237.3_Silent_p.T10T|FBXL2_ENST00000283627.6_3'UTR	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2									p.T300T(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						TCCAGATAACCGACAGCACAC	0.438																																					p.T232T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C696T	3						.	C	,	1,4405	2.1+/-5.4	0,1,2202	191.0	163.0	172.0		696,900	-2.5	0.9	3		172	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	FBXL2	NM_001171713.1,NM_012157.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	232/356,300/424	33420182	1,13005	2203	4300	6503	33395186	SO:0001819	synonymous_variant	25827	exon12			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.900C>T	3.37:g.33420182C>T			33395186	NM_001171713		Silent	SNP	ENST00000484457.1	37	CCDS2658.1																																																																																				0.438	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253245.2	NM_012157	
ULK4	54986	broad.mit.edu	37	3	41757043	41757043	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:41757043A>T	ENST00000301831.4	-	24	2935	c.2473T>A	c.(2473-2475)Ttg>Atg	p.L825M		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	825					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.L825M(1)		breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		ACATTAGCCAAGGAGTTAAGA	0.458																																					p.L825M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2473A	3						.						82.0	80.0	81.0					3																	41757043		1961	4166	6127	41732047	SO:0001583	missense	54986	exon24			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.2473T>A	3.37:g.41757043A>T	ENSP00000301831:p.Leu825Met		41732047	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	37	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	A	17.02	3.281389	0.59758	.	.	ENSG00000168038	ENST00000301831	T	0.70045	-0.45	5.5	0.247	0.15521	Armadillo-type fold (1);	0.000000	0.64402	U	0.000007	T	0.74951	0.3784	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73148	-0.4074	10	0.87932	D	0	.	10.5066	0.44836	0.6696:0.0:0.3304:0.0	.	825	Q96C45	ULK4_HUMAN	M	825	ENSP00000301831:L825M	ENSP00000301831:L825M	L	-	1	2	ULK4	41732047	0.979000	0.34478	0.966000	0.40874	0.723000	0.41478	0.838000	0.27572	-0.174000	0.10743	0.528000	0.53228	TTG		0.458	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
GP5	2814	broad.mit.edu	37	3	194118321	194118321	+	Missense_Mutation	SNP	G	G	A	rs369093144		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr3:194118321G>A	ENST00000401815.1	-	1	762	c.691C>T	c.(691-693)Cgt>Tgt	p.R231C	GP5_ENST00000323007.3_Missense_Mutation_p.R231C			P40197	GPV_HUMAN	glycoprotein V (platelet)	231					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|negative regulation of platelet activation (GO:0010544)|platelet activation (GO:0030168)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R231C(2)|p.R231S(2)		breast(3)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(14)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	35	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GCGATGGAACGGATGTGATTT	0.582																																					p.R231C												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.C691T	3						.	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	113.0	120.0	118.0		691	-1.5	0.0	3		118	0,8600		0,0,4300	no	missense	GP5	NM_004488.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	231/561	194118321	1,13005	2203	4300	6503	195599610	SO:0001583	missense	2814	exon2			L11238	CCDS3307.1	3q29	2008-02-01			ENSG00000178732	ENSG00000178732		"""CD molecules"""	4443	protein-coding gene	gene with protein product		173511				7690959	Standard	NM_004488		Approved	CD42d	uc003ftv.1	P40197	OTTHUMG00000150345	ENST00000401815.1:c.691C>T	3.37:g.194118321G>A	ENSP00000383931:p.Arg231Cys		195599610	NM_004488	D1MER9	Missense_Mutation	SNP	ENST00000401815.1	37	CCDS3307.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256854	0.22965	2.27E-4	0.0	ENSG00000178732	ENST00000401815;ENST00000323007	T;T	0.58210	0.35;0.35	4.33	-1.47	0.08772	.	0.701509	0.11800	N	0.528186	T	0.53158	0.1779	M	0.70903	2.155	0.09310	N	1	D	0.60575	0.988	P	0.48114	0.567	T	0.50474	-0.8824	10	0.56958	D	0.05	.	8.0813	0.30746	0.0685:0.4933:0.3294:0.1089	.	231	P40197	GPV_HUMAN	C	231	ENSP00000383931:R231C;ENSP00000319286:R231C	ENSP00000319286:R231C	R	-	1	0	GP5	195599610	0.000000	0.05858	0.001000	0.08648	0.069000	0.16628	-0.271000	0.08572	-0.186000	0.10533	-0.485000	0.04761	CGT		0.582	GP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317710.1	NM_004488	
CLEC1A	51267	broad.mit.edu	37	12	10233859	10233859	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr12:10233859C>T	ENST00000315330.4	-	3	430	c.368G>A	c.(367-369)cGt>cAt	p.R123H	RN7SKP161_ENST00000411110.1_RNA|CLEC1A_ENST00000457018.2_Missense_Mutation_p.R90H|CLEC1A_ENST00000420265.2_Intron	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	123					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)	p.R123H(2)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						ATACAGCTCACGACAGAGTTT	0.463																																					p.R123H												.	.	2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	c.G368A	12						.						109.0	112.0	111.0					12																	10233859		2203	4300	6503	10125126	SO:0001583	missense	51267	exon3			AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.368G>A	12.37:g.10233859C>T	ENSP00000326407:p.Arg123His		10125126	NM_016511	Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	37	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946124	0.73672	.	.	ENSG00000150048	ENST00000315330;ENST00000457018	T;T	0.17370	2.28;2.28	5.06	3.2	0.36748	.	0.159238	0.30752	N	0.008952	T	0.33818	0.0876	M	0.69823	2.125	0.53688	D	0.99997	D;D	0.76494	0.999;0.999	P;D	0.72338	0.828;0.977	T	0.02244	-1.1189	10	0.38643	T	0.18	.	7.6201	0.28181	0.0:0.8287:0.0:0.1713	.	90;123	E9PFB4;Q8NC01	.;CLC1A_HUMAN	H	123;90	ENSP00000326407:R123H;ENSP00000415048:R90H	ENSP00000326407:R123H	R	-	2	0	CLEC1A	10125126	0.991000	0.36638	0.786000	0.31890	0.940000	0.58332	1.300000	0.33436	2.330000	0.79161	0.563000	0.77884	CGT		0.463	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	A	rs121913529		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr12:25398284C>A	ENST00000256078.4	-	2	98	c.35G>T	c.(34-36)gGt>gTt	p.G12V	KRAS_ENST00000311936.3_Missense_Mutation_p.G12V|KRAS_ENST00000557334.1_Missense_Mutation_p.G12V|KRAS_ENST00000556131.1_Missense_Mutation_p.G12V	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12V	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35T	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>T	12.37:g.25398284C>A	ENSP00000256078:p.Gly12Val		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808637	0.90707	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90373	0.6987	M	0.90650	3.135	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.72625	0.969;0.978	D	0.91773	0.5429	10	0.72032	D	0.01	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	V	12	ENSP00000308495:G12V;ENSP00000452512:G12V;ENSP00000256078:G12V;ENSP00000451856:G12V	ENSP00000256078:G12V	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
DIP2B	57609	broad.mit.edu	37	12	51127944	51127944	+	Silent	SNP	T	T	G			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr12:51127944T>G	ENST00000301180.5	+	33	4042	c.4008T>G	c.(4006-4008)acT>acG	p.T1336T		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1336						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.T1336T(2)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						ATCCGACTACTGTGTATGTGG	0.363																																					p.T1336T												.	.	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.T4008G	12						.						245.0	217.0	227.0					12																	51127944		2203	4300	6503	49414211	SO:0001819	synonymous_variant	57609	exon33			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.4008T>G	12.37:g.51127944T>G			49414211	NM_173602	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	ENST00000301180.5	37	CCDS31799.1																																																																																				0.363	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
CCDC62	84660	broad.mit.edu	37	12	123281894	123281894	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr12:123281894G>A	ENST00000253079.6	+	7	1157	c.813G>A	c.(811-813)gcG>gcA	p.A271A	CCDC62_ENST00000537566.1_Silent_p.A32A|CCDC62_ENST00000392441.4_Silent_p.A271A|CCDC62_ENST00000392440.2_Silent_p.A32A	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	271					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.A271A(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		TTAATATTGCGAAGTCAAAGC	0.353																																					p.A271A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G813A	12						.						123.0	112.0	116.0					12																	123281894		2203	4300	6503	121847847	SO:0001819	synonymous_variant	84660	exon7				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.813G>A	12.37:g.123281894G>A			121847847	NM_201435	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Silent	SNP	ENST00000253079.6	37	CCDS9238.1																																																																																				0.353	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
ICE2	79664	broad.mit.edu	37	15	60758802	60758802	+	Silent	SNP	G	G	C			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr15:60758802G>C	ENST00000261520.4	-	5	753	c.519C>G	c.(517-519)ctC>ctG	p.L173L	NARG2_ENST00000558654.1_5'Flank|NARG2_ENST00000561114.1_Silent_p.L173L|NARG2_ENST00000439632.1_Silent_p.L36L	NM_024611.4	NP_078887.2												p.L173L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						CCTCTGTGAAGAGACGGGCAT	0.378																																					p.L173L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C519G	15						.						97.0	94.0	95.0					15																	60758802		2203	4300	6503	58546094	SO:0001819	synonymous_variant	79664	exon5																														ENST00000261520.4:c.519C>G	15.37:g.60758802G>C			58546094	NM_024611		Silent	SNP	ENST00000261520.4	37	CCDS10176.1																																																																																				0.378	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
