#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
STS	412	broad.mit.edu	37	X	7177635	7177636	+	Frame_Shift_Ins	INS	-	-	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chrX:7177635_7177636insT	ENST00000217961.4	+	5	863_864	c.643_644insT	c.(643-645)gttfs	p.V215fs		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	215					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)	p.V215I(1)		NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	GCCTCTAGGCGTTTTTTTCAGC	0.54									Ichthyosis																												p.V215fs												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.643_644insT	X						.																																			7187636	SO:0001589	frameshift_variant	412	exon5	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.650dupT	X.37:g.7177642_7177642dupT	ENSP00000217961:p.Val215fs		7187635	NM_000351	B2RA47	Frame_Shift_Ins	INS	ENST00000217961.4	37	CCDS14127.1																																																																																				0.540	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
MACC1	346389	broad.mit.edu	37	7	20199081	20199081	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr7:20199081G>C	ENST00000400331.5	-	5	1211	c.903C>G	c.(901-903)ttC>ttG	p.F301L	MACC1_ENST00000589011.1_Missense_Mutation_p.F301L|MACC1_ENST00000332878.4_Missense_Mutation_p.F301L	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	301					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.F301L(1)		endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TGACTTGGCTGAAAGGATCCT	0.418																																					p.F301L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C903G	7						.						60.0	58.0	58.0					7																	20199081		2203	4300	6503	20165606	SO:0001583	missense	346389	exon5				CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.903C>G	7.37:g.20199081G>C	ENSP00000383185:p.Phe301Leu		20165606	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	37	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	G	8.423	0.846822	0.17034	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.08634	3.07;3.07	5.47	2.15	0.27550	.	0.638880	0.17736	N	0.163738	T	0.05273	0.0140	N	0.21583	0.68	0.26618	N	0.972717	B	0.02656	0.0	B	0.04013	0.001	T	0.40794	-0.9544	10	0.18710	T	0.47	-4.8921	8.5006	0.33156	0.2081:0.1268:0.6651:0.0	.	301	Q6ZN28	MACC1_HUMAN	L	301	ENSP00000383185:F301L;ENSP00000328410:F301L	ENSP00000328410:F301L	F	-	3	2	MACC1	20165606	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.931000	0.28871	0.652000	0.30806	0.585000	0.79938	TTC		0.418	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
CYP3A7	1551	broad.mit.edu	37	7	99315163	99315163	+	Missense_Mutation	SNP	C	C	T	rs139250712	byFrequency	TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr7:99315163C>T	ENST00000336374.2	-	5	420	c.418G>A	c.(418-420)Gga>Aga	p.G140R		NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	140					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.G140R(1)		autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	TTGAGTTTTCCGCTGGTGAAT	0.408													C|||	3	0.000599042	0.0	0.0	5008	,	,		20102	0.0		0.0	False		,,,				2504	0.0031				p.G140R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G418A	7						.	C	ARG/GLY	2,4404	4.2+/-10.8	0,2,2201	93.0	83.0	87.0		418	4.0	1.0	7	dbSNP_134	87	0,8600		0,0,4300	no	missense	CYP3A7	NM_000765.3	125	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	140/504	99315163	2,13004	2203	4300	6503	99153099	SO:0001583	missense	1551	exon5			AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.418G>A	7.37:g.99315163C>T	ENSP00000337450:p.Gly140Arg		99153099	NM_000765	A4D288|Q9H241	Missense_Mutation	SNP	ENST00000336374.2	37	CCDS5673.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929871	0.52759	4.54E-4	0.0	ENSG00000160870	ENST00000292414;ENST00000336374	T	0.68765	-0.35	3.98	3.98	0.46160	.	0.000000	0.85682	D	0.000000	D	0.84488	0.5483	M	0.93898	3.47	0.58432	D	0.999998	D	0.71674	0.998	D	0.65773	0.938	D	0.88940	0.3379	10	0.87932	D	0	.	13.8757	0.63651	0.0:1.0:0.0:0.0	.	140	P24462	CP3A7_HUMAN	R	140	ENSP00000337450:G140R	ENSP00000292414:G140R	G	-	1	0	CYP3A7	99153099	1.000000	0.71417	0.996000	0.52242	0.072000	0.16883	7.369000	0.79578	1.901000	0.55032	0.462000	0.41574	GGA		0.408	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345484.1		
