#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MGAM	8972	broad.mit.edu	37	7	141705401	141705402	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-4007-01	TCGA-AG-4007-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:141705401_141705402insA	ENST00000549489.2	+	2	166_167	c.71_72insA	c.(70-75)tttatcfs	p.FI24fs	MGAM_ENST00000475668.2_Frame_Shift_Ins_p.FI24fs	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	24					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.F24fs*48(3)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTTGTGTTGTTTATCATCAGTA	0.342																																					p.F24fs												.	.	3	Insertion - Frameshift(3)	large_intestine(3)	c.71_72insA	7						.																																			141351871	SO:0001589	frameshift_variant	8972	exon2			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	Exception_encountered	7.37:g.141705401_141705402insA	ENSP00000447378:p.Phe24fs		141351870	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Ins	INS	ENST00000549489.2	37	CCDS47727.1																																																																																				0.342	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
TNS3	64759	broad.mit.edu	37	7	47342747	47342748	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AG-4007-01	TCGA-AG-4007-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:47342747_47342748insT	ENST00000398879.1	-	22	3623_3624	c.3257_3258insA	c.(3256-3258)cagfs	p.Q1086fs	TNS3_ENST00000355730.3_Frame_Shift_Ins_p.Q846fs|TNS3_ENST00000311160.9_Frame_Shift_Ins_p.Q1086fs			Q68CZ2	TENS3_HUMAN	tensin 3	1086					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.Q1088fs*13(1)		NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CACCCTGGCCCTGCAGGCCTGG	0.658																																					p.Q1086fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.3258_3259insA	7						.																																			47309273	SO:0001589	frameshift_variant	64759	exon22			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.3258dupA	7.37:g.47342748_47342748dupT	ENSP00000381854:p.Gln1086fs		47309272	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Frame_Shift_Ins	INS	ENST00000398879.1	37	CCDS5506.2																																																																																				0.658	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
AJAP1	55966	broad.mit.edu	37	1	4772582	4772583	+	In_Frame_Ins	INS	-	-	CCA	rs149907194|rs529940202	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:4772582_4772583insCCA	ENST00000378191.4	+	2	1033_1034	c.652_653insCCA	c.(652-654)gcc>gCCAcc	p.225_226insT	AJAP1_ENST00000378190.3_In_Frame_Ins_p.225_226insT	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	225	Thr-rich.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T225_A226insT(1)		endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		AACTGTGGccgccaccaccacc	0.639														10	0.00199681	0.0023	0.0029	5008	,	,		14933	0.0		0.005	False		,,,				2504	0.0				p.A218delinsAT												.	.	1	Insertion - In frame(1)	large_intestine(1)	c.652_653insCCA	1						.																																			4672443	SO:0001652	inframe_insertion	55966	exon2			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.671_673dupCCA	1.37:g.4772589_4772591dupCCA	ENSP00000367433:p.Thr226_Thr227dup		4672442	NM_001042478	Q9Y229	In_Frame_Ins	INS	ENST00000378191.4	37	CCDS54.1																																																																																				0.639	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
HOXD9	3235	broad.mit.edu	37	2	176988158	176988159	+	Frame_Shift_Ins	INS	-	-	G	rs535219899		TCGA-AG-4007-01	TCGA-AG-4007-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:176988158_176988159insG	ENST00000249499.6	+	1	1071_1072	c.662_663insG	c.(661-666)acggggfs	p.TG221fs	HOXD-AS2_ENST00000440016.2_RNA	NM_014213.3	NP_055028.3	P28356	HXD9_HUMAN	homeobox D9	221				AATGGT -> GGDGGN (in Ref. 1; CAA42016). {ECO:0000305}.	adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal system morphogenesis (GO:0048704)|hindlimb morphogenesis (GO:0035137)|mammary gland development (GO:0030879)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T214fs*48(1)		endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		GCAGCGGCGACGGGGGGAACCG	0.718																																					p.T221fs	GBM(47;924 952 7959 9248 12176)											.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.662_663insG	2						.																																			176696405	SO:0001589	frameshift_variant	3235	exon1				CCDS2267.2	2q31.1	2011-06-20	2005-12-22		ENSG00000128709	ENSG00000128709		"""Homeoboxes / ANTP class : HOXL subclass"""	5140	protein-coding gene	gene with protein product		142982	"""homeo box D9"""	HOX4C, HOX4		1973146, 1358459	Standard	NM_014213		Approved		uc010zex.2	P28356	OTTHUMG00000132516	ENST00000249499.6:c.668dupG	2.37:g.176988164_176988164dupG	ENSP00000249499:p.Thr221fs		176696404	NM_014213	Q86ST1	Frame_Shift_Ins	INS	ENST00000249499.6	37	CCDS2267.2																																																																																				0.718	HOXD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255698.4		
UBN2	254048	broad.mit.edu	37	7	138943309	138943309	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:138943309C>T	ENST00000473989.3	+	4	739	c.739C>T	c.(739-741)Cgc>Tgc	p.R247C	UBN2_ENST00000288561.8_Missense_Mutation_p.R164C	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	247						extracellular space (GO:0005615)|nucleus (GO:0005634)		p.R164C(2)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						TCTACAGTTTCGCCAAGCTTC	0.363																																					p.R247C												.	.	2	Substitution - Missense(2)	urinary_tract(1)|large_intestine(1)	c.C739T	7						.						103.0	93.0	96.0					7																	138943309		1852	4090	5942	138593849	SO:0001583	missense	254048	exon4			AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.739C>T	7.37:g.138943309C>T	ENSP00000418648:p.Arg247Cys		138593849	NM_173569	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Missense_Mutation	SNP	ENST00000473989.3	37	CCDS43655.2	.	.	.	.	.	.	.	.	.	.	C	22.4	4.289874	0.80914	.	.	ENSG00000157741	ENST00000486663;ENST00000473989;ENST00000288561	T;T;T	0.28069	1.63;1.63;1.63	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.55561	0.1928	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58651	-0.7599	10	0.87932	D	0	-7.8458	14.138	0.65300	0.1501:0.8499:0.0:0.0	.	247	Q6ZU65	UBN2_HUMAN	C	70;247;164	ENSP00000417849:R70C;ENSP00000418648:R247C;ENSP00000288561:R164C	ENSP00000288561:R164C	R	+	1	0	UBN2	138593849	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.521000	0.53472	2.628000	0.89032	0.460000	0.39030	CGC		0.363	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569	
IQCE	23288	broad.mit.edu	37	7	2632682	2632682	+	Missense_Mutation	SNP	C	C	T	rs200474974		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:2632682C>T	ENST00000402050.2	+	15	1455	c.1271C>T	c.(1270-1272)gCg>gTg	p.A424V	IQCE_ENST00000325979.7_Missense_Mutation_p.A359V|IQCE_ENST00000438376.2_Missense_Mutation_p.A408V|IQCE_ENST00000404984.1_Missense_Mutation_p.A373V	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	424						mitochondrion (GO:0005739)		p.A424V(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		CTCCTGCAGGCGAAGGCCGAC	0.572																																					p.A424V												.	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|large_intestine(1)	c.C1271T	7						.	C	VAL/ALA,VAL/ALA	0,4256		0,0,2128	106.0	130.0	122.0		1223,1271	2.2	0.0	7		122	1,8481		0,1,4240	yes	missense,missense	IQCE	NM_001100390.1,NM_152558.3	64,64	0,1,6368	TT,TC,CC		0.0118,0.0,0.0079	benign,benign	408/680,424/696	2632682	1,12737	2128	4241	6369	2599208	SO:0001583	missense	23288	exon15			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1271C>T	7.37:g.2632682C>T	ENSP00000385597:p.Ala424Val		2599208	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	37	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	C	6.604	0.479857	0.12581	0.0	1.18E-4	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000438376;ENST00000325979	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.03	2.22	0.28083	.	0.557965	0.17201	N	0.183130	T	0.27731	0.0682	L	0.38175	1.15	0.09310	N	1	B;B;P;B;B;B	0.41784	0.369;0.369;0.762;0.051;0.369;0.068	B;B;B;B;B;B	0.36845	0.041;0.041;0.234;0.013;0.023;0.021	T	0.07558	-1.0766	10	0.31617	T	0.26	-0.6608	7.6824	0.28522	0.0:0.7274:0.0:0.2726	.	359;408;359;424;424;408	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	V	424;373;408;359	ENSP00000385597:A424V;ENSP00000385945:A373V;ENSP00000396178:A408V;ENSP00000313772:A359V	ENSP00000313772:A359V	A	+	2	0	IQCE	2599208	0.010000	0.17322	0.000000	0.03702	0.148000	0.21650	0.259000	0.18405	0.246000	0.21394	-0.258000	0.10820	GCG		0.572	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
OCM	654231	broad.mit.edu	37	7	5922227	5922227	+	Silent	SNP	G	G	A	rs541796052		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:5922227G>A	ENST00000242104.5	+	2	257	c.165G>A	c.(163-165)caG>caA	p.Q55Q	OCM_ENST00000416608.1_Silent_p.Q55Q	NM_001097622.1	NP_001091091.1	P0CE72	ONCO_HUMAN	oncomodulin	55	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)	p.Q55Q(1)		endometrium(1)|large_intestine(3)|lung(2)	6		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0978)|OV - Ovarian serous cystadenocarcinoma(56;2.11e-14)		ACAACGACCAGAGCGGGTACC	0.527																																					p.Q55Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G165A	7						.						134.0	114.0	121.0					7																	5922227		2203	4300	6503	5888753	SO:0001819	synonymous_variant	654231	exon2			BC069468	CCDS43548.1	7p22.1	2013-01-10						"""EF-hand domain containing"""	8105	protein-coding gene	gene with protein product	"""oncomodulin 1"""	164795				1559707, 8354278	Standard	NM_001097622		Approved	OCM1	uc003spe.4	P0CE72		ENST00000242104.5:c.165G>A	7.37:g.5922227G>A			5888753	NM_001097622	B9EJH7|P32930|Q6ISI5|Q75MW0	Silent	SNP	ENST00000242104.5	37	CCDS43548.1																																																																																				0.527	OCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340372.1	NM_001097622	
IGFBP3	3486	broad.mit.edu	37	7	45956888	45956888	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:45956888C>T	ENST00000275521.6	-	2	687	c.554G>A	c.(553-555)cGc>cAc	p.R185H	IGFBP3_ENST00000381086.5_Missense_Mutation_p.R88H|IGFBP3_ENST00000465642.1_5'UTR|IGFBP3_ENST00000381083.4_Missense_Mutation_p.R191H	NM_000598.4|NM_001013398.1	NP_000589.2|NP_001013416.1	P17936	IBP3_HUMAN	insulin-like growth factor binding protein 3	185					apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myoblast differentiation (GO:0045663)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|insulin-like growth factor binding protein complex (GO:0016942)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activator activity (GO:0008160)	p.R185H(1)		large_intestine(6)|lung(7)|pancreas(1)|prostate(3)	17					Mecasermin(DB01277)	AACTTTGTAGCGCTGGCTGTC	0.502											OREG0018049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R185H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G554A	7						.						170.0	149.0	156.0					7																	45956888		2203	4300	6503	45923413	SO:0001583	missense	3486	exon2				CCDS5505.1, CCDS34632.1	7p12.3	2014-09-17			ENSG00000146674	ENSG00000146674			5472	protein-coding gene	gene with protein product	"""growth hormone-dependent binding protein"", ""acid stable subunit of the 140 K IGF complex"", ""binding protein 53"", ""binding protein 29"", ""IGF-binding protein 3"""	146732				1695633	Standard	NM_000598		Approved	IBP3, BP-53	uc003tnr.3	P17936	OTTHUMG00000023769	ENST00000275521.6:c.554G>A	7.37:g.45956888C>T	ENSP00000275521:p.Arg185His	935	45923413	NM_000598	A4D2F5|D3DVM0|Q2V509|Q6P1M6|Q9UCL4	Missense_Mutation	SNP	ENST00000275521.6	37	CCDS5505.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.649489|4.649489	0.87958|0.87958	.|.	.|.	ENSG00000146674|ENSG00000146674	ENST00000428530|ENST00000545032;ENST00000275521;ENST00000381086;ENST00000438491;ENST00000442142;ENST00000381083;ENST00000433047;ENST00000448817	.|T;T;T;T	.|0.27890	.|2.34;1.68;2.36;1.64	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Thyroglobulin type-1 (1);	.|2.918300	.|0.00843	.|N	.|0.001760	T|T	0.63988|0.63988	0.2558|0.2558	M|M	0.81239|0.81239	2.535|2.535	0.40816|0.40816	D|D	0.983469|0.983469	.|D;D;D	.|0.71674	.|0.998;0.998;0.998	.|D;D;D	.|0.66351	.|0.943;0.943;0.943	T|T	0.38672|0.38672	-0.9650|-0.9650	5|10	.|0.72032	.|D	.|0.01	-52.4084|-52.4084	15.0203|15.0203	0.71624|0.71624	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|88;185;170	.|B3KWK7;P17936;B4DN53	.|.;IBP3_HUMAN;.	T|H	37|162;185;88;171;83;191;157;75	.|ENSP00000275521:R185H;ENSP00000370476:R88H;ENSP00000370473:R191H;ENSP00000389668:R75H	.|ENSP00000275521:R185H	A|R	-|-	1|2	0|0	IGFBP3|IGFBP3	45923413|45923413	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.750000|4.750000	0.62162|0.62162	2.613000|2.613000	0.88420|0.88420	0.655000|0.655000	0.94253|0.94253	GCT|CGC		0.502	IGFBP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251356.3	NM_001013398	
DNAJC30	84277	broad.mit.edu	37	7	73097234	73097234	+	Missense_Mutation	SNP	C	C	T	rs137909145		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:73097234C>T	ENST00000395176.2	-	1	549	c.520G>A	c.(520-522)Gaa>Aaa	p.E174K	WBSCR22_ENST00000423497.1_5'Flank|WBSCR22_ENST00000423166.2_5'Flank|WBSCR22_ENST00000265758.2_5'Flank	NM_032317.2	NP_115693.2	Q96LL9	DJC30_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 30	174						mitochondrion (GO:0005739)		p.E174K(1)		kidney(1)|large_intestine(2)|lung(1)	4						TCCAGTTGTTCCCCGTAGTGG	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		12861	0.0		0.0	False		,,,				2504	0.001				p.E174K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G520A	7						.	C	LYS/GLU	1,4405		0,1,2202	33.0	34.0	34.0		520	4.3	0.7	7	dbSNP_134	34	0,8600		0,0,4300	no	missense	DNAJC30	NM_032317.2	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	174/227	73097234	1,13005	2203	4300	6503	72735170	SO:0001583	missense	84277	exon1			AF412025	CCDS5556.1	7q11.23	2011-09-02	2008-06-17	2008-06-17	ENSG00000176410	ENSG00000176410		"""Heat shock proteins / DNAJ (HSP40)"""	16410	protein-coding gene	gene with protein product			"""Williams Beuren syndrome chromosome region 18"""	WBSCR18		12073013	Standard	NM_032317		Approved		uc003tys.1	Q96LL9	OTTHUMG00000023290	ENST00000395176.2:c.520G>A	7.37:g.73097234C>T	ENSP00000378605:p.Glu174Lys		72735170	NM_032317	Q9BSG8	Missense_Mutation	SNP	ENST00000395176.2	37	CCDS5556.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.685288	0.88639	2.27E-4	0.0	ENSG00000176410	ENST00000395176	T	0.55234	0.53	5.2	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.68072	0.2961	M	0.81239	2.535	0.41980	D	0.990795	D	0.76494	0.999	P	0.59546	0.859	T	0.72924	-0.4144	10	0.62326	D	0.03	.	11.3409	0.49533	0.0:0.9124:0.0:0.0876	.	174	Q96LL9	DJC30_HUMAN	K	174	ENSP00000378605:E174K	ENSP00000378605:E174K	E	-	1	0	DNAJC30	72735170	0.997000	0.39634	0.702000	0.30337	0.978000	0.69477	3.733000	0.55029	1.431000	0.47355	0.555000	0.69702	GAA		0.682	DNAJC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252304.2		
ZP3	7784	broad.mit.edu	37	7	76062286	76062286	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:76062286G>T	ENST00000394857.3	+	3	532	c.474G>T	c.(472-474)ttG>ttT	p.L158F	ZP3_ENST00000416245.1_5'UTR|ZP3_ENST00000336517.4_Missense_Mutation_p.L107F	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	158	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)	p.L107F(1)		endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						CCACCTGGTTGCCCTTCAGGA	0.592																																					p.L107F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G321T	7						.						96.0	80.0	85.0					7																	76062286		2203	4300	6503	75900222	SO:0001583	missense	7784	exon4			M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.474G>T	7.37:g.76062286G>T	ENSP00000378326:p.Leu158Phe		75900222	NM_007155	Q06633|Q29RW0	Missense_Mutation	SNP	ENST00000394857.3	37	CCDS47618.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474141	0.63737	.	.	ENSG00000188372	ENST00000336517;ENST00000394857;ENST00000544121	D;D	0.82526	-1.62;-1.62	5.4	1.01	0.19927	Zona pellucida sperm-binding protein (3);	0.701438	0.13976	N	0.349833	T	0.74711	0.3752	N	0.24115	0.695	0.80722	D	1	D;B	0.54964	0.969;0.205	P;B	0.51385	0.668;0.215	T	0.71567	-0.4554	10	0.72032	D	0.01	-9.1927	3.2396	0.06776	0.0851:0.2096:0.4368:0.2685	.	107;158	P21754-3;P21754	.;ZP3_HUMAN	F	107;158;158	ENSP00000337310:L107F;ENSP00000378326:L158F	ENSP00000337310:L107F	L	+	3	2	ZP3	75900222	0.969000	0.33509	1.000000	0.80357	0.899000	0.52679	0.017000	0.13399	0.616000	0.30141	-0.221000	0.12465	TTG		0.592	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253004.1		
TSC22D4	81628	broad.mit.edu	37	7	100065186	100065186	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:100065186C>T	ENST00000300181.2	-	4	1721	c.967G>A	c.(967-969)Gag>Aag	p.E323K	TSC22D4_ENST00000496728.1_5'UTR|TSC22D4_ENST00000393991.1_Missense_Mutation_p.E84K	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	323					negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E323K(1)		breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATGGCTTGCTCGATTTTGTTG	0.577																																					p.E323K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G967A	7						.						145.0	135.0	139.0					7																	100065186		2203	4300	6503	99903122	SO:0001583	missense	81628	exon4			BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.967G>A	7.37:g.100065186C>T	ENSP00000300181:p.Glu323Lys		99903122	NM_030935	A4D2C3|A8MWR6|D6W5V9	Missense_Mutation	SNP	ENST00000300181.2	37	CCDS5695.1	.	.	.	.	.	.	.	.	.	.	C	15.28	2.786748	0.49997	.	.	ENSG00000166925	ENST00000300181;ENST00000393991	.	.	.	4.51	2.65	0.31530	.	0.450054	0.18859	N	0.129193	T	0.25232	0.0613	N	0.19112	0.55	0.47659	D	0.999489	D	0.52996	0.957	B	0.34301	0.179	T	0.04579	-1.0941	9	0.87932	D	0	-1.9329	7.6241	0.28202	0.0:0.7372:0.1678:0.095	.	323	Q9Y3Q8	T22D4_HUMAN	K	323;84	.	ENSP00000300181:E323K	E	-	1	0	TSC22D4	99903122	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.451000	0.66632	0.426000	0.26116	-0.181000	0.13052	GAG		0.577	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316970.1	NM_030935	
CLCN1	1180	broad.mit.edu	37	7	143047530	143047530	+	Silent	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr7:143047530G>A	ENST00000343257.2	+	21	2556	c.2469G>A	c.(2467-2469)caG>caA	p.Q823Q		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	823	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)	p.Q823Q(1)		breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					GTATTGACCAGTCTCCCTTCC	0.557																																					p.Q823Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2469A	7						.						124.0	101.0	108.0					7																	143047530		2203	4300	6503	142757652	SO:0001819	synonymous_variant	1180	exon21			Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2469G>A	7.37:g.143047530G>A			142757652	NM_000083	A4D2H5|Q2M202	Silent	SNP	ENST00000343257.2	37	CCDS5881.1																																																																																				0.557	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
TTI1	9675	broad.mit.edu	37	20	36641522	36641522	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr20:36641522C>T	ENST00000373448.2	-	3	935	c.697G>A	c.(697-699)Gta>Ata	p.V233I	TTI1_ENST00000373447.3_Missense_Mutation_p.V233I|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000449821.1_Missense_Mutation_p.V233I	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	233					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)		p.V233I(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						AGGGAAGATACGACAATGCTG	0.428																																					p.V233I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697A	20						.						157.0	154.0	155.0					20																	36641522		2203	4300	6503	36074936	SO:0001583	missense	9675	exon3			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.697G>A	20.37:g.36641522C>T	ENSP00000362547:p.Val233Ile		36074936	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	ENST00000373448.2	37	CCDS13300.1	.	.	.	.	.	.	.	.	.	.	C	0.900	-0.722465	0.03182	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.15139	2.45;2.45;2.45	5.45	3.38	0.38709	Armadillo-like helical (1);Armadillo-type fold (1);	0.302894	0.36409	N	0.002618	T	0.11707	0.0285	L	0.38175	1.15	0.09310	N	1	B	0.19331	0.035	B	0.15052	0.012	T	0.15578	-1.0432	10	0.33141	T	0.24	-27.6647	6.4202	0.21740	0.1648:0.6876:0.0:0.1476	.	233	O43156	TTI1_HUMAN	I	233	ENSP00000362547:V233I;ENSP00000362546:V233I;ENSP00000407270:V233I	ENSP00000362546:V233I	V	-	1	0	TTI1	36074936	0.420000	0.25457	0.013000	0.15412	0.755000	0.42902	1.413000	0.34725	1.517000	0.48917	-0.188000	0.12872	GTA		0.428	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
ZSWIM3	140831	broad.mit.edu	37	20	44506472	44506472	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr20:44506472C>A	ENST00000255152.2	+	2	1484	c.1275C>A	c.(1273-1275)ttC>ttA	p.F425L	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.F419L	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	425							zinc ion binding (GO:0008270)	p.F425F(1)|p.F425L(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				ACATAGACTTCTTTAATACCA	0.498																																					p.F425L												.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C1275A	20						.						62.0	58.0	60.0					20																	44506472		2203	4300	6503	43939879	SO:0001583	missense	140831	exon2			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1275C>A	20.37:g.44506472C>A	ENSP00000255152:p.Phe425Leu		43939879	NM_080752	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	C	7.606	0.673794	0.14841	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.23348	1.95;1.91	5.41	0.275	0.15659	.	0.416464	0.25523	N	0.030098	T	0.11623	0.0283	L	0.29908	0.895	0.31958	N	0.608748	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.002	T	0.19418	-1.0306	10	0.10902	T	0.67	-13.6958	1.5419	0.02557	0.1368:0.3903:0.1486:0.3243	.	419;425	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	L	425;419	ENSP00000255152:F425L;ENSP00000406313:F419L	ENSP00000255152:F425L	F	+	3	2	ZSWIM3	43939879	0.986000	0.35501	0.999000	0.59377	0.997000	0.91878	-0.016000	0.12613	0.125000	0.18397	0.655000	0.94253	TTC		0.498	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
ZSWIM3	140831	broad.mit.edu	37	20	44506752	44506752	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr20:44506752A>T	ENST00000255152.2	+	2	1764	c.1555A>T	c.(1555-1557)Aac>Tac	p.N519Y	ZSWIM3_ENST00000454862.2_Missense_Mutation_p.N513Y	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	519							zinc ion binding (GO:0008270)	p.N519Y(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				GGTGGTACAGAACTCCACCCA	0.567																																					p.N519Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1555T	20						.						90.0	74.0	79.0					20																	44506752		2203	4300	6503	43940159	SO:0001583	missense	140831	exon2			AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.1555A>T	20.37:g.44506752A>T	ENSP00000255152:p.Asn519Tyr		43940159	NM_080752	Q9BR13	Missense_Mutation	SNP	ENST00000255152.2	37	CCDS13381.1	.	.	.	.	.	.	.	.	.	.	A	15.31	2.796332	0.50208	.	.	ENSG00000132801	ENST00000255152;ENST00000454862	T;T	0.26067	1.8;1.76	5.51	5.51	0.81932	.	0.207171	0.43110	D	0.000603	T	0.28797	0.0714	L	0.51422	1.61	0.36899	D	0.890312	D;D	0.61080	0.989;0.976	P;P	0.53450	0.726;0.656	T	0.22173	-1.0224	10	0.02654	T	1	-29.3497	9.8798	0.41227	0.9239:0.0:0.0761:0.0	.	513;519	E7ETT6;Q96MP5	.;ZSWM3_HUMAN	Y	519;513	ENSP00000255152:N519Y;ENSP00000406313:N513Y	ENSP00000255152:N519Y	N	+	1	0	ZSWIM3	43940159	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.158000	0.50723	2.317000	0.78254	0.459000	0.35465	AAC		0.567	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
DHRS4L1	728635	broad.mit.edu	37	14	24505826	24505826	+	RNA	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr14:24505826C>T	ENST00000558293.1	+	0	165					NR_102693.1																						TGGTAACGGCCTCCACCGACT	0.652																																					p.A39A												.	.	0			c.C117T	14						.						38.0	45.0	42.0					14																	24505826		2191	4293	6484	23575666			728635	exon1																															14.37:g.24505826C>T			23575666	NM_001082488		Silent	SNP	ENST00000558293.1	37																																																																																					0.652	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
NFATC4	4776	broad.mit.edu	37	14	24844904	24844904	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr14:24844904C>T	ENST00000250373.4	+	7	2053	c.1912C>T	c.(1912-1914)Cga>Tga	p.R638*	NFATC4_ENST00000413692.2_Nonsense_Mutation_p.R701*|NFATC4_ENST00000554473.1_Nonsense_Mutation_p.R173*|NFATC4_ENST00000554344.1_Nonsense_Mutation_p.R568*|NFATC4_ENST00000554966.1_Nonsense_Mutation_p.R651*|NFATC4_ENST00000557767.1_5'UTR|NFATC4_ENST00000553469.1_Nonsense_Mutation_p.R670*|NFATC4_ENST00000555590.1_Nonsense_Mutation_p.R651*|NFATC4_ENST00000554661.1_Nonsense_Mutation_p.R568*|NFATC4_ENST00000555802.1_5'UTR|NFATC4_ENST00000556279.1_Nonsense_Mutation_p.R670*|NFATC4_ENST00000556759.1_Nonsense_Mutation_p.R173*|NFATC4_ENST00000555453.1_Nonsense_Mutation_p.R626*|NFATC4_ENST00000557451.1_Nonsense_Mutation_p.R568*|NFATC4_ENST00000555393.1_5'UTR|NFATC4_ENST00000422617.3_Nonsense_Mutation_p.R626*|NFATC4_ENST00000555167.1_Nonsense_Mutation_p.R173*|NFATC4_ENST00000424781.2_Nonsense_Mutation_p.R651*|NFATC4_ENST00000553708.1_Nonsense_Mutation_p.R638*|NFATC4_ENST00000554591.1_Nonsense_Mutation_p.R701*|NFATC4_ENST00000553879.1_Nonsense_Mutation_p.R568*|NFATC4_ENST00000539237.2_Nonsense_Mutation_p.R670*|NFATC4_ENST00000554050.1_Nonsense_Mutation_p.R638*|NFATC4_ENST00000556169.1_Nonsense_Mutation_p.R626*	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4	638	IPT/TIG.				cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)	p.R638*(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		CACAGTGAACCGACTGCAGAG	0.627																																					p.R701X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2101T	14						.						56.0	39.0	45.0					14																	24844904		2194	4288	6482	23914744	SO:0001587	stop_gained	4776	exon8			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351	ENST00000250373.4:c.1912C>T	14.37:g.24844904C>T	ENSP00000250373:p.Arg638*		23914744	NM_001136022	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Nonsense_Mutation	SNP	ENST00000250373.4	37	CCDS9629.1	.	.	.	.	.	.	.	.	.	.	C	41	8.934063	0.99008	.	.	ENSG00000100968	ENST00000413692;ENST00000554591;ENST00000555590;ENST00000554966;ENST00000424781;ENST00000539237;ENST00000556279;ENST00000553469;ENST00000554050;ENST00000250373;ENST00000553708;ENST00000553879;ENST00000554344;ENST00000554661;ENST00000556169;ENST00000557451;ENST00000422617;ENST00000555453;ENST00000554473;ENST00000556759;ENST00000555167	.	.	.	5.41	4.46	0.54185	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.5001	10.6467	0.45623	0.276:0.724:0.0:0.0	.	.	.	.	X	701;701;651;651;651;670;670;670;638;638;638;568;568;568;626;568;626;626;173;173;173	.	ENSP00000250373:R638X	R	+	1	2	NFATC4	23914744	0.939000	0.31865	1.000000	0.80357	0.988000	0.76386	0.057000	0.14279	2.816000	0.96949	0.563000	0.77884	CGA		0.627	NFATC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073206.6	NM_004554	
EAPP	55837	broad.mit.edu	37	14	34998597	34998597	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr14:34998597C>T	ENST00000250454.3	-	4	518	c.437G>A	c.(436-438)aGa>aAa	p.R146K		NM_018453.3	NP_060923.2	Q56P03	EAPP_HUMAN	E2F-associated phosphoprotein	146					negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.R146K(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	12	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00342)|Epithelial(34;0.18)	GBM - Glioblastoma multiforme(112;0.0196)		GGCCTGATCTCTGTTATCTTT	0.308																																					p.R146K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G437A	14						.						163.0	144.0	150.0					14																	34998597		1830	4086	5916	34068348	SO:0001583	missense	55837	exon4			AF217512	CCDS41941.1	14q13	2007-03-26	2007-03-26	2007-03-26		ENSG00000129518			19312	protein-coding gene	gene with protein product		609486	"""chromosome 14 open reading frame 11"""	C14orf11		15716352	Standard	NM_018453		Approved	BM036, FLJ20578	uc001wsd.1	Q56P03		ENST00000250454.3:c.437G>A	14.37:g.34998597C>T	ENSP00000250454:p.Arg146Lys		34068348	NM_018453	Q9BVF4|Q9NWV5|Q9NZ86	Missense_Mutation	SNP	ENST00000250454.3	37	CCDS41941.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682787	0.47991	.	.	ENSG00000129518	ENST00000250454;ENST00000554792	T;T	0.41400	1.0;1.0	5.38	4.48	0.54585	.	0.097290	0.64402	D	0.000001	T	0.33644	0.0870	L	0.37561	1.115	0.58432	D	0.999995	B	0.16603	0.018	B	0.19666	0.026	T	0.07252	-1.0782	10	0.28530	T	0.3	-20.1992	13.8651	0.63583	0.0:0.9261:0.0:0.0739	.	146	Q56P03	EAPP_HUMAN	K	146;125	ENSP00000250454:R146K;ENSP00000450908:R125K	ENSP00000250454:R146K	R	-	2	0	EAPP	34068348	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.304000	0.51866	2.705000	0.92388	0.585000	0.79938	AGA		0.308	EAPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409847.1	NM_018453	
RALGAPA1	253959	broad.mit.edu	37	14	36041891	36041891	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr14:36041891C>T	ENST00000389698.3	-	37	6115	c.5725G>A	c.(5725-5727)Gtt>Att	p.V1909I	RALGAPA1_ENST00000307138.6_Missense_Mutation_p.V1909I|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.V1956I|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.V1922I	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1909	Minimal domain that binds to TCF3/E12. {ECO:0000250}.|Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)	p.V1909I(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTGACCAAACAATGTGCACT	0.353																																					p.V1909I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5725A	14						.						104.0	104.0	104.0					14																	36041891		2203	4300	6503	35111642	SO:0001583	missense	253959	exon37			AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5725G>A	14.37:g.36041891C>T	ENSP00000374348:p.Val1909Ile		35111642	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	37	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280601	0.80692	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	D;D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23;-3.23	5.17	4.28	0.50868	Rap/ran-GAP (2);	0.122801	0.53938	N	0.000045	D	0.93858	0.8035	L	0.31120	0.905	0.53005	D	0.999964	D;D;D;D	0.89917	0.997;1.0;0.96;1.0	D;D;P;D	0.91635	0.991;0.999;0.69;0.999	D	0.93869	0.7160	10	0.54805	T	0.06	-10.7572	13.4351	0.61079	0.0:0.9244:0.0:0.0756	.	1956;1922;1909;1909	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	I	1909;1909;1909;1956;547;1922;1956	ENSP00000374348:V1909I;ENSP00000302647:V1909I;ENSP00000258840:V1956I;ENSP00000451133:V547I;ENSP00000371803:V1922I;ENSP00000451877:V1956I	ENSP00000258840:V1956I	V	-	1	0	RALGAPA1	35111642	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.861000	0.56002	1.170000	0.42753	0.585000	0.79938	GTT		0.353	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
VRK1	7443	broad.mit.edu	37	14	97312449	97312449	+	Silent	SNP	A	A	C			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr14:97312449A>C	ENST00000216639.3	+	4	383	c.234A>C	c.(232-234)ggA>ggC	p.G78G		NM_003384.2	NP_003375.1	Q99986	VRK1_HUMAN	vaccinia related kinase 1	78	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Golgi disassembly (GO:0090166)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-T3 phosphorylation (GO:0072355)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi stack (GO:0005795)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H3-S10 specific) (GO:0035175)|histone kinase activity (H3-T3 specific) (GO:0072354)|nucleosomal histone binding (GO:0031493)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.G78G(1)		NS(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(1)|stomach(1)	12		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		GTGACAATGGACCTCTTTTTA	0.318																																					p.G78G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A234C	14						.						87.0	89.0	88.0					14																	97312449		2203	4295	6498	96382202	SO:0001819	synonymous_variant	7443	exon4			AB000449	CCDS9947.1	14q32.2	2012-07-05			ENSG00000100749	ENSG00000100749			12718	protein-coding gene	gene with protein product		602168				9344656	Standard	XM_006720247		Approved		uc001yft.3	Q99986	OTTHUMG00000171459	ENST00000216639.3:c.234A>C	14.37:g.97312449A>C			96382202	NM_003384	Q3SYL2	Silent	SNP	ENST00000216639.3	37	CCDS9947.1																																																																																				0.318	VRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413520.1	NM_003384	