CYP11A1	1583	broad.mit.edu	37	15	74637524	74637527	+	Frame_Shift_Del	DEL	CTCT	CTCT	-			TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr15:74637524_74637527delCTCT	ENST00000268053.6	-	3	637_640	c.483_486delAGAG	c.(481-486)ccagagfs	p.PE161fs	CYP11A1_ENST00000541301.1_Intron|CYP11A1_ENST00000419019.2_Frame_Shift_Del_p.PE3fs|CYP11A1_ENST00000358632.4_Frame_Shift_Del_p.PE3fs	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	161					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)	p.E162fs*63(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	TCTTGGTGGCCTCTGGAGCCATCA	0.588																																					p.161_162del	Esophageal Squamous(87;818 1337 4093 9268 37314)											.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.483_486del	15						.																																			72424580	SO:0001589	frameshift_variant	1583	exon3			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.483_486delAGAG	15.37:g.74637524_74637527delCTCT	ENSP00000268053:p.Pro161fs		72424577	NM_000781	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Frame_Shift_Del	DEL	ENST00000268053.6	37	CCDS32291.1																																																																																				0.588	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319737.1		
SPOCK3	50859	broad.mit.edu	37	4	167675873	167675873	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr4:167675873A>T	ENST00000357154.3	-	9	863	c.726T>A	c.(724-726)gaT>gaA	p.D242E	SPOCK3_ENST00000510741.1_Missense_Mutation_p.D199E|SPOCK3_ENST00000512648.1_Missense_Mutation_p.D239E|SPOCK3_ENST00000511531.1_Missense_Mutation_p.D242E|SPOCK3_ENST00000512681.1_Missense_Mutation_p.D144E|SPOCK3_ENST00000504953.1_Missense_Mutation_p.D239E|SPOCK3_ENST00000421836.2_Missense_Mutation_p.D191E|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Missense_Mutation_p.D239E|SPOCK3_ENST00000534949.1_Missense_Mutation_p.D146E|SPOCK3_ENST00000502330.1_Missense_Mutation_p.D242E|SPOCK3_ENST00000541637.1_Missense_Mutation_p.D144E|SPOCK3_ENST00000506886.1_Missense_Mutation_p.D242E|SPOCK3_ENST00000535728.1_Missense_Mutation_p.D110E|SPOCK3_ENST00000511269.1_Missense_Mutation_p.D239E|SPOCK3_ENST00000541354.1_Missense_Mutation_p.D122E	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	242					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)	p.D239E(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		AGATGCTGGTATCGAATCCTA	0.388																																					p.D242E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T726A	4						.						108.0	99.0	102.0					4																	167675873		2203	4300	6503	167912448	SO:0001583	missense	50859	exon9			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.726T>A	4.37:g.167675873A>T	ENSP00000349677:p.Asp242Glu		167912448	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.764209	0.49574	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000541354;ENST00000512681;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000541637;ENST00000534949;ENST00000512648;ENST00000510403	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;D	0.86769	1.5;1.5;1.5;1.5;1.5;1.5;1.52;1.43;0.95;1.5;1.49;1.3;0.95;1.19;2.24;-2.17	5.64	5.64	0.86602	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.107040	0.64402	D	0.000005	D	0.90872	0.7132	L	0.47190	1.495	0.58432	D	0.999992	P;P;D;D;D;P;D;D	0.71674	0.649;0.804;0.963;0.998;0.998;0.804;0.996;0.998	B;P;P;D;D;B;D;D	0.83275	0.402;0.47;0.812;0.996;0.996;0.325;0.99;0.996	D	0.89369	0.3673	10	0.30854	T	0.27	-1.5653	16.1564	0.81670	1.0:0.0:0.0:0.0	.	144;146;191;251;199;242;239;242	B4DGK5;F5H099;B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;.;.;TICN3_HUMAN	E	242;239;239;242;242;242;199;122;144;239;110;191;144;146;239;121	ENSP00000349677:D242E;ENSP00000350153:D239E;ENSP00000425570:D239E;ENSP00000420920:D242E;ENSP00000423421:D242E;ENSP00000423606:D242E;ENSP00000426716:D199E;ENSP00000444789:D122E;ENSP00000426318:D144E;ENSP00000425502:D239E;ENSP00000441396:D110E;ENSP00000411344:D191E;ENSP00000445430:D144E;ENSP00000438142:D146E;ENSP00000426177:D239E;ENSP00000423176:D121E	ENSP00000349677:D242E	D	-	3	2	SPOCK3	167912448	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	3.583000	0.53928	2.274000	0.75844	0.528000	0.53228	GAT		0.388	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
MAPK10	5602	broad.mit.edu	37	4	87023093	87023093	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr4:87023093A>G	ENST00000359221.3	-	7	1044	c.518T>C	c.(517-519)aTg>aCg	p.M173T	MAPK10_ENST00000395160.3_Missense_Mutation_p.M28T|MAPK10_ENST00000395157.3_Missense_Mutation_p.M28T|MAPK10_ENST00000513839.1_5'Flank|MAPK10_ENST00000395161.2_Missense_Mutation_p.M173T|MAPK10_ENST00000361569.2_Missense_Mutation_p.M173T|MAPK10_ENST00000395166.1_Missense_Mutation_p.M135T|MAPK10_ENST00000449047.2_Missense_Mutation_p.M28T|MAPK10_ENST00000395169.3_Missense_Mutation_p.M135T			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	173	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.M173T(1)|p.M28T(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		GCCACACAACATTTGGTACAG	0.398																																					p.M28T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T83C	4						.						238.0	223.0	228.0					4																	87023093		2203	4300	6503	87242117	SO:0001583	missense	5602	exon2			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.518T>C	4.37:g.87023093A>G	ENSP00000352157:p.Met173Thr		87242117	NM_138981	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	37	CCDS34026.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.208481	0.79240	.	.	ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161	D;D;D;D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61;-1.61	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87152	0.6106	N	0.17594	0.5	0.80722	D	1	B;B;B;B;B	0.28667	0.013;0.219;0.022;0.146;0.049	P;P;P;P;P	0.60415	0.558;0.874;0.522;0.655;0.687	D	0.87355	0.2340	10	0.72032	D	0.01	-13.8068	16.4127	0.83723	1.0:0.0:0.0:0.0	.	59;28;135;173;173	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779	.;.;.;.;MK10_HUMAN	T	135;173;28;173;135;28;28;173	ENSP00000378598:M135T;ENSP00000352157:M173T;ENSP00000378586:M28T;ENSP00000355297:M173T;ENSP00000378595:M135T;ENSP00000378589:M28T;ENSP00000414469:M28T;ENSP00000378590:M173T	ENSP00000352157:M173T	M	-	2	0	MAPK10	87242117	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.231000	0.95317	2.279000	0.76181	0.528000	0.53228	ATG		0.398	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
SPOCK3	50859	broad.mit.edu	37	4	167921517	167921517	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr4:167921517G>T	ENST00000357154.3	-	5	479	c.342C>A	c.(340-342)caC>caA	p.H114Q	SPOCK3_ENST00000510741.1_Missense_Mutation_p.H111Q|SPOCK3_ENST00000512648.1_Missense_Mutation_p.H111Q|SPOCK3_ENST00000511531.1_Missense_Mutation_p.H114Q|SPOCK3_ENST00000512681.1_Intron|SPOCK3_ENST00000504953.1_Missense_Mutation_p.H111Q|SPOCK3_ENST00000421836.2_Missense_Mutation_p.H63Q|SPOCK3_ENST00000507137.1_5'UTR|SPOCK3_ENST00000357545.4_Missense_Mutation_p.H111Q|SPOCK3_ENST00000534949.1_Intron|SPOCK3_ENST00000502330.1_Missense_Mutation_p.H114Q|SPOCK3_ENST00000541637.1_Intron|SPOCK3_ENST00000506886.1_Missense_Mutation_p.H114Q|SPOCK3_ENST00000535728.1_Missense_Mutation_p.H22Q|SPOCK3_ENST00000511269.1_Missense_Mutation_p.H111Q|SPOCK3_ENST00000541354.1_Intron	NM_016950.2	NP_058646.2	Q9BQ16	TICN3_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3	114					negative regulation of endopeptidase activity (GO:0010951)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|metalloendopeptidase inhibitor activity (GO:0008191)	p.H111Q(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	38	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		TAAGCCTCCGGTGACTAATGC	0.408																																					p.H114Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C342A	4						.						127.0	121.0	123.0					4																	167921517		2203	4300	6503	168158092	SO:0001583	missense	50859	exon5			AJ001454	CCDS34095.1, CCDS54817.1, CCDS56343.1, CCDS56344.1, CCDS56346.1, CCDS56347.1, CCDS58931.1, CCDS75207.1	4q32.3	2011-10-10			ENSG00000196104	ENSG00000196104			13565	protein-coding gene	gene with protein product		607989				11751414	Standard	NM_001204352		Approved	testican-3	uc003iri.1	Q9BQ16	OTTHUMG00000161190	ENST00000357154.3:c.342C>A	4.37:g.167921517G>T	ENSP00000349677:p.His114Gln		168158092	NM_016950	B2R7M7|B3KR67|B4DGK5|B4DHB4|B4DHV3|B4DI46|B4DJY3|E7EP61|F5H099|O75705|Q6UW53|Q96Q26	Missense_Mutation	SNP	ENST00000357154.3	37	CCDS54817.1	.	.	.	.	.	.	.	.	.	.	G	9.675	1.147694	0.21288	.	.	ENSG00000196104	ENST00000357154;ENST00000357545;ENST00000504953;ENST00000506886;ENST00000511531;ENST00000502330;ENST00000510741;ENST00000511269;ENST00000535728;ENST00000421836;ENST00000512648;ENST00000509854;ENST00000506697;ENST00000512042	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.40225	1.62;1.62;1.62;1.62;1.62;1.62;1.63;1.62;1.63;1.42;2.39;1.04;1.04;1.04	5.27	2.6	0.31112	.	0.207410	0.46758	D	0.000276	T	0.21062	0.0507	N	0.20766	0.605	0.80722	D	1	B;B;B;B;B;B	0.20052	0.007;0.031;0.031;0.009;0.041;0.031	B;B;B;B;B;B	0.19391	0.006;0.025;0.025;0.01;0.019;0.025	T	0.10314	-1.0635	10	0.06236	T	0.91	-6.6568	6.9416	0.24496	0.2608:0.1282:0.611:0.0	.	63;123;111;114;111;114	B4DHB4;B4DFW5;E7EP61;Q9BQ16-2;Q9BQ16-1;Q9BQ16	.;.;.;.;.;TICN3_HUMAN	Q	114;111;111;114;114;114;111;111;22;63;111;111;114;114	ENSP00000349677:H114Q;ENSP00000350153:H111Q;ENSP00000425570:H111Q;ENSP00000420920:H114Q;ENSP00000423421:H114Q;ENSP00000423606:H114Q;ENSP00000426716:H111Q;ENSP00000425502:H111Q;ENSP00000441396:H22Q;ENSP00000411344:H63Q;ENSP00000426177:H111Q;ENSP00000423367:H111Q;ENSP00000424168:H114Q;ENSP00000425407:H114Q	ENSP00000349677:H114Q	H	-	3	2	SPOCK3	168158092	0.988000	0.35896	1.000000	0.80357	0.857000	0.48899	0.096000	0.15147	0.308000	0.22923	0.460000	0.39030	CAC		0.408	SPOCK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364091.1		