ZNF70	7621	broad.mit.edu	37	22	24086665	24086665	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr22:24086665C>T	ENST00000341976.3	-	2	1123	c.663G>A	c.(661-663)aaG>aaA	p.K221K		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K221K(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						CGTAGGGCCTCTTTCCGGTGT	0.562																																					p.K221K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G663A	22						.						60.0	51.0	54.0					22																	24086665		2203	4300	6503	22416665	SO:0001819	synonymous_variant	7621	exon2			X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.663G>A	22.37:g.24086665C>T			22416665	NM_021916		Silent	SNP	ENST00000341976.3	37	CCDS13812.1																																																																																				0.562	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	NM_021916	
ZC3H7B	23264	broad.mit.edu	37	22	41742078	41742078	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr22:41742078G>A	ENST00000352645.4	+	14	1788	c.1531G>A	c.(1531-1533)Gtg>Atg	p.V511M	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.V511M	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	527					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.V511M(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						GGAGATCGACGTGTGGACCGA	0.587																																					p.V511M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1531A	22						.						203.0	167.0	179.0					22																	41742078		2203	4300	6503	40072024	SO:0001583	missense	23264	exon14				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.1531G>A	22.37:g.41742078G>A	ENSP00000345793:p.Val511Met		40072024	NM_017590	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	ENST00000352645.4	37	CCDS14013.1	.	.	.	.	.	.	.	.	.	.	G	33	5.290145	0.95546	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.22336	1.96;1.96	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.50803	0.1637	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.54669	-0.8259	10	0.87932	D	0	-28.124	19.0939	0.93242	0.0:0.0:1.0:0.0	.	511	Q9UGR2-2	.	M	511	ENSP00000345793:V511M;ENSP00000263243:V511M	ENSP00000263243:V511M	V	+	1	0	ZC3H7B	40072024	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.523000	0.85059	0.555000	0.69702	GTG		0.587	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320696.1	NM_017590	
SMARCA4	6597	broad.mit.edu	37	19	11135019	11135019	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:11135019A>T	ENST00000429416.3	+	22	3267	c.2986A>T	c.(2986-2988)Atc>Ttc	p.I996F	SMARCA4_ENST00000413806.3_Missense_Mutation_p.I996F|SMARCA4_ENST00000344626.4_Missense_Mutation_p.I996F|SMARCA4_ENST00000450717.3_Missense_Mutation_p.I996F|SMARCA4_ENST00000541122.2_Missense_Mutation_p.I996F|SMARCA4_ENST00000590574.1_Missense_Mutation_p.I996F|SMARCA4_ENST00000444061.3_Missense_Mutation_p.I996F|SMARCA4_ENST00000358026.2_Missense_Mutation_p.I996F|SMARCA4_ENST00000589677.1_Missense_Mutation_p.I996F	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	996					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.I996F(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GGAGTACGTCATCAAGTGCGA	0.627			"""F, N, Mis"""		NSCLC																																p.I996F			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	.	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|lung(1)	c.A2986T	19						.						91.0	63.0	72.0					19																	11135019		2203	4300	6503	10996019	SO:0001583	missense	6597	exon21			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2986A>T	19.37:g.11135019A>T	ENSP00000395654:p.Ile996Phe		10996019	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.832490	0.91036	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.23	5.23	0.72850	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.86994	0.6067	M	0.76328	2.33	0.80722	D	1	D;D;D;D;D;D;D;D	0.67145	0.993;0.984;0.993;0.996;0.992;0.986;0.993;0.993	D;D;D;D;P;D;D;D	0.75020	0.962;0.949;0.962;0.985;0.889;0.935;0.962;0.962	D	0.88581	0.3136	10	0.87932	D	0	-36.8253	14.2475	0.65997	1.0:0.0:0.0:0.0	.	996;996;996;996;996;216;996;996	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	F	996;996;1060;996;996;996;996;996	ENSP00000395654:I996F;ENSP00000350720:I996F;ENSP00000343896:I996F;ENSP00000445036:I996F;ENSP00000392837:I996F;ENSP00000397783:I996F;ENSP00000414727:I996F	ENSP00000343896:I996F	I	+	1	0	SMARCA4	10996019	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.127000	0.77210	2.202000	0.70862	0.533000	0.62120	ATC		0.627	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
EMR2	30817	broad.mit.edu	37	19	14884750	14884750	+	Splice_Site	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:14884750C>T	ENST00000315576.3	-	4	650	c.199G>A	c.(199-201)Gac>Aac	p.D67N	EMR2_ENST00000353876.1_Splice_Site_p.D67N|EMR2_ENST00000599423.1_5'UTR|EMR2_ENST00000346057.1_Splice_Site_p.D67N|EMR2_ENST00000595839.1_Splice_Site_p.D67N|EMR2_ENST00000392964.3_5'Flank|EMR2_ENST00000594076.1_Splice_Site_p.D67N|EMR2_ENST00000353005.1_Splice_Site_p.D67N|EMR2_ENST00000392967.2_Splice_Site_p.D67N|EMR2_ENST00000392965.3_Splice_Site_p.D67N|EMR2_ENST00000601345.1_Splice_Site_p.D67N|EMR2_ENST00000594294.1_Splice_Site_p.D67N|EMR2_ENST00000596991.2_Splice_Site_p.D67N	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	67	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)	p.D67N(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GCCTCTGTACCGTCACAAGTC	0.582																																					p.D67N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	19						.						130.0	122.0	125.0					19																	14884750		2203	4300	6503	14745750	SO:0001630	splice_region_variant	30817	exon4			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.199+1G>A	19.37:g.14884750C>T			14745750	NM_152920	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299094	0.60195	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000360222;ENST00000392965;ENST00000392962	D;D;D;D;D;D;D	0.99051	-5.37;-5.37;-5.37;-5.37;-5.37;-5.37;-5.37	3.87	2.83	0.33086	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99086	0.9686	M	0.83012	2.62	0.24000	N	0.99621	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.991;1.0;1.0	D;D;P;D;P;D;D	0.91635	0.999;0.982;0.908;0.96;0.633;0.985;0.975	D	0.95651	0.8707	8	.	.	.	.	8.0793	0.30735	0.0:0.8795:0.0:0.1205	.	67;67;67;67;67;67;67	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;Q9UHX3;Q9UHX3-2	.;.;.;.;.;EMR2_HUMAN;.	N	67	ENSP00000319883:D67N;ENSP00000376694:D67N;ENSP00000263380:D67N;ENSP00000319454:D67N;ENSP00000319838:D67N;ENSP00000376692:D67N;ENSP00000376689:D67N	.	D	-	1	0	EMR2	14745750	0.524000	0.26282	0.330000	0.25442	0.038000	0.13279	2.233000	0.43027	0.930000	0.37217	-0.507000	0.04495	GAC		0.582	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2		Missense_Mutation
CASP14	23581	broad.mit.edu	37	19	15164318	15164318	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:15164318G>A	ENST00000427043.3	+	3	361	c.53G>A	c.(52-54)cGc>cAc	p.R18H	CASP14_ENST00000221740.1_Missense_Mutation_p.R18H|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	18					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)	p.R18H(1)|p.R18P(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						TCAGGTGCCCGCCTGGCCCTA	0.512																																					p.R18H												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G53A	19						.						81.0	79.0	80.0					19																	15164318		2203	4300	6503	15025318	SO:0001583	missense	23581	exon3				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.53G>A	19.37:g.15164318G>A	ENSP00000393417:p.Arg18His		15025318	NM_012114	O95823|Q3SYC9	Missense_Mutation	SNP	ENST00000427043.3	37	CCDS12323.1	.	.	.	.	.	.	.	.	.	.	g	20.4	3.989537	0.74589	.	.	ENSG00000105141	ENST00000427043;ENST00000221740	T;T	0.03717	3.83;3.83	4.81	4.81	0.61882	Peptidase C14, caspase precursor p45, core (1);	0.238103	0.21366	N	0.075706	T	0.19127	0.0459	M	0.84683	2.71	0.37202	D	0.904416	D	0.89917	1.0	D	0.70935	0.971	T	0.03863	-1.0997	10	0.49607	T	0.09	.	13.3594	0.60646	0.0:0.0:1.0:0.0	.	18	P31944	CASPE_HUMAN	H	18	ENSP00000393417:R18H;ENSP00000221740:R18H	ENSP00000221740:R18H	R	+	2	0	CASP14	15025318	0.996000	0.38824	0.996000	0.52242	0.820000	0.46376	3.077000	0.50089	2.209000	0.71365	0.306000	0.20318	CGC		0.512	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465663.1	NM_012114	
NOTCH3	4854	broad.mit.edu	37	19	15299048	15299048	+	Missense_Mutation	SNP	G	G	A	rs114207045	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:15299048G>A	ENST00000263388.2	-	9	1565	c.1490C>T	c.(1489-1491)tCg>tTg	p.S497L		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	497	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.S497L(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GTCCTCACCCGAGGGGCAGGT	0.562													G|||	37	0.00738818	0.0106	0.0086	5008	,	,		15109	0.001		0.006	False		,,,				2504	0.0102				p.S497L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1490T	19						.	G	LEU/SER	46,4360		0,46,2157	27.0	26.0	26.0		1490	5.0	1.0	19	dbSNP_132	26	52,8544		0,52,4246	yes	missense	NOTCH3	NM_000435.2	145	0,98,6403	AA,AG,GG		0.6049,1.044,0.7537	benign	497/2322	15299048	98,12904	2203	4298	6501	15160048	SO:0001583	missense	4854	exon9			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1490C>T	19.37:g.15299048G>A	ENSP00000263388:p.Ser497Leu		15160048	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	15	0.006868131868131868	4	0.008130081300813009	7	0.019337016574585635	0	0.0	4	0.005277044854881266	g	13.27	2.185760	0.38609	0.01044	0.006049	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.86694	-2.16	5.04	5.04	0.67666	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.27705	N	0.018199	T	0.66694	0.2815	N	0.16708	0.43	0.41468	D	0.988085	B;B	0.22146	0.031;0.065	B;B	0.21708	0.02;0.036	T	0.70353	-0.4895	10	0.26408	T	0.33	.	17.1812	0.86855	0.0:0.0:1.0:0.0	.	500;497	Q59FL3;Q9UM47	.;NOTC3_HUMAN	L	497;499	ENSP00000263388:S497L	ENSP00000263388:S497L	S	-	2	0	NOTCH3	15160048	0.788000	0.28762	0.965000	0.40720	0.908000	0.53690	4.305000	0.59110	2.347000	0.79759	0.556000	0.70494	TCG		0.562	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
NWD1	284434	broad.mit.edu	37	19	16899843	16899843	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:16899843G>T	ENST00000552788.1	+	11	2782	c.2782G>T	c.(2782-2784)Gct>Tct	p.A928S	NWD1_ENST00000339803.6_Missense_Mutation_p.A793S|NWD1_ENST00000379808.3_Missense_Mutation_p.A928S|NWD1_ENST00000524140.2_Missense_Mutation_p.A928S|NWD1_ENST00000549814.1_Missense_Mutation_p.A928S|NWD1_ENST00000523826.1_Missense_Mutation_p.A722S			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	928							ATP binding (GO:0005524)	p.A793S(1)|p.A928S(1)		NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGCCAACTCTGCTTCAAAGGA	0.493																																					p.A928S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2782T	19						.						120.0	115.0	117.0					19																	16899843		2203	4300	6503	16760843	SO:0001583	missense	284434	exon13			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.2782G>T	19.37:g.16899843G>T	ENSP00000447224:p.Ala928Ser		16760843	NM_001007525	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	G	11.17	1.560318	0.27827	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04;0.04	5.65	2.13	0.27403	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.411559	0.24947	N	0.034331	T	0.63307	0.2500	L	0.42529	1.33	0.26405	N	0.97636	D;D;D	0.69078	0.99;0.997;0.957	P;D;P	0.64042	0.846;0.921;0.67	T	0.51426	-0.8707	10	0.27785	T	0.31	-14.0575	6.1517	0.20316	0.0875:0.0:0.5622:0.3503	.	928;928;793	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	S	793;928;928;928;722;928;793	ENSP00000428579:A928S;ENSP00000447548:A928S;ENSP00000369136:A928S;ENSP00000428955:A722S;ENSP00000447224:A928S;ENSP00000340159:A793S	ENSP00000340159:A793S	A	+	1	0	NWD1	16760843	0.922000	0.31269	0.894000	0.35097	0.046000	0.14306	1.305000	0.33493	0.712000	0.32039	0.591000	0.81541	GCT		0.493	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
WDR88	126248	broad.mit.edu	37	19	33639806	33639806	+	Silent	SNP	C	C	T	rs144975503	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:33639806C>T	ENST00000355868.3	+	5	745	c.669C>T	c.(667-669)tcC>tcT	p.S223S	WDR88_ENST00000361680.2_Silent_p.S223S	NM_173479.3	NP_775750.3	Q6ZMY6	WDR88_HUMAN	WD repeat domain 88	223								p.S223S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25	Esophageal squamous(110;0.137)					CCACCGTTTCCGTCATCAAAG	0.493																																					p.S223S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C669T	19						.	C		0,4406		0,0,2203	130.0	99.0	109.0		669	-10.9	0.0	19	dbSNP_134	109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WDR88	NM_173479.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		223/473	33639806	1,13005	2203	4300	6503	38331646	SO:0001819	synonymous_variant	126248	exon5			BC031227	CCDS12429.1	19q13.11	2013-01-09	2007-04-04	2007-04-04		ENSG00000166359		"""WD repeat domain containing"""	26999	protein-coding gene	gene with protein product			"""PQQ repeat and WD repeat domain containing"""	PQWD		12477932	Standard	NM_173479		Approved		uc002nui.3	Q6ZMY6		ENST00000355868.3:c.669C>T	19.37:g.33639806C>T			38331646	NM_173479	Q8NEF8	Silent	SNP	ENST00000355868.3	37	CCDS12429.1																																																																																				0.493	WDR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450840.1	NM_173479	
ATP4A	495	broad.mit.edu	37	19	36051502	36051502	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:36051502G>A	ENST00000262623.3	-	6	578	c.550C>T	c.(550-552)Cgc>Tgc	p.R184C		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	184					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.R184C(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	TCTCCATCGCGGATGACAGTG	0.617																																					p.R184C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C550T	19						.						35.0	35.0	35.0					19																	36051502		2203	4300	6503	40743342	SO:0001583	missense	495	exon6				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.550C>T	19.37:g.36051502G>A	ENSP00000262623:p.Arg184Cys		40743342	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	g	16.79	3.220823	0.58560	.	.	ENSG00000105675	ENST00000262623	D	0.94046	-3.34	3.99	3.99	0.46301	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.64402	D	0.000015	D	0.98121	0.9380	H	0.99197	4.465	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98776	1.0730	10	0.87932	D	0	.	13.9607	0.64177	0.0:0.0:1.0:0.0	.	184	P20648	ATP4A_HUMAN	C	184	ENSP00000262623:R184C	ENSP00000262623:R184C	R	-	1	0	ATP4A	40743342	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	2.179000	0.42528	2.227000	0.72691	0.306000	0.20318	CGC		0.617	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
TMIGD2	126259	broad.mit.edu	37	19	4298087	4298087	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:4298087G>A	ENST00000301272.2	-	2	347	c.302C>T	c.(301-303)cCt>cTt	p.P101L	TMIGD2_ENST00000595645.1_Missense_Mutation_p.P101L|TMIGD2_ENST00000600114.1_Intron|TMIGD2_ENST00000600349.1_Intron	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	101	Ig-like.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)	p.P101L(1)|p.P101H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGCTCACAGGGTCCAGCTG	0.642																																					p.P101L												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.C302T	19						.						65.0	68.0	67.0					19																	4298087		2203	4300	6503	4249087	SO:0001583	missense	126259	exon2			BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.302C>T	19.37:g.4298087G>A	ENSP00000301272:p.Pro101Leu		4249087	NM_001169126	Q6UW59	Missense_Mutation	SNP	ENST00000301272.2	37	CCDS12126.1	.	.	.	.	.	.	.	.	.	.	G	5.391	0.257422	0.10239	.	.	ENSG00000167664	ENST00000301272	T	0.28069	1.63	4.09	-8.19	0.01049	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13372	0.0324	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.12116	-1.0560	9	0.27785	T	0.31	.	4.0659	0.09859	0.1911:0.4567:0.2033:0.1489	.	101;101	Q96BF3-2;Q96BF3	.;TMIG2_HUMAN	L	101	ENSP00000301272:P101L	ENSP00000301272:P101L	P	-	2	0	TMIGD2	4249087	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-5.654000	0.00107	-3.515000	0.00149	-0.350000	0.07774	CCT		0.642	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458088.1	NM_144615	
APLP1	333	broad.mit.edu	37	19	36361838	36361838	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:36361838C>T	ENST00000221891.4	+	3	524	c.332C>T	c.(331-333)aCg>aTg	p.T111M	APLP1_ENST00000586861.1_Missense_Mutation_p.T105M|APLP1_ENST00000537454.2_Missense_Mutation_p.T72M|NPHS1_ENST00000591817.1_5'Flank	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	111					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.T111M(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGCAGGCTACGCAGGCCATC	0.697																																					p.T111M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C332T	19						.						19.0	21.0	20.0					19																	36361838		2203	4299	6502	41053678	SO:0001583	missense	333	exon3			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.332C>T	19.37:g.36361838C>T	ENSP00000221891:p.Thr111Met		41053678	NM_001024807	O00113|Q96A92	Missense_Mutation	SNP	ENST00000221891.4	37	CCDS32997.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365860	0.24684	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.93953	-3.25;-3.32	4.96	2.62	0.31277	Amyloidogenic glycoprotein, extracellular (1);Amyloidogenic glycoprotein, heparin-binding (3);	0.912638	0.09172	N	0.838648	D	0.89114	0.6623	N	0.14661	0.345	0.09310	N	1	D;P;P;P	0.59357	0.985;0.917;0.872;0.895	P;B;B;P	0.48921	0.595;0.429;0.36;0.493	T	0.80888	-0.1181	10	0.87932	D	0	-0.1806	9.4215	0.38555	0.3868:0.6132:0.0:0.0	.	105;72;111;111	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	M	72;111	ENSP00000441501:T72M;ENSP00000221891:T111M	ENSP00000221891:T111M	T	+	2	0	APLP1	41053678	0.001000	0.12720	0.033000	0.17914	0.256000	0.26092	1.513000	0.35823	1.045000	0.40225	0.484000	0.47621	ACG		0.697	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452564.1	NM_001024807	
FCGBP	8857	broad.mit.edu	37	19	40392496	40392496	+	Missense_Mutation	SNP	C	C	T	rs143680639	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:40392496C>T	ENST00000221347.6	-	16	8015	c.8008G>A	c.(8008-8010)Ggg>Agg	p.G2670R		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2670	VWFD 6. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)		p.G2670R(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GACAGTGGCCCTGTGGGGCTG	0.597																																					p.G2670R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G8008A	19						.						36.0	38.0	37.0					19																	40392496		2171	4287	6458	45084336	SO:0001583	missense	8857	exon16			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.8008G>A	19.37:g.40392496C>T	ENSP00000221347:p.Gly2670Arg		45084336	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401441	0.42613	.	.	ENSG00000090920	ENST00000221347	T	0.24908	1.83	2.66	2.66	0.31614	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	M	0.92784	3.345	0.42617	D	0.993336	D	0.89917	1.0	D	0.97110	1.0	T	0.70223	-0.4931	10	0.87932	D	0	.	12.5273	0.56093	0.0:1.0:0.0:0.0	.	2670	Q9Y6R7	FCGBP_HUMAN	R	2670	ENSP00000221347:G2670R	ENSP00000221347:G2670R	G	-	1	0	FCGBP	45084336	1.000000	0.71417	0.382000	0.26119	0.147000	0.21601	5.593000	0.67550	1.495000	0.48549	0.298000	0.19748	GGG		0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF112	7771	broad.mit.edu	37	19	44832911	44832911	+	Missense_Mutation	SNP	G	G	A	rs202199443		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:44832911G>A	ENST00000337401.4	-	5	1505	c.1417C>T	c.(1417-1419)Cgc>Tgc	p.R473C	ZNF112_ENST00000354340.4_Missense_Mutation_p.R467C|ZNF112_ENST00000536500.1_Missense_Mutation_p.R490C	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R473C(1)|p.R467C(1)									CACACATAGCGTTTATATGGT	0.403													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20002	0.0		0.0	False		,,,				2504	0.0				p.R467C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1399T	19						.						118.0	107.0	110.0					19																	44832911		2203	4300	6503	49524751	SO:0001583	missense	7771	exon4			AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.1417C>T	19.37:g.44832911G>A	ENSP00000337081:p.Arg473Cys		49524751	NM_013380	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	37	CCDS54276.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	0.005	-2.172726	0.00315	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.00575	6.46;6.46;6.46	4.73	0.312	0.15837	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.027060	0.07822	N	0.959946	T	0.00073	0.0002	N	0.00000	-3.935	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.50346	-0.8839	10	0.02654	T	1	-0.4915	6.7395	0.23428	0.5532:0.0:0.4468:0.0	.	472;490;473	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	C	473;473;467;490;472	ENSP00000337081:R473C;ENSP00000346305:R467C;ENSP00000441990:R490C	ENSP00000253426:R472C	R	-	1	0	ZNF285	49524751	0.004000	0.15560	0.001000	0.08648	0.135000	0.20990	1.882000	0.39648	0.316000	0.23135	0.561000	0.74099	CGC		0.403	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
CKM	1158	broad.mit.edu	37	19	45821107	45821107	+	Silent	SNP	A	A	G			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:45821107A>G	ENST00000221476.3	-	3	498	c.324T>C	c.(322-324)acT>acC	p.T108T		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	108					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.T108T(1)		cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	GGTTGAGGTCAGTCTTGTGCT	0.562																																					p.T108T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T324C	19						.						146.0	116.0	126.0					19																	45821107		2203	4300	6503	50512947	SO:0001819	synonymous_variant	1158	exon3			M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.324T>C	19.37:g.45821107A>G			50512947	NM_001824	Q96QL9	Silent	SNP	ENST00000221476.3	37	CCDS12659.1																																																																																				0.562	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457569.1		
NOVA2	4858	broad.mit.edu	37	19	46457181	46457181	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:46457181C>T	ENST00000263257.5	-	3	447	c.253G>A	c.(253-255)Gta>Ata	p.V85I		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	85	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.V85I(1)		endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		GTGCCCTGTACTAGGCATACC	0.532																																					p.V85I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G253A	19						.						199.0	165.0	177.0					19																	46457181		2203	4300	6503	51149021	SO:0001583	missense	4858	exon3			U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.253G>A	19.37:g.46457181C>T	ENSP00000263257:p.Val85Ile		51149021	NM_002516	O43267|Q9UEA1	Missense_Mutation	SNP	ENST00000263257.5	37	CCDS12679.1	.	.	.	.	.	.	.	.	.	.	C	5.969	0.362750	0.11296	.	.	ENSG00000104967	ENST00000263257	T	0.18174	2.23	5.17	4.13	0.48395	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.063980	0.64402	D	0.000008	T	0.04861	0.0131	N	0.00966	-1.09	0.42916	D	0.994277	B	0.16603	0.018	B	0.20184	0.028	T	0.28396	-1.0045	10	0.02654	T	1	-11.484	11.6811	0.51458	0.0:0.9144:0.0:0.0856	.	85	Q9UNW9	NOVA2_HUMAN	I	85	ENSP00000263257:V85I	ENSP00000263257:V85I	V	-	1	0	NOVA2	51149021	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.338000	0.52128	1.419000	0.47118	0.591000	0.81541	GTA		0.532	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516	
SIGLECL1	284369	broad.mit.edu	37	19	51769106	51769106	+	Missense_Mutation	SNP	C	C	T	rs149546733		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:51769106C>T	ENST00000316401.7	+	4	761	c.380C>T	c.(379-381)gCg>gTg	p.A127V	SIGLECL1_ENST00000593968.1_3'UTR|SIGLECL1_ENST00000597824.1_Missense_Mutation_p.A33V|CTD-3187F8.2_ENST00000597569.1_RNA	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	489	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A127V(1)									ATTGTAATTGCGCTGCTCTTC	0.557																																					p.A127V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C380T	19						.	C	VAL/ALA	0,4406		0,0,2203	243.0	224.0	230.0		380	0.9	0.0	19	dbSNP_134	230	2,8598	2.2+/-6.3	0,2,4298	yes	missense	C19orf75	NM_173635.1	64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	127/198	51769106	2,13004	2203	4300	6503	56460918	SO:0001583	missense	284369	exon4			AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.380C>T	19.37:g.51769106C>T	ENSP00000321249:p.Ala127Val		56460918	NM_173635	Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599762	0.28534	0.0	2.33E-4	ENSG00000179213	ENST00000316401	T	0.38560	1.13	4.38	0.863	0.19062	.	1.625570	0.03695	N	0.247752	T	0.42040	0.1185	L	0.55017	1.72	0.09310	N	1	B;D	0.56287	0.0;0.975	B;P	0.46299	0.001;0.511	T	0.28170	-1.0052	10	0.41790	T	0.15	.	4.069	0.09874	0.0:0.5631:0.2137:0.2231	.	33;127	B7ZLS6;Q8N7X8	.;CS075_HUMAN	V	127	ENSP00000321249:A127V	ENSP00000321249:A127V	A	+	2	0	C19orf75	56460918	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.247000	0.08866	0.507000	0.28148	-0.128000	0.14901	GCG		0.557	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464161.2	NM_173635	
ZSCAN5B	342933	broad.mit.edu	37	19	56704070	56704070	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:56704070G>C	ENST00000586855.2	-	2	665	c.352C>G	c.(352-354)Ctg>Gtg	p.L118V	ZSCAN5B_ENST00000358992.3_Missense_Mutation_p.L118V			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	118	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L118V(2)		breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TTTCGTAGCAGGTCCTCCAGG	0.547																																					p.L118V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C352G	19						.						50.0	54.0	53.0					19																	56704070		2202	4294	6496	61395882	SO:0001583	missense	342933	exon1				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.352C>G	19.37:g.56704070G>C	ENSP00000466072:p.Leu118Val		61395882	NM_001080456		Missense_Mutation	SNP	ENST00000586855.2	37	CCDS46203.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.341251	0.24339	.	.	ENSG00000197213	ENST00000358992	T	0.07688	3.17	2.48	-4.95	0.03048	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.17238	0.0414	M	0.64170	1.965	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.07558	-1.0766	9	0.34782	T	0.22	.	5.6768	0.17753	0.0:0.1783:0.2802:0.5416	.	118	A6NJL1	ZSA5B_HUMAN	V	118	ENSP00000351883:L118V	ENSP00000351883:L118V	L	-	1	2	ZSCAN5B	61395882	0.001000	0.12720	0.050000	0.19076	0.166000	0.22503	-1.910000	0.01584	-0.684000	0.05183	0.313000	0.20887	CTG		0.547	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456	
MUC16	94025	broad.mit.edu	37	19	9067649	9067649	+	Silent	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:9067649G>A	ENST00000397910.4	-	3	20000	c.19797C>T	c.(19795-19797)acC>acT	p.T6599T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6601	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.T6599T(2)|p.T2232T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGAAGTGGTGGTCCCCACAT	0.443																																					p.T6599T												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.C19797T	19						.						199.0	181.0	187.0					19																	9067649		1931	4133	6064	8928649	SO:0001819	synonymous_variant	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19797C>T	19.37:g.9067649G>A			8928649	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																				0.443	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF846	162993	broad.mit.edu	37	19	9868340	9868340	+	Silent	SNP	C	C	T	rs377731453		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:9868340C>T	ENST00000397902.2	-	6	1826	c.1413G>A	c.(1411-1413)acG>acA	p.T471T	ZNF846_ENST00000592859.1_Intron|ZNF846_ENST00000588267.1_Intron|ZNF846_ENST00000586293.1_3'UTR	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	471					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T471T(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						CTCCTGTGTGCGTTCGCATGT	0.433																																					p.T471T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1413A	19						.	C		0,4316		0,0,2158	95.0	104.0	101.0		1413	-4.0	0.0	19		101	1,8571		0,1,4285	no	coding-synonymous	ZNF846	NM_001077624.1		0,1,6443	TT,TC,CC		0.0117,0.0,0.0078		471/534	9868340	1,12887	2158	4286	6444	9729340	SO:0001819	synonymous_variant	162993	exon6			AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.1413G>A	19.37:g.9868340C>T			9729340	NM_001077624	A8K0H1|B3KUP1	Silent	SNP	ENST00000397902.2	37	CCDS42496.1																																																																																				0.433	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624	
ZNF471	57573	broad.mit.edu	37	19	57027677	57027677	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr19:57027677T>C	ENST00000308031.5	+	3	200	c.67T>C	c.(67-69)Ttt>Ctt	p.F23L	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Missense_Mutation_p.F23L	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	23	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F23L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		GGCAATAGATTTTTCCCAGGA	0.418																																					p.F23L	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T67C	19						.						149.0	135.0	140.0					19																	57027677		2203	4300	6503	61719489	SO:0001583	missense	57573	exon3			AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.67T>C	19.37:g.57027677T>C	ENSP00000309161:p.Phe23Leu		61719489	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	37	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.716358	0.68844	.	.	ENSG00000196263	ENST00000308031	T	0.12879	2.64	3.77	3.77	0.43336	Krueppel-associated box (4);	.	.	.	.	T	0.35068	0.0919	M	0.76574	2.34	0.28823	N	0.897584	D	0.76494	0.999	D	0.79108	0.992	T	0.07947	-1.0746	9	0.52906	T	0.07	.	10.7951	0.46455	0.0:0.0:0.0:1.0	.	23	Q9BX82	ZN471_HUMAN	L	23	ENSP00000309161:F23L	ENSP00000309161:F23L	F	+	1	0	ZNF471	61719489	0.998000	0.40836	0.921000	0.36526	0.976000	0.68499	2.040000	0.41203	1.708000	0.51301	0.528000	0.53228	TTT		0.418	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
ABRA	137735	broad.mit.edu	37	8	107782396	107782396	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr8:107782396C>A	ENST00000311955.3	-	1	77	c.23G>T	c.(22-24)aGc>aTc	p.S8I		NM_139166.4	NP_631905.1			actin-binding Rho activating protein									p.S8I(1)		breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			GCCCTCCCCGCTTTCCTTTTC	0.602																																					p.S8I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G23T	8						.						37.0	41.0	40.0					8																	107782396		2201	4298	6499	107851572	SO:0001583	missense	137735	exon1			AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.23G>T	8.37:g.107782396C>A	ENSP00000311436:p.Ser8Ile		107851572	NM_139166		Missense_Mutation	SNP	ENST00000311955.3	37	CCDS6305.1	.	.	.	.	.	.	.	.	.	.	C	5.954	0.360073	0.11296	.	.	ENSG00000174429	ENST00000311955	.	.	.	5.29	4.35	0.52113	.	0.493537	0.25601	N	0.029556	T	0.27933	0.0688	N	0.14661	0.345	0.09310	N	1	B	0.24882	0.113	B	0.18871	0.023	T	0.32455	-0.9906	9	0.72032	D	0.01	.	14.8959	0.70644	0.0:0.6747:0.3253:0.0	.	8	Q8N0Z2	ABRA_HUMAN	I	8	.	ENSP00000311436:S8I	S	-	2	0	ABRA	107851572	0.000000	0.05858	0.332000	0.25469	0.135000	0.20990	0.286000	0.18902	2.613000	0.88420	0.609000	0.83330	AGC		0.602	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380416.1	NM_139166	
CSMD1	64478	broad.mit.edu	37	8	4495006	4495006	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr8:4495006T>A	ENST00000520002.1	-	2	715	c.160A>T	c.(160-162)Aac>Tac	p.N54Y	CSMD1_ENST00000602723.1_Missense_Mutation_p.N54Y|CSMD1_ENST00000400186.3_Missense_Mutation_p.N54Y|CSMD1_ENST00000539096.1_Missense_Mutation_p.N54Y|CSMD1_ENST00000542608.1_Missense_Mutation_p.N54Y|CSMD1_ENST00000602557.1_Missense_Mutation_p.N54Y|CSMD1_ENST00000537824.1_Missense_Mutation_p.N54Y			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	54	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)		p.N54Y(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TTGGCATAGTTCGGATACCCG	0.468																																					p.N54Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A160T	8						.						106.0	107.0	106.0					8																	4495006		1937	4153	6090	4482414	SO:0001583	missense	64478	exon2					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.160A>T	8.37:g.4495006T>A	ENSP00000430733:p.Asn54Tyr		4482414	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	T	16.77	3.216358	0.58452	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.32	5.32	0.75619	.	.	.	.	.	T	0.61223	0.2330	M	0.89478	3.035	0.39734	D	0.97164	D	0.89917	1.0	D	0.91635	0.999	T	0.70941	-0.4735	9	0.87932	D	0	.	13.2346	0.59963	0.0:0.0:0.0:1.0	.	54	E5RIG2	.	Y	54	ENSP00000383047:N54Y;ENSP00000430733:N54Y;ENSP00000441462:N54Y;ENSP00000446243:N54Y;ENSP00000441675:N54Y	ENSP00000383047:N54Y	N	-	1	0	CSMD1	4482414	1.000000	0.71417	0.897000	0.35233	0.155000	0.21991	7.975000	0.88055	2.029000	0.59856	0.477000	0.44152	AAC		0.468	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