GLUD2	2747	broad.mit.edu	37	X	120181654	120181654	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chrX:120181654C>A	ENST00000328078.1	+	1	193	c.116C>A	c.(115-117)gCc>gAc	p.A39D		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	39					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)	p.A39D(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CAGCCCGCCGCCGCCTCGCAG	0.761																																					p.A39D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C116A	X						.						8.0	10.0	9.0					X																	120181654		2065	4029	6094	120009335	SO:0001583	missense	2747	exon1			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.116C>A	X.37:g.120181654C>A	ENSP00000327589:p.Ala39Asp		120009335	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608163	0.46527	.	.	ENSG00000182890	ENST00000328078	D	0.96685	-4.09	0.886	0.886	0.19194	.	0.341384	0.25408	U	0.030882	D	0.87313	0.6146	N	0.08118	0	0.30090	N	0.80838	B	0.02656	0.0	B	0.01281	0.0	T	0.79843	-0.1632	10	0.31617	T	0.26	.	4.8548	0.13554	0.0:1.0:0.0:0.0	.	39	P49448	DHE4_HUMAN	D	39	ENSP00000327589:A39D	ENSP00000327589:A39D	A	+	2	0	GLUD2	120009335	0.992000	0.36948	0.003000	0.11579	0.005000	0.04900	2.224000	0.42945	0.727000	0.32360	0.372000	0.22366	GCC		0.761	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
GPC3	2719	broad.mit.edu	37	X	132887834	132887834	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chrX:132887834C>T	ENST00000370818.3	-	3	1152	c.707G>A	c.(706-708)gGa>gAa	p.G236E	GPC3_ENST00000394299.2_Missense_Mutation_p.G236E|GPC3_ENST00000543339.1_Missense_Mutation_p.G182E	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	236					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)	p.G236E(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CACTTCAATTCCAAGATTCAG	0.463			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.G220E		yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G659A	X						.						457.0	307.0	358.0					X																	132887834		2203	4300	6503	132715500	SO:0001583	missense	2719	exon3	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.707G>A	X.37:g.132887834C>T	ENSP00000359854:p.Gly236Glu		132715500	NM_001164618	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	ENST00000370818.3	37	CCDS14638.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768777	0.69878	.	.	ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339	T;T;T	0.56941	0.43;0.43;0.43	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.74596	0.3737	M	0.77616	2.38	0.54753	D	0.999989	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	T	0.77544	-0.2548	10	0.87932	D	0	.	17.9336	0.89006	0.0:1.0:0.0:0.0	.	220;182;236;236	B4DTD8;G3V1R0;C9JLE3;P51654	.;.;.;GPC3_HUMAN	E	236;236;182	ENSP00000359854:G236E;ENSP00000377836:G236E;ENSP00000444222:G182E	ENSP00000359854:G236E	G	-	2	0	GPC3	132715500	1.000000	0.71417	0.911000	0.35937	0.978000	0.69477	7.487000	0.81328	2.455000	0.83008	0.594000	0.82650	GGA		0.463	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058356.1	NM_004484	
NHS	4810	broad.mit.edu	37	X	17743893	17743893	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chrX:17743893A>G	ENST00000380060.3	+	6	1942	c.1604A>G	c.(1603-1605)gAc>gGc	p.D535G	NHS_ENST00000398097.3_Missense_Mutation_p.D379G	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	556					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.D535G(1)|p.D379G(1)		breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					AGTGCCCAGGACCACCAGCCT	0.542																																					p.D379G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1136G	X						.						61.0	54.0	57.0					X																	17743893		2203	4300	6503	17653814	SO:0001583	missense	4810	exon7				CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.1604A>G	X.37:g.17743893A>G	ENSP00000369400:p.Asp535Gly		17653814	NM_001136024	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	A	11.69	1.713649	0.30413	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.44083	0.93;0.94	5.86	4.71	0.59529	.	0.206541	0.50627	D	0.000111	T	0.29158	0.0725	N	0.22421	0.69	0.46113	D	0.998878	B;B;B;B	0.25850	0.0;0.0;0.0;0.136	B;B;B;B	0.23419	0.0;0.0;0.0;0.046	T	0.14783	-1.0460	10	0.72032	D	0.01	-4.313	10.4431	0.44477	0.9237:0.0:0.0763:0.0	.	556;377;379;535	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	G	535;379;377	ENSP00000369400:D535G;ENSP00000381170:D379G	ENSP00000369397:D377G	D	+	2	0	NHS	17653814	1.000000	0.71417	0.998000	0.56505	0.896000	0.52359	5.025000	0.64097	1.974000	0.57490	0.486000	0.48141	GAC		0.542	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
FAM47C	442444	broad.mit.edu	37	X	37027597	37027597	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chrX:37027597G>A	ENST00000358047.3	+	1	1166	c.1114G>A	c.(1114-1116)Gag>Aag	p.E372K		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	372								p.E372K(1)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GCTGCCTCCCGAGGCTGGAGT	0.637																																					p.E372K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1114A	X						.						62.0	62.0	62.0					X																	37027597		2202	4299	6501	36937518	SO:0001583	missense	442444	exon1			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1114G>A	X.37:g.37027597G>A	ENSP00000367913:p.Glu372Lys		36937518	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	g	8.268	0.812734	0.16537	.	.	ENSG00000198173	ENST00000358047	T	0.19806	2.12	0.951	0.951	0.19579	.	.	.	.	.	T	0.14527	0.0351	N	0.12182	0.205	0.23546	N	0.997445	D	0.69078	0.997	P	0.54312	0.748	T	0.06481	-1.0824	9	0.06365	T	0.9	.	7.6353	0.28264	1.0E-4:0.0:0.9999:0.0	.	372	Q5HY64	FA47C_HUMAN	K	372	ENSP00000367913:E372K	ENSP00000367913:E372K	E	+	1	0	FAM47C	36937518	0.341000	0.24801	0.019000	0.16419	0.013000	0.08279	0.467000	0.22035	0.181000	0.19994	0.183000	0.17082	GAG		0.637	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
OTC	5009	broad.mit.edu	37	X	38260659	38260659	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chrX:38260659T>G	ENST00000039007.4	+	5	670	c.518T>G	c.(517-519)cTg>cGg	p.L173R	TM4SF2_ENST00000465127.1_Intron|OTC_ENST00000488812.1_3'UTR	NM_000531.5	NP_000522.3	P00480	OTC_HUMAN	ornithine carbamoyltransferase	173					ammonia homeostasis (GO:0097272)|arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|liver development (GO:0001889)|midgut development (GO:0007494)|ornithine catabolic process (GO:0006593)|protein homotrimerization (GO:0070207)|response to biotin (GO:0070781)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|ornithine carbamoyltransferase activity (GO:0004585)|phosphate ion binding (GO:0042301)|phospholipid binding (GO:0005543)	p.L173R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22					L-Citrulline(DB00155)|L-Ornithine(DB00129)	ATCCAGATCCTGGCTGATTAC	0.388																																					p.L173R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T518G	X						.						134.0	99.0	111.0					X																	38260659		2202	4300	6502	38145603	SO:0001583	missense	5009	exon5			K02100	CCDS14247.1	Xp21.1	2014-06-28			ENSG00000036473	ENSG00000036473	2.1.3.3		8512	protein-coding gene	gene with protein product		300461					Standard	NM_000531		Approved		uc004def.4	P00480	OTTHUMG00000022727	ENST00000039007.4:c.518T>G	X.37:g.38260659T>G	ENSP00000039007:p.Leu173Arg		38145603	NM_000531	A8K9P2|D3DWB0|Q3KNR1|Q6B0I1|Q9NYJ5	Missense_Mutation	SNP	ENST00000039007.4	37	CCDS14247.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.520585	0.85495	.	.	ENSG00000036473	ENST00000039007	D	0.99688	-6.41	5.97	5.97	0.96955	Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	H	0.99143	4.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96248	0.9181	10	0.87932	D	0	-10.1205	15.388	0.74718	0.0:0.0:0.0:1.0	.	173	P00480	OTC_HUMAN	R	173	ENSP00000039007:L173R	ENSP00000039007:L173R	L	+	2	0	OTC	38145603	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.651000	0.83577	2.018000	0.59344	0.486000	0.48141	CTG		0.388	OTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059006.2		
RPL10	6134	broad.mit.edu	37	X	153628261	153628261	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chrX:153628261T>C	ENST00000369817.2	+	6	884	c.308T>C	c.(307-309)tTg>tCg	p.L103S	RPL10_ENST00000406022.2_Missense_Mutation_p.L52S|RPL10_ENST00000424325.2_Missense_Mutation_p.L103S|SNORA70_ENST00000384436.1_RNA			P27635	RL10_HUMAN	ribosomal protein L10	103					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.L103S(1)		large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AACAAGATGTTGTCCTGTGCT	0.478																																					p.L103S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T308C	X						.						56.0	50.0	52.0					X																	153628261		2203	4300	6503	153281455	SO:0001583	missense	6134	exon5			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.308T>C	X.37:g.153628261T>C	ENSP00000358832:p.Leu103Ser		153281455	NM_006013	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	ENST00000369817.2	37	CCDS14746.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.792937	0.90453	.	.	ENSG00000147403	ENST00000369817;ENST00000424325;ENST00000436473;ENST00000344746;ENST00000458500;ENST00000406022;ENST00000451365;ENST00000427682;ENST00000449494;ENST00000428169	T;T;T;T	0.77358	-1.07;-1.07;-1.07;-1.09	4.88	4.88	0.63580	Ribosomal protein L10e/L16 (2);	0.000000	0.56097	U	0.000035	D	0.91761	0.7394	H	0.98466	4.24	0.80722	D	1	P;D;P	0.64830	0.88;0.994;0.948	P;D;P	0.67103	0.828;0.949;0.837	D	0.93763	0.7068	10	0.87932	D	0	-24.1658	11.5135	0.50507	0.0:0.0:0.0:1.0	.	52;103;103	F8W7C6;A6QRI9;P27635	.;.;RL10_HUMAN	S	103;103;103;103;103;52;86;13;13;13	ENSP00000358832:L103S;ENSP00000413436:L103S;ENSP00000341730:L103S;ENSP00000385621:L52S	ENSP00000341730:L103S	L	+	2	0	RPL10	153281455	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.369000	0.79578	1.617000	0.50277	0.417000	0.27973	TTG		0.478	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013	
NTSR2	23620	broad.mit.edu	37	2	11800224	11800224	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:11800224G>A	ENST00000306928.5	-	3	968	c.934C>T	c.(934-936)Ccg>Tcg	p.P312S		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	312					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)	p.P312S(1)		breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	GCATGGTACGGCAGCCAGCAG	0.562																																					p.P312S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C934T	2						.						100.0	86.0	90.0					2																	11800224		2203	4300	6503	11717675	SO:0001583	missense	23620	exon3			Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.934C>T	2.37:g.11800224G>A	ENSP00000303686:p.Pro312Ser		11717675	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Missense_Mutation	SNP	ENST00000306928.5	37	CCDS1681.1	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908729	0.72868	.	.	ENSG00000169006	ENST00000306928	T	0.80304	-1.36	3.33	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.128890	0.34750	N	0.003701	D	0.90923	0.7147	M	0.92555	3.32	0.39942	D	0.974426	D	0.89917	1.0	D	0.77557	0.99	D	0.93217	0.6605	10	0.87932	D	0	-25.8996	12.9419	0.58350	0.0:0.0:1.0:0.0	.	312	O95665	NTR2_HUMAN	S	312	ENSP00000303686:P312S	ENSP00000303686:P312S	P	-	1	0	NTSR2	11717675	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.514000	0.81750	2.149000	0.67028	0.650000	0.86243	CCG		0.562	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