XKR4	114786	broad.mit.edu	37	8	56436504	56436504	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr8:56436504C>T	ENST00000327381.6	+	3	1771	c.1671C>T	c.(1669-1671)agC>agT	p.S557S	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	557						integral component of membrane (GO:0016021)		p.S557S(1)		NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GTGTTGTCAGCGACCGCGATC	0.592																																					p.S557S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1671T	8						.						66.0	68.0	68.0					8																	56436504		2203	4300	6503	56599058	SO:0001819	synonymous_variant	114786	exon3			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1671C>T	8.37:g.56436504C>T			56599058	NM_052898	Q96PZ8	Silent	SNP	ENST00000327381.6	37	CCDS34893.1																																																																																				0.592	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
CSMD3	114788	broad.mit.edu	37	8	113267642	113267642	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr8:113267642C>A	ENST00000297405.5	-	62	10121	c.9877G>T	c.(9877-9879)Gac>Tac	p.D3293Y	CSMD3_ENST00000343508.3_Missense_Mutation_p.D3253Y|CSMD3_ENST00000352409.3_Missense_Mutation_p.D3223Y|CSMD3_ENST00000455883.2_Missense_Mutation_p.D3124Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3293	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D3293Y(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATACCAGGGTCACCACAAAAC	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.D3293Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G9877T	8						.						88.0	84.0	85.0					8																	113267642		2203	4300	6503	113336818	SO:0001583	missense	114788	exon62			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.9877G>T	8.37:g.113267642C>A	ENSP00000297405:p.Asp3293Tyr		113336818	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204153	0.79127	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	4.99	4.99	0.66335	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.80768	0.4686	M	0.81942	2.565	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.876	D;D;P	0.81914	0.991;0.995;0.457	D	0.83503	0.0076	10	0.87932	D	0	.	18.485	0.90825	0.0:1.0:0.0:0.0	.	3124;3293;3253	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	3253;3293;2563;3124;3223	ENSP00000345799:D3253Y;ENSP00000297405:D3293Y;ENSP00000341558:D2563Y;ENSP00000412263:D3124Y;ENSP00000343124:D3223Y	ENSP00000297405:D3293Y	D	-	1	0	CSMD3	113336818	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.581000	0.82535	2.601000	0.87937	0.650000	0.86243	GAC		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
EPS8L3	79574	broad.mit.edu	37	1	110301241	110301241	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:110301241C>T	ENST00000361965.4	-	7	612	c.506G>A	c.(505-507)gGg>gAg	p.G169E	RP4-735C1.4_ENST00000431955.1_RNA|EPS8L3_ENST00000494151.1_5'UTR|EPS8L3_ENST00000361852.4_Missense_Mutation_p.G169E|EPS8L3_ENST00000369805.3_Missense_Mutation_p.G170E	NM_133181.3	NP_573444.2	Q8TE67	ES8L3_HUMAN	EPS8-like 3	169						cytoplasm (GO:0005737)		p.G170E(1)		breast(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	32		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		CATAGCAGGCCCCCTCCATCT	0.607																																					p.G170E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G509A	1						.						56.0	54.0	55.0					1																	110301241		2203	4300	6503	110102764	SO:0001583	missense	79574	exon7			AK025175	CCDS813.1, CCDS814.1, CCDS815.1	1p13.2	2008-02-05			ENSG00000198758	ENSG00000198758			21297	protein-coding gene	gene with protein product		614989				12620401	Standard	NM_139053		Approved	FLJ21522, MGC16817	uc001dyq.2	Q8TE67	OTTHUMG00000011651	ENST00000361965.4:c.506G>A	1.37:g.110301241C>T	ENSP00000355255:p.Gly169Glu		110102764	NM_139053	A8K833|Q5T8Q6|Q5T8Q7|Q5T8Q8|Q96E47|Q9H719	Missense_Mutation	SNP	ENST00000361965.4	37	CCDS814.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062007	0.36373	.	.	ENSG00000198758	ENST00000361852;ENST00000369805;ENST00000361965	T;T;T	0.59638	2.61;0.26;0.25	5.35	3.33	0.38152	.	0.800615	0.11900	N	0.518687	T	0.33381	0.0861	M	0.70595	2.14	0.09310	N	1	B;B;B;B	0.24368	0.013;0.023;0.007;0.102	B;B;B;B	0.25759	0.01;0.016;0.004;0.063	T	0.29027	-1.0025	10	0.15952	T	0.53	-19.5781	9.1532	0.36976	0.1631:0.6786:0.1583:0.0	.	169;169;169;170	A8K2J6;Q8TE67-2;Q8TE67;Q8TE67-3	.;.;ES8L3_HUMAN;.	E	169;170;169	ENSP00000354551:G169E;ENSP00000358820:G170E;ENSP00000355255:G169E	ENSP00000354551:G169E	G	-	2	0	EPS8L3	110102764	0.000000	0.05858	0.045000	0.18777	0.331000	0.28603	-0.059000	0.11731	1.343000	0.45638	0.655000	0.94253	GGG		0.607	EPS8L3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000032234.1	NM_024526	
LYSMD1	388695	broad.mit.edu	37	1	151137721	151137721	+	Missense_Mutation	SNP	G	G	A	rs200029870		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:151137721G>A	ENST00000368908.5	-	1	674	c.14C>T	c.(13-15)tCt>tTt	p.S5F	SCNM1_ENST00000368905.4_5'Flank|LYSMD1_ENST00000440902.2_Intron	NM_212551.4	NP_997716.1	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain containing 1	5								p.S5F(1)		endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGGCTGTCTAGACGGGGAAGC	0.592																																					p.S5F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C14T	1						.						38.0	41.0	40.0					1																	151137721		2203	4300	6503	149404345	SO:0001583	missense	388695	exon1			BX647911	CCDS986.1, CCDS44218.1	1q21.2	2008-02-05			ENSG00000163155	ENSG00000163155			32070	protein-coding gene	gene with protein product						12477932	Standard	NM_212551		Approved	SB145, MGC35223, RP11-68I18.5	uc001ewy.3	Q96S90	OTTHUMG00000012260	ENST00000368908.5:c.14C>T	1.37:g.151137721G>A	ENSP00000357904:p.Ser5Phe		149404345	NM_212551	B4DQA1|Q69YX9	Missense_Mutation	SNP	ENST00000368908.5	37	CCDS986.1	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508010	0.64410	.	.	ENSG00000163155	ENST00000368908	T	0.34472	1.36	5.04	5.04	0.67666	.	0.349858	0.30989	N	0.008479	T	0.32164	0.0820	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.03863	-1.0997	10	0.12430	T	0.62	.	17.3159	0.87224	0.0:0.0:1.0:0.0	.	5	Q96S90	LYSM1_HUMAN	F	5	ENSP00000357904:S5F	ENSP00000357904:S5F	S	-	2	0	LYSMD1	149404345	1.000000	0.71417	1.000000	0.80357	0.464000	0.32679	4.118000	0.57884	2.607000	0.88179	0.557000	0.71058	TCT		0.592	LYSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034070.3	NM_212551	
IL6R	3570	broad.mit.edu	37	1	154408532	154408532	+	Missense_Mutation	SNP	G	G	A	rs375243100		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:154408532G>A	ENST00000368485.3	+	6	1332	c.895G>A	c.(895-897)Ggg>Agg	p.G299R	IL6R_ENST00000344086.4_Missense_Mutation_p.G299R|IL6R_ENST00000507256.1_Intron	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	299	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)	p.G299R(1)	IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	GGAGGAGTTCGGGCAAGGCGA	0.637																																					p.G299R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G895A	1						.	G	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	87.0	74.0	78.0		895,895,895	1.9	0.4	1		78	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	IL6R	NM_000565.3,NM_001206866.1,NM_181359.2	125,125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	299/469,299/353,299/366	154408532	1,13005	2203	4300	6503	152675156	SO:0001583	missense	3570	exon6			X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.895G>A	1.37:g.154408532G>A	ENSP00000357470:p.Gly299Arg		152675156	NM_181359	A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Missense_Mutation	SNP	ENST00000368485.3	37	CCDS1067.1	.	.	.	.	.	.	.	.	.	.	G	8.648	0.897580	0.17686	0.0	1.16E-4	ENSG00000160712	ENST00000368485;ENST00000344086	T;T	0.21361	2.34;2.01	5.29	1.93	0.25924	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.823181	0.11253	N	0.583388	T	0.06508	0.0167	M	0.74647	2.275	0.09310	N	1	P;B	0.46621	0.881;0.421	B;B	0.31016	0.123;0.027	T	0.28267	-1.0049	10	0.41790	T	0.15	-9.0432	3.259	0.06842	0.276:0.2246:0.4994:0.0	.	299;299	P08887-2;P08887	.;IL6RA_HUMAN	R	299	ENSP00000357470:G299R;ENSP00000340589:G299R	ENSP00000340589:G299R	G	+	1	0	IL6R	152675156	0.011000	0.17503	0.433000	0.26760	0.073000	0.16967	1.093000	0.30939	0.574000	0.29417	-0.165000	0.13383	GGG		0.637	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087911.1	NM_000565	
PAPPA2	60676	broad.mit.edu	37	1	176769219	176769219	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:176769219G>A	ENST00000367662.3	+	21	6317	c.5153G>A	c.(5152-5154)cGt>cAt	p.R1718H		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1718	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R1718H(1)		NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						ACTGGCCGGCGTCAATGGCAC	0.493																																					p.R1718H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5153A	1						.						133.0	129.0	131.0					1																	176769219		1935	4140	6075	175035842	SO:0001583	missense	60676	exon21			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5153G>A	1.37:g.176769219G>A	ENSP00000356634:p.Arg1718His		175035842	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	17.21	3.330450	0.60743	.	.	ENSG00000116183	ENST00000367662	T	0.01705	4.68	6.02	3.07	0.35406	.	0.289113	0.33092	N	0.005285	T	0.04048	0.0113	L	0.51422	1.61	0.09310	N	0.999999	D	0.76494	0.999	P	0.58210	0.835	T	0.36286	-0.9754	10	0.38643	T	0.18	-9.571	5.7732	0.18265	0.1489:0.0:0.6041:0.247	.	1718	Q9BXP8	PAPP2_HUMAN	H	1718	ENSP00000356634:R1718H	ENSP00000356634:R1718H	R	+	2	0	PAPPA2	175035842	0.007000	0.16637	0.443000	0.26883	0.918000	0.54935	1.478000	0.35442	0.897000	0.36392	-0.122000	0.15005	CGT		0.493	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
RASAL2	9462	broad.mit.edu	37	1	178389684	178389684	+	Silent	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:178389684G>A	ENST00000462775.1	+	3	284	c.159G>A	c.(157-159)agG>agA	p.R53R	RASAL2_ENST00000448150.3_Silent_p.R183R|RASAL2_ENST00000367649.3_Silent_p.R201R	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	53	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.R53S(1)|p.R183S(1)|p.R183R(1)|p.R201R(1)|p.R201S(1)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CCATCAAGAGGACCAAAAGCC	0.463																																					p.R201R												.	.	5	Substitution - Missense(3)|Substitution - coding silent(2)	lung(3)|large_intestine(2)	c.G603A	1						.						74.0	68.0	70.0					1																	178389684		2203	4300	6503	176656307	SO:0001819	synonymous_variant	9462	exon5			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.159G>A	1.37:g.178389684G>A			176656307	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Silent	SNP	ENST00000462775.1	37	CCDS1322.1																																																																																				0.463	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
KDM5B	10765	broad.mit.edu	37	1	202702942	202702942	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:202702942T>G	ENST00000367265.3	-	23	4660	c.3496A>C	c.(3496-3498)Aaa>Caa	p.K1166Q	KDM5B_ENST00000367264.2_Missense_Mutation_p.K1202Q	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1166					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.K1166Q(1)		breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GACAGCAATTTCCCTTCATTG	0.473																																					p.K1166Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3496C	1						.						108.0	116.0	114.0					1																	202702942		2203	4300	6503	200969565	SO:0001583	missense	10765	exon23			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3496A>C	1.37:g.202702942T>G	ENSP00000356234:p.Lys1166Gln		200969565	NM_006618	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	37	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841515	0.71488	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.85013	-1.93;-1.93;-1.93	5.89	5.89	0.94794	Zinc finger, FYVE/PHD-type (1);	0.041875	0.85682	D	0.000000	D	0.90823	0.7118	M	0.68317	2.08	0.80722	D	1	D;D	0.69078	0.997;0.981	P;D	0.63793	0.904;0.918	D	0.91427	0.5163	10	0.62326	D	0.03	-26.7497	16.3036	0.82836	0.0:0.0:0.0:1.0	.	1202;1166	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	Q	1166;1008;1202;1008	ENSP00000356234:K1166Q;ENSP00000356233:K1202Q;ENSP00000235790:K1008Q	ENSP00000235790:K1008Q	K	-	1	0	KDM5B	200969565	1.000000	0.71417	0.977000	0.42913	0.281000	0.26958	7.695000	0.84257	2.251000	0.74343	0.533000	0.62120	AAA		0.473	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
NEK2	4751	broad.mit.edu	37	1	211842487	211842487	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:211842487C>T	ENST00000366999.4	-	6	1091	c.953G>A	c.(952-954)cGa>cAa	p.R318Q	NEK2_ENST00000462283.1_5'UTR|NEK2_ENST00000540251.1_Missense_Mutation_p.R275Q|NEK2_ENST00000366998.3_Missense_Mutation_p.R318Q	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	318	Interaction with PCNT.|Leucine-zipper.				blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)	p.R318Q(1)		breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		TTTGAGAGCTCGCTCTCGCTC	0.453																																					p.R318Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G953A	1						.						209.0	220.0	216.0					1																	211842487		2203	4300	6503	209909110	SO:0001583	missense	4751	exon6			U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.953G>A	1.37:g.211842487C>T	ENSP00000355966:p.Arg318Gln		209909110	NM_002497	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Missense_Mutation	SNP	ENST00000366999.4	37	CCDS1500.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785519	0.31593	.	.	ENSG00000117650	ENST00000366999;ENST00000540251;ENST00000366998	T;T;T	0.32023	1.47;1.47;1.47	4.76	-1.44	0.08856	.	0.572625	0.19593	N	0.110575	T	0.07683	0.0193	N	0.02158	-0.66	0.28095	N	0.931653	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.36456	-0.9747	10	0.06625	T	0.88	.	5.4603	0.16614	0.0:0.3886:0.1443:0.4671	.	318;318;318	P51955-2;P51955;P51955-4	.;NEK2_HUMAN;.	Q	318;275;318	ENSP00000355966:R318Q;ENSP00000440237:R275Q;ENSP00000355965:R318Q	ENSP00000355965:R318Q	R	-	2	0	NEK2	209909110	0.000000	0.05858	0.968000	0.41197	0.926000	0.56050	-0.158000	0.10070	-0.075000	0.12798	-0.237000	0.12165	CGA		0.453	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	
DISP1	84976	broad.mit.edu	37	1	223177920	223177920	+	Missense_Mutation	SNP	C	C	T	rs371849402		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:223177920C>T	ENST00000284476.6	+	8	3345	c.3181C>T	c.(3181-3183)Cgc>Tgc	p.R1061C		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	1061					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)	p.R1061C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		GGTTGCCTACCGCTTGGCTCC	0.582																																					p.R1061C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3181T	1						.	C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	119.0	113.0	115.0		3181	5.0	1.0	1		115	0,8600		0,0,4300	no	missense	DISP1	NM_032890.3	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	1061/1525	223177920	1,13005	2203	4300	6503	221244543	SO:0001583	missense	84976	exon8			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.3181C>T	1.37:g.223177920C>T	ENSP00000284476:p.Arg1061Cys		221244543	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	ENST00000284476.6	37	CCDS1536.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278060	0.59758	2.27E-4	0.0	ENSG00000154309	ENST00000284476	D	0.85339	-1.97	5.95	5.03	0.67393	.	0.091610	0.85682	D	0.000000	D	0.84615	0.5511	M	0.67700	2.07	0.80722	D	1	B	0.26400	0.148	B	0.30179	0.112	T	0.81824	-0.0755	10	0.38643	T	0.18	-32.2348	15.4394	0.75171	0.0:0.9329:0.0:0.0671	.	1061	Q96F81	DISP1_HUMAN	C	1061	ENSP00000284476:R1061C	ENSP00000284476:R1061C	R	+	1	0	DISP1	221244543	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.716000	0.61916	1.503000	0.48686	0.491000	0.48974	CGC		0.582	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
RNF207	388591	broad.mit.edu	37	1	6278400	6278400	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:6278400C>T	ENST00000377939.4	+	17	1831	c.1704C>T	c.(1702-1704)gaC>gaT	p.D568D	RNF207_ENST00000377948.2_3'UTR|RNF207_ENST00000483336.1_3'UTR	NM_207396.2	NP_997279.2	Q6ZRF8	RN207_HUMAN	ring finger protein 207	568						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.D568D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(2)	16	Ovarian(185;0.0634)	all_cancers(23;1.22e-38)|all_epithelial(116;4.25e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.84e-38)|GBM - Glioblastoma multiforme(13;5.77e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.88e-19)|Colorectal(212;6.9e-08)|COAD - Colon adenocarcinoma(227;8.13e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		ACACGCACGACGACAGCAGGA	0.577																																					p.D568D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1704T	1						.						69.0	81.0	77.0					1																	6278400		2141	4253	6394	6200987	SO:0001819	synonymous_variant	388591	exon17			AK128246	CCDS59.2	1p36.31	2008-11-19			ENSG00000158286	ENSG00000158286		"""RING-type (C3HC4) zinc fingers"""	32947	protein-coding gene	gene with protein product	"""OTTHUMG00000001089"""		"""chromosome 1 open reading frame 188"""	C1orf188			Standard	NM_207396		Approved	FLJ46380, FLJ32096	uc001amg.3	Q6ZRF8	OTTHUMG00000001089	ENST00000377939.4:c.1704C>T	1.37:g.6278400C>T			6200987	NM_207396	A2VCM8|B4DFR6|Q5TGS6|Q6ZS63|Q96MP2	Silent	SNP	ENST00000377939.4	37	CCDS59.2																																																																																				0.577	RNF207-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003669.2	NM_207396	
SLC2A7	155184	broad.mit.edu	37	1	9082990	9082990	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:9082990C>A	ENST00000400906.1	-	3	297	c.298G>T	c.(298-300)Gat>Tat	p.D100Y		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	100					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.D100Y(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CCGCAGCTATCAACCAGCAGG	0.547																																					p.D100Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G298T	1						.						138.0	134.0	135.0					1																	9082990		2203	4300	6503	9005577	SO:0001583	missense	155184	exon3			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.298G>T	1.37:g.9082990C>A	ENSP00000383698:p.Asp100Tyr		9005577	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702906	0.48412	.	.	ENSG00000197241	ENST00000400906	T	0.73789	-0.78	4.86	1.88	0.25563	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.196667	0.41194	D	0.000936	T	0.81550	0.4846	M	0.81942	2.565	0.09310	N	1	P	0.49961	0.93	P	0.59948	0.866	T	0.71130	-0.4682	10	0.72032	D	0.01	.	6.8259	0.23883	0.0:0.5246:0.0:0.4754	.	100	Q6PXP3	GTR7_HUMAN	Y	100	ENSP00000383698:D100Y	ENSP00000383698:D100Y	D	-	1	0	SLC2A7	9005577	0.189000	0.23263	0.005000	0.12908	0.026000	0.11368	1.350000	0.34010	0.624000	0.30286	0.561000	0.74099	GAT		0.547	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
CSMD2	114784	broad.mit.edu	37	1	34037186	34037186	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:34037186G>A	ENST00000373381.4	-	51	8079	c.7903C>T	c.(7903-7905)Cgc>Tgc	p.R2635C		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2637	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2637C(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCCTGACAGCGGATGACCCTT	0.572																																					p.R2637C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7909T	1						.						87.0	76.0	80.0					1																	34037186		2203	4300	6503	33809773	SO:0001583	missense	114784	exon52			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7903C>T	1.37:g.34037186G>A	ENSP00000362479:p.Arg2635Cys		33809773	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	G	22.5	4.300383	0.81136	.	.	ENSG00000121904	ENST00000373381	T	0.66099	-0.19	5.32	4.4	0.53042	Complement control module (2);Sushi/SCR/CCP (3);	0.121265	0.53938	D	0.000041	T	0.77765	0.4179	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	0.987;1.0	P;D	0.71414	0.846;0.973	T	0.79045	-0.1964	10	0.59425	D	0.04	.	8.6692	0.34140	0.0815:0.0:0.7583:0.1603	.	2637;2635	Q7Z408;E7EUA6	CSMD2_HUMAN;.	C	2635	ENSP00000362479:R2635C	ENSP00000241312:R2637C	R	-	1	0	CSMD2	33809773	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.617000	0.54181	1.237000	0.43756	0.655000	0.94253	CGC		0.572	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
INADL	10207	broad.mit.edu	37	1	62349972	62349972	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:62349972G>C	ENST00000371158.2	+	22	3137	c.3023G>C	c.(3022-3024)aGg>aCg	p.R1008T	INADL_ENST00000316485.6_Missense_Mutation_p.R1008T	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1008					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.R1008T(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GTGGCTCAAAGGAGGGAGCAA	0.463																																					p.R1008T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3023C	1						.						213.0	188.0	196.0					1																	62349972		2203	4300	6503	62122560	SO:0001583	missense	10207	exon22			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3023G>C	1.37:g.62349972G>C	ENSP00000360200:p.Arg1008Thr		62122560	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	g	3.668	-0.068156	0.07228	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.13657	2.72;2.57	5.13	2.21	0.28008	.	0.614978	0.15878	N	0.240200	T	0.12732	0.0309	M	0.65975	2.015	0.09310	N	1	B;B;B	0.24132	0.098;0.085;0.029	B;B;B	0.27608	0.067;0.026;0.081	T	0.32824	-0.9892	10	0.14252	T	0.57	.	4.2443	0.10663	0.0856:0.1565:0.5956:0.1622	.	1008;1008;1008	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	T	1008	ENSP00000360200:R1008T;ENSP00000326199:R1008T	ENSP00000255202:R1008T	R	+	2	0	INADL	62122560	0.132000	0.22450	0.067000	0.19924	0.001000	0.01503	0.816000	0.27267	0.773000	0.33404	-0.233000	0.12211	AGG		0.463	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
RYR2	6262	broad.mit.edu	37	1	237954780	237954780	+	Missense_Mutation	SNP	G	G	A	rs397516510		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr1:237954780G>A	ENST00000366574.2	+	93	13845	c.13528G>A	c.(13528-13530)Gca>Aca	p.A4510T	RYR2_ENST00000542537.1_Missense_Mutation_p.A4494T|RYR2_ENST00000360064.6_Missense_Mutation_p.A4516T	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4510			A -> T (in CPVT1). {ECO:0000269|PubMed:15466642}.		BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.A4508T(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTATTTGTCGCATTTGCTAT	0.323																																					p.A4510T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G13528A	1	GRCh37	CM043079	RYR2	M		.						208.0	181.0	189.0					1																	237954780		1844	4089	5933	236021403	SO:0001583	missense	6262	exon93			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13528G>A	1.37:g.237954780G>A	ENSP00000355533:p.Ala4510Thr		236021403	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036831	0.93630	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97089	-4.24;-4.24;-4.24	4.66	4.66	0.58398	Ryanodine Receptor TM 4-6 (1);	0.000000	0.56097	U	0.000037	D	0.98163	0.9393	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.99482	1.0948	10	0.87932	D	0	.	17.917	0.88954	0.0:0.0:1.0:0.0	.	4510	Q92736	RYR2_HUMAN	T	4510;4516;4494	ENSP00000355533:A4510T;ENSP00000353174:A4516T;ENSP00000443798:A4494T	ENSP00000353174:A4516T	A	+	1	0	RYR2	236021403	1.000000	0.71417	0.969000	0.41365	0.891000	0.51852	9.813000	0.99286	2.309000	0.77851	0.555000	0.69702	GCA		0.323	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RAB39A	54734	broad.mit.edu	37	11	107832799	107832799	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:107832799C>T	ENST00000320578.2	+	2	421	c.355C>T	c.(355-357)Cgg>Tgg	p.R119W		NM_017516.1	NP_059986.1	Q14964	RB39A_HUMAN	RAB39A, member RAS oncogene family	119					phagosome acidification (GO:0090383)|phagosome-lysosome fusion (GO:0090385)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.R119W(1)									ACAGCCATTTCGGATTGTATT	0.378																																					p.R119W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C355T	11						.						78.0	74.0	76.0					11																	107832799		2201	4298	6499	107338009	SO:0001583	missense	54734	exon2			X99962	CCDS8338.1	11q22.3	2011-11-22	2011-11-22	2011-11-22	ENSG00000179331	ENSG00000179331		"""RAB, member RAS oncogene"""	16521	protein-coding gene	gene with protein product	"""rab-related GTP-binding protein"""		"""RAB39, member RAS oncogene family"""	RAB39		9119394	Standard	NM_017516		Approved		uc001pjt.3	Q14964	OTTHUMG00000166367	ENST00000320578.2:c.355C>T	11.37:g.107832799C>T	ENSP00000322594:p.Arg119Trp		107338009	NM_017516	A8KAA4|Q8N6W2	Missense_Mutation	SNP	ENST00000320578.2	37	CCDS8338.1	.	.	.	.	.	.	.	.	.	.	C	19.70	3.876868	0.72180	.	.	ENSG00000179331	ENST00000320578	T	0.80033	-1.33	5.21	5.21	0.72293	Small GTP-binding protein domain (1);	0.382752	0.22323	N	0.061577	D	0.83202	0.5203	L	0.34521	1.04	0.34607	D	0.717194	D	0.60160	0.987	P	0.57244	0.816	D	0.87944	0.2719	10	0.87932	D	0	.	18.9407	0.92604	0.0:1.0:0.0:0.0	.	119	Q14964	RB39A_HUMAN	W	119	ENSP00000322594:R119W	ENSP00000322594:R119W	R	+	1	2	RAB39	107338009	1.000000	0.71417	0.999000	0.59377	0.819000	0.46315	2.869000	0.48444	2.693000	0.91896	0.655000	0.94253	CGG		0.378	RAB39A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389423.1	NM_017516	
KCNC1	3746	broad.mit.edu	37	11	17793429	17793429	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:17793429G>A	ENST00000379472.3	+	2	818	c.788G>A	c.(787-789)cGt>cAt	p.R263H	KCNC1_ENST00000265969.6_Missense_Mutation_p.R263H	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	263					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.R263H(1)		breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	TTCCTCATGCGTGTCATCTTC	0.567																																					p.R263H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G788A	11						.						305.0	259.0	275.0					11																	17793429		2200	4293	6493	17750005	SO:0001583	missense	3746	exon2			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.788G>A	11.37:g.17793429G>A	ENSP00000368785:p.Arg263His		17750005	NM_004976	K4DI87	Missense_Mutation	SNP	ENST00000379472.3	37	CCDS7827.1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772471	0.69992	.	.	ENSG00000129159	ENST00000265969;ENST00000379472	D;D	0.98684	-5.07;-5.07	4.77	4.77	0.60923	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99174	0.9714	M	0.84846	2.72	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.99501	1.0953	10	0.66056	D	0.02	.	17.808	0.88607	0.0:0.0:1.0:0.0	.	263;263	Q3KNS8;P48547	.;KCNC1_HUMAN	H	263	ENSP00000265969:R263H;ENSP00000368785:R263H	ENSP00000265969:R263H	R	+	2	0	KCNC1	17750005	1.000000	0.71417	0.994000	0.49952	0.883000	0.51084	9.869000	0.99810	2.202000	0.70862	0.555000	0.69702	CGT		0.567	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976	
CAT	847	broad.mit.edu	37	11	34478355	34478355	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:34478355A>T	ENST00000241052.4	+	8	1136	c.1047A>T	c.(1045-1047)aaA>aaT	p.K349N		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	349					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.K349N(1)		breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	GTCCTGACAAAATGCTTCAGG	0.478																																					p.K349N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1047T	11						.						77.0	61.0	66.0					11																	34478355		2202	4298	6500	34434931	SO:0001583	missense	847	exon8			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1047A>T	11.37:g.34478355A>T	ENSP00000241052:p.Lys349Asn		34434931	NM_001752	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Missense_Mutation	SNP	ENST00000241052.4	37	CCDS7891.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.916169	0.73098	.	.	ENSG00000121691	ENST00000241052	D	0.92446	-3.04	6.04	-3.64	0.04515	Catalase domain (1);Catalase, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96895	0.8986	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95841	0.8866	10	0.87932	D	0	-24.192	14.6482	0.68777	0.5116:0.0:0.4884:0.0	.	349	P04040	CATA_HUMAN	N	349	ENSP00000241052:K349N	ENSP00000241052:K349N	K	+	3	2	CAT	34434931	1.000000	0.71417	0.922000	0.36590	0.736000	0.42039	1.155000	0.31700	-0.978000	0.03533	-0.371000	0.07208	AAA		0.478	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752	
LRRC55	219527	broad.mit.edu	37	11	56954801	56954801	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:56954801C>T	ENST00000497933.1	+	2	1020	c.873C>T	c.(871-873)gcC>gcT	p.A291A		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	261					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A291A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						GCTTCAAGGCCTGCCACCTGA	0.582																																					p.A291A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C873T	11						.						158.0	111.0	127.0					11																	56954801		2201	4296	6497	56711377	SO:0001819	synonymous_variant	219527	exon2				CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.873C>T	11.37:g.56954801C>T			56711377	NM_001005210	A7E2U7|B2RN81	Silent	SNP	ENST00000497933.1	37	CCDS31539.1																																																																																				0.582	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	NM_001005210	
APLNR	187	broad.mit.edu	37	11	57004033	57004033	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:57004033G>A	ENST00000606794.1	-	1	642	c.446C>T	c.(445-447)gCc>gTc	p.A149V		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	149					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.A149V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						AACTGCCGTGGCCACGGCCCC	0.652																																					p.A149V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C446T	11						.						35.0	32.0	33.0					11																	57004033		2200	4294	6494	56760609	SO:0001583	missense	187	exon1			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.446C>T	11.37:g.57004033G>A	ENSP00000475344:p.Ala149Val		56760609	NM_005161		Missense_Mutation	SNP	ENST00000606794.1	37	CCDS7950.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.898755	0.33535	.	.	ENSG00000134817	ENST00000257254	T	0.35421	1.31	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.131941	0.52532	D	0.000075	T	0.21962	0.0529	N	0.25060	0.705	0.42160	D	0.991592	B	0.11235	0.004	B	0.17722	0.019	T	0.06041	-1.0849	10	0.02654	T	1	-22.2821	12.866	0.57939	0.0795:0.0:0.9205:0.0	.	149	P35414	APJ_HUMAN	V	149	ENSP00000257254:A149V	ENSP00000257254:A149V	A	-	2	0	APLNR	56760609	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	3.437000	0.52863	2.448000	0.82819	0.555000	0.69702	GCC		0.652	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470575.1	NM_005161	
ARAP1	116985	broad.mit.edu	37	11	72423599	72423599	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:72423599C>T	ENST00000393609.3	-	6	964	c.762G>A	c.(760-762)ccG>ccA	p.P254P	ARAP1_ENST00000393605.3_Silent_p.P14P|ARAP1_ENST00000359373.5_Silent_p.P254P|ARAP1_ENST00000455638.2_Silent_p.P254P|ARAP1_ENST00000426523.1_Silent_p.P9P|ARAP1_ENST00000429686.1_Silent_p.P9P|ARAP1_ENST00000334211.8_Silent_p.P9P	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	254					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.P254P(1)|p.P14P(1)		cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GGACTCGGCTCGGTGGGGGCT	0.672																																					p.P254P	Ovarian(102;1198 1520 13195 17913 37529)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G762A	11						.						110.0	99.0	103.0					11																	72423599		2200	4293	6493	72101247	SO:0001819	synonymous_variant	116985	exon6			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.762G>A	11.37:g.72423599C>T			72101247	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	ENST00000393609.3	37	CCDS41687.1																																																																																				0.672	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
TENM4	26011	broad.mit.edu	37	11	78380888	78380888	+	Missense_Mutation	SNP	C	C	T	rs200474747	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:78380888C>T	ENST00000278550.7	-	32	6964	c.6502G>A	c.(6502-6504)Gtc>Atc	p.V2168I		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2168					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.V2168I(2)									TCATACTGGACGGTCATCCAG	0.507													C|||	3	0.000599042	0.0	0.0014	5008	,	,		24345	0.0		0.0	False		,,,				2504	0.002				p.V2168I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G6502A	11						.	C	ILE/VAL	0,4164		0,0,2082	74.0	76.0	75.0		6502	5.1	1.0	11		75	1,8443		0,1,4221	no	missense	ODZ4	NM_001098816.2	29	0,1,6303	TT,TC,CC		0.0118,0.0,0.0079	benign	2168/2770	78380888	1,12607	2082	4222	6304	78058536	SO:0001583	missense	26011	exon32			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6502G>A	11.37:g.78380888C>T	ENSP00000278550:p.Val2168Ile		78058536	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909110	0.33721	0.0	1.18E-4	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89270	-2.49;0.97	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.91730	0.7385	L	0.41356	1.27	0.53688	D	0.999978	D	0.76494	0.999	D	0.71184	0.972	D	0.90428	0.4422	9	.	.	.	.	18.8078	0.92045	0.0:1.0:0.0:0.0	.	2168	Q6N022	TEN4_HUMAN	I	2168;632	ENSP00000278550:V2168I;ENSP00000431711:V632I	.	V	-	1	0	ODZ4	78058536	1.000000	0.71417	0.964000	0.40570	0.961000	0.63080	4.672000	0.61597	2.677000	0.91161	0.655000	0.94253	GTC		0.507	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
PCF11	51585	broad.mit.edu	37	11	82879949	82879949	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:82879949G>T	ENST00000298281.4	+	8	3024	c.2572G>T	c.(2572-2574)Gga>Tga	p.G858*		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	858	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)		p.G858*(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GAGGTTTGAGGGATCTCCAGG	0.567																																					p.G858X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G2572T	11						.						74.0	75.0	75.0					11																	82879949		1928	4135	6063	82557597	SO:0001587	stop_gained	51585	exon8			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.2572G>T	11.37:g.82879949G>T	ENSP00000298281:p.Gly858*		82557597	NM_015885	A6H8W7|O43671|Q6P0X8	Nonsense_Mutation	SNP	ENST00000298281.4	37	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	G	41	8.623808	0.98890	.	.	ENSG00000165494	ENST00000298281;ENST00000530660	.	.	.	5.65	5.65	0.86999	.	0.000000	0.52532	D	0.000067	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.3635	16.751	0.85485	0.0:0.0:1.0:0.0	.	.	.	.	X	858;989	.	.	G	+	1	0	PCF11	82557597	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.126000	0.77201	2.941000	0.99782	0.655000	0.94253	GGA		0.567	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
DSCAML1	57453	broad.mit.edu	37	11	117332214	117332214	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr11:117332214C>T	ENST00000321322.6	-	18	3545	c.3544G>A	c.(3544-3546)Gtc>Atc	p.V1182I	DSCAML1_ENST00000527706.1_Missense_Mutation_p.V912I	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1122	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.V1182I(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CCTTTGAGGACGCCATTGAGG	0.627																																					p.V1182I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3544A	11						.						83.0	82.0	83.0					11																	117332214		2201	4296	6497	116837424	SO:0001583	missense	57453	exon18				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.3544G>A	11.37:g.117332214C>T	ENSP00000315465:p.Val1182Ile		116837424	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961222	0.53400	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.57436	0.4;0.4	4.9	4.9	0.64082	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.31263	0.0791	N	0.11064	0.09	0.80722	D	1	B	0.33807	0.426	B	0.32211	0.142	T	0.26121	-1.0112	9	0.02654	T	1	.	18.2786	0.90091	0.0:1.0:0.0:0.0	.	1122	Q8TD84	DSCL1_HUMAN	I	912;1182;889	ENSP00000434335:V912I;ENSP00000315465:V1182I	ENSP00000315465:V1182I	V	-	1	0	DSCAML1	116837424	1.000000	0.71417	0.971000	0.41717	0.989000	0.77384	5.841000	0.69409	2.547000	0.85894	0.655000	0.94253	GTC		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
NUS1	116150	broad.mit.edu	37	6	118014243	118014243	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:118014243A>G	ENST00000368494.3	+	2	623	c.454A>G	c.(454-456)Att>Gtt	p.I152V		NM_138459.3	NP_612468.1	Q96E22	NGBR_HUMAN	nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)	152					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|intracellular cholesterol transport (GO:0032367)|protein glycosylation (GO:0006486)|sterol homeostasis (GO:0055092)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)	p.I152V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|prostate(2)	8		all_cancers(87;0.0395)|all_epithelial(87;0.0301)		GBM - Glioblastoma multiforme(226;0.02)|OV - Ovarian serous cystadenocarcinoma(136;0.115)|all cancers(137;0.146)		GATGGATGAAATTTTAAAACA	0.313																																					p.I152V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A454G	6						.						29.0	32.0	31.0					6																	118014243		2194	4289	6483	118120936	SO:0001583	missense	116150	exon2			BC013026	CCDS5118.1	6q22.1	2012-12-13	2006-11-24	2006-11-24	ENSG00000153989	ENSG00000153989			21042	protein-coding gene	gene with protein product	"""Nogo-B receptor"", ""transport and golgi organization 14 homolog (Drosophila)"""	610463	"""chromosome 6 open reading frame 68"""	C6orf68			Standard	NM_138459		Approved	MGC7199, NgBR, TANGO14	uc003pxw.3	Q96E22	OTTHUMG00000015458	ENST00000368494.3:c.454A>G	6.37:g.118014243A>G	ENSP00000357480:p.Ile152Val		118120936	NM_138459	B2RWQ4|O00251	Missense_Mutation	SNP	ENST00000368494.3	37	CCDS5118.1	.	.	.	.	.	.	.	.	.	.	A	15.51	2.854612	0.51376	.	.	ENSG00000153989	ENST00000368494	T	0.16897	2.31	5.68	5.68	0.88126	.	0.046662	0.85682	D	0.000000	T	0.08582	0.0213	L	0.33753	1.03	0.49798	D	0.999822	P	0.43431	0.807	P	0.45913	0.497	T	0.20538	-1.0272	10	0.24483	T	0.36	-2.9742	10.5563	0.45118	0.9278:0.0:0.0722:0.0	.	152	Q96E22	NGBR_HUMAN	V	152	ENSP00000357480:I152V	ENSP00000357480:I152V	I	+	1	0	NUS1	118120936	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.997000	0.70646	2.289000	0.77006	0.533000	0.62120	ATT		0.313	NUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041989.1	NM_138459	
CYP21A2	1589	broad.mit.edu	37	6	32007206	32007206	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:32007206G>A	ENST00000418967.2	+	4	679	c.521G>A	c.(520-522)tGt>tAt	p.C174Y	CYP21A2_ENST00000435122.2_Missense_Mutation_p.C144Y	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	173					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)	p.C174Y(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	AGCATCATCTGTTACCTCACC	0.582																																					p.C174Y	Melanoma(174;1669 1998 3915 34700 46447)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G521A	6						.						60.0	52.0	55.0					6																	32007206		2203	4299	6502	32115185	SO:0001583	missense	1589	exon4			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.521G>A	6.37:g.32007206G>A	ENSP00000408860:p.Cys174Tyr		32115185	NM_000500	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Missense_Mutation	SNP	ENST00000418967.2	37	CCDS4735.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021652	0.54576	.	.	ENSG00000231852	ENST00000418967;ENST00000478281;ENST00000471671;ENST00000435122	T;T;T;T	0.69806	-0.42;-0.43;-0.42;-0.42	4.69	3.81	0.43845	.	0.474215	0.17898	N	0.158294	T	0.70254	0.3203	M	0.76838	2.35	0.22796	N	0.998726	D;D	0.63880	0.984;0.993	D;D	0.63381	0.914;0.914	T	0.64563	-0.6378	10	0.87932	D	0	.	11.0699	0.47997	0.0:0.1869:0.8131:0.0	.	144;174	Q5ST44;Q16874	.;.	Y	174;185;174;144	ENSP00000408860:C174Y;ENSP00000419572:C185Y;ENSP00000418561:C174Y;ENSP00000415043:C144Y	ENSP00000408860:C174Y	C	+	2	0	CYP21A2	32115185	0.993000	0.37304	0.709000	0.30452	0.969000	0.65631	1.980000	0.40618	0.942000	0.37525	0.655000	0.94253	TGT		0.582	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	NM_000500	
TNXB	7148	broad.mit.edu	37	6	32036877	32036877	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:32036877G>A	ENST00000375244.3	-	16	5825	c.5624C>T	c.(5623-5625)cCg>cTg	p.P1875L	TNXB_ENST00000375247.2_Missense_Mutation_p.P1875L			P22105	TENX_HUMAN	tenascin XB	1957	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.P1962L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGGAGGGGTCGGGGCCGTGGT	0.612																																					p.P1875L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5624T	6						.						33.0	37.0	35.0					6																	32036877		1297	2552	3849	32144855	SO:0001583	missense	7148	exon16			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5624C>T	6.37:g.32036877G>A	ENSP00000364393:p.Pro1875Leu		32144855	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	G	11.08	1.533957	0.27387	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.66995	-0.07;-0.24	4.5	1.42	0.22433	.	0.258742	0.27673	N	0.018333	T	0.34774	0.0909	M	0.78049	2.395	0.09310	N	1	B	0.16166	0.016	B	0.15870	0.014	T	0.32798	-0.9893	10	0.09590	T	0.72	.	4.5495	0.12105	0.1114:0.0:0.5063:0.3823	.	1875	P22105-3	.	L	1875	ENSP00000364393:P1875L;ENSP00000364396:P1875L	ENSP00000364393:P1875L	P	-	2	0	TNXB	32144855	0.002000	0.14202	0.004000	0.12327	0.040000	0.13550	0.619000	0.24388	0.164000	0.19529	0.655000	0.94253	CCG		0.612	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
ZNF318	24149	broad.mit.edu	37	6	43322831	43322831	+	Silent	SNP	A	A	T			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:43322831A>T	ENST00000361428.2	-	4	2318	c.2241T>A	c.(2239-2241)tcT>tcA	p.S747S	ZNF318_ENST00000318149.3_Silent_p.S747S	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	747					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S747S(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TAATTGGGGCAGATGGGGCTG	0.522																																					p.S747S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2241A	6						.						128.0	122.0	124.0					6																	43322831		2203	4300	6503	43430809	SO:0001819	synonymous_variant	24149	exon4			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2241T>A	6.37:g.43322831A>T			43430809	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Silent	SNP	ENST00000361428.2	37	CCDS4895.2																																																																																				0.522	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
PKHD1	5314	broad.mit.edu	37	6	51914991	51914991	+	Missense_Mutation	SNP	G	G	A	rs141622697	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:51914991G>A	ENST00000371117.3	-	22	2518	c.2243C>T	c.(2242-2244)gCg>gTg	p.A748V	PKHD1_ENST00000340994.4_Missense_Mutation_p.A748V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	748					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.A748V(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GCCACACCCCGCCAGCCAGGA	0.582											OREG0017493	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0015	0.0	5008	,	,		18230	0.0		0.0	False		,,,				2504	0.0				p.A748V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2243T	6						.	G	VAL/ALA,VAL/ALA	8,4398	14.3+/-33.2	0,8,2195	62.0	58.0	59.0		2243,2243	2.9	0.0	6	dbSNP_134	59	0,8600		0,0,4300	yes	missense,missense	PKHD1	NM_138694.3,NM_170724.2	64,64	0,8,6495	AA,AG,GG		0.0,0.1816,0.0615	benign,benign	748/4075,748/3397	51914991	8,12998	2203	4300	6503	52022950	SO:0001583	missense	5314	exon22			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2243C>T	6.37:g.51914991G>A	ENSP00000360158:p.Ala748Val	981	52022950	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	7.277	0.608416	0.14002	0.001816	0.0	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87571	-2.07;-2.27	5.64	2.93	0.34026	.	0.376059	0.24715	N	0.036196	T	0.57548	0.2061	N	0.16656	0.425	0.09310	N	1	B;B	0.24483	0.104;0.036	B;B	0.20384	0.029;0.004	T	0.48103	-0.9064	10	0.22706	T	0.39	.	10.0749	0.42355	0.2157:0.0:0.7843:0.0	.	748;748	P08F94-2;P08F94	.;PKHD1_HUMAN	V	748	ENSP00000360158:A748V;ENSP00000341097:A748V	ENSP00000341097:A748V	A	-	2	0	PKHD1	52022950	0.001000	0.12720	0.022000	0.16811	0.210000	0.24377	0.856000	0.27818	0.342000	0.23796	-0.136000	0.14681	GCG		0.582	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PHIP	55023	broad.mit.edu	37	6	79675473	79675473	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:79675473T>G	ENST00000275034.4	-	29	3493	c.3326A>C	c.(3325-3327)aAt>aCt	p.N1109T	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1109	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.N1109T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TGTATCTCCATTGTCCCAGCT	0.279																																					p.N1109T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3326C	6						.						94.0	96.0	95.0					6																	79675473		2203	4298	6501	79732192	SO:0001583	missense	55023	exon29			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3326A>C	6.37:g.79675473T>G	ENSP00000275034:p.Asn1109Thr		79732192	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	37	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.154589	0.57259	.	.	ENSG00000146247	ENST00000275034	T	0.39787	1.06	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.53530	0.1802	M	0.66506	2.035	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.73380	0.98;0.98	T	0.54351	-0.8307	9	.	.	.	-21.7131	15.1344	0.72552	0.0:0.0:0.0:1.0	.	1109;1109	A7J992;Q8WWQ0	.;PHIP_HUMAN	T	1109	ENSP00000275034:N1109T	.	N	-	2	0	PHIP	79732192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.608000	0.82898	2.232000	0.73038	0.528000	0.53228	AAT		0.279	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
GJB7	375519	broad.mit.edu	37	6	87994312	87994312	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:87994312T>C	ENST00000525899.1	-	3	664	c.319A>G	c.(319-321)Aag>Gag	p.K107E	GJB7_ENST00000296882.3_Missense_Mutation_p.K107E	NM_198568.2	NP_940970.1	Q6PEY0	CXB7_HUMAN	gap junction protein, beta 7, 25kDa	107					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.K107E(1)		endometrium(2)|large_intestine(3)	5		all_cancers(76;1.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;7.38e-10)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00323)		BRCA - Breast invasive adenocarcinoma(108;0.0167)		TAGAGTTTCTTTCTGTGCCTT	0.438																																					p.K107E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A319G	6						.						97.0	97.0	97.0					6																	87994312		2203	4300	6503	88051031	SO:0001583	missense	375519	exon3			AJ414563	CCDS5008.1	6q15	2008-02-05	2007-11-06			ENSG00000164411		"""Ion channels / Gap junction proteins (connexins)"""	16690	protein-coding gene	gene with protein product	"""connexin 25"""	611921	"""gap junction protein, beta 7"""				Standard	NM_198568		Approved	CX25, bA136M9.1	uc003plo.2	Q6PEY0		ENST00000525899.1:c.319A>G	6.37:g.87994312T>C	ENSP00000435355:p.Lys107Glu		88051031	NM_198568	B3KXL0|Q96KP0	Missense_Mutation	SNP	ENST00000525899.1	37	CCDS5008.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.729301	0.00687	.	.	ENSG00000164411	ENST00000525899;ENST00000296882;ENST00000369576	D;D;D	0.99042	-5.36;-5.36;-5.36	4.84	3.59	0.41128	Connexin, N-terminal (1);	0.207536	0.20002	U	0.101315	D	0.90830	0.7120	N	0.20445	0.575	0.23743	N	0.996967	B	0.06786	0.001	B	0.04013	0.001	T	0.82265	-0.0543	10	0.02654	T	1	.	10.0214	0.42046	0.0:0.0:0.2576:0.7424	.	107	Q6PEY0	CXB7_HUMAN	E	107	ENSP00000435355:K107E;ENSP00000296882:K107E;ENSP00000358589:K107E	ENSP00000296882:K107E	K	-	1	0	GJB7	88051031	0.974000	0.33945	0.993000	0.49108	0.195000	0.23768	1.112000	0.31172	1.807000	0.52817	0.459000	0.35465	AAG		0.438	GJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394780.1		
SOGA3	387104	broad.mit.edu	37	6	127796803	127796803	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr6:127796803G>A	ENST00000525778.1	-	6	3113	c.2368C>T	c.(2368-2370)Cgc>Tgc	p.R790C	SOGA3_ENST00000481848.2_Missense_Mutation_p.R790C|SOGA3_ENST00000556132.1_Missense_Mutation_p.R790C|SOGA3_ENST00000465909.2_Missense_Mutation_p.R790C|SOGA3_ENST00000474293.2_5'UTR|SOGA3_ENST00000368268.2_Missense_Mutation_p.R790C			Q5TF21	SOGA3_HUMAN	SOGA family member 3	790					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.R790C(1)									GTGAGGCAGCGGATGTTGCGC	0.701																																					p.R790C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2368T	6						.						21.0	27.0	25.0					6																	127796803		2124	4232	6356	127838496	SO:0001583	missense	387104	exon6			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.2368C>T	6.37:g.127796803G>A	ENSP00000434570:p.Arg790Cys		127838496	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	37	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.928261	0.92389	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.45637	0.1352	L	0.51422	1.61	0.80722	D	1	D	0.69078	0.997	P	0.60286	0.872	T	0.43114	-0.9411	10	0.72032	D	0.01	-15.0059	19.4355	0.94792	0.0:0.0:1.0:0.0	.	790	Q5TF21	CF174_HUMAN	C	790	ENSP00000451768:R790C;ENSP00000357251:R790C;ENSP00000434570:R790C;ENSP00000435559:R790C	ENSP00000435559:R790C	R	-	1	0	C6orf174	127838496	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.508000	0.73721	2.593000	0.87608	0.462000	0.41574	CGC		0.701	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
NLRP1	22861	broad.mit.edu	37	17	5433948	5433948	+	Missense_Mutation	SNP	C	C	T	rs201871081		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:5433948C>T	ENST00000572272.1	-	12	3372	c.3373G>A	c.(3373-3375)Gtt>Att	p.V1125I	NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000269280.4_Missense_Mutation_p.V1125I|NLRP1_ENST00000577119.1_Missense_Mutation_p.V1095I|NLRP1_ENST00000262467.5_Missense_Mutation_p.V1129I|NLRP1_ENST00000354411.3_Missense_Mutation_p.V1095I|NLRP1_ENST00000345221.3_Missense_Mutation_p.V1125I			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1125					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)	p.V1125I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TCAATCTCAACGGTCACCGCT	0.572																																					p.V1095I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3283A	17						.						89.0	82.0	85.0					17																	5433948		2203	4300	6503	5374672	SO:0001583	missense	22861	exon11			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.3373G>A	17.37:g.5433948C>T	ENSP00000460475:p.Val1125Ile		5374672	NM_033007	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	ENST00000572272.1	37	CCDS42246.1	.	.	.	.	.	.	.	.	.	.	C	1.052	-0.675426	0.03378	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221;ENST00000537069	T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2	5.13	-3.0	0.05480	.	0.422499	0.17492	N	0.172302	T	0.04588	0.0125	N	0.01618	-0.8	0.09310	N	1	B;B;B;B;B;B	0.10296	0.002;0.003;0.003;0.003;0.003;0.001	B;B;B;B;B;B	0.09377	0.004;0.003;0.003;0.004;0.003;0.004	T	0.38757	-0.9646	10	0.02654	T	1	.	7.311	0.26475	0.0:0.4184:0.1253:0.4564	.	391;1095;1095;1125;1125;1129	F5H042;Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;.;NALP1_HUMAN;.;.	I	1129;1129;1125;1095;1125;391	ENSP00000442029:V1129I;ENSP00000262467:V1129I;ENSP00000269280:V1125I;ENSP00000346390:V1095I;ENSP00000324366:V1125I	ENSP00000262467:V1129I	V	-	1	0	NLRP1	5374672	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.078000	0.03413	-0.465000	0.06953	-0.357000	0.07601	GTT		0.572	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439517.1	NM_033004	
ABI3	51225	broad.mit.edu	37	17	47293951	47293951	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:47293951C>T	ENST00000225941.1	+	2	674	c.176C>T	c.(175-177)gCc>gTc	p.A59V	ABI3_ENST00000419580.2_Missense_Mutation_p.A59V	NM_001135186.1|NM_016428.2	NP_001128658.1|NP_057512	Q9P2A4	ABI3_HUMAN	ABI family, member 3	59					cellular component movement (GO:0006928)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|membrane (GO:0016020)		p.A59V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	12			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			CAGGCACTGGCCAGCGTGGCC	0.652										HNSCC(55;0.14)																											p.A59V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C176T	17						.						31.0	28.0	29.0					17																	47293951		2203	4300	6503	44648950	SO:0001583	missense	51225	exon2			AB037886	CCDS11546.1, CCDS45725.1	17q21.3	2011-03-04	2008-09-12		ENSG00000108798	ENSG00000108798			29859	protein-coding gene	gene with protein product		606363				10978530, 11956071	Standard	NM_001135186		Approved	NESH, SSH3BP3	uc002iop.1	Q9P2A4	OTTHUMG00000161306	ENST00000225941.1:c.176C>T	17.37:g.47293951C>T	ENSP00000225941:p.Ala59Val		44648950	NM_001135186	C9IZN8|Q9H0P6	Missense_Mutation	SNP	ENST00000225941.1	37	CCDS11546.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.748941	0.89753	.	.	ENSG00000108798	ENST00000225941;ENST00000419580	D;D	0.92595	-3.07;-3.07	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000002	D	0.96059	0.8716	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	D	0.96509	0.9377	10	0.87932	D	0	-29.607	16.8368	0.85958	0.0:1.0:0.0:0.0	.	59;59	Q9P2A4-2;Q9P2A4	.;ABI3_HUMAN	V	59	ENSP00000225941:A59V;ENSP00000406651:A59V	ENSP00000225941:A59V	A	+	2	0	ABI3	44648950	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	7.133000	0.77259	2.486000	0.83907	0.563000	0.77884	GCC		0.652	ABI3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364475.1	NM_016428	
CSH1	1442	broad.mit.edu	37	17	61972614	61972614	+	Intron	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:61972614G>A	ENST00000316193.8	-	5	598				CSH1_ENST00000329882.8_Silent_p.S225S|CSH1_ENST00000453363.3_Intron	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						GAGGCCAAGCGCTTGGGCACT	0.542									Russell-Silver syndrome																												p.S225S												.	.	0			c.C675T	17						.						68.0	69.0	69.0					17																	61972614		2192	4297	6489	59326346	SO:0001627	intron_variant	1442	exon4	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.457-35C>T	17.37:g.61972614G>A			59326346	NM_022640	P01243|Q0VDB1|Q14407	Silent	SNP	ENST00000316193.8	37	CCDS11649.1																																																																																				0.542	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416040.1	NM_001317	
SCN4A	6329	broad.mit.edu	37	17	62034860	62034860	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:62034860C>A	ENST00000435607.1	-	13	2114	c.2038G>T	c.(2038-2040)Gcc>Tcc	p.A680S	SCN4A_ENST00000578147.1_Missense_Mutation_p.A680S	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	680					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A680S(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CACGACTTGGCCAGCTTGAAG	0.582																																					p.A680S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2038T	17						.						58.0	65.0	63.0					17																	62034860		2125	4244	6369	59388592	SO:0001583	missense	6329	exon13			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2038G>T	17.37:g.62034860C>A	ENSP00000396320:p.Ala680Ser		59388592	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394902	0.83011	.	.	ENSG00000007314	ENST00000435607	D	0.98531	-4.98	3.52	3.52	0.40303	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98912	0.9631	M	0.87682	2.9	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.99308	1.0903	10	0.87932	D	0	.	14.5928	0.68383	0.0:1.0:0.0:0.0	.	680	P35499	SCN4A_HUMAN	S	680	ENSP00000396320:A680S	ENSP00000396320:A680S	A	-	1	0	SCN4A	59388592	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.609000	0.82925	1.979000	0.57680	0.561000	0.74099	GCC		0.582	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
TP53	7157	broad.mit.edu	37	17	7578551	7578551	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:7578551A>G	ENST00000269305.4	-	5	568	c.379T>C	c.(379-381)Tcc>Ccc	p.S127P	TP53_ENST00000359597.4_Missense_Mutation_p.S127P|TP53_ENST00000420246.2_Missense_Mutation_p.S127P|TP53_ENST00000413465.2_Missense_Mutation_p.S127P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.S127P|TP53_ENST00000455263.2_Missense_Mutation_p.S127P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	127	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in a sporadic cancer; somatic mutation).|S -> F (in sporadic cancers; somatic mutation).|S -> P (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).|S -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.S127T(6)|p.Y126_K132delYSPALNK(6)|p.S127P(6)|p.A129fs*20(3)|p.Y126_S127insQPHH(3)|p.Y126_N131delYSPALN(3)|p.V73fs*9(1)|p.S127fs*43(1)|p.?(1)|p.A36fs*20(1)|p.Y126fs*11(1)|p.S127_Q136del10(1)|p.S34P(1)|p.P13fs*18(1)|p.Y33_S34insQPHH(1)|p.S127fs*42(1)|p.Y126fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGGCAGGGGAGTACTGTAGG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S127P	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,urinary_tract,bladder,Substitution - Nonsense,-1	.	46	Substitution - Missense(13)|Deletion - In frame(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(4)|Insertion - In frame(4)|Unknown(1)	large_intestine(7)|upper_aerodigestive_tract(5)|haematopoietic_and_lymphoid_tissue(5)|breast(5)|central_nervous_system(4)|pancreas(4)|prostate(4)|bone(4)|lung(3)|ovary(2)|stomach(1)|urinary_tract(1)|liver(1)	c.T379C	17						.						43.0	44.0	44.0					17																	7578551		2203	4300	6503	7519276	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.379T>C	17.37:g.7578551A>G	ENSP00000269305:p.Ser127Pro		7519276	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.741786	0.89573	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D;D	0.99940	-8.39;-8.39;-8.39;-8.39;-8.39;-8.39;-8.39;-8.39;-8.39	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99937	0.9972	M	0.91038	3.17	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;0.977;1.0;1.0;1.0	D	0.95533	0.8605	10	0.87932	D	0	-30.2503	13.8301	0.63375	1.0:0.0:0.0:0.0	.	88;127;127;34;127;127;127	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	127;127;127;127;127;127;116;34;34;127;127	ENSP00000410739:S127P;ENSP00000352610:S127P;ENSP00000269305:S127P;ENSP00000398846:S127P;ENSP00000391127:S127P;ENSP00000391478:S127P;ENSP00000423862:S34P;ENSP00000424104:S127P;ENSP00000426252:S127P	ENSP00000269305:S127P	S	-	1	0	TP53	7519276	1.000000	0.71417	0.962000	0.40283	0.934000	0.57294	7.419000	0.80179	2.206000	0.71126	0.533000	0.62120	TCC		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH10	4628	broad.mit.edu	37	17	8413168	8413168	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:8413168T>A	ENST00000269243.4	-	23	3097	c.2959A>T	c.(2959-2961)Att>Ttt	p.I987F	RNU7-43P_ENST00000516554.1_RNA|MYH10_ENST00000379980.4_Missense_Mutation_p.I1003F|MYH10_ENST00000360416.3_Missense_Mutation_p.I1018F|MYH10_ENST00000396239.1_Missense_Mutation_p.I1008F	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	987					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.I987F(1)		breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						AGAAGCAGAATCTCCTCTTCC	0.428																																					p.I987F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2959T	17						.						143.0	138.0	140.0					17																	8413168		2203	4300	6503	8353893	SO:0001583	missense	4628	exon23			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.2959A>T	17.37:g.8413168T>A	ENSP00000269243:p.Ile987Phe		8353893	NM_005964	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	37	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.226789	0.39399	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	5.04	3.97	0.46021	.	0.110339	0.64402	D	0.000012	D	0.89378	0.6698	M	0.79693	2.465	0.46678	D	0.999159	B;B;B	0.33212	0.104;0.167;0.402	B;B;B	0.31016	0.058;0.123;0.058	D	0.87838	0.2649	10	0.87932	D	0	.	10.013	0.41997	0.0:0.0804:0.0:0.9196	.	996;1018;987	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	F	987;1018;1008;1003	ENSP00000269243:I987F;ENSP00000353590:I1018F;ENSP00000379539:I1008F;ENSP00000369315:I1003F	ENSP00000269243:I987F	I	-	1	0	MYH10	8353893	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.548000	0.45794	0.951000	0.37770	0.482000	0.46254	ATT		0.428	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
SCN4A	6329	broad.mit.edu	37	17	62049785	62049785	+	Missense_Mutation	SNP	C	C	T	rs538978403		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr17:62049785C>T	ENST00000435607.1	-	2	395	c.319G>A	c.(319-321)Gcc>Acc	p.A107T	SCN4A_ENST00000578147.1_Missense_Mutation_p.A107T|CTC-264K15.6_ENST00000577329.1_lincRNA	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	107					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A107T(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCAGGTGTGGCGGAGAAGCGG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		20555	0.0		0.0	False		,,,				2504	0.001				p.A107T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G319A	17						.						81.0	88.0	86.0					17																	62049785		2172	4276	6448	59403517	SO:0001583	missense	6329	exon2			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.319G>A	17.37:g.62049785C>T	ENSP00000396320:p.Ala107Thr		59403517	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251406	0.59212	.	.	ENSG00000007314	ENST00000435607	D	0.96913	-4.17	4.23	4.23	0.50019	.	0.054077	0.64402	D	0.000001	D	0.95931	0.8675	M	0.80847	2.515	0.45307	D	0.998308	D	0.59357	0.985	B	0.43623	0.425	D	0.96374	0.9276	10	0.59425	D	0.04	.	15.7671	0.78135	0.0:1.0:0.0:0.0	.	107	P35499	SCN4A_HUMAN	T	107	ENSP00000396320:A107T	ENSP00000396320:A107T	A	-	1	0	SCN4A	59403517	0.978000	0.34361	0.861000	0.33841	0.834000	0.47266	2.510000	0.45468	2.188000	0.69820	0.313000	0.20887	GCC		0.592	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
MYH11	4629	broad.mit.edu	37	16	15844149	15844149	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr16:15844149G>A	ENST00000300036.5	-	16	2013	c.1904C>T	c.(1903-1905)aCg>aTg	p.T635M	MYH11_ENST00000576790.2_Missense_Mutation_p.T635M|MYH11_ENST00000452625.2_Missense_Mutation_p.T642M|MYH11_ENST00000396324.3_Missense_Mutation_p.T642M	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	635	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.T635M(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CGAGCTCTCCGTCATCTTGGC	0.627			T	CBFB	AML																																p.T642M			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1925T	16						.						93.0	69.0	77.0					16																	15844149		2197	4300	6497	15751650	SO:0001583	missense	4629	exon17			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1904C>T	16.37:g.15844149G>A	ENSP00000300036:p.Thr635Met		15751650	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993385	0.74703	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.123826	0.53938	D	0.000050	D	0.87313	0.6146	L	0.47190	1.495	0.80722	D	1	D;P;P;P;P;P	0.54397	0.966;0.619;0.619;0.619;0.904;0.619	P;P;P;P;P;P	0.49799	0.622;0.5;0.5;0.5;0.5;0.5	D	0.88077	0.2804	10	0.56958	D	0.05	.	15.4747	0.75468	0.0:0.1387:0.8613:0.0	.	642;635;635;642;635;642	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	M	635;635;642;642;642	ENSP00000300036:T635M;ENSP00000345136:T635M;ENSP00000379616:T642M;ENSP00000407821:T642M	ENSP00000300036:T635M	T	-	2	0	MYH11	15751650	1.000000	0.71417	0.993000	0.49108	0.977000	0.68977	6.660000	0.74417	2.571000	0.86741	0.561000	0.74099	ACG		0.627	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
POLR3E	55718	broad.mit.edu	37	16	22334241	22334241	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr16:22334241C>T	ENST00000299853.5	+	14	1224	c.1057C>T	c.(1057-1059)Cga>Tga	p.R353*	POLR3E_ENST00000359210.4_Nonsense_Mutation_p.R353*|POLR3E_ENST00000564209.1_Nonsense_Mutation_p.R353*|POLR3E_ENST00000418581.2_Nonsense_Mutation_p.R317*	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	353					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)	p.R353*(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		CTGCAGGGGCCGAGACTTCGT	0.642																																					p.R353X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1057T	16						.						58.0	47.0	51.0					16																	22334241		2197	4300	6497	22241742	SO:0001587	stop_gained	55718	exon14			AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.1057C>T	16.37:g.22334241C>T	ENSP00000299853:p.Arg353*		22241742	NM_018119	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Nonsense_Mutation	SNP	ENST00000299853.5	37	CCDS10605.1	.	.	.	.	.	.	.	.	.	.	C	37	6.070576	0.97256	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	.	.	.	5.43	5.43	0.79202	.	0.122739	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.6457	12.3828	0.55315	0.284:0.716:0.0:0.0	.	.	.	.	X	353;353;317	.	ENSP00000299853:R353X	R	+	1	2	POLR3E	22241742	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.189000	0.42621	2.550000	0.86006	0.655000	0.94253	CGA		0.642	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211590.1	NM_018119	
HYDIN	54768	broad.mit.edu	37	16	70975668	70975668	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr16:70975668G>A	ENST00000393567.2	-	43	6874	c.6724C>T	c.(6724-6726)Cag>Tag	p.Q2242*		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	2242			Q -> R (in dbSNP:rs2258307).		cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.Q2241*(1)|p.Q2193*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCAGCATTCTGAGCAAAGAGA	0.537																																					p.Q2241X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C6721T	16						.						74.0	75.0	75.0					16																	70975668		1973	4158	6131	69533169	SO:0001587	stop_gained	54768	exon43			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.6724C>T	16.37:g.70975668G>A	ENSP00000377197:p.Gln2242*		69533169	NM_032821	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Nonsense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	G	44	11.228427	0.99534	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	.	.	.	5.32	3.2	0.36748	.	0.000000	0.31290	U	0.007911	.	.	.	.	.	.	0.44337	D	0.997229	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	14.4735	0.67531	0.0:0.0:0.7365:0.2635	.	.	.	.	X	2242;2241	.	ENSP00000313052:Q2241X	Q	-	1	0	HYDIN	69533169	0.015000	0.18098	0.189000	0.23252	0.128000	0.20619	1.443000	0.35057	1.350000	0.45770	0.508000	0.49915	CAG		0.537	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