CNTNAP5	129684	broad.mit.edu	37	2	125521264	125521264	+	Silent	SNP	C	C	A			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:125521264C>A	ENST00000431078.1	+	15	2611	c.2247C>A	c.(2245-2247)ggC>ggA	p.G749G		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	749	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G749G(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		ATGATACTGGCTTTCTTTCCT	0.408																																					p.G749G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2247A	2						.						85.0	76.0	78.0					2																	125521264		1843	4092	5935	125237734	SO:0001819	synonymous_variant	129684	exon15			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2247C>A	2.37:g.125521264C>A			125237734	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	ENST00000431078.1	37	CCDS46401.1																																																																																				0.408	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
MYO7B	4648	broad.mit.edu	37	2	128338352	128338352	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:128338352C>T	ENST00000409816.2	+	9	1067	c.1035C>T	c.(1033-1035)gaC>gaT	p.D345D	MYO7B_ENST00000389524.4_Silent_p.D345D|MYO7B_ENST00000428314.1_Silent_p.D345D			Q6PIF6	MYO7B_HUMAN	myosin VIIB	345	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.D345E(2)|p.D345D(2)		breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACGCCTCAGACGTGATGGAGA	0.602																																					p.D345D												.	.	4	Substitution - Missense(2)|Substitution - coding silent(2)	large_intestine(2)|lung(2)	c.C1035T	2						.						55.0	57.0	56.0					2																	128338352		1993	4164	6157	128054822	SO:0001819	synonymous_variant	4648	exon10				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1035C>T	2.37:g.128338352C>T			128054822	NM_001080527	Q14786|Q8TEE1	Silent	SNP	ENST00000409816.2	37	CCDS46405.1																																																																																				0.602	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331124.3	XM_291001	
NCKAP5	344148	broad.mit.edu	37	2	133539711	133539711	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:133539711G>C	ENST00000409261.1	-	14	5046	c.4673C>G	c.(4672-4674)cCt>cGt	p.P1558R	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000317721.6_Missense_Mutation_p.P1558R|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1558								p.P1558R(2)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTGTAGTTCAGGCTTCTTTTT	0.378																																					p.P1558R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C4673G	2						.						141.0	130.0	133.0					2																	133539711		1849	4096	5945	133256181	SO:0001583	missense	344148	exon14			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4673C>G	2.37:g.133539711G>C	ENSP00000387128:p.Pro1558Arg		133256181	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	37	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.908355	0.33721	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.09350	2.99;2.99	5.33	4.43	0.53597	.	0.624337	0.11884	U	0.520243	T	0.08179	0.0204	N	0.19112	0.55	0.22156	N	0.999321	P	0.44380	0.834	B	0.42282	0.382	T	0.19943	-1.0290	10	0.25751	T	0.34	.	9.4479	0.38708	0.0771:0.1426:0.7803:0.0	.	1558	O14513	NCKP5_HUMAN	R	1558	ENSP00000387128:P1558R;ENSP00000380603:P1558R	ENSP00000380603:P1558R	P	-	2	0	NCKAP5	133256181	0.828000	0.29307	0.972000	0.41901	0.941000	0.58515	2.851000	0.48302	2.781000	0.95711	0.591000	0.81541	CCT		0.378	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
LRP1B	53353	broad.mit.edu	37	2	141643736	141643736	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:141643736A>C	ENST00000389484.3	-	24	4906	c.3935T>G	c.(3934-3936)aTa>aGa	p.I1312R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1312					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.I1312R(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCCCCGGTATATTCTGTCTTC	0.303										TSP Lung(27;0.18)																											p.I1312R	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3935G	2						.						60.0	61.0	61.0					2																	141643736		2202	4299	6501	141360206	SO:0001583	missense	53353	exon24			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3935T>G	2.37:g.141643736A>C	ENSP00000374135:p.Ile1312Arg		141360206	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.420845	0.83559	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.94138	-3.36;-3.36	5.68	5.68	0.88126	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97926	0.9318	H	0.96662	3.86	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	D	0.99372	1.0920	10	0.87932	D	0	.	15.9351	0.79698	1.0:0.0:0.0:0.0	.	495;1312	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	R	1312;1250;457	ENSP00000374135:I1312R;ENSP00000413239:I457R	ENSP00000374135:I1312R	I	-	2	0	LRP1B	141360206	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.124000	0.94394	2.159000	0.67721	0.528000	0.53228	ATA		0.303	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
NEB	4703	broad.mit.edu	37	2	152500443	152500443	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:152500443G>A	ENST00000172853.10	-	57	7992	c.7845C>T	c.(7843-7845)tgC>tgT	p.C2615C	NEB_ENST00000427231.2_Silent_p.C2615C|NEB_ENST00000604864.1_Silent_p.C2615C|NEB_ENST00000397345.3_Silent_p.C2615C|NEB_ENST00000409198.1_Silent_p.C2615C|NEB_ENST00000603639.1_Silent_p.C2615C			P20929	NEBU_HUMAN	nebulin	2615					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.C2615C(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTAAGGTCTGGCACTTCTTGG	0.557																																					p.C2615C												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C7845T	2						.						347.0	332.0	337.0					2																	152500443		2069	4207	6276	152208689	SO:0001819	synonymous_variant	4703	exon57			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7845C>T	2.37:g.152500443G>A			152208689	NM_001164507	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																					0.557	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
CACNB4	785	broad.mit.edu	37	2	152717291	152717291	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4005-01	TCGA-AG-4005-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:152717291T>C	ENST00000539935.1	-	10	869	c.802A>G	c.(802-804)Agg>Ggg	p.R268G	CACNB4_ENST00000360283.6_Missense_Mutation_p.R235G|CACNB4_ENST00000534999.1_Missense_Mutation_p.R234G|CACNB4_ENST00000427385.1_Missense_Mutation_p.R250G|CACNB4_ENST00000201943.5_Missense_Mutation_p.R268G|CACNB4_ENST00000397327.2_Missense_Mutation_p.R221G	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	268					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.R268G(2)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGACAGACCTCTTAGCAAGA	0.418																																					p.R268G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A802G	2						.						158.0	150.0	153.0					2																	152717291		1880	4112	5992	152425537	SO:0001583	missense	785	exon10			AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.802A>G	2.37:g.152717291T>C	ENSP00000438949:p.Arg268Gly		152425537	NM_001145798	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	ENST00000539935.1	37	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.162886	0.78226	.	.	ENSG00000182389	ENST00000539935;ENST00000360283;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943;ENST00000339254	D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	5.82	4.63	0.57726	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.000000	0.85682	D	0.000000	D	0.95220	0.8450	M	0.91038	3.17	0.80722	D	1	D;D;D;D	0.69078	0.994;0.995;0.997;0.994	D;D;D;D	0.83275	0.985;0.989;0.996;0.981	D	0.95401	0.8490	10	0.87932	D	0	-15.9052	12.6562	0.56788	0.0:0.0:0.1382:0.8618	.	268;268;250;234	A7BJ74;O00305;B4DG40;O00305-2	.;CACB4_HUMAN;.;.	G	268;235;225;263;234;221;250;268;269	ENSP00000438949:R268G;ENSP00000353425:R235G;ENSP00000390161:R263G;ENSP00000443893:R234G;ENSP00000380490:R221G;ENSP00000410978:R250G;ENSP00000201943:R268G	ENSP00000201943:R268G	R	-	1	2	CACNB4	152425537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.359000	0.52292	0.980000	0.38523	0.455000	0.32223	AGG		0.418	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
ITGA4	3676	broad.mit.edu	37	2	182388171	182388171	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:182388171A>G	ENST00000397033.2	+	19	2511	c.2081A>G	c.(2080-2082)aAg>aGg	p.K694R		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	694					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)	p.K694R(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	TAGGAAGAGAAGCAAATAAAC	0.343																																					p.K694R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2081G	2						.						105.0	99.0	101.0					2																	182388171		1836	4094	5930	182096416	SO:0001583	missense	3676	exon19				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.2081A>G	2.37:g.182388171A>G	ENSP00000380227:p.Lys694Arg		182096416	NM_000885	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	.	.	.	.	.	.	.	.	.	.	A	15.99	2.996769	0.54147	.	.	ENSG00000115232	ENST00000397033	T	0.46063	0.88	4.94	4.94	0.65067	Integrin alpha-2 (1);	0.046879	0.85682	D	0.000000	T	0.54727	0.1876	M	0.61703	1.905	0.44995	D	0.998014	D;D	0.62365	0.991;0.991	D;D	0.64776	0.929;0.929	T	0.51212	-0.8734	10	0.22706	T	0.39	.	10.3183	0.43751	0.8351:0.1649:0.0:0.0	.	516;694	Q59H74;P13612	.;ITA4_HUMAN	R	694	ENSP00000380227:K694R	ENSP00000380227:K694R	K	+	2	0	ITGA4	182096416	1.000000	0.71417	0.995000	0.50966	0.807000	0.45602	3.863000	0.56016	1.975000	0.57531	0.477000	0.44152	AAG		0.343	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