CD226	10666	broad.mit.edu	37	18	67562982	67562982	+	Missense_Mutation	SNP	C	C	T	rs146723371	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr18:67562982C>T	ENST00000280200.4	-	4	950	c.682G>A	c.(682-684)Gca>Aca	p.A228T	CD226_ENST00000577287.1_Missense_Mutation_p.A73T|CD226_ENST00000581982.1_Missense_Mutation_p.A73T|CD226_ENST00000582621.1_Missense_Mutation_p.A228T	NM_006566.2	NP_006557.2	Q15762	CD226_HUMAN	CD226 molecule	228	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)|cytokine production (GO:0001816)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)	p.A228T(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	24		Esophageal squamous(42;0.129)				TTTTCTCCTGCGCTGGCCTGC	0.542													C|||	4	0.000798722	0.003	0.0	5008	,	,		18442	0.0		0.0	False		,,,				2504	0.0				p.A228T	NSCLC(184;838 2130 8673 21498 50749)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G682A	18						.	C	THR/ALA	4,4402	8.1+/-20.4	0,4,2199	133.0	134.0	134.0		682	-0.9	0.0	18	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CD226	NM_006566.2	58	0,5,6498	TT,TC,CC		0.0116,0.0908,0.0384	benign	228/337	67562982	5,13001	2203	4300	6503	65713962	SO:0001583	missense	10666	exon4			U56102	CCDS11997.1	18q22.3	2013-01-11	2006-03-28		ENSG00000150637	ENSG00000150637		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	16961	protein-coding gene	gene with protein product		605397	"""CD226 antigen"""			8673704	Standard	NM_006566		Approved	DNAM-1, DNAM1, PTA1, TLiSA1	uc002lkm.4	Q15762	OTTHUMG00000132809	ENST00000280200.4:c.682G>A	18.37:g.67562982C>T	ENSP00000280200:p.Ala228Thr		65713962	NM_006566	B2R818	Missense_Mutation	SNP	ENST00000280200.4	37	CCDS11997.1	.	.	.	.	.	.	.	.	.	.	C	1.448	-0.565719	0.03910	9.08E-4	1.16E-4	ENSG00000150637	ENST00000280200	T	0.12255	2.7	4.82	-0.932	0.10435	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.434279	0.24513	N	0.037863	T	0.01489	0.0048	N	0.00092	-2.175	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.40776	-0.9545	10	0.02654	T	1	.	2.8128	0.05446	0.318:0.183:0.0:0.499	.	228	Q15762	CD226_HUMAN	T	228	ENSP00000280200:A228T	ENSP00000280200:A228T	A	-	1	0	CD226	65713962	0.012000	0.17670	0.001000	0.08648	0.004000	0.04260	0.019000	0.13444	-0.166000	0.10890	-0.300000	0.09419	GCA		0.542	CD226-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256226.3	NM_006566	
SRPRB	58477	broad.mit.edu	37	3	133538462	133538462	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:133538462C>A	ENST00000466490.2	+	8	953	c.668C>A	c.(667-669)gCt>gAt	p.A223D		NM_021203.3	NP_067026.3	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, B subunit	223					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|small GTPase mediated signal transduction (GO:0007264)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.A223D(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(2)	12						ACTGCCCCTGCTCAGCTGGGG	0.557																																					p.A223D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C668A	3						.						64.0	68.0	67.0					3																	133538462		2203	4300	6503	135021152	SO:0001583	missense	58477	exon8			AK075531	CCDS3081.1	3q22.1	2004-01-29			ENSG00000144867	ENSG00000144867			24085	protein-coding gene	gene with protein product						7844142, 10859309	Standard	NM_021203		Approved	APMCF1	uc003epx.2	Q9Y5M8	OTTHUMG00000159753	ENST00000466490.2:c.668C>A	3.37:g.133538462C>A	ENSP00000418401:p.Ala223Asp		135021152	NM_021203	Q6P595|Q8N2D8	Missense_Mutation	SNP	ENST00000466490.2	37	CCDS3081.1	.	.	.	.	.	.	.	.	.	.	C	9.402	1.078169	0.20227	.	.	ENSG00000144867	ENST00000466490	T	0.14144	2.53	5.83	2.99	0.34606	.	1.114620	0.06770	N	0.783378	T	0.07593	0.0191	N	0.03253	-0.375	0.21967	N	0.999449	B	0.30937	0.301	B	0.30495	0.116	T	0.44847	-0.9301	10	0.31617	T	0.26	0.7643	10.5691	0.45190	0.0:0.7923:0.0:0.2077	.	223	Q9Y5M8	SRPRB_HUMAN	D	223	ENSP00000418401:A223D	ENSP00000418401:A223D	A	+	2	0	SRPRB	135021152	0.973000	0.33851	0.205000	0.23548	0.783000	0.44284	1.335000	0.33839	0.341000	0.23771	-0.355000	0.07637	GCT		0.557	SRPRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357170.2		
ESYT3	83850	broad.mit.edu	37	3	138193103	138193103	+	Missense_Mutation	SNP	G	G	A	rs201464827	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:138193103G>A	ENST00000389567.4	+	20	2563	c.2377G>A	c.(2377-2379)Gtc>Atc	p.V793I	ESYT3_ENST00000460133.1_Intron	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	793	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)	p.V793I(1)		breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						TGATCCCTACGTCCGTGTCTA	0.463													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18298	0.0		0.0	False		,,,				2504	0.0				p.V793I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2377A	3						.	G	ILE/VAL	12,3928		0,12,1958	150.0	155.0	154.0		2377	4.8	1.0	3		154	0,8286		0,0,4143	yes	missense	ESYT3	NM_031913.3	29	0,12,6101	AA,AG,GG		0.0,0.3046,0.0982	benign	793/887	138193103	12,12214	1970	4143	6113	139675793	SO:0001583	missense	83850	exon20			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2377G>A	3.37:g.138193103G>A	ENSP00000374218:p.Val793Ile		139675793	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	ENST00000389567.4	37	CCDS3101.2	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880401	0.72294	0.003046	0.0	ENSG00000158220	ENST00000389567	T	0.21543	2.0	4.75	4.75	0.60458	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.184731	0.33854	N	0.004497	T	0.34308	0.0893	M	0.69185	2.1	0.80722	D	1	P	0.46142	0.873	P	0.49451	0.611	T	0.10965	-1.0607	10	0.59425	D	0.04	-13.1291	15.2928	0.73879	0.0:0.0:1.0:0.0	.	793	A0FGR9	ESYT3_HUMAN	I	793	ENSP00000374218:V793I	ENSP00000374218:V793I	V	+	1	0	ESYT3	139675793	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	5.507000	0.66999	2.459000	0.83118	0.655000	0.94253	GTC		0.463	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
TRPC1	7220	broad.mit.edu	37	3	142522954	142522954	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:142522954C>T	ENST00000476941.1	+	11	2379	c.1893C>T	c.(1891-1893)gtC>gtT	p.V631V	RNU7-47P_ENST00000515978.1_RNA|TRPC1_ENST00000273482.6_Silent_p.V597V	NM_001251845.1	NP_001238774.1	P48995	TRPC1_HUMAN	transient receptor potential cation channel, subfamily C, member 1	631					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|response to calcium ion (GO:0051592)|saliva secretion (GO:0046541)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|sarcomere (GO:0030017)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|inositol 1,4,5 trisphosphate binding (GO:0070679)|ion channel binding (GO:0044325)|store-operated calcium channel activity (GO:0015279)	p.V597V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(2)|stomach(3)|urinary_tract(1)	37						CATACAATGTCGTGGTTGTGA	0.393																																					p.V597V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1791T	3						.						186.0	162.0	170.0					3																	142522954		2203	4300	6503	144005644	SO:0001819	synonymous_variant	7220	exon10			X89066	CCDS3126.1, CCDS58856.1	3q23	2011-12-14			ENSG00000144935	ENSG00000144935		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12333	protein-coding gene	gene with protein product		602343				7568191, 16382100	Standard	NM_001251845		Approved	HTRP-1	uc003evc.3	P48995	OTTHUMG00000159301	ENST00000476941.1:c.1893C>T	3.37:g.142522954C>T			144005644	NM_003304	Q14CE4	Silent	SNP	ENST00000476941.1	37	CCDS58856.1																																																																																				0.393	TRPC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354520.1	NM_003304	
MED12L	116931	broad.mit.edu	37	3	151150580	151150580	+	Silent	SNP	T	T	G			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:151150580T>G	ENST00000474524.1	+	43	6464	c.6426T>G	c.(6424-6426)ccT>ccG	p.P2142P	MED12L_ENST00000273432.4_Silent_p.P1806P	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	2142						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P2142P(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATGGGCATCCTTCACACTTCT	0.378																																					p.P2142P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6426G	3						.						111.0	98.0	103.0					3																	151150580		2203	4300	6503	152633270	SO:0001819	synonymous_variant	116931	exon43			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.6426T>G	3.37:g.151150580T>G			152633270	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1																																																																																				0.378	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
SUCNR1	56670	broad.mit.edu	37	3	151598788	151598788	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:151598788G>C	ENST00000362032.5	+	3	562	c.457G>C	c.(457-459)Gag>Cag	p.E153Q	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	153						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.E153Q(1)		endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	AGTAACCTTAGAGTTACTACC	0.383																																					p.E153Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G457C	3						.						132.0	133.0	132.0					3																	151598788		2203	4300	6503	153081478	SO:0001583	missense	56670	exon3			AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.457G>C	3.37:g.151598788G>C	ENSP00000355156:p.Glu153Gln		153081478	NM_033050	A8K305|Q8TDQ8	Missense_Mutation	SNP	ENST00000362032.5	37	CCDS3162.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.104244	0.37145	.	.	ENSG00000198829	ENST00000362032	T	0.71579	-0.58	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.062950	0.64402	U	0.000011	T	0.72851	0.3512	L	0.33710	1.025	0.35041	D	0.759752	D	0.57899	0.981	D	0.64042	0.921	T	0.74393	-0.3680	10	0.24483	T	0.36	.	12.6389	0.56698	0.0758:0.0:0.9242:0.0	.	153	Q9BXA5	SUCR1_HUMAN	Q	153	ENSP00000355156:E153Q	ENSP00000355156:E153Q	E	+	1	0	SUCNR1	153081478	1.000000	0.71417	0.353000	0.25747	0.036000	0.12997	3.544000	0.53640	2.646000	0.89796	0.655000	0.94253	GAG		0.383	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357897.2	NM_033050	
MME	4311	broad.mit.edu	37	3	154884783	154884783	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:154884783G>A	ENST00000460393.1	+	18	1873	c.1753G>A	c.(1753-1755)Gaa>Aaa	p.E585K	MME_ENST00000360490.2_Missense_Mutation_p.E585K|MME_ENST00000462745.1_Missense_Mutation_p.E585K|MME_ENST00000492661.1_Missense_Mutation_p.E585K|MME_ENST00000493237.1_Missense_Mutation_p.E585K|MME-AS1_ENST00000484721.1_RNA	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	585					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)	p.E585K(2)		central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	CATAGGACACGAAATCACCCA	0.448																																					p.E585K												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G1753A	3						.						147.0	134.0	138.0					3																	154884783		2203	4300	6503	156367477	SO:0001583	missense	4311	exon18				CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1753G>A	3.37:g.154884783G>A	ENSP00000418525:p.Glu585Lys		156367477	NM_000902	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	ENST00000460393.1	37	CCDS3172.1	.	.	.	.	.	.	.	.	.	.	G	36	5.841453	0.97009	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	D;D;D;D;D	0.98835	-5.17;-5.17;-5.17;-5.17;-5.17	5.9	5.9	0.94986	Peptidase M13, neprilysin, C-terminal (2);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99557	0.9841	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97965	1.0340	10	0.87932	D	0	-31.9984	20.2789	0.98501	0.0:0.0:1.0:0.0	.	585	P08473	NEP_HUMAN	K	585	ENSP00000420389:E585K;ENSP00000418525:E585K;ENSP00000419653:E585K;ENSP00000417079:E585K;ENSP00000353679:E585K	ENSP00000353679:E585K	E	+	1	0	MME	156367477	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	9.731000	0.98807	2.788000	0.95919	0.650000	0.86243	GAA		0.448	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351076.1	NM_000902	
BCHE	590	broad.mit.edu	37	3	165547452	165547452	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:165547452G>A	ENST00000264381.3	-	2	1536	c.1370C>T	c.(1369-1371)cCg>cTg	p.P457L	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	457					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)	p.P457L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TTCTGGCCACGGAAGTTTGGA	0.398																																					p.P457L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1370T	3						.						98.0	102.0	101.0					3																	165547452		2203	4300	6503	167030146	SO:0001583	missense	590	exon2			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1370C>T	3.37:g.165547452G>A	ENSP00000264381:p.Pro457Leu		167030146	NM_000055	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	37	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901674	0.33535	.	.	ENSG00000114200	ENST00000264381	T	0.65364	-0.15	5.52	5.52	0.82312	Carboxylesterase, type B (1);	0.170167	0.52532	D	0.000063	T	0.44244	0.1284	N	0.16602	0.42	0.80722	D	1	P	0.41910	0.764	B	0.30029	0.11	T	0.49570	-0.8926	10	0.41790	T	0.15	.	18.4281	0.90615	0.0:0.0:1.0:0.0	.	457	P06276	CHLE_HUMAN	L	457	ENSP00000264381:P457L	ENSP00000264381:P457L	P	-	2	0	BCHE	167030146	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.496000	0.81526	2.605000	0.88082	0.591000	0.81541	CCG		0.398	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
GRM7	2917	broad.mit.edu	37	3	7721970	7721970	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:7721970G>A	ENST00000357716.4	+	9	2960	c.2686G>A	c.(2686-2688)Gta>Ata	p.V896I	GRM7_ENST00000403881.1_Missense_Mutation_p.V896I|GRM7_ENST00000402647.2_Missense_Mutation_p.V896I|GRM7_ENST00000389336.4_Missense_Mutation_p.V896I|GRM7_ENST00000486284.1_Missense_Mutation_p.V896I	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	896					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)	p.V896I(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CTGTGAAAACGTAGACCCAAA	0.512																																					p.V896I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2686A	3						.						100.0	69.0	79.0					3																	7721970		2203	4300	6503	7696970	SO:0001583	missense	2917	exon9			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.2686G>A	3.37:g.7721970G>A	ENSP00000350348:p.Val896Ile		7696970	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	37	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966329	0.53507	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647	D;D;D;D;D	0.89196	-2.44;-2.48;-2.48;-2.48;-2.48	5.07	5.07	0.68467	.	0.330029	0.32819	N	0.005617	T	0.82111	0.4966	L	0.36672	1.1	0.32604	N	0.525576	B;P;B;P	0.40681	0.44;0.66;0.313;0.727	B;B;B;B	0.32393	0.026;0.055;0.011;0.145	D	0.84142	0.0418	10	0.23891	T	0.37	.	17.3817	0.87406	0.0:0.0:1.0:0.0	.	896;651;896;896	Q14831-5;Q59G95;Q14831;Q14831-2	.;.;GRM7_HUMAN;.	I	896	ENSP00000350348:V896I;ENSP00000417536:V896I;ENSP00000373987:V896I;ENSP00000385664:V896I;ENSP00000384585:V896I	ENSP00000350348:V896I	V	+	1	0	GRM7	7696970	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	3.919000	0.56439	2.509000	0.84616	0.591000	0.81541	GTA		0.512	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
UBE2E2	7325	broad.mit.edu	37	3	23541106	23541106	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:23541106C>A	ENST00000396703.1	+	4	415	c.235C>A	c.(235-237)Ccc>Acc	p.P79T	UBE2E2_ENST00000425792.1_Missense_Mutation_p.P79T	NM_152653.3	NP_689866.1	Q96LR5	UB2E2_HUMAN	ubiquitin-conjugating enzyme E2E 2	79					ISG15-protein conjugation (GO:0032020)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)		ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)	p.P79T(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(2)	10						CAGTGCTGGACCCAAAGGAGA	0.373																																					p.P79T	GBM(85;1941 2083 9456)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C235A	3						.						100.0	94.0	96.0					3																	23541106		2203	4300	6503	23516110	SO:0001583	missense	7325	exon4			AK057886	CCDS2637.1	3p24.2	2011-05-19	2011-05-19		ENSG00000182247	ENSG00000182247		"""Ubiquitin-conjugating enzymes E2"""	12478	protein-coding gene	gene with protein product		602163	"""ubiquitin-conjugating enzyme E2E 2 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast)"""			9371400	Standard	NM_152653		Approved	UbcH8, FLJ25157	uc003ccg.2	Q96LR5	OTTHUMG00000130482	ENST00000396703.1:c.235C>A	3.37:g.23541106C>A	ENSP00000379931:p.Pro79Thr		23516110	NM_152653		Missense_Mutation	SNP	ENST00000396703.1	37	CCDS2637.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795097	0.90453	.	.	ENSG00000182247	ENST00000425792;ENST00000452894;ENST00000396703	T;T;T	0.59638	0.25;0.25;0.25	5.84	5.84	0.93424	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000002	D	0.82728	0.5100	M	0.92784	3.345	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86096	0.1553	10	0.87932	D	0	.	19.7502	0.96265	0.0:1.0:0.0:0.0	.	79	Q96LR5	UB2E2_HUMAN	T	79;103;79	ENSP00000401053:P79T;ENSP00000392800:P103T;ENSP00000379931:P79T	ENSP00000379931:P79T	P	+	1	0	UBE2E2	23516110	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.783000	0.85696	2.760000	0.94817	0.655000	0.94253	CCC		0.373	UBE2E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252881.2	NM_152653	
SCN5A	6331	broad.mit.edu	37	3	38601826	38601826	+	Missense_Mutation	SNP	C	C	T	rs199473233		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:38601826C>T	ENST00000333535.4	-	23	4206	c.4057G>A	c.(4057-4059)Gtg>Atg	p.V1353M	SCN5A_ENST00000455624.2_Missense_Mutation_p.V1352M|SCN5A_ENST00000423572.2_Missense_Mutation_p.V1352M|SCN5A_ENST00000414099.2_Missense_Mutation_p.V1353M|SCN5A_ENST00000449557.2_Missense_Mutation_p.V1299M|SCN5A_ENST00000443581.1_Missense_Mutation_p.V1352M|SCN5A_ENST00000425664.1_Missense_Mutation_p.V1353M|SCN5A_ENST00000450102.2_Missense_Mutation_p.V1299M|SCN5A_ENST00000451551.2_Missense_Mutation_p.V1299M|SCN5A_ENST00000413689.1_Missense_Mutation_p.V1353M			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1353					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.V1353M(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	AAGAGGTTCACGCCCATGATG	0.547																																					p.V1353M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4057A	3						.						115.0	111.0	112.0					3																	38601826		2203	4300	6503	38576830	SO:0001583	missense	6331	exon23			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4057G>A	3.37:g.38601826C>T	ENSP00000328968:p.Val1353Met		38576830	NM_001099405	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	37	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.676898	0.88445	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98493	-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96;-4.96	4.25	4.25	0.50352	Ion transport (1);	0.067398	0.64402	D	0.000014	D	0.99089	0.9687	M	0.89785	3.06	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	0.998;1.0;0.987;0.989;1.0;0.995;0.987	D;D;P;P;D;D;P	0.91635	0.937;0.999;0.782;0.861;0.984;0.928;0.643	D	0.99338	1.0911	10	0.87932	D	0	.	17.2234	0.86963	0.0:1.0:0.0:0.0	.	1299;1352;1353;1353;1353;1352;1353	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	M	1353;1352;1353;1299;1352;1353;1353;1352;1299;1299	ENSP00000398962:V1353M;ENSP00000398266:V1352M;ENSP00000410257:V1353M;ENSP00000388797:V1299M;ENSP00000397915:V1352M;ENSP00000416634:V1353M;ENSP00000328968:V1353M;ENSP00000399524:V1352M;ENSP00000403355:V1299M;ENSP00000413996:V1299M	ENSP00000328968:V1353M	V	-	1	0	SCN5A	38576830	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.575000	0.82447	2.355000	0.79922	0.655000	0.94253	GTG		0.547	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
GRM2	2912	broad.mit.edu	37	3	51750037	51750037	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:51750037C>T	ENST00000395052.3	+	4	2482	c.2248C>T	c.(2248-2250)Cgc>Tgc	p.R750C	GRM2_ENST00000442933.2_Missense_Mutation_p.R472C|GRM2_ENST00000475478.1_3'UTR	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	750					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R750C(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTTCAAGACTCGCAAGTGCCC	0.547																																					p.R132C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C394T	3						.						109.0	89.0	96.0					3																	51750037		2203	4300	6503	51725077	SO:0001583	missense	2912	exon2			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.2248C>T	3.37:g.51750037C>T	ENSP00000378492:p.Arg750Cys		51725077	NM_001130063	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	ENST00000395052.3	37	CCDS2834.1	.	.	.	.	.	.	.	.	.	.	C	11.01	1.512621	0.27123	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.91521	-2.86;-2.86	5.08	4.17	0.49024	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.96741	0.8936	H	0.96833	3.89	0.27273	N	0.958325	D	0.89917	1.0	D	0.97110	1.0	D	0.92061	0.5656	10	0.87932	D	0	.	13.1596	0.59537	0.2896:0.7104:0.0:0.0	.	750	Q14416	GRM2_HUMAN	C	750;472	ENSP00000378492:R750C;ENSP00000408906:R472C	ENSP00000378492:R750C	R	+	1	0	GRM2	51725077	0.943000	0.32029	0.955000	0.39395	0.553000	0.35397	1.173000	0.31920	1.213000	0.43380	0.549000	0.68633	CGC		0.547	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346542.1		
RRP9	9136	broad.mit.edu	37	3	51972119	51972119	+	Missense_Mutation	SNP	C	C	T	rs374405922		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:51972119C>T	ENST00000232888.6	-	3	345	c.272G>A	c.(271-273)cGt>cAt	p.R91H		NM_004704.3	NP_004695.1	O43818	U3IP2_HUMAN	ribosomal RNA processing 9, small subunit (SSU) processome component, homolog (yeast)	91	Glu-rich.				rRNA processing (GO:0006364)	nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)	p.R91H(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|ovary(1)|skin(1)	21				BRCA - Breast invasive adenocarcinoma(193;8.04e-05)|Kidney(197;0.000553)|KIRC - Kidney renal clear cell carcinoma(197;0.000724)		ACCTTGCTGACGGAGCTGCTC	0.627																																					p.R91H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	3						.	C	HIS/ARG	0,4406		0,0,2203	76.0	59.0	65.0		272	2.6	1.0	3		65	1,8599	1.2+/-3.3	0,1,4299	no	missense	RRP9	NM_004704.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	91/476	51972119	1,13005	2203	4300	6503	51947159	SO:0001583	missense	9136	exon3			AJ001340	CCDS2837.1	3p21.31	2013-01-10	2008-02-26	2006-10-24	ENSG00000114767	ENSG00000114767		"""WD repeat domain containing"""	16829	protein-coding gene	gene with protein product			"""RNA, U3 small nucleolar interacting protein 2"""	RNU3IP2		9418896, 12032086	Standard	NM_004704		Approved	U3-55K	uc003dbw.2	O43818	OTTHUMG00000156930	ENST00000232888.6:c.272G>A	3.37:g.51972119C>T	ENSP00000232888:p.Arg91His		51947159	NM_004704	B2R996|Q8IZ30	Missense_Mutation	SNP	ENST00000232888.6	37	CCDS2837.1	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039752	0.55003	0.0	1.16E-4	ENSG00000114767	ENST00000232888	T	0.56275	0.47	5.34	2.6	0.31112	.	0.207680	0.48286	D	0.000195	T	0.46249	0.1383	L	0.45581	1.43	0.32210	N	0.576657	P	0.49696	0.927	P	0.44732	0.459	T	0.57225	-0.7848	10	0.66056	D	0.02	-23.5166	8.6788	0.34196	0.0:0.7114:0.0:0.2885	.	91	O43818	U3IP2_HUMAN	H	91	ENSP00000232888:R91H	ENSP00000232888:R91H	R	-	2	0	RRP9	51947159	0.247000	0.23920	0.952000	0.39060	0.861000	0.49209	1.464000	0.35288	0.259000	0.21709	0.563000	0.77884	CGT		0.627	RRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346637.1	NM_004704	
ROBO1	6091	broad.mit.edu	37	3	78796020	78796020	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:78796020G>A	ENST00000464233.1	-	5	643	c.530C>T	c.(529-531)tCg>tTg	p.S177L	ROBO1_ENST00000467549.1_Missense_Mutation_p.S138L|ROBO1_ENST00000436010.2_Missense_Mutation_p.S138L|ROBO1_ENST00000495273.1_Missense_Mutation_p.S138L	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	177	Ig-like C2-type 2.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.S177*(2)|p.S177L(1)|p.S138*(1)|p.S154*(1)|p.S154L(1)|p.S138L(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		CATGACATCCGAAGGGTTTTG	0.458																																					p.S177L												.	.	7	Substitution - Nonsense(4)|Substitution - Missense(3)	lung(4)|large_intestine(3)	c.C530T	3						.						103.0	100.0	101.0					3																	78796020		1914	4136	6050	78878710	SO:0001583	missense	6091	exon5			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.530C>T	3.37:g.78796020G>A	ENSP00000420321:p.Ser177Leu		78878710	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440972	0.43326	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.83	5.83	0.93111	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.163360	0.56097	D	0.000030	T	0.57286	0.2043	L	0.28504	0.86	0.50171	D	0.999852	P;B;P;P	0.37276	0.589;0.438;0.589;0.534	B;B;B;B	0.35550	0.205;0.205;0.205;0.13	T	0.53655	-0.8408	9	.	.	.	.	20.1133	0.97917	0.0:0.0:1.0:0.0	.	177;138;138;138	Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	ROBO1_HUMAN;.;.;.	L	138;138;177;138;138;177	ENSP00000406043:S138L;ENSP00000420321:S177L;ENSP00000420637:S138L;ENSP00000417992:S138L	.	S	-	2	0	ROBO1	78878710	1.000000	0.71417	0.998000	0.56505	0.179000	0.23085	6.669000	0.74462	2.762000	0.94881	0.591000	0.81541	TCG		0.458	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
MASP1	5648	broad.mit.edu	37	3	186954338	186954338	+	Intron	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr3:186954338G>A	ENST00000337774.5	-	10	1693				MASP1_ENST00000296280.6_Missense_Mutation_p.R441C|MASP1_ENST00000392472.2_Missense_Mutation_p.R328C|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.R441C(1)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GGCAGGGAGCGGGAGGGCTGA	0.572																																					p.R441C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1321T	3						.						77.0	79.0	78.0					3																	186954338		2203	4300	6503	188437032	SO:0001627	intron_variant	5648	exon11			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+4930C>T	3.37:g.186954338G>A			188437032	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	ENST00000337774.5	37	CCDS33907.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923270	0.92319	.	.	ENSG00000127241	ENST00000296280;ENST00000392472;ENST00000541896	D;D	0.83837	-1.75;-1.77	5.91	5.91	0.95273	.	0.440644	0.28683	N	0.014493	D	0.88526	0.6460	M	0.62723	1.935	0.80722	D	1	D;D	0.71674	0.997;0.998	P;P	0.58520	0.84;0.84	D	0.86406	0.1745	10	0.36615	T	0.2	.	19.2934	0.94112	0.0:0.0:1.0:0.0	.	328;441	P48740-4;P48740-2	.;.	C	441;328;328	ENSP00000296280:R441C;ENSP00000376264:R328C	ENSP00000296280:R441C	R	-	1	0	MASP1	188437032	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.526000	0.81920	2.808000	0.96608	0.655000	0.94253	CGC		0.572	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
SH2B3	10019	broad.mit.edu	37	12	111886037	111886037	+	Silent	SNP	G	G	A	rs369151728		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:111886037G>A	ENST00000341259.2	+	8	2016	c.1659G>A	c.(1657-1659)tcG>tcA	p.S553S	SH2B3_ENST00000538307.1_Silent_p.S351S	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	553					blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)	p.S553S(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	CCCGGGACTCGGACTACGAAA	0.602																																					p.S553S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1659A	12						.						86.0	102.0	97.0					12																	111886037		2203	4300	6503	110370420	SO:0001819	synonymous_variant	10019	exon8			AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1659G>A	12.37:g.111886037G>A			110370420	NM_005475	B9EGG5|O95184	Silent	SNP	ENST00000341259.2	37	CCDS9153.1																																																																																				0.602	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
CHD4	1108	broad.mit.edu	37	12	6697108	6697108	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:6697108C>A	ENST00000357008.2	-	24	3636	c.3473G>T	c.(3472-3474)aGc>aTc	p.S1158I	CHD4_ENST00000544484.1_Missense_Mutation_p.S1155I|CHD4_ENST00000309577.6_Missense_Mutation_p.S1158I|CHD4_ENST00000544040.1_Missense_Mutation_p.S1151I|CHD4_ENST00000540960.1_5'Flank	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1158	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.S1158I(2)		central_nervous_system(2)	2						GTGAGCTCTGCTAAAGGCCTG	0.448																																					p.S1158I	Colon(32;586 792 4568 16848 45314)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G3473T	12						.						64.0	63.0	64.0					12																	6697108		2203	4300	6503	6567369	SO:0001583	missense	1108	exon24			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.3473G>T	12.37:g.6697108C>A	ENSP00000349508:p.Ser1158Ile		6567369	NM_001273	Q8IXZ5	Missense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979196	0.74360	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	5.91	5.91	0.95273	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.89508	0.6735	M	0.90483	3.12	0.80722	D	1	P;P;D	0.69078	0.776;0.744;0.997	P;P;D	0.80764	0.72;0.832;0.994	D	0.90581	0.4529	10	0.87932	D	0	.	20.2882	0.98536	0.0:1.0:0.0:0.0	.	1158;1158;1151	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	I	1155;1151;1158;1158;1132	ENSP00000440392:S1155I;ENSP00000440542:S1151I;ENSP00000312419:S1158I;ENSP00000349508:S1158I	ENSP00000312419:S1158I	S	-	2	0	CHD4	6567369	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	7.448000	0.80631	2.802000	0.96397	0.543000	0.68304	AGC		0.448	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
CCNT1	904	broad.mit.edu	37	12	49087215	49087215	+	Silent	SNP	A	A	G			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:49087215A>G	ENST00000261900.3	-	9	2004	c.1782T>C	c.(1780-1782)agT>agC	p.S594S		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	594	Ser-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)	p.S594S(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						AGGATTTAGTACTCTTGGCAA	0.473																																					p.S594S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1782C	12						.						92.0	92.0	92.0					12																	49087215		2203	4300	6503	47373482	SO:0001819	synonymous_variant	904	exon9			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.1782T>C	12.37:g.49087215A>G			47373482	NM_001240	A9XU13|E7EX76|O60581	Silent	SNP	ENST00000261900.3	37	CCDS8766.1																																																																																				0.473	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408853.1	NM_001240	
SLC4A8	9498	broad.mit.edu	37	12	51863567	51863567	+	Missense_Mutation	SNP	C	C	T	rs374704511		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:51863567C>T	ENST00000453097.2	+	12	1736	c.1519C>T	c.(1519-1521)Cgc>Tgc	p.R507C	SLC4A8_ENST00000535225.2_Missense_Mutation_p.R454C|SLC4A8_ENST00000546663.1_3'UTR|SLC4A8_ENST00000394856.1_Missense_Mutation_p.R454C|SLC4A8_ENST00000358657.3_Missense_Mutation_p.R534C|SLC4A8_ENST00000514353.3_Missense_Mutation_p.R454C	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8									p.R454C(1)|p.R507C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		CACTGAGGGACGCATAGTAAG	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22189	0.0		0.0	False		,,,				2504	0.0				p.R507C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1519T	12						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	165.0	152.0	157.0		1519,1519	5.7	1.0	12		157	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	SLC4A8	NM_001039960.1,NM_004858.2	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	507/1094,507/1045	51863567	1,13005	2203	4300	6503	50149834	SO:0001583	missense	9498	exon12			AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1519C>T	12.37:g.51863567C>T	ENSP00000405812:p.Arg507Cys		50149834	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.196508	0.79015	0.0	1.16E-4	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25	5.69	5.69	0.88448	Bicarbonate transporter, C-terminal (1);	0.145309	0.64402	D	0.000004	D	0.89361	0.6693	M	0.86178	2.8	0.58432	D	0.999991	D;D;D;D;D;D	0.89917	0.999;0.998;1.0;0.999;0.995;1.0	D;P;D;D;D;D	0.70487	0.916;0.827;0.961;0.969;0.921;0.961	D	0.89528	0.3783	10	0.56958	D	0.05	.	18.9789	0.92748	0.0:1.0:0.0:0.0	.	454;534;454;507;507;507	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	C	454;534;507;454;507;454;454	ENSP00000441520:R454C;ENSP00000351483:R534C;ENSP00000405812:R507C;ENSP00000378325:R454C;ENSP00000442561:R454C	ENSP00000315789:R507C	R	+	1	0	SLC4A8	50149834	0.973000	0.33851	1.000000	0.80357	0.995000	0.86356	2.534000	0.45676	2.865000	0.98341	0.655000	0.94253	CGC		0.488	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
KRT6A	3853	broad.mit.edu	37	12	52883814	52883814	+	Silent	SNP	G	G	A	rs372043088		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:52883814G>A	ENST00000330722.6	-	6	1184	c.1116C>T	c.(1114-1116)gaC>gaT	p.D372D		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	372	Coil 2.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.D372D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCGCAGGTCGTCCCCATGTC	0.562													g|||	1	0.000199681	0.0	0.0	5008	,	,		23467	0.0		0.0	False		,,,				2504	0.001				p.D372D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1116T	12						.	G		0,4404		0,0,2202	100.0	81.0	88.0		1116	-5.6	0.8	12		88	1,8555	1.2+/-3.3	0,1,4277	no	coding-synonymous	KRT6A	NM_005554.3		0,1,6479	AA,AG,GG		0.0117,0.0,0.0077		372/565	52883814	1,12959	2202	4278	6480	51170081	SO:0001819	synonymous_variant	3853	exon6			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1116C>T	12.37:g.52883814G>A			51170081	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Silent	SNP	ENST00000330722.6	37	CCDS41786.1																																																																																				0.562	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