APOB	338	broad.mit.edu	37	2	21227306	21227306	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:21227306C>T	ENST00000233242.1	-	28	12049	c.11922G>A	c.(11920-11922)gcG>gcA	p.A3974A		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3974					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.A3974A(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TATTGAGGTGCGCTTTTCCTT	0.473																																					p.A3974A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G11922A	2						.						133.0	131.0	132.0					2																	21227306		2203	4300	6503	21080811	SO:0001819	synonymous_variant	338	exon28			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11922G>A	2.37:g.21227306C>T			21080811	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																				0.473	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	broad.mit.edu	37	2	21245844	21245844	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:21245844G>A	ENST00000233242.1	-	18	2802	c.2675C>T	c.(2674-2676)cCg>cTg	p.P892L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	892					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.P892L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCGAAGTCCGGAATGATGAT	0.483																																					p.P892L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2675T	2						.						110.0	109.0	110.0					2																	21245844		2203	4300	6503	21099349	SO:0001583	missense	338	exon18			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2675C>T	2.37:g.21245844G>A	ENSP00000233242:p.Pro892Leu		21099349	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683825	0.88639	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.21031	2.03	5.51	5.51	0.81932	Lipid transport protein, beta-sheet shell (1);Vitellinogen, open beta-sheet (1);Vitellinogen, open beta-sheet, subdomain 2 (1);	0.000000	0.64402	D	0.000009	T	0.53061	0.1773	M	0.82923	2.615	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55692	-0.8101	10	0.62326	D	0.03	.	19.7977	0.96492	0.0:0.0:1.0:0.0	.	892	P04114	APOB_HUMAN	L	892	ENSP00000233242:P892L	ENSP00000233242:P892L	P	-	2	0	APOB	21099349	1.000000	0.71417	0.902000	0.35471	0.687000	0.40016	9.360000	0.97119	2.765000	0.95021	0.655000	0.94253	CCG		0.483	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
STAT4	6775	broad.mit.edu	37	2	191905872	191905872	+	Silent	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:191905872G>T	ENST00000392320.2	-	15	1568	c.1254C>A	c.(1252-1254)ggC>ggA	p.G418G	STAT4_ENST00000358470.4_Silent_p.G418G|STAT4_ENST00000470708.1_5'UTR	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	418					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.G418G(1)		breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CCATGTGACAGCCCTAAGGAA	0.333																																					p.G418G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1254A	2						.						103.0	97.0	99.0					2																	191905872		2203	4300	6503	191614117	SO:0001819	synonymous_variant	6775	exon15				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.1254C>A	2.37:g.191905872G>T			191614117	NM_003151	Q96NZ6	Silent	SNP	ENST00000392320.2	37	CCDS2310.1																																																																																				0.333	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335586.1	NM_003151	
FN1	2335	broad.mit.edu	37	2	216247030	216247030	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:216247030A>G	ENST00000359671.1	-	31	5061	c.4796T>C	c.(4795-4797)aTt>aCt	p.I1599T	FN1_ENST00000490833.1_5'UTR|FN1_ENST00000336916.4_Missense_Mutation_p.I1599T|FN1_ENST00000346544.3_Missense_Mutation_p.I1599T|FN1_ENST00000357009.2_Missense_Mutation_p.I1599T|FN1_ENST00000421182.1_Missense_Mutation_p.I1599T|FN1_ENST00000356005.4_Missense_Mutation_p.I1599T|FN1_ENST00000345488.5_Missense_Mutation_p.I1599T|FN1_ENST00000443816.1_Missense_Mutation_p.I1599T|FN1_ENST00000323926.6_Missense_Mutation_p.I1690T|FN1_ENST00000354785.4_Missense_Mutation_p.I1690T|FN1_ENST00000446046.1_Missense_Mutation_p.I1599T|FN1_ENST00000432072.2_Missense_Mutation_p.I1690T|FN1_ENST00000357867.4_Missense_Mutation_p.I1599T			P02751	FINC_HUMAN	fibronectin 1	1599	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)	p.I1599T(1)	FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CAAGCCTTCAATAGTCATTTC	0.463																																					p.I1599T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4796C	2						.						82.0	72.0	75.0					2																	216247030		2203	4300	6503	215955275	SO:0001583	missense	2335	exon31				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4796T>C	2.37:g.216247030A>G	ENSP00000352696:p.Ile1599Thr		215955275	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	A	23.3	4.395075	0.83011	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22;0.22	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000002	T	0.79839	0.4515	M	0.86953	2.85	0.80722	D	1	D;D;D;B;P;D;D;P;D;D;D;D	0.71674	0.998;0.981;0.99;0.087;0.733;0.997;0.998;0.938;0.996;0.99;0.99;0.995	D;D;D;B;P;D;D;D;D;D;D;D	0.87578	0.998;0.987;0.987;0.155;0.621;0.996;0.998;0.942;0.998;0.987;0.987;0.993	D	0.83530	0.0090	10	0.87932	D	0	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	1390;1599;1690;1690;1599;1599;1599;1599;1600;1599;1599;1690	Q68CX6;F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.;.;.	T	1599;1690;1599;1599;1690;1600;1599;1599;1599;1599;1599;1599;1690;1599;406	ENSP00000394423:I1599T;ENSP00000323534:I1690T;ENSP00000338200:I1599T;ENSP00000350534:I1599T;ENSP00000346839:I1690T;ENSP00000352696:I1599T;ENSP00000265312:I1599T;ENSP00000273049:I1599T;ENSP00000349509:I1599T;ENSP00000410422:I1599T;ENSP00000415018:I1599T;ENSP00000399538:I1690T;ENSP00000348285:I1599T;ENSP00000416139:I406T	ENSP00000265313:I1600T	I	-	2	0	FN1	215955275	1.000000	0.71417	0.987000	0.45799	0.973000	0.67179	9.300000	0.96151	2.254000	0.74563	0.533000	0.62120	ATT		0.463	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
AGBL5	60509	broad.mit.edu	37	2	27292470	27292470	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:27292470G>A	ENST00000360131.4	+	14	2544	c.2385G>A	c.(2383-2385)ccG>ccA	p.P795P		NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	795					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.P795P(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGCTCACCGCCGACTCGCA	0.587																																					p.P795P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2385A	2						.						117.0	132.0	127.0					2																	27292470		2203	4300	6503	27145974	SO:0001819	synonymous_variant	60509	exon14			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.2385G>A	2.37:g.27292470G>A			27145974	NM_021831	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	ENST00000360131.4	37	CCDS1732.3																																																																																				0.587	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309033.1	NM_021831	
CALM2	805	broad.mit.edu	37	2	47397889	47397889	+	Silent	SNP	A	A	G			TCGA-AG-4005-01	TCGA-AG-4005-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:47397889A>G	ENST00000272298.7	-	2	175	c.18T>C	c.(16-18)acT>acC	p.T6T	RP11-761B3.1_ENST00000422269.1_Missense_Mutation_p.L29P|CALM2_ENST00000409563.1_5'UTR|CALM2_ENST00000484408.1_5'UTR	NM_001743.4	NP_001734.1	P62158	CALM_HUMAN	calmodulin 2 (phosphorylase kinase, delta)	6					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)	p.0?(2)|p.T6T(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)	5		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	TCTGCTCTTCAGTCAGTTGGT	0.368																																					p.T6T												.	.	3	Whole gene deletion(2)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)	c.T18C	2						.						129.0	130.0	130.0					2																	47397889		2203	4300	6503	47251393	SO:0001819	synonymous_variant	805	exon2				CCDS1832.1	2p21.3-p21.1	2013-02-25			ENSG00000143933	ENSG00000143933		"""EF-hand domain containing"", ""Endogenous ligands"""	1445	protein-coding gene	gene with protein product	"""prepro-calmodulin 2"""	114182					Standard	NM_001743		Approved	PHKD, CAMII	uc002rvt.2	P62158	OTTHUMG00000128850	ENST00000272298.7:c.18T>C	2.37:g.47397889A>G			47251393	NM_001743	P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	Silent	SNP	ENST00000272298.7	37	CCDS1832.1																																																																																				0.368	CALM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250789.3	NM_001743	
CTNNA2	1496	broad.mit.edu	37	2	80101313	80101313	+	Missense_Mutation	SNP	G	G	A	rs559758762		TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:80101313G>A	ENST00000402739.4	+	5	702	c.697G>A	c.(697-699)Gtc>Atc	p.V233I	CTNNA2_ENST00000466387.1_Missense_Mutation_p.V233I|CTNNA2_ENST00000541047.1_Missense_Mutation_p.V233I|CTNNA2_ENST00000496558.1_Missense_Mutation_p.V233I|CTNNA2_ENST00000540488.1_Missense_Mutation_p.V233I|CTNNA2_ENST00000361291.4_Missense_Mutation_p.V267I	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	233					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.V233I(2)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CCACCCAGATGTCGCCGCTAC	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		16564	0.0		0.001	False		,,,				2504	0.0				p.V233I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G697A	2						.						51.0	56.0	54.0					2																	80101313		2072	4220	6292	79954821	SO:0001583	missense	1496	exon6				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.697G>A	2.37:g.80101313G>A	ENSP00000384638:p.Val233Ile		79954821	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	18.73	3.687461	0.68157	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000001	T	0.44138	0.1279	L	0.60845	1.875	0.80722	D	1	B;B;B	0.28400	0.21;0.095;0.095	B;B;B	0.28916	0.089;0.096;0.096	T	0.24835	-1.0149	10	0.24483	T	0.36	.	19.8448	0.96704	0.0:0.0:1.0:0.0	.	233;233;233	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	I	233;233;267;233;233;233	ENSP00000418191:V233I;ENSP00000419295:V233I;ENSP00000355398:V267I;ENSP00000384638:V233I;ENSP00000444675:V233I;ENSP00000441705:V233I	ENSP00000355398:V267I	V	+	1	0	CTNNA2	79954821	1.000000	0.71417	0.979000	0.43373	0.821000	0.46438	9.869000	0.99810	2.686000	0.91538	0.650000	0.86243	GTC		0.577	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