PPP1R12A	4659	broad.mit.edu	37	12	80199538	80199538	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:80199538G>A	ENST00000450142.2	-	14	2100	c.1834C>T	c.(1834-1836)Cgt>Tgt	p.R612C	PPP1R12A_ENST00000546369.1_Missense_Mutation_p.R525C|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.R556C|AC073569.1_ENST00000598624.1_Intron|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.R612C|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.R612C	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	612	Ser/Thr-rich.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.R612C(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						GCCCACAAACGATTTGAGGTA	0.413																																					p.R525C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1573T	12						.						98.0	90.0	92.0					12																	80199538		2002	4164	6166	78723669	SO:0001583	missense	4659	exon14			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1834C>T	12.37:g.80199538G>A	ENSP00000389168:p.Arg612Cys		78723669	NM_001143886	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	37	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.782956	0.70222	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107	T;T;T;T;T	0.39997	1.09;1.09;1.12;1.12;1.05	5.54	5.54	0.83059	.	0.046039	0.85682	D	0.000000	T	0.63510	0.2517	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.997	P;D;P	0.76575	0.738;0.988;0.551	T	0.64769	-0.6329	10	0.72032	D	0.01	.	19.4766	0.94991	0.0:0.0:1.0:0.0	.	612;556;612	O14974-2;O14974-3;O14974	.;.;MYPT1_HUMAN	C	612;612;612;556;612;612;525;556	ENSP00000261207:R612C;ENSP00000389168:R612C;ENSP00000416769:R612C;ENSP00000449514:R525C;ENSP00000446855:R556C	ENSP00000261207:R612C	R	-	1	0	PPP1R12A	78723669	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.663000	0.61532	2.585000	0.87301	0.591000	0.81541	CGT		0.413	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
SCYL2	55681	broad.mit.edu	37	12	100711606	100711606	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:100711606T>A	ENST00000360820.2	+	10	1735	c.1298T>A	c.(1297-1299)aTg>aAg	p.M433K		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	433					endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)	p.M437K(1)		central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						CTACAAAAAATGGATTTGCTA	0.343																																					p.M433K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1298A	12						.						62.0	59.0	60.0					12																	100711606		2203	4300	6503	99235737	SO:0001583	missense	55681	exon10			AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.1298T>A	12.37:g.100711606T>A	ENSP00000354061:p.Met433Lys		99235737	NM_017988	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.587249	0.86851	.	.	ENSG00000136021	ENST00000549687;ENST00000258506;ENST00000360820	T;T	0.33654	1.4;1.4	5.23	5.23	0.72850	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	M	0.77313	2.365	0.80722	D	1	D	0.65815	0.995	D	0.64144	0.922	T	0.65664	-0.6113	10	0.87932	D	0	.	15.4116	0.74929	0.0:0.0:0.0:1.0	.	433	Q6P3W7	SCYL2_HUMAN	K	433;260;433	ENSP00000448366:M433K;ENSP00000354061:M433K	ENSP00000258506:M260K	M	+	2	0	SCYL2	99235737	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.013000	0.88655	2.099000	0.63709	0.528000	0.53228	ATG		0.343	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
DNAH10	196385	broad.mit.edu	37	12	124345570	124345570	+	Missense_Mutation	SNP	C	C	T	rs372604094		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr12:124345570C>T	ENST00000409039.3	+	38	6432	c.6407C>T	c.(6406-6408)aCg>aTg	p.T2136M		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2136	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T728M(1)|p.T2136M(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTTGGGCTGACGACAAAGTTG	0.483																																					p.T2136M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C6407T	12						.	T	MET/THR	0,3788		0,0,1894	76.0	75.0	75.0		6407	2.0	0.1	12		75	1,8231		0,1,4115	no	missense	DNAH10	NM_207437.3	81	0,1,6009	TT,TC,CC		0.0121,0.0,0.0083	benign	2136/4472	124345570	1,12019	1894	4116	6010	122911523	SO:0001583	missense	196385	exon38			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6407C>T	12.37:g.124345570C>T	ENSP00000386770:p.Thr2136Met		122911523	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	T	5.742	0.321349	0.10845	0.0	1.21E-4	ENSG00000197653	ENST00000409039	T	0.39592	1.07	5.59	1.99	0.26369	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.569325	0.15863	N	0.240912	T	0.36193	0.0958	L	0.50919	1.6	0.09310	N	1	B	0.19200	0.034	B	0.22880	0.042	T	0.26950	-1.0088	10	0.46703	T	0.11	.	9.3607	0.38195	0.0:0.2687:0.0:0.7313	.	2136	Q8IVF4	DYH10_HUMAN	M	2136	ENSP00000386770:T2136M	ENSP00000386770:T2136M	T	+	2	0	DNAH10	122911523	0.996000	0.38824	0.063000	0.19743	0.382000	0.30200	2.814000	0.48010	-0.113000	0.11958	-1.062000	0.02293	ACG		0.483	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
Unknown	0	broad.mit.edu	37	Unknown	0	0	+	IGR	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Invalid:failed_liftOver	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrUnknown:0G>A								None (None upstream) : None (None downstream)																								0.0																																					p.D50D												.	.	0			c.C150T	15						.																																			19336151	SO:0001628	intergenic_variant	339010	exon1																															Unknown.37:g.0G>A			19336151	NM_207355		Silent	SNP		37																																																																																				0	0								
SNX22	79856	broad.mit.edu	37	15	64446589	64446589	+	Missense_Mutation	SNP	C	C	T	rs111942276	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr15:64446589C>T	ENST00000325881.4	+	7	523	c.464C>T	c.(463-465)tCg>tTg	p.S155L	PPIB_ENST00000558492.1_5'Flank	NM_024798.2	NP_079074.2	Q96L94	SNX22_HUMAN	sorting nexin 22	155					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)	p.S155L(1)		large_intestine(3)|lung(1)|urinary_tract(2)	6						CCCACAGAGTCGCTGCCCAAC	0.602											OREG0023180	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2	0.000399361	0.0	0.0	5008	,	,		18755	0.0		0.001	False		,,,				2504	0.001				p.S155L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C464T	15						.						93.0	90.0	91.0					15																	64446589		2203	4300	6503	62233642	SO:0001583	missense	79856	exon7			AK024014	CCDS10190.1	15q22.1	2010-01-15			ENSG00000157734	ENSG00000157734		"""Sorting nexins"""	16315	protein-coding gene	gene with protein product						12461558, 17400918	Standard	NR_073534		Approved	FLJ13952	uc002anc.1	Q96L94	OTTHUMG00000132965	ENST00000325881.4:c.464C>T	15.37:g.64446589C>T	ENSP00000323435:p.Ser155Leu	1076	62233642	NM_024798	Q8WUS9|Q9H844	Missense_Mutation	SNP	ENST00000325881.4	37	CCDS10190.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	4.014	0.000010	0.07819	.	.	ENSG00000157734	ENST00000325881	T	0.78246	-1.16	5.43	3.55	0.40652	.	0.801287	0.11987	N	0.510246	T	0.64811	0.2632	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47045	-0.9147	10	0.26408	T	0.33	-14.4408	12.8442	0.57821	0.0:0.8739:0.0:0.1261	.	155	Q96L94	SNX22_HUMAN	L	155	ENSP00000323435:S155L	ENSP00000323435:S155L	S	+	2	0	SNX22	62233642	0.000000	0.05858	0.125000	0.21846	0.088000	0.18126	0.144000	0.16135	0.289000	0.22422	-1.564000	0.00881	TCG		0.602	SNX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256524.2	NM_024798	
ISLR2	57611	broad.mit.edu	37	15	74425863	74425863	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr15:74425863C>T	ENST00000361742.3	+	4	1537	c.768C>T	c.(766-768)ttC>ttT	p.F256F	ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000453268.2_Silent_p.F256F|ISLR2_ENST00000565540.1_Silent_p.F256F|ISLR2_ENST00000445793.1_Silent_p.F256F|ISLR2_ENST00000565159.1_Silent_p.F256F|ISLR2_ENST00000419208.1_Silent_p.F256F|ISLR2_ENST00000435464.1_Silent_p.F256F	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	256	Ig-like.				positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.F256F(1)		breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GACTGGCGTTCGTGTTACACT	0.672																																					p.F256F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C768T	15						.						40.0	38.0	39.0					15																	74425863		2197	4296	6493	72212916	SO:0001819	synonymous_variant	57611	exon3				CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.768C>T	15.37:g.74425863C>T			72212916	NM_020851	A8K352|Q9P263	Silent	SNP	ENST00000361742.3	37	CCDS10259.1																																																																																				0.672	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851	
ZNF710	374655	broad.mit.edu	37	15	90610934	90610934	+	Missense_Mutation	SNP	C	C	G	rs151314806	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr15:90610934C>G	ENST00000268154.4	+	2	816	c.565C>G	c.(565-567)Cct>Gct	p.P189A		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	189	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P189A(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			CCCATATGACCCTCACTTCCC	0.697													C|||	36	0.0071885	0.0023	0.0058	5008	,	,		14097	0.0		0.0139	False		,,,				2504	0.0153				p.P189A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C565G	15						.	C	ALA/PRO	9,4309		0,9,2150	14.0	19.0	17.0		565	3.0	1.0	15	dbSNP_134	17	111,8433		0,111,4161	yes	missense	ZNF710	NM_198526.2	27	0,120,6311	GG,GC,CC		1.2992,0.2084,0.933	possibly-damaging	189/665	90610934	120,12742	2159	4272	6431	88411938	SO:0001583	missense	374655	exon2			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.565C>G	15.37:g.90610934C>G	ENSP00000268154:p.Pro189Ala		88411938	NM_198526	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	ENST00000268154.4	37	CCDS10358.1	18	0.008241758241758242	2	0.0040650406504065045	3	0.008287292817679558	0	0.0	13	0.017150395778364115	C	4.116	0.019767	0.08006	0.002084	0.012992	ENSG00000140548	ENST00000268154	T	0.08193	3.12	4.98	3.02	0.34903	.	2.285390	0.01855	N	0.036197	T	0.01800	0.0057	N	0.08118	0	0.24754	N	0.992965	B	0.02656	0.0	B	0.01281	0.0	T	0.40683	-0.9550	10	0.02654	T	1	-17.0777	3.1738	0.06561	0.1666:0.5534:0.1819:0.0981	.	189	Q8N1W2	ZN710_HUMAN	A	189	ENSP00000268154:P189A	ENSP00000268154:P189A	P	+	1	0	ZNF710	88411938	0.000000	0.05858	0.989000	0.46669	0.128000	0.20619	0.298000	0.19120	1.324000	0.45282	0.561000	0.74099	CCT		0.697	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313423.1	NM_198526	
SLC9B1	150159	broad.mit.edu	37	4	103867924	103867924	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:103867924C>T	ENST00000296422.7	-	5	546	c.405G>A	c.(403-405)acG>acA	p.T135T	SLC9B1_ENST00000394789.3_Silent_p.T135T	NM_139173.3	NP_631912	Q4ZJI4	SL9B1_HUMAN	solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1	135					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)	p.T135T(1)									CATTCCTAATCGTAAAACCAG	0.328																																					p.T135T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G405A	4						.						52.0	52.0	52.0					4																	103867924		2203	4298	6501	104087373	SO:0001819	synonymous_variant	150159	exon5			AF447585	CCDS34041.1, CCDS47119.1	4q24	2013-05-22	2012-03-22	2011-07-26	ENSG00000164037	ENSG00000164037		"""Solute carriers"""	24244	protein-coding gene	gene with protein product		611527	"""Na+/H+ exchanger domain containing 1"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1"""	NHEDC1		16850186	Standard	NM_139173		Approved	NHA1	uc003hww.3	Q4ZJI4	OTTHUMG00000161114	ENST00000296422.7:c.405G>A	4.37:g.103867924C>T			104087373	NM_139173	A1KXV1|B9EH04|C9JBP7|Q49A30|Q8NCV2|Q8WVZ0	Silent	SNP	ENST00000296422.7	37	CCDS34041.1																																																																																				0.328	SLC9B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363841.1	NM_139173	
BBS12	166379	broad.mit.edu	37	4	123663513	123663513	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:123663513A>C	ENST00000314218.3	+	2	659	c.466A>C	c.(466-468)Agt>Cgt	p.S156R	BBS12_ENST00000542236.1_Missense_Mutation_p.S156R	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	156					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)	p.S156R(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						ATTTAGTGTAAGTTTGTGTCC	0.373									Bardet-Biedl syndrome																												p.S156R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A466C	4						.						115.0	102.0	106.0					4																	123663513		2203	4300	6503	123882963	SO:0001583	missense	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.466A>C	4.37:g.123663513A>C	ENSP00000319062:p.Ser156Arg		123882963	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	ENST00000314218.3	37	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	A	5.941	0.357554	0.11239	.	.	ENSG00000181004	ENST00000314218;ENST00000542236;ENST00000433287	T;T;T	0.70631	-0.5;-0.5;0.13	5.2	-1.35	0.09114	.	0.931433	0.09170	N	0.838998	T	0.53433	0.1796	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40757	-0.9546	10	0.45353	T	0.12	-34.7595	5.5141	0.16896	0.4917:0.0:0.3764:0.1319	.	156	Q6ZW61	BBS12_HUMAN	R	156	ENSP00000319062:S156R;ENSP00000438273:S156R;ENSP00000398912:S156R	ENSP00000319062:S156R	S	+	1	0	BBS12	123882963	0.000000	0.05858	0.000000	0.03702	0.319000	0.28217	0.551000	0.23361	-0.137000	0.11455	0.528000	0.53228	AGT		0.373	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
DCHS2	54798	broad.mit.edu	37	4	155157679	155157679	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:155157679C>G	ENST00000357232.4	-	25	6759	c.6760G>C	c.(6760-6762)Gag>Cag	p.E2254Q		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2254	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E2254Q(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGTCCCTTCTCATTTCCAGAG	0.403																																					p.E2254Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6760C	4						.						98.0	102.0	101.0					4																	155157679		2203	4300	6503	155377129	SO:0001583	missense	54798	exon25			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6760G>C	4.37:g.155157679C>G	ENSP00000349768:p.Glu2254Gln		155377129	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908492	0.52333	.	.	ENSG00000197410	ENST00000357232	T	0.54279	0.58	5.64	5.64	0.86602	Cadherin (4);Cadherin-like (1);	0.079447	0.51477	D	0.000083	T	0.68668	0.3026	L	0.50847	1.595	0.80722	D	1	D	0.71674	0.998	D	0.69142	0.962	T	0.68784	-0.5317	10	0.59425	D	0.04	.	19.7012	0.96054	0.0:1.0:0.0:0.0	.	2254	Q6V1P9	PCD23_HUMAN	Q	2254	ENSP00000349768:E2254Q	ENSP00000349768:E2254Q	E	-	1	0	DCHS2	155377129	1.000000	0.71417	0.974000	0.42286	0.717000	0.41224	2.582000	0.46085	2.637000	0.89404	0.563000	0.77884	GAG		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
WDR17	116966	broad.mit.edu	37	4	177100635	177100635	+	Missense_Mutation	SNP	G	G	A	rs146320284		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:177100635G>A	ENST00000280190.4	+	31	4030	c.3874G>A	c.(3874-3876)Ggg>Agg	p.G1292R	WDR17_ENST00000393643.2_Missense_Mutation_p.G1268R|WDR17_ENST00000507824.2_Missense_Mutation_p.G1267R|WDR17_ENST00000508596.1_Missense_Mutation_p.G1253R			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1292								p.G1292R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CCTTGAAGACGGGAAATCTGC	0.393																																					p.G1253R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3757A	4						.	G	ARG/GLY,ARG/GLY	0,4406		0,0,2203	144.0	131.0	136.0		3874,3757	4.7	1.0	4	dbSNP_134	136	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	WDR17	NM_170710.4,NM_181265.3	125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	1292/1323,1253/1284	177100635	1,13005	2203	4300	6503	177337629	SO:0001583	missense	116966	exon29			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3874G>A	4.37:g.177100635G>A	ENSP00000280190:p.Gly1292Arg		177337629	NM_181265	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.9|21.9	4.211820|4.211820	0.79240|0.79240	0.0|0.0	1.16E-4|1.16E-4	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000443118	T;T;T|.	0.71579|.	-0.44;-0.51;-0.58|.	5.51|5.51	4.66|4.66	0.58398|0.58398	.|.	0.125096|.	0.53938|.	N|.	0.000059|.	T|T	0.73705|0.73705	0.3621|0.3621	M|M	0.74881|0.74881	2.28|2.28	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.76494|.	0.999;0.997;0.997|.	P;P;P|.	0.62298|.	0.9;0.847;0.847|.	T|T	0.74780|0.74780	-0.3549|-0.3549	10|5	0.87932|.	D|.	0|.	-16.1458|-16.1458	14.4989|14.4989	0.67707|0.67707	0.0711:0.0:0.9289:0.0|0.0711:0.0:0.9289:0.0	.|.	1268;1253;1292|.	E7EP77;E7EQX0;Q8IZU2|.	.;.;WDR17_HUMAN|.	R|Q	1253;1268;1292;1268|526	ENSP00000422763:G1253R;ENSP00000377258:G1268R;ENSP00000280190:G1292R|.	ENSP00000280190:G1292R|.	G|R	+|+	1|2	0|0	WDR17|WDR17	177337629|177337629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.954000|0.954000	0.61252|0.61252	6.273000|6.273000	0.72581|0.72581	1.451000|1.451000	0.47736|0.47736	0.655000|0.655000	0.94253|0.94253	GGG|CGG		0.393	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
SLC30A9	10463	broad.mit.edu	37	4	42025372	42025372	+	Missense_Mutation	SNP	G	G	A	rs144935504	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:42025372G>A	ENST00000264451.7	+	6	761	c.581G>A	c.(580-582)cGt>cAt	p.R194H		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	194					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R194H(3)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAAAAATTGCGTAAGGAAGCA	0.343													G|||	2	0.000399361	0.0	0.0	5008	,	,		17754	0.0		0.001	False		,,,				2504	0.001				p.R194H												.	.	3	Substitution - Missense(3)	large_intestine(2)|endometrium(1)	c.G581A	4						.	G	HIS/ARG	0,4406		0,0,2203	98.0	103.0	101.0		581	5.5	1.0	4	dbSNP_134	101	3,8597	3.7+/-12.6	0,3,4297	yes	missense	SLC30A9	NM_006345.3	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	194/569	42025372	3,13003	2203	4300	6503	41720129	SO:0001583	missense	10463	exon6			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.581G>A	4.37:g.42025372G>A	ENSP00000264451:p.Arg194His		41720129	NM_006345	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	37	CCDS3465.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	34	5.319460	0.95682	0.0	3.49E-4	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.56444	0.46	5.48	5.48	0.80851	DNA binding domain, putative (1);	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	T	0.78270	-0.2269	10	0.87932	D	0	-11.4523	19.3393	0.94335	0.0:0.0:1.0:0.0	.	194	Q6PML9	ZNT9_HUMAN	H	194;22	ENSP00000264451:R194H	ENSP00000264451:R194H	R	+	2	0	SLC30A9	41720129	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	9.297000	0.96120	2.556000	0.86216	0.585000	0.79938	CGT		0.343	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216842.3		
POLR2B	5431	broad.mit.edu	37	4	57896476	57896476	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:57896476G>A	ENST00000381227.1	+	25	3759	c.3346G>A	c.(3346-3348)Gtt>Att	p.V1116I	POLR2B_ENST00000314595.5_Missense_Mutation_p.V1116I|IGFBP7_ENST00000512512.1_5'Flank|POLR2B_ENST00000441246.2_Missense_Mutation_p.V1109I|POLR2B_ENST00000431623.2_Missense_Mutation_p.V1041I			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	1116					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)	p.V1116F(2)|p.V1116I(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TCCATATCAGGTTCATGTTTG	0.458																																					p.V1116I												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.G3346A	4						.						114.0	111.0	112.0					4																	57896476		2203	4300	6503	57591233	SO:0001583	missense	5431	exon24				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.3346G>A	4.37:g.57896476G>A	ENSP00000370625:p.Val1116Ile		57591233	NM_000938	A8K1A8|Q8IZ61	Missense_Mutation	SNP	ENST00000381227.1	37	CCDS3511.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.915342	0.52546	.	.	ENSG00000047315	ENST00000381227;ENST00000431623;ENST00000441246;ENST00000314595	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.41	5.41	0.78517	RNA polymerase Rpb2, domain 7 (1);	0.000000	0.85682	D	0.000000	T	0.72317	0.3445	L	0.41124	1.26	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.006	T	0.65660	-0.6114	10	0.29301	T	0.29	.	19.2125	0.93763	0.0:0.0:1.0:0.0	.	1041;1116	C9J4M6;P30876	.;RPB2_HUMAN	I	1116;1041;1109;1116	ENSP00000370625:V1116I;ENSP00000391096:V1041I;ENSP00000391452:V1109I;ENSP00000312735:V1116I	ENSP00000312735:V1116I	V	+	1	0	POLR2B	57591233	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.623000	0.98386	2.529000	0.85273	0.585000	0.79938	GTT		0.458	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250692.1	NM_000938	
CFAP97	57587	broad.mit.edu	37	4	186112011	186112011	+	Missense_Mutation	SNP	C	C	T	rs371391407		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr4:186112011C>T	ENST00000458385.2	-	2	459	c.340G>A	c.(340-342)Gtg>Atg	p.V114M	KIAA1430_ENST00000296775.6_Missense_Mutation_p.V114M|KIAA1430_ENST00000514798.1_Missense_Mutation_p.V114M	NM_020827.1	NP_065878.1	Q9P2B7	K1430_HUMAN		114								p.V114M(1)		endometrium(3)|kidney(2)|large_intestine(5)|upper_aerodigestive_tract(1)	11		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		GGAATGGACACGTGTATTTTA	0.363																																					p.V114M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G340A	4						.						91.0	81.0	84.0					4																	186112011		1859	4105	5964	186349005	SO:0001583	missense	57587	exon2																														ENST00000458385.2:c.340G>A	4.37:g.186112011C>T	ENSP00000409964:p.Val114Met		186349005	NM_020827	B3KRP7|D3DP60|Q05CU1|Q4W5M4|Q8N6E7|Q9UF45	Missense_Mutation	SNP	ENST00000458385.2	37	CCDS47168.1	.	.	.	.	.	.	.	.	.	.	C	0.735	-0.778583	0.02929	.	.	ENSG00000164323	ENST00000458385;ENST00000514798;ENST00000296775;ENST00000503223	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.21	1.25	0.21368	.	0.525227	0.17162	N	0.184648	T	0.12433	0.0302	N	0.03608	-0.345	0.09310	N	1	P;B	0.40476	0.718;0.002	B;B	0.27380	0.079;0.001	T	0.14309	-1.0477	10	0.42905	T	0.14	0.0991	2.5544	0.04756	0.3949:0.3519:0.1462:0.1071	.	114;114	Q9P2B7-2;Q9P2B7	.;K1430_HUMAN	M	114	ENSP00000409964:V114M;ENSP00000423312:V114M;ENSP00000296775:V114M;ENSP00000420832:V114M	ENSP00000296775:V114M	V	-	1	0	KIAA1430	186349005	0.000000	0.05858	0.026000	0.17262	0.023000	0.10783	0.133000	0.15912	0.052000	0.16007	-0.706000	0.03657	GTG		0.363	KIAA1430-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360717.2		
GPRASP1	9737	broad.mit.edu	37	X	101912025	101912025	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:101912025T>G	ENST00000361600.5	+	5	3985	c.3184T>G	c.(3184-3186)Ttc>Gtc	p.F1062V	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.F1062V|GPRASP1_ENST00000444152.1_Missense_Mutation_p.F1062V|GPRASP1_ENST00000415986.1_Missense_Mutation_p.F1062V	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1062	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)		p.F1062V(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TAGGGTCGGCTTCCCATCTAT	0.517																																					p.F1062V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3184G	X						.						122.0	121.0	121.0					X																	101912025		2203	4300	6503	101798681	SO:0001583	missense	9737	exon3			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3184T>G	X.37:g.101912025T>G	ENSP00000355146:p.Phe1062Val		101798681	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822931	0.32237	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.10477	2.87;2.87;2.87;2.87	2.84	2.84	0.33178	.	.	.	.	.	T	0.25269	0.0614	M	0.61703	1.905	0.27121	N	0.962141	D	0.76494	0.999	D	0.78314	0.991	T	0.03060	-1.1077	9	0.52906	T	0.07	-3.9728	6.6244	0.22820	0.0:0.0:0.0:1.0	.	1062	Q5JY77	GASP1_HUMAN	V	1062	ENSP00000393691:F1062V;ENSP00000409420:F1062V;ENSP00000355146:F1062V;ENSP00000445683:F1062V	ENSP00000355146:F1062V	F	+	1	0	GPRASP1	101798681	1.000000	0.71417	0.931000	0.37212	0.948000	0.59901	2.926000	0.48892	1.365000	0.46057	0.235000	0.17854	TTC		0.517	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
IRS4	8471	broad.mit.edu	37	X	107979463	107979463	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:107979463C>T	ENST00000372129.2	-	1	188	c.112G>A	c.(112-114)Gga>Aga	p.G38R	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	38					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)	p.G38R(1)		NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GTCGGGGTTCCCGAGGAAAGA	0.642																																					p.G38R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G112A	X						.						27.0	29.0	28.0					X																	107979463		2203	4297	6500	107866119	SO:0001583	missense	8471	exon1			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.112G>A	X.37:g.107979463C>T	ENSP00000361202:p.Gly38Arg		107866119	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	c	11.57	1.677313	0.29783	.	.	ENSG00000133124	ENST00000372129	T	0.39229	1.09	3.21	1.37	0.22104	.	0.575630	0.13084	U	0.415070	T	0.21550	0.0519	N	0.08118	0	0.27800	N	0.942521	B	0.15930	0.015	B	0.15484	0.013	T	0.17806	-1.0357	10	0.66056	D	0.02	-0.0909	6.7584	0.23526	0.2:0.6093:0.1906:0.0	.	38	O14654	IRS4_HUMAN	R	38	ENSP00000361202:G38R	ENSP00000361202:G38R	G	-	1	0	IRS4	107866119	0.775000	0.28604	0.007000	0.13788	0.548000	0.35241	3.443000	0.52907	0.246000	0.21394	-1.562000	0.00884	GGA		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
PAK3	5063	broad.mit.edu	37	X	110463652	110463652	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:110463652G>A	ENST00000372010.1	+	19	2099	c.1657G>A	c.(1657-1659)Gca>Aca	p.A553T	PAK3_ENST00000425146.1_Missense_Mutation_p.A538T|PAK3_ENST00000519681.1_Missense_Mutation_p.A559T|PAK3_ENST00000372007.5_Missense_Mutation_p.A538T|PAK3_ENST00000262836.4_Missense_Mutation_p.A553T|PAK3_ENST00000518291.1_Missense_Mutation_p.A574T|PAK3_ENST00000446737.1_Missense_Mutation_p.A538T|PAK3_ENST00000360648.4_Missense_Mutation_p.A574T|PAK3_ENST00000417227.1_Missense_Mutation_p.A559T			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	553					activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.A538T(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TGCAAAGGAAGCAATTAAGAA	0.433										TSP Lung(19;0.15)																											p.A538T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1612A	X						.						50.0	42.0	44.0					X																	110463652		2203	4300	6503	110350308	SO:0001583	missense	5063	exon16			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1657G>A	X.37:g.110463652G>A	ENSP00000361080:p.Ala553Thr		110350308	NM_001128166	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945037	0.73672	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.72167	-0.61;-0.61;-0.62;-0.63;-0.61;-0.61;-0.61;-0.63;-0.62	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70116	0.3187	L	0.45352	1.415	0.80722	D	1	B;P;P;P	0.39665	0.379;0.549;0.554;0.682	B;B;B;B	0.41412	0.251;0.251;0.232;0.356	T	0.71262	-0.4645	10	0.59425	D	0.04	.	19.7362	0.96205	0.0:0.0:1.0:0.0	.	559;574;553;538	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	T	538;538;553;559;538;574;574;559;553	ENSP00000410853:A538T;ENSP00000401982:A538T;ENSP00000361080:A553T;ENSP00000429113:A559T;ENSP00000361077:A538T;ENSP00000428921:A574T;ENSP00000353864:A574T;ENSP00000389172:A559T;ENSP00000262836:A553T	ENSP00000262836:A553T	A	+	1	0	PAK3	110350308	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	9.390000	0.97246	2.618000	0.88619	0.600000	0.82982	GCA		0.433	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
SLC6A14	11254	broad.mit.edu	37	X	115588822	115588822	+	Silent	SNP	C	C	T	rs187409232		TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:115588822C>T	ENST00000371900.4	+	13	1750	c.1662C>T	c.(1660-1662)ggC>ggT	p.G554G	SLC6A14_ENST00000463626.1_Intron	NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	554					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.G554G(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CTAATTATGGCGCAATTCCAT	0.353													C|||	3	0.000794702	0.0	0.0	3775	,	,		11785	0.003		0.0	False		,,,				2504	0.0				p.G554G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1662T	X						.						190.0	167.0	175.0					X																	115588822		2203	4300	6503	115502850	SO:0001819	synonymous_variant	11254	exon13			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1662C>T	X.37:g.115588822C>T			115502850	NM_007231	Q5H942	Silent	SNP	ENST00000371900.4	37	CCDS14570.1																																																																																				0.353	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
DCAF12L2	340578	broad.mit.edu	37	X	125299670	125299670	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:125299670C>T	ENST00000360028.2	-	1	264	c.238G>A	c.(238-240)Gtc>Atc	p.V80I	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.V80I			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	80								p.V80I(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						AGCCTCTGGACGGCGTAGCCC	0.701																																					p.V80I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G238A	X						.						25.0	27.0	26.0					X																	125299670		2190	4261	6451	125127351	SO:0001583	missense	340578	exon1			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.238G>A	X.37:g.125299670C>T	ENSP00000353128:p.Val80Ile		125127351	NM_001013628	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	c	13.93	2.385398	0.42308	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.34859	1.34;1.34	3.28	3.28	0.37604	.	.	.	.	.	T	0.25419	0.0618	L	0.46157	1.445	0.31006	N	0.719822	P	0.49358	0.923	B	0.32022	0.139	T	0.26780	-1.0093	9	0.34782	T	0.22	.	11.6703	0.51396	0.0:1.0:0.0:0.0	.	80	Q5VW00	DC122_HUMAN	I	80	ENSP00000441489:V80I;ENSP00000353128:V80I	ENSP00000353128:V80I	V	-	1	0	DCAF12L2	125127351	1.000000	0.71417	0.024000	0.17045	0.059000	0.15707	5.147000	0.64851	1.891000	0.54761	0.287000	0.19450	GTC		0.701	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
MXRA5	25878	broad.mit.edu	37	X	3238174	3238174	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:3238174T>C	ENST00000217939.6	-	5	5706	c.5552A>G	c.(5551-5553)gAa>gGa	p.E1851G		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1851						extracellular vesicular exosome (GO:0070062)		p.E1851G(2)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGTGGCTTTTCCCCAAGAGA	0.507																																					p.E1851G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A5552G	X						.						96.0	85.0	89.0					X																	3238174		2203	4300	6503	3248174	SO:0001583	missense	25878	exon5			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5552A>G	X.37:g.3238174T>C	ENSP00000217939:p.Glu1851Gly		3248174	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	T	10.51	1.369042	0.24771	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.68025	-0.3	3.51	3.51	0.40186	.	0.000000	0.39341	U	0.001398	T	0.47691	0.1459	N	0.08118	0	0.21915	N	0.999477	P	0.52842	0.956	B	0.44224	0.444	T	0.45352	-0.9267	10	0.54805	T	0.06	.	11.8172	0.52218	0.0:0.0:0.0:1.0	.	1851	Q9NR99	MXRA5_HUMAN	G	1851	ENSP00000217939:E1851G	ENSP00000217939:E1851G	E	-	2	0	MXRA5	3248174	0.020000	0.18652	0.257000	0.24404	0.156000	0.22039	1.247000	0.32815	1.133000	0.42147	0.372000	0.22366	GAA		0.507	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
ZNF674	641339	broad.mit.edu	37	X	46359623	46359623	+	Silent	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:46359623T>C	ENST00000523374.1	-	6	1611	c.1401A>G	c.(1399-1401)aaA>aaG	p.K467K	ZNF674_ENST00000414387.2_Silent_p.K461K|ZNF674_ENST00000518795.1_5'Flank	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)	2						ATTTATAGGGTTTCTCTCCTG	0.423																																					p.K462K												.	.	0			c.A1386G	X						.						78.0	78.0	78.0					X																	46359623		2195	4293	6488	46244567	SO:0001819	synonymous_variant	641339	exon6			AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.1401A>G	X.37:g.46359623T>C			46244567	NM_001190417	B4DHE2|E9PHQ4	Silent	SNP	ENST00000523374.1	37	CCDS48099.1																																																																																				0.423	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056357.2	NM_001039891	
TRO	7216	broad.mit.edu	37	X	54955781	54955781	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:54955781C>T	ENST00000173898.7	+	12	2736	c.2624C>T	c.(2623-2625)aCg>aTg	p.T875M	TRO_ENST00000420798.2_Missense_Mutation_p.T406M|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375022.4_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Missense_Mutation_p.T478M|TRO_ENST00000319167.8_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	875	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T875M(1)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GCACCCACAACGAGCACAGTC	0.572																																					p.T875M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2624T	X						.						55.0	50.0	52.0					X																	54955781		2128	4221	6349	54972506	SO:0001583	missense	7216	exon12			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.2624C>T	X.37:g.54955781C>T	ENSP00000173898:p.Thr875Met		54972506	NM_001039705	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	37	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	1.206	-0.631151	0.03584	.	.	ENSG00000067445	ENST00000173898;ENST00000420798;ENST00000375041	T;T;T	0.09630	2.96;2.96;2.96	2.84	0.95	0.19572	.	.	.	.	.	T	0.07458	0.0188	L	0.46157	1.445	0.09310	N	1	P;P	0.41848	0.763;0.763	B;B	0.29440	0.102;0.102	T	0.27640	-1.0068	9	0.87932	D	0	.	5.2366	0.15450	0.0:0.6559:0.2082:0.1359	.	478;875	B1AKE9;Q12816	.;TROP_HUMAN	M	875;406;478	ENSP00000173898:T875M;ENSP00000405126:T406M;ENSP00000364181:T478M	ENSP00000173898:T875M	T	+	2	0	TRO	54972506	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.144000	0.16135	0.122000	0.18314	-0.248000	0.11899	ACG		0.572	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
TBX22	50945	broad.mit.edu	37	X	79277903	79277903	+	Silent	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:79277903G>A	ENST00000373294.5	+	1	163	c.135G>A	c.(133-135)gaG>gaA	p.E45E	TBX22_ENST00000442340.1_5'UTR|TBX22_ENST00000373296.3_Silent_p.E45E|TBX22_ENST00000373291.1_5'Flank|TBX22_ENST00000476373.1_3'UTR	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	45					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E45E(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AGGAAGAGGAGGAGAGAAGGA	0.592																																					p.E45E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G135A	X						.						65.0	50.0	55.0					X																	79277903		2200	4295	6495	79164559	SO:0001819	synonymous_variant	50945	exon2			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.135G>A	X.37:g.79277903G>A			79164559	NM_001109878	Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	ENST00000373294.5	37	CCDS14445.1																																																																																				0.592	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
GPR101	83550	broad.mit.edu	37	X	136113120	136113120	+	Silent	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chrX:136113120G>T	ENST00000298110.1	-	1	713	c.714C>A	c.(712-714)gtC>gtA	p.V238V		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.V238V(1)		autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CACAGTCCTTGACTCGCACTT	0.532																																					p.V238V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C714A	X						.						128.0	113.0	118.0					X																	136113120		2203	4300	6503	135940786	SO:0001819	synonymous_variant	83550	exon1			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.714C>A	X.37:g.136113120G>T			135940786	NM_054021	Q5JSM8|Q8NG93	Silent	SNP	ENST00000298110.1	37	CCDS14662.1																																																																																				0.532	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
TRIB2	28951	broad.mit.edu	37	2	12863517	12863517	+	Silent	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:12863517T>C	ENST00000405331.3	+	2	472	c.402T>C	c.(400-402)taT>taC	p.Y134Y	TRIB2_ENST00000155926.4_Silent_p.Y134Y|TRIB2_ENST00000381465.2_5'UTR					tribbles pseudokinase 2									p.Y134Y(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGCGAAGCTATGGGGACATGC	0.522																																					p.Y134Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T402C	2						.						113.0	96.0	102.0					2																	12863517		2203	4300	6503	12780968	SO:0001819	synonymous_variant	28951	exon2			AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000405331.3:c.402T>C	2.37:g.12863517T>C			12780968	NM_021643		Silent	SNP	ENST00000405331.3	37																																																																																					0.522	TRIB2-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000323585.1	NM_021643	
ZC3H8	84524	broad.mit.edu	37	2	112991733	112991733	+	Silent	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:112991733T>C	ENST00000409573.2	-	5	714	c.585A>G	c.(583-585)caA>caG	p.Q195Q	ZC3H8_ENST00000272570.5_Silent_p.Q195Q|ZC3H8_ENST00000476902.1_5'Flank			Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	195					apoptotic process (GO:0006915)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to antibiotic (GO:0046677)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|T cell homeostasis (GO:0043029)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q195Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	7						ATTTACAAATTTGTTTTCCCT	0.308																																					p.Q195Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A585G	2						.						80.0	71.0	74.0					2																	112991733		1831	4083	5914	112708204	SO:0001819	synonymous_variant	84524	exon5			AF334161	CCDS46392.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000144161	ENSG00000144161		"""Zinc fingers, CCCH-type domain containing"""	30941	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 8"""	ZC3HDC8		12477932	Standard	NM_032494		Approved	Fliz1	uc021vmw.1	Q8N5P1	OTTHUMG00000153270	ENST00000409573.2:c.585A>G	2.37:g.112991733T>C			112708204	NM_032494	Q9BZ75	Silent	SNP	ENST00000409573.2	37	CCDS46392.1																																																																																				0.308	ZC3H8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330521.3	NM_032494	
UGGT1	56886	broad.mit.edu	37	2	128914868	128914868	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:128914868A>G	ENST00000259253.6	+	22	2350	c.2303A>G	c.(2302-2304)gAt>gGt	p.D768G	UGGT1_ENST00000375990.3_Missense_Mutation_p.D744G	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	768					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)	p.D768G(1)		NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ATTGTTGGGGATTTTGATAGC	0.373																																					p.D768G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2303G	2						.						154.0	144.0	148.0					2																	128914868		2203	4300	6503	128631338	SO:0001583	missense	56886	exon22			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.2303A>G	2.37:g.128914868A>G	ENSP00000259253:p.Asp768Gly		128631338	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	ENST00000259253.6	37	CCDS2154.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.853066	0.91355	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.28069	1.63;1.63	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.63844	-0.6545	9	.	.	.	.	16.2962	0.82776	1.0:0.0:0.0:0.0	.	744;768	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	G	744;768	ENSP00000365158:D744G;ENSP00000259253:D768G	.	D	+	2	0	UGGT1	128631338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.691000	0.91279	2.304000	0.77564	0.528000	0.53228	GAT		0.373	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
LRP1B	53353	broad.mit.edu	37	2	141243076	141243076	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:141243076C>T	ENST00000389484.3	-	59	10232	c.9261G>A	c.(9259-9261)gcG>gcA	p.A3087A		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3087					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A3087A(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATTGGGGACCGCTGTGTTAT	0.368										TSP Lung(27;0.18)																											p.A3087A	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G9261A	2						.						105.0	97.0	100.0					2																	141243076		2203	4300	6503	140959546	SO:0001819	synonymous_variant	53353	exon59			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9261G>A	2.37:g.141243076C>T			140959546	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																				0.368	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SCN7A	6332	broad.mit.edu	37	2	167300022	167300022	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:167300022T>A	ENST00000409855.1	-	13	1917	c.1791A>T	c.(1789-1791)ttA>ttT	p.L597F		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	597					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L597F(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCATCCTGAATAATCGAAGAA	0.353																																					p.L597F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1791T	2						.						61.0	55.0	56.0					2																	167300022		1835	4088	5923	167008268	SO:0001583	missense	6332	exon13			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.1791A>T	2.37:g.167300022T>A	ENSP00000386796:p.Leu597Phe		167008268	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	T	11.26	1.587440	0.28268	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.98792	-5.14;-5.14	4.87	2.51	0.30379	Ion transport (1);	2.578750	0.01291	N	0.010005	D	0.97445	0.9164	L	0.36672	1.1	0.09310	N	1	P	0.37612	0.602	P	0.45377	0.478	D	0.93604	0.6933	10	0.62326	D	0.03	.	5.1412	0.14959	0.0:0.0936:0.3665:0.5398	.	597	Q01118	SCN7A_HUMAN	F	597	ENSP00000386796:L597F;ENSP00000413699:L597F	ENSP00000259060:L597F	L	-	3	2	SCN7A	167008268	0.000000	0.05858	0.124000	0.21820	0.588000	0.36517	-1.382000	0.02546	0.965000	0.38133	0.482000	0.46254	TTA		0.353	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
CCDC173	129881	broad.mit.edu	37	2	170502570	170502570	+	Silent	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:170502570T>C	ENST00000447353.1	-	9	1545	c.1440A>G	c.(1438-1440)gaA>gaG	p.E480E		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	480								p.E474E(1)									CCGATTCAAGTTCAATTACCT	0.418																																					p.E480E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1440G	2						.						208.0	208.0	208.0					2																	170502570		1859	4085	5944	170210816	SO:0001819	synonymous_variant	129881	exon9			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1440A>G	2.37:g.170502570T>C			170210816	NM_001085447	Q6PJF6	Silent	SNP	ENST00000447353.1	37	CCDS46445.1																																																																																				0.418	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333954.2	NM_001085447	
TTN	7273	broad.mit.edu	37	2	179586845	179586845	+	Silent	SNP	G	G	T	rs373496180		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:179586845G>T	ENST00000591111.1	-	76	21818	c.21594C>A	c.(21592-21594)ccC>ccA	p.P7198P	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.P7515P|TTN_ENST00000342992.6_Silent_p.P6271P|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12766	Ig-like 54.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P6271P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTCAAAGAAGGGAGATTTCT	0.383																																					p.P6271P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C18813A	2						.						171.0	162.0	165.0					2																	179586845		1909	4118	6027	179295090	SO:0001819	synonymous_variant	7273	exon75			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21594C>A	2.37:g.179586845G>T			179295090	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																					0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
OSR1	130497	broad.mit.edu	37	2	19553321	19553321	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:19553321C>T	ENST00000272223.2	-	2	590	c.246G>A	c.(244-246)gcG>gcA	p.A82A	OSR1_ENST00000536433.1_Silent_p.A82A	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	82					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A82A(1)		breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				GCTGGAAGCGCGCATCCACCA	0.632																																					p.A82A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G246A	2						.						37.0	39.0	39.0					2																	19553321		2203	4300	6503	19416802	SO:0001819	synonymous_variant	130497	exon2			BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.246G>A	2.37:g.19553321C>T			19416802	NM_145260	B3KV97|D6W521	Silent	SNP	ENST00000272223.2	37	CCDS1694.1																																																																																				0.632	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000201432.2	NM_145260	
ZC3H15	55854	broad.mit.edu	37	2	187373395	187373395	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:187373395C>G	ENST00000337859.6	+	10	1443	c.1216C>G	c.(1216-1218)Ctt>Gtt	p.L406V		NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	406					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L406V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			TGATGAAAATCTTTTCACTGG	0.403																																					p.L406V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1216G	2						.						125.0	127.0	127.0					2																	187373395		1861	4112	5973	187081640	SO:0001583	missense	55854	exon10				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.1216C>G	2.37:g.187373395C>G	ENSP00000338788:p.Leu406Val		187081640	NM_018471	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	ENST00000337859.6	37	CCDS42791.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.804340	0.90623	.	.	ENSG00000065548	ENST00000337859	T	0.44482	0.92	5.81	5.81	0.92471	.	0.192112	0.44902	N	0.000403	T	0.64649	0.2617	M	0.75777	2.31	0.80722	D	1	D	0.67145	0.996	P	0.60473	0.875	T	0.66897	-0.5807	10	0.87932	D	0	-7.0391	20.066	0.97704	0.0:1.0:0.0:0.0	.	406	Q8WU90	ZC3HF_HUMAN	V	406	ENSP00000338788:L406V	ENSP00000338788:L406V	L	+	1	0	ZC3H15	187081640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.405000	0.80007	2.730000	0.93505	0.650000	0.86243	CTT		0.403	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334547.2	NM_018471	
CTLA4	1493	broad.mit.edu	37	2	204736159	204736159	+	Silent	SNP	G	G	A	rs375949600		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:204736159G>A	ENST00000302823.3	+	3	673	c.516G>A	c.(514-516)tcG>tcA	p.S172S	CTLA4_ENST00000487393.1_Intron|CTLA4_ENST00000472206.1_Intron|CTLA4_ENST00000427473.2_Intron|CTLA4_ENST00000295854.6_Intron	NM_005214.4	NP_005205.2	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	172					B cell receptor signaling pathway (GO:0050853)|cellular response to DNA damage stimulus (GO:0006974)|immune response (GO:0006955)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of immune response (GO:0050777)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of apoptotic process (GO:0043065)|T cell costimulation (GO:0031295)	clathrin-coated endocytic vesicle (GO:0045334)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.S172S(1)		large_intestine(4)|lung(4)|skin(1)	9					Ipilimumab(DB06186)	CAGTTAGTTCGGGGTTGTTTT	0.468																																					p.S172S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G516A	2						.	G	,	2,4404	4.2+/-10.8	0,2,2201	199.0	188.0	192.0		,516	-10.8	0.6	2		192	0,8600		0,0,4300	no	intron,coding-synonymous	CTLA4	NM_001037631.2,NM_005214.4	,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,	,172/224	204736159	2,13004	2203	4300	6503	204444404	SO:0001819	synonymous_variant	1493	exon3				CCDS2362.1, CCDS42803.1	2q33	2014-02-03			ENSG00000163599	ENSG00000163599		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	2505	protein-coding gene	gene with protein product		123890	"""celiac disease 3"", ""insulin-dependent diabetes mellitus 12"""	CELIAC3, IDDM12		3220103, 8817351	Standard	NM_005214		Approved	CD152, CD, GSE, CD28, ICOS	uc002vak.2	P16410	OTTHUMG00000132877	ENST00000302823.3:c.516G>A	2.37:g.204736159G>A			204444404	NM_005214	A0N1S0|E9PDH0|O95653|Q0PP65|Q52MC1|Q53TD5|Q5S005|Q8WXJ1|Q96P43|Q9UKN9	Silent	SNP	ENST00000302823.3	37	CCDS2362.1																																																																																				0.468	CTLA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256365.1	NM_005214	
ZDBF2	57683	broad.mit.edu	37	2	207174525	207174525	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:207174525C>A	ENST00000374423.3	+	5	5659	c.5273C>A	c.(5272-5274)tCt>tAt	p.S1758Y		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1758							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.S1758Y(2)		endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CCTCTTCCATCTGATACTGAT	0.398																																					p.S1758Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C5273A	2						.						59.0	58.0	58.0					2																	207174525		1865	4096	5961	206882770	SO:0001583	missense	57683	exon5			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5273C>A	2.37:g.207174525C>A	ENSP00000363545:p.Ser1758Tyr		206882770	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413534	0.42817	.	.	ENSG00000204186	ENST00000374423	T	0.59364	0.27	4.84	1.5	0.22942	.	.	.	.	.	T	0.49745	0.1575	L	0.53249	1.67	0.09310	N	1	P	0.46512	0.879	B	0.41691	0.364	T	0.41840	-0.9486	9	0.87932	D	0	.	6.3204	0.21215	0.0:0.5041:0.2998:0.1961	.	1758	Q9HCK1	ZDBF2_HUMAN	Y	1758	ENSP00000363545:S1758Y	ENSP00000363545:S1758Y	S	+	2	0	ZDBF2	206882770	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.021000	0.12504	0.090000	0.17273	0.650000	0.86243	TCT		0.398	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
TMEM169	92691	broad.mit.edu	37	2	216964670	216964670	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:216964670G>A	ENST00000295658.4	+	3	506	c.299G>A	c.(298-300)cGc>cAc	p.R100H	TMEM169_ENST00000454545.1_Missense_Mutation_p.R100H|TMEM169_ENST00000437356.2_Missense_Mutation_p.R100H|TMEM169_ENST00000406027.2_Missense_Mutation_p.R100H	NM_001142311.1|NM_001142312.1|NM_138390.3	NP_001135783.1|NP_001135784.1|NP_612399.1	Q96HH4	TM169_HUMAN	transmembrane protein 169	100						integral component of membrane (GO:0016021)		p.R100H(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)	13		Renal(323;0.0651)		Epithelial(149;6.44e-06)|all cancers(144;0.000398)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGACAGCCGCTACGTCACC	0.522																																					p.R100H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G299A	2						.						170.0	159.0	163.0					2																	216964670		2203	4300	6503	216672915	SO:0001583	missense	92691	exon3			AK091582	CCDS2401.1	2q35	2008-02-05			ENSG00000163449	ENSG00000163449			25130	protein-coding gene	gene with protein product						12477932	Standard	NM_001142310		Approved	FLJ34263	uc002vfv.4	Q96HH4	OTTHUMG00000133053	ENST00000295658.4:c.299G>A	2.37:g.216964670G>A	ENSP00000295658:p.Arg100His		216672915	NM_001142311	B2R8W6	Missense_Mutation	SNP	ENST00000295658.4	37	CCDS2401.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543629	0.86022	.	.	ENSG00000163449	ENST00000433112;ENST00000454545;ENST00000437356;ENST00000295658;ENST00000455479;ENST00000406027	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.59445	0.2194	M	0.63843	1.955	0.58432	D	0.999997	P	0.49559	0.925	B	0.43052	0.406	T	0.67122	-0.5750	9	0.66056	D	0.02	-8.7	17.308	0.87200	0.0:0.0:1.0:0.0	.	100	Q96HH4	TM169_HUMAN	H	100	.	ENSP00000295658:R100H	R	+	2	0	TMEM169	216672915	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.761000	0.85260	2.550000	0.86006	0.655000	0.94253	CGC		0.522	TMEM169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256666.2	NM_138390	
GMPPA	29926	broad.mit.edu	37	2	220366585	220366585	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:220366585A>C	ENST00000358215.3	+	5	624	c.255A>C	c.(253-255)gaA>gaC	p.E85D	GMPPA_ENST00000373908.1_Missense_Mutation_p.E85D|GMPPA_ENST00000313597.5_Missense_Mutation_p.E85D|AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000373917.3_Missense_Mutation_p.E85D|GMPPA_ENST00000341142.3_Missense_Mutation_p.E85D	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	85					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)	p.E85D(1)|p.I17L(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		ACCTGCAGGAATTTGCCCCCC	0.592																																					p.E85D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A255C	2						.						71.0	67.0	68.0					2																	220366585		2203	4300	6503	220074829	SO:0001583	missense	29926	exon5			AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.255A>C	2.37:g.220366585A>C	ENSP00000350949:p.Glu85Asp		220074829	NM_205847	A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	ENST00000358215.3	37	CCDS2441.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.45|19.45	3.829544|3.829544	0.71258|0.71258	.|.	.|.	ENSG00000144591|ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000455657;ENST00000435316;ENST00000341142|ENST00000373924	T;T;T;T;T;T;T|.	0.77098|.	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07|.	4.68|4.68	0.95|0.95	0.19572|0.19572	Nucleotidyl transferase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75206|0.75206	0.3818|0.3818	M|M	0.89095|0.89095	3.005|3.005	0.58432|0.58432	D|D	0.999992|0.999992	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.997;0.999|.	T|T	0.75199|0.75199	-0.3402|-0.3402	10|6	0.87932|0.87932	D|D	0|0	-35.3195|-35.3195	8.405|8.405	0.32610|0.32610	0.6583:0.0:0.3417:0.0|0.6583:0.0:0.3417:0.0	.|.	85;85|.	Q96IJ6-2;Q96IJ6|.	.;GMPPA_HUMAN|.	D|L	85;85;85;85;85;50;85|17	ENSP00000315925:E85D;ENSP00000363027:E85D;ENSP00000350949:E85D;ENSP00000363016:E85D;ENSP00000392465:E85D;ENSP00000411060:E50D;ENSP00000340760:E85D|.	ENSP00000315925:E85D|ENSP00000363034:I17L	E|I	+|+	3|1	2|0	GMPPA|GMPPA	220074829|220074829	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	1.069000|1.069000	0.30641|0.30641	0.172000|0.172000	0.19760|0.19760	0.459000|0.459000	0.35465|0.35465	GAA|ATT		0.592	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130230.1	NM_013335	
KCNE4	23704	broad.mit.edu	37	2	223917943	223917943	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:223917943C>T	ENST00000281830.3	+	2	879	c.548C>T	c.(547-549)cCg>cTg	p.P183L	KCNE4_ENST00000604125.1_Missense_Mutation_p.P132L|KCNE4_ENST00000488477.2_Intron			Q8WWG9	KCNE4_HUMAN	potassium voltage-gated channel, Isk-related family, member 4	183						apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	voltage-gated potassium channel activity (GO:0005249)	p.P132L(1)		large_intestine(2)|lung(5)|ovary(2)|skin(1)	10		Renal(207;0.0183)|Lung NSC(271;0.137)|all_lung(227;0.175)		Epithelial(121;4.48e-11)|all cancers(144;2.88e-08)|Lung(261;0.00688)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCCTCCTCCCCGGACGTGCAC	0.652																																					p.P132L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C395T	2						.						41.0	43.0	42.0					2																	223917943		2203	4300	6503	223626187	SO:0001583	missense	23704	exon2			AY065987	CCDS2456.1, CCDS2456.2	2q36.1	2008-02-05			ENSG00000152049	ENSG00000152049		"""Potassium channels"""	6244	protein-coding gene	gene with protein product		607775				10219239, 12670483	Standard	NM_080671		Approved	MiRP3	uc002vnl.5	Q8WWG9	OTTHUMG00000133161	ENST00000281830.3:c.548C>T	2.37:g.223917943C>T	ENSP00000281830:p.Pro183Leu		223626187	NM_080671	B7Z275|Q53SM4|Q96CC4	Missense_Mutation	SNP	ENST00000281830.3	37		.	.	.	.	.	.	.	.	.	.	C	27.0	4.794290	0.90453	.	.	ENSG00000152049	ENST00000281830	.	.	.	6.17	6.17	0.99709	.	0.054288	0.85682	D	0.000000	T	0.39655	0.1086	N	0.24115	0.695	0.80722	D	1	P	0.44659	0.84	B	0.31390	0.129	T	0.45818	-0.9235	9	0.72032	D	0.01	-16.3701	20.8794	0.99867	0.0:1.0:0.0:0.0	.	132	Q8WWG9	KCNE4_HUMAN	L	132	.	ENSP00000281830:P132L	P	+	2	0	KCNE4	223626187	1.000000	0.71417	0.845000	0.33349	0.953000	0.61014	7.342000	0.79310	2.941000	0.99782	0.655000	0.94253	CCG		0.652	KCNE4-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000330997.2	NM_080671	
TSPYL6	388951	broad.mit.edu	37	2	54482114	54482114	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:54482114C>T	ENST00000317802.7	-	1	1295	c.1175G>A	c.(1174-1176)cGt>cAt	p.R392H	ACYP2_ENST00000606865.1_Intron|ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000303536.4_Intron|ACYP2_ENST00000607452.1_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	392					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.R392H(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						TACCAGGCGACGTCTAGCTCT	0.527																																					p.R392H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1175A	2						.						73.0	80.0	78.0					2																	54482114		2146	4284	6430	54335618	SO:0001583	missense	388951	exon1			AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.1175G>A	2.37:g.54482114C>T	ENSP00000417919:p.Arg392His		54335618	NM_001003937	Q6NUJ3	Missense_Mutation	SNP	ENST00000317802.7	37	CCDS42682.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.121605	0.37436	.	.	ENSG00000178021	ENST00000317802	T	0.24538	1.85	1.83	-3.09	0.05331	.	.	.	.	.	T	0.37433	0.1003	M	0.68317	2.08	0.09310	N	1	D	0.89917	1.0	D	0.65987	0.94	T	0.23190	-1.0195	9	0.62326	D	0.03	.	2.987	0.05971	0.2296:0.3162:0.0:0.4541	.	392	Q8N831	TSYL6_HUMAN	H	392	ENSP00000417919:R392H	ENSP00000417919:R392H	R	-	2	0	TSPYL6	54335618	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.487000	0.06505	-1.009000	0.03400	-0.469000	0.05056	CGT		0.527	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
PLEK	5341	broad.mit.edu	37	2	68609685	68609685	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:68609685T>C	ENST00000234313.7	+	4	571	c.392T>C	c.(391-393)tTg>tCg	p.L131S		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	131					actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)	p.L131S(1)		autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		GCCTTATATTTGTCCATGAAA	0.363																																					p.L131S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T392C	2						.						89.0	93.0	91.0					2																	68609685		2203	4300	6503	68463189	SO:0001583	missense	5341	exon4			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.392T>C	2.37:g.68609685T>C	ENSP00000234313:p.Leu131Ser		68463189	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	T	3.237	-0.156247	0.06544	.	.	ENSG00000115956	ENST00000234313	T	0.19250	2.16	5.42	5.42	0.78866	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.577827	0.17755	N	0.163086	T	0.15349	0.0370	L	0.36672	1.1	0.30844	N	0.735329	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.15521	-1.0434	10	0.09084	T	0.74	.	10.9229	0.47176	0.14:0.0:0.0:0.86	.	149;131	Q59GZ2;P08567	.;PLEK_HUMAN	S	131	ENSP00000234313:L131S	ENSP00000234313:L131S	L	+	2	0	PLEK	68463189	0.731000	0.28111	1.000000	0.80357	0.986000	0.74619	2.146000	0.42216	2.181000	0.69327	0.496000	0.49642	TTG		0.363	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
SEMA4F	10505	broad.mit.edu	37	2	74902749	74902749	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:74902749G>T	ENST00000357877.2	+	11	1619	c.1470G>T	c.(1468-1470)atG>atT	p.M490I	SEMA4F_ENST00000339773.5_Missense_Mutation_p.M335I|SEMA4F_ENST00000473350.1_3'UTR	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	490	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)	p.M490I(1)		biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TTGAGAACATGAAATTGTACC	0.512																																					p.M490I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1470T	2						.						102.0	91.0	95.0					2																	74902749		2203	4300	6503	74756257	SO:0001583	missense	10505	exon11			AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1470G>T	2.37:g.74902749G>T	ENSP00000350547:p.Met490Ile		74756257	NM_004263	Q542Y7|Q9NS35	Missense_Mutation	SNP	ENST00000357877.2	37	CCDS1955.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758270	0.31137	.	.	ENSG00000135622	ENST00000357877;ENST00000339773	T;T	0.32023	1.47;1.47	4.5	3.58	0.41010	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.129054	0.51477	D	0.000093	T	0.17916	0.0430	N	0.12887	0.27	0.34285	D	0.682588	B;B	0.14012	0.003;0.009	B;B	0.15052	0.007;0.012	T	0.15983	-1.0418	10	0.46703	T	0.11	.	12.2822	0.54771	0.0:0.1859:0.814:0.0	.	335;490	O95754-2;O95754	.;SEM4F_HUMAN	I	490;335	ENSP00000350547:M490I;ENSP00000342675:M335I	ENSP00000342675:M335I	M	+	3	0	SEMA4F	74756257	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	1.936000	0.40183	2.333000	0.79357	0.467000	0.42956	ATG		0.512	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
SP140L	93349	broad.mit.edu	37	2	231264877	231264877	+	Silent	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr2:231264877C>T	ENST00000415673.2	+	15	1319	c.1233C>T	c.(1231-1233)gaC>gaT	p.D411D	SP140L_ENST00000243810.6_Silent_p.D411D|SP140L_ENST00000396563.4_Silent_p.D376D|SP140L_ENST00000444636.1_Silent_p.D411D	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	411						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.D411D(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						TGTGCCGGGACGGAGGGGAGC	0.527																																					p.D411D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1233T	2						.						188.0	194.0	192.0					2																	231264877		2072	4228	6300	230973121	SO:0001819	synonymous_variant	93349	exon15			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.1233C>T	2.37:g.231264877C>T			230973121	NM_138402	Q2M375|Q4ZG65|Q9BSP3	Silent	SNP	ENST00000415673.2	37	CCDS46538.1																																																																																				0.527	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402	
C9orf72	203228	broad.mit.edu	37	9	27566891	27566891	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr9:27566891C>G	ENST00000380003.3	-	2	291	c.228G>C	c.(226-228)gaG>gaC	p.E76D	C9orf72_ENST00000488117.1_5'UTR|C9orf72_ENST00000379997.3_Missense_Mutation_p.E76D	NM_001256054.1|NM_018325.3	NP_001242983.1|NP_060795.1	Q96LT7	CI072_HUMAN	chromosome 9 open reading frame 72	76					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular space (GO:0005615)|lysosome (GO:0005764)|nucleus (GO:0005634)	Rab GTPase binding (GO:0017137)	p.E76D(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(4)|pancreas(1)	23		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		TAGCACCACTCTCTGCATTTC	0.393																																					p.E76D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G228C	9						.						100.0	96.0	97.0					9																	27566891		2203	4300	6503	27556891	SO:0001583	missense	203228	exon2			AL832467	CCDS6522.1, CCDS6523.1	9p21.1	2014-09-17			ENSG00000147894	ENSG00000147894			28337	protein-coding gene	gene with protein product		614260				21944778, 24549040	Standard	NM_145005		Approved	MGC23980	uc003zqq.3	Q96LT7	OTTHUMG00000019716	ENST00000380003.3:c.228G>C	9.37:g.27566891C>G	ENSP00000369339:p.Glu76Asp		27556891	NM_018325	A8K5W0|D3DRK6|G8I0B6|Q6NUS9	Missense_Mutation	SNP	ENST00000380003.3	37	CCDS6522.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307577	0.60305	.	.	ENSG00000147894	ENST00000380003;ENST00000379997;ENST00000379995	T;T;T	0.45276	0.9;0.9;0.9	5.99	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.45577	0.1349	N	0.24115	0.695	0.58432	D	0.999998	D;P	0.61697	0.99;0.892	D;P	0.70935	0.971;0.641	T	0.37291	-0.9712	9	.	.	.	.	9.1847	0.37163	0.0:0.7736:0.0:0.2264	.	76;76	Q96LT7-2;Q96LT7	.;CI072_HUMAN	D	76	ENSP00000369339:E76D;ENSP00000369333:E76D;ENSP00000369331:E76D	.	E	-	3	2	C9orf72	27556891	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.033000	0.41136	1.540000	0.49301	0.655000	0.94253	GAG		0.393	C9orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051969.1	NM_018325	
NPR2	4882	broad.mit.edu	37	9	35811508	35811509	+	IGR	DNP	AG	AG	GA	rs28409023		TCGA-AG-4007-01	TCGA-AG-4007-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr9:35811508_35811509AG>GA	ENST00000342694.2	+	0	3686				SPAG8_ENST00000479751.1_5'Flank|TMEM8B_ENST00000377996.1_5'Flank|SPAG8_ENST00000396638.2_Missense_Mutation_p.S179P|SPAG8_ENST00000484764.1_Missense_Mutation_p.S177P|HINT2_ENST00000474908.1_5'Flank|SPAG8_ENST00000340291.2_Missense_Mutation_p.S179P|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.G178>?(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ccaggaccagagccaggaccag	0.644																																					.												.	.	2	Complex(2)	large_intestine(2)	c.534_535TC	9						.																																			35801509	SO:0001628	intergenic_variant	26206	exon2			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	Exception_encountered	9.37:g.35811508_35811509delinsGA			35801508	NM_172312	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	DNP	ENST00000342694.2	37	CCDS6590.1																																																																																				0.644	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
APBA1	320	broad.mit.edu	37	9	72047482	72047482	+	Silent	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr9:72047482G>A	ENST00000265381.4	-	12	2634	c.2412C>T	c.(2410-2412)atC>atT	p.I804I		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	804	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.I804I(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GAATGTGGACGATCTTCTCGT	0.622																																					p.I804I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2412T	9						.						91.0	72.0	78.0					9																	72047482		2203	4300	6503	71237302	SO:0001819	synonymous_variant	320	exon12			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.2412C>T	9.37:g.72047482G>A			71237302	NM_001163	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	37	CCDS6630.1																																																																																				0.622	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