Unknown	0	broad.mit.edu	37	2	98156677	98156677	+	IGR	SNP	C	C	T	rs536823787	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:98156677C>T								AC159540.1 (65628 upstream) : ANKRD36B (7350 downstream)																							CAAGGCTGGTCGTCTCTGAGA	0.313																																					p.R634Q												.	.	0			c.G1901A	2						.						67.0	53.0	58.0					2																	98156677		1550	2479	4029	97523109	SO:0001628	intergenic_variant	57730	exon29																															2.37:g.98156677C>T			97523109	NM_025190		Missense_Mutation	SNP		37																																																																																				0	0.313								
IRS1	3667	broad.mit.edu	37	2	227662786	227662786	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr2:227662786G>A	ENST00000305123.5	-	1	1689	c.669C>T	c.(667-669)atC>atT	p.I223I	RP11-395N3.2_ENST00000607970.1_lincRNA|IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	223	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.I223I(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGCCCACCTCGATGAAGAAGA	0.607											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I223I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C669T	2						.						76.0	84.0	82.0					2																	227662786		2203	4300	6503	227371030	SO:0001819	synonymous_variant	3667	exon1				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.669C>T	2.37:g.227662786G>A		2321	227371030	NM_005544		Silent	SNP	ENST00000305123.5	37	CCDS2463.1																																																																																				0.607	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
APBA1	320	broad.mit.edu	37	9	72067136	72067136	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr9:72067136C>T	ENST00000265381.4	-	9	2092	c.1870G>A	c.(1870-1872)Gaa>Aaa	p.E624K		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	624	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E624K(2)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CTGAGATCTTCGGGGTTAATC	0.502																																					p.E624K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1870A	9						.						205.0	172.0	183.0					9																	72067136		2203	4300	6503	71256956	SO:0001583	missense	320	exon9			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1870G>A	9.37:g.72067136C>T	ENSP00000265381:p.Glu624Lys		71256956	NM_001163	O14914|O60570|Q5VYR8	Missense_Mutation	SNP	ENST00000265381.4	37	CCDS6630.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.823790	0.90873	.	.	ENSG00000107282	ENST00000265381	T	0.04502	3.61	5.54	5.54	0.83059	Phosphotyrosine interaction domain (1);	0.000000	0.85682	D	0.000000	T	0.18759	0.0450	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.00098	-1.2070	10	0.45353	T	0.12	-11.9676	19.4843	0.95024	0.0:1.0:0.0:0.0	.	624	Q02410	APBA1_HUMAN	K	624	ENSP00000265381:E624K	ENSP00000265381:E624K	E	-	1	0	APBA1	71256956	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.884000	0.63135	2.610000	0.88304	0.655000	0.94253	GAA		0.502	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
TSC1	7248	broad.mit.edu	37	9	135772645	135772645	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr9:135772645G>A	ENST00000298552.3	-	22	3122	c.2901C>T	c.(2899-2901)ggC>ggT	p.G967G	TSC1_ENST00000440111.2_Silent_p.G967G|TSC1_ENST00000545250.1_Silent_p.G916G	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	967					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.G967G(1)|p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TCTCCAACCTGCCATATAAAT	0.443			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.G966G		yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	.	.	2	Unknown(1)|Substitution - coding silent(1)	large_intestine(1)|bone(1)	c.C2898T	9						.						134.0	140.0	138.0					9																	135772645		2203	4300	6503	134762466	SO:0001819	synonymous_variant	7248	exon22	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2901C>T	9.37:g.135772645G>A			134762466	NM_001162426	B7Z897|Q5VVN5	Silent	SNP	ENST00000298552.3	37	CCDS6956.1																																																																																				0.443	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
METTL21C	196541	broad.mit.edu	37	13	103346751	103346751	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:103346751G>A	ENST00000267273.6	-	1	103	c.98C>T	c.(97-99)cCg>cTg	p.P33L		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	33					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)	p.P33L(1)		breast(1)|large_intestine(3)|lung(2)|skin(1)	7						GTCTTTCTGCGGAGCCCCCTT	0.577																																					p.P33L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C98T	13						.						54.0	53.0	53.0					13																	103346751		2203	4300	6503	102144752	SO:0001583	missense	196541	exon1				CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.98C>T	13.37:g.103346751G>A	ENSP00000267273:p.Pro33Leu		102144752	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	37	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	G	3.352	-0.132307	0.06753	.	.	ENSG00000139780	ENST00000267273	T	0.12569	2.67	4.31	-2.77	0.05877	.	1.401160	0.04609	N	0.399880	T	0.05090	0.0136	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39643	-0.9604	10	0.30078	T	0.28	-6.3194	8.8733	0.35330	0.5016:0.0:0.4984:0.0	.	33	Q5VZV1	MT21C_HUMAN	L	33	ENSP00000267273:P33L	ENSP00000267273:P33L	P	-	2	0	METTL21C	102144752	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.105000	0.15333	-0.382000	0.07870	-1.223000	0.01593	CCG		0.577	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
TPTE2	93492	broad.mit.edu	37	13	20049728	20049728	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:20049728G>T	ENST00000400230.2	-	5	259	c.215C>A	c.(214-216)tCa>tAa	p.S72*	TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382975.4_Nonsense_Mutation_p.S72*|TPTE2_ENST00000457266.2_Intron|TPTE2_ENST00000382977.4_Nonsense_Mutation_p.S72*|TPTE2_ENST00000382978.1_Nonsense_Mutation_p.S72*|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000400103.2_Intron			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	72					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S72*(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		TGCAAAGGATGATACAATTGA	0.338																																					p.S72X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C215A	13						.						29.0	30.0	30.0					13																	20049728		2201	4294	6495	18947728	SO:0001587	stop_gained	93492	exon6			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.215C>A	13.37:g.20049728G>T	ENSP00000383089:p.Ser72*		18947728	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Nonsense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	g	19.90	3.913320	0.72983	.	.	ENSG00000132958	ENST00000382978;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000343548	.	.	.	2.29	2.29	0.28610	.	0.376195	0.24717	U	0.036161	.	.	.	.	.	.	0.21184	N	0.999763	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.2474	8.1387	0.31069	0.0:0.0:1.0:0.0	.	.	.	.	X	72	.	.	S	-	2	0	TPTE2	18947728	0.901000	0.30685	0.054000	0.19295	0.169000	0.22640	1.547000	0.36190	1.590000	0.49995	0.467000	0.42956	TCA		0.338	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
SACS	26278	broad.mit.edu	37	13	23910682	23910682	+	Nonsense_Mutation	SNP	C	C	A	rs564734108		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:23910682C>A	ENST00000382292.3	-	9	7606	c.7333G>T	c.(7333-7335)Gag>Tag	p.E2445*	SACS_ENST00000382298.3_Nonsense_Mutation_p.E2445*|SACS_ENST00000402364.1_Nonsense_Mutation_p.E1695*			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2445					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E2298*(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TAATTTTTCTCACAAAATTCT	0.343																																					p.E2445X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G7333T	13						.						74.0	77.0	76.0					13																	23910682		2203	4299	6502	22808682	SO:0001587	stop_gained	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.7333G>T	13.37:g.23910682C>A	ENSP00000371729:p.Glu2445*		22808682	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Nonsense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	56	26.749135	0.99969	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	.	.	.	5.6	5.6	0.85130	.	0.176257	0.50627	D	0.000118	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	19.6023	0.95568	0.0:1.0:0.0:0.0	.	.	.	.	X	2445;1695;2445	.	ENSP00000371729:E2445X	E	-	1	0	SACS	22808682	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.115000	0.50391	2.653000	0.90120	0.561000	0.74099	GAG		0.343	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
WASF3	10810	broad.mit.edu	37	13	27250749	27250749	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:27250749C>T	ENST00000335327.5	+	7	782	c.604C>T	c.(604-606)Cgc>Tgc	p.R202C	WASF3_ENST00000496788.1_3'UTR|WASF3_ENST00000361042.4_Intron	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	202					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)		p.R202C(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CAGAAACAGGCGCCAGGAGTG	0.502																																					p.R202C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C604T	13						.						132.0	130.0	131.0					13																	27250749		2203	4300	6503	26148749	SO:0001583	missense	10810	exon7			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.604C>T	13.37:g.27250749C>T	ENSP00000335055:p.Arg202Cys		26148749	NM_006646	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	37	CCDS9318.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954114	0.92726	.	.	ENSG00000132970	ENST00000335327	T	0.49432	0.78	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.67411	0.2890	M	0.79258	2.445	0.80722	D	1	D	0.76494	0.999	P	0.56865	0.808	T	0.70850	-0.4760	10	0.87932	D	0	-11.6242	19.9634	0.97258	0.0:1.0:0.0:0.0	.	202	Q9UPY6	WASF3_HUMAN	C	202	ENSP00000335055:R202C	ENSP00000335055:R202C	R	+	1	0	WASF3	26148749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.478000	0.66806	2.726000	0.93360	0.591000	0.81541	CGC		0.502	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
RBM26	64062	broad.mit.edu	37	13	79911344	79911344	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:79911344G>A	ENST00000438737.2	-	19	3066	c.2626C>T	c.(2626-2628)Cga>Tga	p.R876*	RBM26_ENST00000267229.7_Nonsense_Mutation_p.R849*|RBM26_ENST00000438724.1_Nonsense_Mutation_p.R852*			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	876					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R849*(1)|p.R876*(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		CCTCGCCCTCGCCCTCGCCCC	0.562																																					p.R849X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2545T	13						.						108.0	89.0	96.0					13																	79911344		2203	4300	6503	78809345	SO:0001587	stop_gained	64062	exon18			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.2626C>T	13.37:g.79911344G>A	ENSP00000387531:p.Arg876*		78809345	NM_022118	B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Nonsense_Mutation	SNP	ENST00000438737.2	37		.	.	.	.	.	.	.	.	.	.	G	44	11.121188	0.99518	.	.	ENSG00000139746	ENST00000449987;ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	.	.	.	4.89	3.98	0.46160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.4544	12.7836	0.57491	0.0:0.0:0.7152:0.2848	.	.	.	.	X	62;849;877;876;852	.	.	R	-	1	2	RBM26	78809345	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	2.678000	0.46900	2.406000	0.81754	0.650000	0.86243	CGA		0.562	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045373.4	NM_022118	
HS6ST3	266722	broad.mit.edu	37	13	97485095	97485095	+	Silent	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:97485095C>T	ENST00000376705.2	+	2	1083	c.1059C>T	c.(1057-1059)ctC>ctT	p.L353L		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	353					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)	p.L353L(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					TCTTTGGGCTCACTGAGTTCC	0.463																																					p.L353L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1059T	13						.						99.0	102.0	101.0					13																	97485095		2203	4300	6503	96283096	SO:0001819	synonymous_variant	266722	exon2			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.1059C>T	13.37:g.97485095C>T			96283096	NM_153456	Q5W0L0|Q68CW6	Silent	SNP	ENST00000376705.2	37	CCDS9481.1																																																																																				0.463	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456	
FARP1	10160	broad.mit.edu	37	13	99061752	99061752	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:99061752G>A	ENST00000319562.6	+	14	1840	c.1575G>A	c.(1573-1575)acG>acA	p.T525T	FARP1_ENST00000376586.2_Silent_p.T525T|FARP1_ENST00000595437.1_Silent_p.T525T	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	525					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T525T(2)		breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GCCCCCGGACGGACGATGAGG	0.597																																					p.T525T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1575A	13						.						28.0	21.0	24.0					13																	99061752		2203	4300	6503	97859753	SO:0001819	synonymous_variant	10160	exon14			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1575G>A	13.37:g.99061752G>A			97859753	NM_005766	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	G	9.017	0.983827	0.18889	.	.	ENSG00000152767	ENST00000457029	.	.	.	5.57	-11.1	0.00147	.	.	.	.	.	T	0.32645	0.0836	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42749	-0.9433	4	.	.	.	.	2.1902	0.03897	0.2377:0.3487:0.0944:0.3193	.	.	.	.	Q	54	.	.	R	+	2	0	FARP1	97859753	0.000000	0.05858	0.064000	0.19789	0.879000	0.50718	-2.950000	0.00678	-3.054000	0.00259	-0.136000	0.14681	CGG		0.597	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
MCF2L	23263	broad.mit.edu	37	13	113739450	113739450	+	Silent	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr13:113739450G>T	ENST00000375608.3	+	21	2353	c.2295G>T	c.(2293-2295)ctG>ctT	p.L765L	MCF2L_ENST00000434480.2_Silent_p.L741L|MCF2L_ENST00000421756.1_Silent_p.L739L|MCF2L_ENST00000423482.2_Silent_p.L733L|MCF2L_ENST00000397030.1_Silent_p.L768L|MCF2L_ENST00000375597.4_Silent_p.L733L|MCF2L_ENST00000442652.2_Silent_p.L765L|MCF2L_ENST00000375604.2_Silent_p.L792L|MCF2L_ENST00000535094.2_Silent_p.L735L|MCF2L_ENST00000375601.3_Silent_p.L739L			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	765	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L739L(1)		kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CCTACCTGCTGAAGCCAGTGC	0.582																																					p.L739L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2217T	13						.						71.0	63.0	66.0					13																	113739450		2203	4300	6503	112787451	SO:0001819	synonymous_variant	23263	exon20			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.2295G>T	13.37:g.113739450G>T			112787451	NM_024979	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Silent	SNP	ENST00000375608.3	37		.	.	.	.	.	.	.	.	.	.	G	9.251	1.040818	0.19669	.	.	ENSG00000126217	ENST00000397017	.	.	.	4.83	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6485	0.39883	0.161:0.0:0.839:0.0	.	.	.	.	X	396	.	.	E	+	1	0	MCF2L	112787451	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.397000	0.52572	1.035000	0.39972	0.306000	0.20318	GAA		0.582	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
LZTS2	84445	broad.mit.edu	37	10	102766409	102766409	+	Silent	SNP	C	C	T	rs183305963	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr10:102766409C>T	ENST00000370220.1	+	4	4557	c.1494C>T	c.(1492-1494)gcC>gcT	p.A498A	LZTS2_ENST00000370223.3_Silent_p.A498A					leucine zipper, putative tumor suppressor 2									p.A498A(1)		breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TACAGGAGGCCGCCCGAGCTC	0.697													C|||	15	0.00299521	0.0	0.0072	5008	,	,		13583	0.0		0.0099	False		,,,				2504	0.0				p.A498A	Esophageal Squamous(8;38 437 13604 19902 37640)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1494T	10						.	C		8,4346		0,8,2169	10.0	13.0	12.0		1494	-9.6	0.8	10		12	72,8456		0,72,4192	no	coding-synonymous	LZTS2	NM_032429.2		0,80,6361	TT,TC,CC		0.8443,0.1837,0.621		498/670	102766409	80,12802	2177	4264	6441	102756399	SO:0001819	synonymous_variant	84445	exon5			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1494C>T	10.37:g.102766409C>T			102756399	NM_032429		Silent	SNP	ENST00000370220.1	37	CCDS7507.1																																																																																				0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
SYT15	83849	broad.mit.edu	37	10	46968587	46968587	+	Missense_Mutation	SNP	C	C	T	rs373437721	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr10:46968587C>T	ENST00000374321.4	-	3	415	c.349G>A	c.(349-351)Ggc>Agc	p.G117S	SYT15_ENST00000374323.4_Missense_Mutation_p.G170S|SYT15_ENST00000503753.1_Missense_Mutation_p.G117S|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374325.3_Missense_Mutation_p.G117S	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G117S(2)		cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						TCACCAAGGCCGCCGCTGGAG	0.657													C|||	2	0.000399361	0.0015	0.0	5008	,	,		33609	0.0		0.0	False		,,,				2504	0.0				p.G117S	Ovarian(57;1152 1428 19651 37745)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G349A	10						.																																			46388593	SO:0001583	missense	83849	exon3			AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.349G>A	10.37:g.46968587C>T	ENSP00000363441:p.Gly117Ser		46388593	NM_181519	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	.	3.038	-0.198099	0.06219	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321	T;T;T;T	0.12465	2.68;2.68;2.87;2.89	4.37	0.329	0.15924	.	1.202190	0.06237	N	0.689767	T	0.04407	0.0121	N	0.04090	-0.28	0.09310	N	1	B;B	0.17852	0.007;0.024	B;B	0.06405	0.002;0.002	T	0.38520	-0.9657	10	0.06494	T	0.89	.	0.737	0.00967	0.2873:0.1088:0.1665:0.4374	.	117;117	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	S	117;117;117;170;117	ENSP00000363445:G117S;ENSP00000427607:G117S;ENSP00000363443:G170S;ENSP00000363441:G117S	ENSP00000363441:G117S	G	-	1	0	SYT15	46388593	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.273000	0.18662	0.294000	0.22547	-0.391000	0.06502	GGC		0.657	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912	
TLX1NB	100038246	broad.mit.edu	37	10	102849370	102849370	+	Frame_Shift_Del	DEL	T	T	-	rs200664029	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr10:102849370delT	ENST00000445873.1	-	3	1569	c.293delA	c.(292-294)cagfs	p.Q98fs	TLX1NB_ENST00000425505.1_5'Flank	NM_001085398.1	NP_001078867.1	P0CAT3	TLXNB_HUMAN	TLX1 neighbor	98																	TTTCTCCAGCTGAGGTGACCT	0.572													T|T|-|deletion	7	0.00139776	0.0008	0.0014	5008	,	,		15955	0.0		0.005	False		,,,				2504	0.0				p.Q98fs												.	.	0			c.293delA	10						.			8,3620		0,8,1806	33.0	33.0	33.0			1.1	0.0	10		33	75,7807		1,73,3867	no	frameshift	TLX1NB	NM_001085398.1		1,81,5673	A1A1,A1R,RR		0.9515,0.2205,0.7211			102849370	83,11427	1881	4116	5997	102839360	SO:0001589	frameshift_variant	100038246	exon3			BC019674	CCDS60615.1	10q24	2014-04-01			ENSG00000236311	ENSG00000236311			37183	protein-coding gene	gene with protein product		612734				17303350	Standard	NM_001085398		Approved	TD1, TDI, APT-B7	uc001ksv.3	P0CAT3	OTTHUMG00000018925	ENST00000445873.1:c.293delA	10.37:g.102849370delT	ENSP00000475001:p.Gln98fs		102839360	NM_001085398		Frame_Shift_Del	DEL	ENST00000445873.1	37																																																																																					0.572	TLX1NB-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000049925.2	NM_001085398	
SH3PXD2A	9644	broad.mit.edu	37	10	105526904	105526904	+	Silent	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr10:105526904G>A	ENST00000369774.4	-	3	453	c.177C>T	c.(175-177)ccC>ccT	p.P59P	SH3PXD2A_ENST00000355946.2_Silent_p.P59P			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	59	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)	p.P59P(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CACCTTCAATGGGAAACTTAT	0.542																																					p.P59P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C177T	10						.						95.0	74.0	81.0					10																	105526904		2203	4300	6503	105516894	SO:0001819	synonymous_variant	9644	exon3			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.177C>T	10.37:g.105526904G>A			105516894	NM_014631	D3DR98|O43302|Q5TCZ2|Q5TDQ8	Silent	SNP	ENST00000369774.4	37		.	.	.	.	.	.	.	.	.	.	G	10.10	1.256326	0.22965	.	.	ENSG00000107957	ENST00000420222	.	.	.	5.38	2.5	0.30297	.	.	.	.	.	T	0.57621	0.2066	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49234	-0.8961	4	.	.	.	-21.8477	8.5498	0.33444	0.2532:0.0:0.7468:0.0	.	.	.	.	Y	14	.	.	H	-	1	0	SH3PXD2A	105516894	0.985000	0.35326	0.992000	0.48379	0.998000	0.95712	0.042000	0.13949	0.252000	0.21531	0.561000	0.74099	CAT		0.542	SH3PXD2A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050178.1	NM_014631	