VPS13A	23230	broad.mit.edu	37	9	79929571	79929571	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr9:79929571C>T	ENST00000360280.3	+	37	4663	c.4403C>T	c.(4402-4404)gCa>gTa	p.A1468V	VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000376636.3_Missense_Mutation_p.A1429V|VPS13A_ENST00000357409.5_Missense_Mutation_p.A1468V|VPS13A_ENST00000376634.4_Missense_Mutation_p.A1468V	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1468					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.A1468V(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTCAAGAAAGCAACTCCTCGG	0.299																																					p.A1429V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C4286T	9						.						49.0	52.0	51.0					9																	79929571		2188	4284	6472	79119391	SO:0001583	missense	23230	exon36			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.4403C>T	9.37:g.79929571C>T	ENSP00000353422:p.Ala1468Val		79119391	NM_001018037	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445501	0.43429	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.49139	0.97;0.79;0.88;0.97	5.35	5.35	0.76521	.	0.171825	0.37906	N	0.001882	T	0.41026	0.1141	L	0.45051	1.395	0.80722	D	1	B;B;B;B	0.29766	0.036;0.163;0.256;0.256	B;B;B;B	0.33295	0.09;0.046;0.161;0.161	T	0.18745	-1.0327	10	0.13470	T	0.59	.	14.6651	0.68901	0.1459:0.8541:0.0:0.0	.	1429;1468;1468;1468	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	V	1468;1429;1468;1468	ENSP00000365821:A1468V;ENSP00000365823:A1429V;ENSP00000353422:A1468V;ENSP00000349985:A1468V	ENSP00000349985:A1468V	A	+	2	0	VPS13A	79119391	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.065000	0.64344	2.510000	0.84645	0.557000	0.71058	GCA		0.299	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
VWA8	23078	broad.mit.edu	37	13	42263628	42263628	+	Silent	SNP	T	T	G			TCGA-AG-4007-01	TCGA-AG-4007-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr13:42263628T>G	ENST00000379310.3	-	34	4061	c.3993A>C	c.(3991-3993)atA>atC	p.I1331I	VWA8_ENST00000478987.1_5'UTR	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1331						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.I1331I(1)									TTTTATGAGGTATGCTGAACT	0.358																																					p.I1331I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A3993C	13						.						89.0	80.0	83.0					13																	42263628		1820	4086	5906	41161628	SO:0001819	synonymous_variant	23078	exon34			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.3993A>C	13.37:g.42263628T>G			41161628	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																				0.358	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
PCDH17	27253	broad.mit.edu	37	13	58207746	58207746	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr13:58207746G>A	ENST00000377918.3	+	1	1092	c.1066G>A	c.(1066-1068)Gtg>Atg	p.V356M		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	356	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V356M(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TTTCGTCTCCGTGCGCCAGGG	0.672																																					p.V356M	Melanoma(72;952 1291 1619 12849 33676)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1066A	13						.						49.0	50.0	50.0					13																	58207746		2203	4300	6503	57105747	SO:0001583	missense	27253	exon1			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1066G>A	13.37:g.58207746G>A	ENSP00000367151:p.Val356Met		57105747	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.888282	0.72524	.	.	ENSG00000118946	ENST00000377918	T	0.21543	2.0	5.67	5.67	0.87782	Cadherin (1);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.38427	0.1040	L	0.35854	1.095	0.58432	D	0.999994	D;D	0.89917	0.981;1.0	P;D	0.72625	0.787;0.978	T	0.01771	-1.1277	9	.	.	.	.	19.7768	0.96398	0.0:0.0:1.0:0.0	.	356;356	O14917-2;O14917	.;PCD17_HUMAN	M	356	ENSP00000367151:V356M	.	V	+	1	0	PCDH17	57105747	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.698000	0.92095	0.650000	0.86243	GTG		0.672	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
SLITRK6	84189	broad.mit.edu	37	13	86369420	86369420	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr13:86369420C>A	ENST00000400286.2	-	2	1822	c.1224G>T	c.(1222-1224)atG>atT	p.M408I		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	408					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.M408I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TCGTTAGGTTCATAAACGATC	0.343																																					p.M408I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1224T	13						.						78.0	73.0	74.0					13																	86369420		1848	4092	5940	85267421	SO:0001583	missense	84189	exon2			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1224G>T	13.37:g.86369420C>A	ENSP00000383143:p.Met408Ile		85267421	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	ENST00000400286.2	37	CCDS41903.1	.	.	.	.	.	.	.	.	.	.	C	0.258	-1.001577	0.02128	.	.	ENSG00000184564	ENST00000400286	T	0.57107	0.42	5.61	3.89	0.44902	.	0.158438	0.42682	N	0.000665	T	0.27205	0.0667	N	0.04787	-0.16	0.34758	D	0.732438	B	0.02656	0.0	B	0.04013	0.001	T	0.15350	-1.0440	10	0.34782	T	0.22	-3.2485	6.1342	0.20221	0.1505:0.6926:0.0:0.157	.	408	Q9H5Y7	SLIK6_HUMAN	I	408	ENSP00000383143:M408I	ENSP00000383143:M408I	M	-	3	0	SLITRK6	85267421	0.996000	0.38824	0.998000	0.56505	0.483000	0.33249	0.361000	0.20267	0.733000	0.32492	0.585000	0.79938	ATG		0.343	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
GPC6	10082	broad.mit.edu	37	13	95055269	95055269	+	Splice_Site	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr13:95055269G>A	ENST00000377047.4	+	9	2081	c.1466G>A	c.(1465-1467)aGt>aAt	p.S489N		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	489					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.S489N(1)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				TCCACACTAGGTGATGAATCC	0.502																																					p.S489N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1466A	13						.						153.0	165.0	161.0					13																	95055269		2203	4300	6503	93853270	SO:0001630	splice_region_variant	10082	exon9			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.1466-1G>A	13.37:g.95055269G>A			93853270	NM_005708	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483366	0.63962	.	.	ENSG00000183098	ENST00000377047	T	0.52295	0.67	5.84	5.84	0.93424	.	0.043940	0.85682	D	0.000000	T	0.50871	0.1641	M	0.69248	2.105	0.80722	D	1	B	0.28208	0.203	B	0.28709	0.093	T	0.43065	-0.9414	9	.	.	.	.	20.1432	0.98067	0.0:0.0:1.0:0.0	.	489	Q9Y625	GPC6_HUMAN	N	489	ENSP00000366246:S489N	.	S	+	2	0	GPC6	93853270	1.000000	0.71417	0.934000	0.37439	0.885000	0.51271	7.602000	0.82796	2.769000	0.95229	0.561000	0.74099	AGT		0.502	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	Missense_Mutation
SORCS1	114815	broad.mit.edu	37	10	108431124	108431124	+	Splice_Site	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr10:108431124C>T	ENST00000263054.6	-	16	2067	c.2060G>A	c.(2059-2061)gGg>gAg	p.G687E	SORCS1_ENST00000369698.1_Splice_Site_p.G222E|SORCS1_ENST00000344440.6_Splice_Site_p.G687E	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	687					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)	p.G687E(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ACATGCTTCCCCCTGTAAGCA	0.438																																					p.G687E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2060A	10						.						186.0	164.0	171.0					10																	108431124		2203	4300	6503	108421114	SO:0001630	splice_region_variant	114815	exon16			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.2059-1G>A	10.37:g.108431124C>T			108421114	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	37	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406782	0.83230	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.51071	0.72;0.72;0.72	5.87	5.87	0.94306	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.68421	0.2999	M	0.62209	1.925	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999	T	0.63247	-0.6680	9	.	.	.	-23.8546	20.5827	0.99408	0.0:1.0:0.0:0.0	.	687;687;687;687;687	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	E	222;687;687	ENSP00000358712:G222E;ENSP00000263054:G687E;ENSP00000345964:G687E	.	G	-	2	0	SORCS1	108421114	1.000000	0.71417	1.000000	0.80357	0.577000	0.36160	5.717000	0.68446	2.941000	0.99782	0.655000	0.94253	GGG		0.438	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	Missense_Mutation
CACNB2	783	broad.mit.edu	37	10	18803963	18803963	+	Intron	SNP	G	G	A	rs373932682		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr10:18803963G>A	ENST00000324631.7	+	7	864				CACNB2_ENST00000282343.8_Intron|RP11-499P20.2_ENST00000425669.1_RNA|CACNB2_ENST00000396576.2_Intron|CACNB2_ENST00000377319.3_Intron|CACNB2_ENST00000377331.2_Missense_Mutation_p.R214Q|CACNB2_ENST00000377329.4_Intron|CACNB2_ENST00000377315.4_Intron|CACNB2_ENST00000377328.1_Intron|CACNB2_ENST00000352115.6_Missense_Mutation_p.R242Q	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)	p.R242Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTGTTTTGGCGGTTTACTGTG	0.378																																					p.R214Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G641A	10						.						112.0	108.0	109.0					10																	18803963		2203	4300	6503	18843969	SO:0001627	intron_variant	783	exon7			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.804+665G>A	10.37:g.18803963G>A			18843969	NM_201572	A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Missense_Mutation	SNP	ENST00000324631.7	37	CCDS7125.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.280572	0.23392	.	.	ENSG00000165995	ENST00000352115;ENST00000377331	D;D	0.82526	-1.62;-1.62	5.43	4.52	0.55395	.	.	.	.	.	T	0.56963	0.2021	N	0.00841	-1.15	0.80722	D	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.55444	-0.8140	9	0.42905	T	0.14	.	9.4879	0.38942	0.1763:0.0:0.8237:0.0	.	188;214;242	Q6TME1;A6PVM7;Q08289-8	.;.;.	Q	242;214	ENSP00000344474:R242Q;ENSP00000366548:R214Q	ENSP00000344474:R242Q	R	+	2	0	CACNB2	18843969	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.666000	0.37460	1.426000	0.47256	0.655000	0.94253	CGG		0.378	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047072.2	NM_000724	
NRG3	10718	broad.mit.edu	37	10	84745020	84745020	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr10:84745020G>T	ENST00000404547.1	+	10	1822	c.1822G>T	c.(1822-1824)Gaa>Taa	p.E608*	NRG3_ENST00000404576.2_Nonsense_Mutation_p.E388*|NRG3_ENST00000537893.1_Nonsense_Mutation_p.E234*|NRG3_ENST00000545131.1_Nonsense_Mutation_p.E234*|NRG3_ENST00000556918.1_Nonsense_Mutation_p.E414*|NRG3_ENST00000372141.2_Nonsense_Mutation_p.E584*|NRG3_ENST00000372142.2_Nonsense_Mutation_p.E387*			P56975	NRG3_HUMAN	neuregulin 3	608					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.E584*(1)|p.E387*(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		GGGTTTAGAGGAAACCTGCCT	0.463																																					p.E387X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G1159T	10						.						106.0	110.0	109.0					10																	84745020		2203	4300	6503	84735000	SO:0001587	stop_gained	10718	exon11			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1822G>T	10.37:g.84745020G>T	ENSP00000384796:p.Glu608*		84735000	NM_001165973	A4D7U1|Q0PEH2|Q5VYH3	Nonsense_Mutation	SNP	ENST00000404547.1	37	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049770	0.75846	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	.	.	.	5.95	5.95	0.96441	.	0.135483	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-30.5666	17.8962	0.88888	0.0:0.0:1.0:0.0	.	.	.	.	X	584;608;583;387;388;414;234;234	.	ENSP00000361214:E584X	E	+	1	0	NRG3	84735000	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.668000	0.74457	2.827000	0.97445	0.650000	0.86243	GAA		0.463	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
KIF20B	9585	broad.mit.edu	37	10	91474900	91474900	+	Missense_Mutation	SNP	C	C	T	rs138800578	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr10:91474900C>T	ENST00000371728.3	+	8	966	c.901C>T	c.(901-903)Cgc>Tgc	p.R301C	KIF20B_ENST00000260753.4_Missense_Mutation_p.R301C|KIF20B_ENST00000394289.2_Missense_Mutation_p.R301C|KIF20B_ENST00000416354.1_Missense_Mutation_p.R301C	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	301	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.R301C(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						AAAGATGCTGCGCCTTTCCCA	0.313													C|||	5	0.000998403	0.0	0.0	5008	,	,		15681	0.005		0.0	False		,,,				2504	0.0				p.R301C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C901T	10						.						42.0	46.0	45.0					10																	91474900		2197	4285	6482	91464880	SO:0001583	missense	9585	exon8			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.901C>T	10.37:g.91474900C>T	ENSP00000360793:p.Arg301Cys		91464880	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	22.4	4.288186	0.80803	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.36	5.36	0.76844	Kinesin, motor domain (4);	0.000000	0.47852	D	0.000208	D	0.84538	0.5494	M	0.81942	2.565	0.80722	D	1	D;P	0.89917	1.0;0.783	D;P	0.91635	0.999;0.661	D	0.87388	0.2361	10	0.87932	D	0	-3.9588	14.3059	0.66384	0.1485:0.8515:0.0:0.0	.	301;301	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	C	301	ENSP00000260753:R301C;ENSP00000411545:R301C;ENSP00000377830:R301C;ENSP00000360793:R301C	ENSP00000260753:R301C	R	+	1	0	KIF20B	91464880	0.999000	0.42202	0.960000	0.40013	0.995000	0.86356	4.304000	0.59104	2.674000	0.91012	0.650000	0.86243	CGC		0.313	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
LCOR	84458	broad.mit.edu	37	10	98715591	98715591	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr10:98715591G>T	ENST00000371097.4	+	8	1760	c.1214G>T	c.(1213-1215)aGg>aTg	p.R405M	LCOR_ENST00000540664.1_Splice_Site_p.S405I|LCOR_ENST00000371103.3_Missense_Mutation_p.R405M|LCOR_ENST00000498444.1_Intron|LCOR_ENST00000356016.3_Missense_Mutation_p.R405M			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	405					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R405M(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		AAATTAATGAGGTCGGAGGGG	0.423																																					p.R405M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1214T	10						.						43.0	46.0	45.0					10																	98715591		2203	4300	6503	98705581	SO:0001583	missense	84458	exon8				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.1214G>T	10.37:g.98715591G>T	ENSP00000360138:p.Arg405Met		98705581	NM_032440	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	ENST00000371097.4	37	CCDS7451.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.39|13.39	2.224355|2.224355	0.39300|0.39300	.|.	.|.	ENSG00000196233|ENSG00000196233	ENST00000371103;ENST00000371097;ENST00000356016|ENST00000540664	.|.	.|.	.|.	5.52|5.52	5.52|5.52	0.82312|0.82312	Homeodomain-like (1);|.	0.075176|.	0.64402|.	D|.	0.000001|.	T|T	0.29684|0.29684	0.0741|0.0741	N|N	0.14661|0.14661	0.345|0.345	0.27937|0.27937	N|N	0.937664|0.937664	P|B	0.47350|0.20368	0.894|0.044	B|B	0.44044|0.17433	0.439|0.018	T|T	0.19063|0.19063	-1.0317|-1.0317	9|8	0.66056|0.87932	D|D	0.02|0	-0.0971|-0.0971	13.0708|13.0708	0.59059|0.59059	0.0736:0.0:0.9264:0.0|0.0736:0.0:0.9264:0.0	.|.	405|405	Q96JN0|Q96JN0-2	LCOR_HUMAN|.	M|I	405|405	.|.	ENSP00000348298:R405M|ENSP00000443431:S405I	R|S	+|+	2|2	0|0	LCOR|LCOR	98705581|98705581	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	4.883000|4.883000	0.63128|0.63128	2.759000|2.759000	0.94783|0.94783	0.555000|0.555000	0.69702|0.69702	AGG|AGT		0.423	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2		
TCF7L2	6934	broad.mit.edu	37	10	114920390	114920390	+	Intron	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr10:114920390C>A	ENST00000355995.4	+	14	1949				TCF7L2_ENST00000355717.4_Intron|TCF7L2_ENST00000369386.1_Silent_p.S111S|TCF7L2_ENST00000466338.1_Intron|TCF7L2_ENST00000534894.1_Silent_p.S485S|TCF7L2_ENST00000543371.1_Missense_Mutation_p.P444Q|TCF7L2_ENST00000369397.4_Intron|TCF7L2_ENST00000369389.1_Intron|TCF7L2_ENST00000536810.1_Intron|TCF7L2_ENST00000352065.5_Intron|TCF7L2_ENST00000545257.1_Missense_Mutation_p.P461Q|TCF7L2_ENST00000542695.1_Intron|TCF7L2_ENST00000538897.1_Intron			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)						blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P444Q(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GCAAATACTCCAAAGAAGTGT	0.448			T	VTI1A	colorectal																																p.P421Q			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1262A	10						.						85.0	71.0	76.0					10																	114920390		1568	3582	5150	114910380	SO:0001627	intron_variant	6934	exon12			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1442+639C>A	10.37:g.114920390C>A			114910380	NM_001198526	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	C	18.18	3.566503	0.65651	.	.	ENSG00000148737	ENST00000545257;ENST00000543371	D;D	0.98633	-4.94;-5.04	5.15	5.15	0.70609	.	.	.	.	.	D	0.97692	0.9243	.	.	.	0.80722	D	1	B;P;B;B	0.47841	0.23;0.901;0.23;0.202	B;P;B;B	0.45474	0.138;0.482;0.05;0.153	D	0.97439	1.0020	8	0.30854	T	0.27	.	18.9807	0.92754	0.0:1.0:0.0:0.0	.	461;376;421;444	Q9NQB0;C6ZRJ6;C6ZRJ8;Q9NQB0-7	TF7L2_HUMAN;.;.;.	Q	461;444	ENSP00000440547:P461Q;ENSP00000444972:P444Q	ENSP00000444972:P444Q	P	+	2	0	TCF7L2	114910380	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.305000	0.78891	2.549000	0.85964	0.655000	0.94253	CCA		0.448	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
ST8SIA4	7903	broad.mit.edu	37	5	100191810	100191810	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:100191810C>T	ENST00000231461.5	-	4	1104	c.794G>A	c.(793-795)aGa>aAa	p.R265K		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	265					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.R265K(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		CACTTACCCTCTGACAGCATG	0.413																																					p.R265K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G794A	5						.						101.0	90.0	94.0					5																	100191810		2203	4300	6503	100219709	SO:0001583	missense	7903	exon4			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.794G>A	5.37:g.100191810C>T	ENSP00000231461:p.Arg265Lys		100219709	NM_005668	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	37	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.974224	0.74246	.	.	ENSG00000113532	ENST00000231461	T	0.30714	1.52	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.26304	0.0642	L	0.45422	1.42	0.80722	D	1	B	0.23735	0.09	B	0.23852	0.049	T	0.08086	-1.0739	10	0.05620	T	0.96	.	18.1509	0.89674	0.0:1.0:0.0:0.0	.	265	Q92187	SIA8D_HUMAN	K	265	ENSP00000231461:R265K	ENSP00000231461:R265K	R	-	2	0	ST8SIA4	100219709	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.619000	0.83057	2.751000	0.94390	0.591000	0.81541	AGA		0.413	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
APC	324	broad.mit.edu	37	5	112175198	112175198	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:112175198C>T	ENST00000457016.1	+	16	4287	c.3907C>T	c.(3907-3909)Caa>Taa	p.Q1303*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.Q1303*|APC_ENST00000257430.4_Nonsense_Mutation_p.Q1303*			P25054	APC_HUMAN	adenomatous polyposis coli	1303	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.Q1303*(15)|p.T1301fs*10(3)|p.L1302fs*11(2)|p.?(1)|p.Q1303fs*12(1)|p.T1293fs*2(1)|p.K1192fs*3(1)|p.I1304fs*14(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TAATACCCTGCAAATAGCAGA	0.408		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.Q1285X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,colon,Substitution - Nonsense,0	.	25	Substitution - Nonsense(15)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Unknown(1)	large_intestine(23)|soft_tissue(1)|skin(1)	c.C3853T	5	GRCh37	CM994441	APC	M		.						52.0	54.0	53.0					5																	112175198		2202	4300	6502	112203097	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3907C>T	5.37:g.112175198C>T	ENSP00000413133:p.Gln1303*		112203097	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	C	37	6.579943	0.97680	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	5.73	4.84	0.62591	.	0.317892	0.34986	N	0.003538	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.4727	14.3231	0.66499	0.2698:0.7302:0.0:0.0	.	.	.	.	X	1303	.	.	Q	+	1	0	APC	112203097	1.000000	0.71417	0.993000	0.49108	0.822000	0.46500	4.360000	0.59455	1.515000	0.48885	0.655000	0.94253	CAA		0.408	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
APC	324	broad.mit.edu	37	5	112175426	112175426	+	Nonsense_Mutation	SNP	G	G	T	rs121913326		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:112175426G>T	ENST00000457016.1	+	16	4515	c.4135G>T	c.(4135-4137)Gag>Tag	p.E1379*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Nonsense_Mutation_p.E1379*|APC_ENST00000257430.4_Nonsense_Mutation_p.E1379*			P25054	APC_HUMAN	adenomatous polyposis coli	1379	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1379*(21)|p.Y1376fs*41(1)|p.?(1)|p.Q1378fs*5(1)|p.K1192fs*3(1)|p.Y1376fs*5(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTATGTTCAGGAGACCCCACT	0.473		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1361X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0	.	26	Substitution - Nonsense(21)|Deletion - Frameshift(4)|Unknown(1)	large_intestine(24)|soft_tissue(1)|skin(1)	c.G4081T	5						.						94.0	89.0	91.0					5																	112175426		2202	4300	6502	112203325	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4135G>T	5.37:g.112175426G>T	ENSP00000413133:p.Glu1379*		112203325	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	41	9.025348	0.99040	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	.	.	.	6.17	6.17	0.99709	.	0.047393	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-17.4605	20.4898	0.99202	0.0:0.0:1.0:0.0	.	.	.	.	X	1379	.	.	E	+	1	0	APC	112203325	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GAG		0.473	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PAIP2	51247	broad.mit.edu	37	5	138700309	138700309	+	Silent	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:138700309G>A	ENST00000394795.2	+	3	1186	c.195G>A	c.(193-195)ctG>ctA	p.L65L	PAIP2_ENST00000265192.4_Silent_p.L65L|PAIP2_ENST00000511706.1_Intron|PAIP2_ENST00000510080.1_Silent_p.L65L|CTB-43P18.1_ENST00000503553.3_RNA|PAIP2_ENST00000511381.1_3'UTR			Q9BPZ3	PAIP2_HUMAN	poly(A) binding protein interacting protein 2	65	Glu-rich.|PABPC1-interacting motif-1 (PAM1).				memory (GO:0007613)|negative regulation of translational initiation (GO:0045947)|regulation of long-term synaptic potentiation (GO:1900271)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mRNA binding (GO:0003729)|translation repressor activity (GO:0030371)	p.L65L(1)		kidney(1)|large_intestine(2)|lung(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AAGAAATGCTGGAAGAGGAAG	0.368																																					p.L65L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G195A	5						.						100.0	93.0	95.0					5																	138700309		2203	4300	6503	138728208	SO:0001819	synonymous_variant	51247	exon3			AF151052	CCDS4211.1	5q32	2008-02-05			ENSG00000120727	ENSG00000120727			17970	protein-coding gene	gene with protein product		605604				11172725, 16804161	Standard	NM_016480		Approved	PAIP2A	uc003led.3	Q9BPZ3	OTTHUMG00000129227	ENST00000394795.2:c.195G>A	5.37:g.138700309G>A			138728208	NM_001033112	B2RBI1|D3DQC6|Q49A06|Q9H0Y5|Q9P0Q8	Silent	SNP	ENST00000394795.2	37	CCDS4211.1																																																																																				0.368	PAIP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373002.1	NM_016480	
PSD2	84249	broad.mit.edu	37	5	139219669	139219669	+	Missense_Mutation	SNP	G	G	A	rs549742335		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:139219669G>A	ENST00000274710.3	+	14	2231	c.2026G>A	c.(2026-2028)Gaa>Aaa	p.E676K		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	676					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.E676K(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGCTGGCCGAACACAGGTG	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		20605	0.001		0.0	False		,,,				2504	0.0				p.E676K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2026A	5						.						115.0	104.0	108.0					5																	139219669		2203	4300	6503	139199853	SO:0001583	missense	84249	exon14			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.2026G>A	5.37:g.139219669G>A	ENSP00000274710:p.Glu676Lys		139199853	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411924	0.83340	.	.	ENSG00000146005	ENST00000274710	T	0.14266	2.52	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.25791	0.0628	M	0.84948	2.725	0.80722	D	1	P	0.51653	0.947	B	0.41412	0.356	T	0.37842	-0.9688	10	0.87932	D	0	.	18.5248	0.90968	0.0:0.0:1.0:0.0	.	676	Q9BQI7	PSD2_HUMAN	K	676	ENSP00000274710:E676K	ENSP00000274710:E676K	E	+	1	0	PSD2	139199853	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	7.700000	0.84556	2.455000	0.83008	0.555000	0.69702	GAA		0.567	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PCDHB3	56132	broad.mit.edu	37	5	140481975	140481975	+	Missense_Mutation	SNP	A	A	C	rs541148618	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:140481975A>C	ENST00000231130.2	+	1	1742	c.1742A>C	c.(1741-1743)gAg>gCg	p.E581A	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	581	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.E581A(1)		NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGGCGGCTGAGCCGGGCTAC	0.711																																					p.E581A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1742C	5						.						19.0	24.0	22.0					5																	140481975		2175	4212	6387	140462159	SO:0001583	missense	56132	exon1			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1742A>C	5.37:g.140481975A>C	ENSP00000231130:p.Glu581Ala		140462159	NM_018937	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	37	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.441848	0.63067	.	.	ENSG00000113205	ENST00000231130	T	0.50813	0.73	4.24	4.24	0.50183	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.56217	0.1970	L	0.48986	1.54	0.20196	N	0.999925	P	0.49559	0.925	P	0.56648	0.803	T	0.47686	-0.9098	9	0.87932	D	0	.	10.4481	0.44505	0.8369:0.1631:0.0:0.0	.	581	Q9Y5E6	PCDB3_HUMAN	A	581	ENSP00000231130:E581A	ENSP00000231130:E581A	E	+	2	0	PCDHB3	140462159	0.005000	0.15991	0.989000	0.46669	0.899000	0.52679	2.119000	0.41958	1.689000	0.51079	0.454000	0.30748	GAG		0.711	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB6	56130	broad.mit.edu	37	5	140531988	140531988	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-4007-01	TCGA-AG-4007-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:140531988C>A	ENST00000231136.1	+	1	2150	c.2150C>A	c.(2149-2151)gCg>gAg	p.A717E	PCDHB6_ENST00000543635.1_Missense_Mutation_p.A581E	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	717					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A717E(1)		cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGAGCAGGGCGGCCTCGGTG	0.652																																					p.A717E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2150A	5						.						77.0	91.0	86.0					5																	140531988		2202	4300	6502	140512172	SO:0001583	missense	56130	exon1			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2150C>A	5.37:g.140531988C>A	ENSP00000231136:p.Ala717Glu		140512172	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	37	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.408269	0.25378	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.17054	2.3;2.3	4.45	0.753	0.18404	.	.	.	.	.	T	0.16938	0.0407	L	0.58302	1.8	0.09310	N	1	B	0.17667	0.023	B	0.18263	0.021	T	0.23440	-1.0188	9	0.49607	T	0.09	.	7.7172	0.28710	0.2384:0.5394:0.2222:0.0	.	717	Q9Y5E3	PCDB6_HUMAN	E	581;717	ENSP00000438466:A581E;ENSP00000231136:A717E	ENSP00000231136:A717E	A	+	2	0	PCDHB6	140512172	0.003000	0.15002	0.001000	0.08648	0.204000	0.24138	0.351000	0.20096	0.382000	0.24878	0.556000	0.70494	GCG		0.652	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHGA11	56105	broad.mit.edu	37	5	140802769	140802769	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:140802769G>A	ENST00000398587.2	+	1	2008	c.1975G>A	c.(1975-1977)Gtc>Atc	p.V659I	PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	659	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V659I(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGGCCACCGTCACGCTCAC	0.672																																					p.V659I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1975A	5						.						34.0	42.0	40.0					5																	140802769		2202	4297	6499	140782953	SO:0001583	missense	56105	exon1			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1975G>A	5.37:g.140802769G>A	ENSP00000381589:p.Val659Ile		140782953	NM_018914	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	g	15.20	2.763662	0.49574	.	.	ENSG00000253873	ENST00000398587	T	0.52983	0.64	5.33	3.53	0.40419	Cadherin (4);Cadherin-like (1);	0.474182	0.12845	U	0.434472	T	0.53094	0.1775	M	0.69823	2.125	0.80722	D	1	P;P	0.40875	0.731;0.538	P;B	0.45232	0.474;0.12	T	0.54543	-0.8278	10	0.54805	T	0.06	.	10.3526	0.43945	0.2135:0.0:0.7865:0.0	.	659;659	Q9Y5H2;Q9Y5H2-2	PCDGB_HUMAN;.	I	659	ENSP00000381589:V659I	ENSP00000381589:V659I	V	+	1	0	PCDHGA11	140782953	0.483000	0.25956	0.097000	0.21041	0.868000	0.49771	3.305000	0.51873	1.272000	0.44329	0.556000	0.70494	GTC		0.672	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
CCNJL	79616	broad.mit.edu	37	5	159682576	159682576	+	Silent	SNP	C	C	T	rs544092120	byFrequency	TCGA-AG-4007-01	TCGA-AG-4007-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:159682576C>T	ENST00000393977.3	-	6	1152	c.867G>A	c.(865-867)acG>acA	p.T289T	CCNJL_ENST00000257536.7_Silent_p.T241T|CCNJL_ENST00000541762.1_Silent_p.T240T|CCNJL_ENST00000377503.2_5'UTR|CCNJL_ENST00000519673.1_Silent_p.T241T	NM_024565.5	NP_078841.3	Q8IV13	CCNJL_HUMAN	cyclin J-like	289						nucleus (GO:0005634)		p.T289T(3)		endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTTCAATACACGTGCTGAGGT	0.552													C|||	2	0.000399361	0.0015	0.0	5008	,	,		16431	0.0		0.0	False		,,,				2504	0.0				p.T289T												.	.	3	Substitution - coding silent(3)	large_intestine(1)|endometrium(1)|kidney(1)	c.G867A	5						.						179.0	179.0	179.0					5																	159682576		1903	4138	6041	159615154	SO:0001819	synonymous_variant	79616	exon6			BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000393977.3:c.867G>A	5.37:g.159682576C>T			159615154	NM_024565	Q6ZN43|Q9H7W8	Silent	SNP	ENST00000393977.3	37	CCDS4350.2																																																																																				0.552	CCNJL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252674.1	NM_024565	
ADCY2	108	broad.mit.edu	37	5	7802364	7802364	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-4007-01	TCGA-AG-4007-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:7802364G>A	ENST00000338316.4	+	21	2751	c.2662G>A	c.(2662-2664)Gtc>Atc	p.V888I	ADCY2_ENST00000537121.1_Missense_Mutation_p.V708I	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	888					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.V888I(3)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CTGCGTCTGCGTCATGTTTGC	0.488																																					p.V888I												.	.	3	Substitution - Missense(3)	ovary(2)|large_intestine(1)	c.G2662A	5						.						82.0	78.0	79.0					5																	7802364		2203	4300	6503	7855364	SO:0001583	missense	108	exon21			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2662G>A	5.37:g.7802364G>A	ENSP00000342952:p.Val888Ile		7855364	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	31	5.078655	0.94050	.	.	ENSG00000078295	ENST00000338316;ENST00000382532;ENST00000541993;ENST00000537121	T;T	0.80653	-1.4;-1.4	5.24	5.24	0.73138	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.87613	0.6221	L	0.52126	1.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.87987	0.2747	10	0.56958	D	0.05	.	18.8415	0.92186	0.0:0.0:1.0:0.0	.	708;888	B7Z2C1;Q08462	.;ADCY2_HUMAN	I	888;41;721;708	ENSP00000342952:V888I;ENSP00000444803:V708I	ENSP00000342952:V888I	V	+	1	0	ADCY2	7855364	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.506000	0.97992	2.447000	0.82792	0.591000	0.81541	GTC		0.488	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADAMTS2	9509	broad.mit.edu	37	5	178585754	178585754	+	Missense_Mutation	SNP	G	G	A	rs371384169		TCGA-AG-4007-01	TCGA-AG-4007-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-4007-01	TCGA-AG-4007-01	g.chr5:178585754G>A	ENST00000251582.7	-	6	1203	c.1102C>T	c.(1102-1104)Cgg>Tgg	p.R368W	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.R368W	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	368	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R368W(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AAGTCCTGCCGTGTGAGGAAG	0.627																																					p.R368W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1102T	5						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	156.0	135.0	142.0		1102,1102	2.6	0.9	5		142	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADAMTS2	NM_014244.4,NM_021599.2	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	368/1212,368/567	178585754	1,13005	2203	4300	6503	178518360	SO:0001583	missense	9509	exon6			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1102C>T	5.37:g.178585754G>A	ENSP00000251582:p.Arg368Trp		178518360	NM_021599		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590408	0.66219	0.0	1.16E-4	ENSG00000087116	ENST00000251582;ENST00000274609	D;D	0.87491	-2.26;-2.26	5.73	2.61	0.31194	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.51477	D	0.000087	D	0.94653	0.8276	M	0.93854	3.465	0.42100	D	0.991334	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.95601	0.8663	10	0.87932	D	0	.	14.1394	0.65311	0.0:0.0:0.4888:0.5112	.	368;368	O95450-2;O95450	.;ATS2_HUMAN	W	368	ENSP00000251582:R368W;ENSP00000274609:R368W	ENSP00000251582:R368W	R	-	1	2	ADAMTS2	178518360	0.665000	0.27466	0.932000	0.37286	0.991000	0.79684	0.944000	0.29043	0.733000	0.32492	0.650000	0.86243	CGG		0.627	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