APC	324	broad.mit.edu	37	5	112174884	112174884	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr5:112174884C>G	ENST00000457016.1	+	16	3973	c.3593C>G	c.(3592-3594)tCa>tGa	p.S1198*	APC_ENST00000257430.4_Nonsense_Mutation_p.S1198*|APC_ENST00000508376.2_Nonsense_Mutation_p.S1198*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1198	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1198*(1)|p.K1192fs*3(1)|p.?(1)|p.S1198fs*1(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TTTTCATTCTCAAAGAGTTCA	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S1180X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	4	Substitution - Nonsense(1)|Unknown(1)|Complex - frameshift(1)|Deletion - Frameshift(1)	large_intestine(2)|soft_tissue(1)|skin(1)	c.C3539G	5	GRCh37	CM040980|CM990160	APC	M		.						84.0	88.0	87.0					5																	112174884		2202	4300	6502	112202783	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3593C>G	5.37:g.112174884C>G	ENSP00000413133:p.Ser1198*		112202783	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	38	7.020417	0.98006	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.91	5.91	0.95273	.	0.413227	0.24818	N	0.035348	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.3231	20.2983	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	1198	.	.	S	+	2	0	APC	112202783	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.331000	0.65905	2.802000	0.96397	0.655000	0.94253	TCA		0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175273	112175273	+	Nonsense_Mutation	SNP	C	C	T	rs398123121		TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr5:112175273C>T	ENST00000457016.1	+	16	4362	c.3982C>T	c.(3982-3984)Cag>Tag	p.Q1328*	APC_ENST00000257430.4_Nonsense_Mutation_p.Q1328*|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1328*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1328	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.			AVSQHPR -> SSVHSTLE (in Ref. 1; AAA60353/ AAA60354). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1328*(12)|p.Q1328fs*3(2)|p.?(1)|p.?fs(1)|p.K1192fs*3(1)|p.V1326fs*3(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCAGTGTCACAGCACCCTAG	0.448		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1310X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	18	Substitution - Nonsense(12)|Deletion - Frameshift(4)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(15)|soft_tissue(1)|endometrium(1)|skin(1)	c.C3928T	5	GRCh37	CM930028	APC	M		.						61.0	63.0	63.0					5																	112175273		2202	4300	6502	112203172	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3982C>T	5.37:g.112175273C>T	ENSP00000413133:p.Gln1328*		112203172	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	36	5.920796	0.97105	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.03	6.03	0.97812	.	0.360425	0.32258	N	0.006349	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.017	20.1672	0.98154	0.0:1.0:0.0:0.0	.	.	.	.	X	1328	.	.	Q	+	1	0	APC	112203172	1.000000	0.71417	0.958000	0.39756	0.198000	0.23893	4.377000	0.59562	2.861000	0.98227	0.655000	0.94253	CAG		0.448	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PCDHB16	57717	broad.mit.edu	37	5	140563203	140563203	+	Missense_Mutation	SNP	C	C	G	rs17857089	byFrequency	TCGA-AG-4005-01	TCGA-AG-4005-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr5:140563203C>G	ENST00000361016.2	+	1	2224	c.1069C>G	c.(1069-1071)Cca>Gca	p.P357A		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	357	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.			P -> A (in Ref. 7; AAH36062). {ECO:0000305}.	calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P357A(1)		breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGCCCCATCCCAGAGAACTC	0.532																																					p.P357A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1069G	5						.						81.0	85.0	84.0					5																	140563203		2203	4300	6503	140543387	SO:0001583	missense	57717	exon1			AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1069C>G	5.37:g.140563203C>G	ENSP00000354293:p.Pro357Ala		140543387	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	37	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	C	13.43	2.235645	0.39498	.	.	ENSG00000196963	ENST00000361016	T	0.73258	-0.73	4.47	2.6	0.31112	Cadherin (3);Cadherin-like (1);	0.000000	0.34046	N	0.004302	T	0.65037	0.2653	M	0.64676	1.99	0.26717	N	0.970867	B;B	0.16802	0.011;0.019	B;B	0.23150	0.017;0.044	T	0.58741	-0.7583	10	0.44086	T	0.13	.	9.5484	0.39295	0.0:0.7784:0.1415:0.0801	rs17857089;rs17857089	47;357	O15199;Q9NRJ7	.;PCDBG_HUMAN	A	357	ENSP00000354293:P357A	ENSP00000354293:P357A	P	+	1	0	PCDHB16	140543387	0.000000	0.05858	0.693000	0.30195	0.993000	0.82548	0.651000	0.24873	0.823000	0.34589	0.591000	0.81541	CCA		0.532	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
TCOF1	6949	broad.mit.edu	37	5	149776096	149776096	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4005-01	TCGA-AG-4005-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr5:149776096C>T	ENST00000504761.2	+	24	4033	c.4033C>T	c.(4033-4035)Cgc>Tgc	p.R1345C	TCOF1_ENST00000445265.2_Missense_Mutation_p.R1269C|TCOF1_ENST00000377797.3_Missense_Mutation_p.R1346C|TCOF1_ENST00000439160.2_Missense_Mutation_p.R1308C|TCOF1_ENST00000323668.7_Missense_Mutation_p.R1268C|TCOF1_ENST00000513346.1_Missense_Mutation_p.R1345C|TCOF1_ENST00000451292.1_Missense_Mutation_p.R1382C			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1345					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)	p.R1268C(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGGAGAGCCGCAAGCGGAA	0.617																																					p.R1345C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4033T	5						.						20.0	22.0	21.0					5																	149776096		2201	4295	6496	149756289	SO:0001583	missense	6949	exon24				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.4033C>T	5.37:g.149776096C>T	ENSP00000421655:p.Arg1345Cys		149756289	NM_001135243	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.568324	0.45798	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97;-0.97	4.8	3.01	0.34805	.	.	.	.	.	T	0.70710	0.3255	L	0.27053	0.805	0.09310	N	1	D;D;D;D;D	0.76494	0.996;0.996;0.996;0.999;0.996	P;P;P;P;P	0.56474	0.648;0.648;0.648;0.799;0.648	T	0.59467	-0.7449	9	0.87932	D	0	0.4065	6.311	0.21164	0.1815:0.7229:0.0:0.0956	.	1308;1268;1307;1345;1269	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	C	1382;1346;1269;1268;1308;1307;1345;1345	ENSP00000400939:R1382C;ENSP00000367028:R1346C;ENSP00000409944:R1269C;ENSP00000325223:R1268C;ENSP00000406888:R1308C;ENSP00000390717:R1307C;ENSP00000421655:R1345C;ENSP00000427484:R1345C	ENSP00000325223:R1268C	R	+	1	0	TCOF1	149756289	0.061000	0.20836	0.005000	0.12908	0.818000	0.46254	0.663000	0.25053	0.560000	0.29169	0.561000	0.74099	CGC		0.617	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
MAP1B	4131	broad.mit.edu	37	5	71490971	71490971	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr5:71490971G>T	ENST00000296755.7	+	5	2087	c.1789G>T	c.(1789-1791)Gag>Tag	p.E597*		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	597	Lys-rich (highly basic, contains many KKEE and KKEI/V repeats).				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.E597*(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AATAAAAACAGAGACCAAACC	0.453																																					p.E597X	Melanoma(17;367 822 11631 31730 47712)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1789T	5						.						63.0	66.0	65.0					5																	71490971		2203	4300	6503	71526727	SO:0001587	stop_gained	4131	exon5			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.1789G>T	5.37:g.71490971G>T	ENSP00000296755:p.Glu597*		71526727	NM_005909	A2BDK5	Nonsense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756132	0.89843	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	.	.	.	5.81	5.81	0.92471	.	0.087773	0.48767	D	0.000175	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-13.8229	20.0825	0.97783	0.0:0.0:1.0:0.0	.	.	.	.	X	597;614;471	.	ENSP00000296755:E597X	E	+	1	0	MAP1B	71526727	1.000000	0.71417	0.978000	0.43139	0.977000	0.68977	9.869000	0.99810	2.746000	0.94184	0.655000	0.94253	GAG		0.453	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
CYFIP2	26999	broad.mit.edu	37	5	156786108	156786108	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4005-01	TCGA-AG-4005-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4005-01	TCGA-AG-4005-01	g.chr5:156786108G>A	ENST00000442283.2	+	26	2902	c.620G>A	c.(619-621)aGg>aAg	p.R207K	CYFIP2_ENST00000377576.3_Silent_p.Q923Q|CYFIP2_ENST00000522463.1_Silent_p.Q727Q|CYFIP2_ENST00000318218.6_Silent_p.Q948Q|CYFIP2_ENST00000541131.1_Silent_p.Q848Q|CYFIP2_ENST00000347377.6_Silent_p.Q923Q|CYFIP2_ENST00000435847.2_Silent_p.Q622Q|CYFIP2_ENST00000521420.1_Silent_p.Q897Q	NM_001037333.1	NP_001032410.1			cytoplasmic FMR1 interacting protein 2									p.Q948Q(2)		breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGGGTTATCAGGGCATCGCTG	0.498																																					p.Q923Q												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2769A	5						.						134.0	134.0	134.0					5																	156786108		1994	4178	6172	156718686	SO:0001583	missense	26999	exon24			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000442283.2:c.620G>A	5.37:g.156786108G>A	ENSP00000390948:p.Arg207Lys		156718686	NM_001037333		Silent	SNP	ENST00000442283.2	37		.	.	.	.	.	.	.	.	.	.	G	20.1	3.940706	0.73557	.	.	ENSG00000055163	ENST00000442283	T	0.33216	1.42	5.28	5.28	0.74379	.	.	.	.	.	T	0.40145	0.1105	.	.	.	0.23628	N	0.997259	.	.	.	.	.	.	T	0.26710	-1.0095	6	0.48119	T	0.1	-27.3022	14.1828	0.65586	0.0736:0.0:0.9264:0.0	.	.	.	.	K	207	ENSP00000390948:R207K	ENSP00000390948:R207K	R	+	2	0	CYFIP2	156718686	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.903000	0.39858	2.455000	0.83008	0.655000	0.94253	AGG		0.498	CYFIP2-205	KNOWN	basic	protein_coding	protein_coding		NM_001037332	