BPIFB4	149954	broad.mit.edu	37	20	31670792	31670792	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr20:31670792G>A	ENST00000375483.3	+	2	155	c.155G>A	c.(154-156)aGa>aAa	p.R52K		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	52						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)	p.R13K(1)									TCGGCCCTGAGAGAGGTGCCC	0.607																																					p.R52K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G155A	20						.						109.0	95.0	99.0					20																	31670792		2203	4300	6503	31134453	SO:0001583	missense	149954	exon2			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.155G>A	20.37:g.31670792G>A	ENSP00000364632:p.Arg52Lys		31134453	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	37	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	g	11.33	1.607313	0.28623	.	.	ENSG00000186191	ENST00000375483	T	0.01015	5.44	3.41	3.41	0.39046	.	0.000000	0.33732	U	0.004601	T	0.01800	0.0057	L	0.29908	0.895	0.22435	N	0.999102	P	0.44690	0.841	P	0.54210	0.745	T	0.46219	-0.9207	10	0.87932	D	0	-8.2401	10.1934	0.43041	0.0:0.0:1.0:0.0	.	52	P59827	BPIB4_HUMAN	K	52	ENSP00000364632:R52K	ENSP00000364632:R52K	R	+	2	0	BPIFB4	31134453	1.000000	0.71417	0.999000	0.59377	0.425000	0.31504	2.477000	0.45180	1.729000	0.51567	0.306000	0.20318	AGA		0.607	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
CSE1L	1434	broad.mit.edu	37	20	47682749	47682749	+	Silent	SNP	A	A	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr20:47682749A>G	ENST00000262982.2	+	4	372	c.249A>G	c.(247-249)aaA>aaG	p.K83K	CSE1L_ENST00000542325.1_Intron|CSE1L_ENST00000396192.3_Silent_p.K83K	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	83	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)	p.K83K(1)		breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AACCAAACAAAATTTGTGAAG	0.398																																					p.K83K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A249G	20						.						81.0	76.0	78.0					20																	47682749		2203	4300	6503	47116156	SO:0001819	synonymous_variant	1434	exon4			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.249A>G	20.37:g.47682749A>G			47116156	NM_001316	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	ENST00000262982.2	37	CCDS13412.1																																																																																				0.398	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080345.2	NM_001316	
KCNB1	3745	broad.mit.edu	37	20	47990218	47990218	+	Missense_Mutation	SNP	G	G	A	rs554351105		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr20:47990218G>A	ENST00000371741.4	-	2	2045	c.1879C>T	c.(1879-1881)Cgg>Tgg	p.R627W		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	627					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)	p.R627W(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	AGAGCTCCCCGCCAGCCCACT	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15901	0.0		0.0	False		,,,				2504	0.0				p.R627W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1879T	20						.						30.0	32.0	31.0					20																	47990218		2203	4300	6503	47423625	SO:0001583	missense	3745	exon2			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1879C>T	20.37:g.47990218G>A	ENSP00000360806:p.Arg627Trp		47423625	NM_004975	Q14193	Missense_Mutation	SNP	ENST00000371741.4	37	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.660566	0.47572	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.23950	1.88	5.7	3.68	0.42216	.	1.383220	0.04370	N	0.358880	T	0.37156	0.0993	L	0.43152	1.355	0.34369	D	0.691791	D	0.56968	0.978	P	0.49301	0.606	T	0.37709	-0.9694	10	0.72032	D	0.01	.	14.4842	0.67606	0.0:0.0:0.591:0.409	.	627	Q14721	KCNB1_HUMAN	W	627;582	ENSP00000360806:R627W	ENSP00000360806:R627W	R	-	1	2	KCNB1	47423625	0.329000	0.24696	1.000000	0.80357	0.915000	0.54546	0.798000	0.27014	1.410000	0.46936	-0.152000	0.13540	CGG		0.612	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
PHACTR3	116154	broad.mit.edu	37	20	58416497	58416497	+	Silent	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr20:58416497G>A	ENST00000371015.1	+	11	1961	c.1494G>A	c.(1492-1494)ctG>ctA	p.L498L	PHACTR3_ENST00000395639.4_Silent_p.L387L|PHACTR3_ENST00000361300.4_Silent_p.L387L|PHACTR3_ENST00000359926.3_Silent_p.L495L|PHACTR3_ENST00000355648.4_Silent_p.L457L|PHACTR3_ENST00000395636.2_Silent_p.L457L|PHACTR3_ENST00000541461.1_Silent_p.L457L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	498	Required for PP1CA binding and inhibition of PP1 activity.					nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.L498L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GAAAAATTCTGATACGATTCA	0.403																																					p.L498L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1494A	20						.						90.0	85.0	87.0					20																	58416497		2203	4300	6503	57849892	SO:0001819	synonymous_variant	116154	exon11			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.1494G>A	20.37:g.58416497G>A			57849892	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Silent	SNP	ENST00000371015.1	37	CCDS13480.1																																																																																				0.403	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
NAA30	122830	broad.mit.edu	37	14	57876139	57876139	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr14:57876139C>G	ENST00000556492.1	+	5	1148	c.994C>G	c.(994-996)Ctt>Gtt	p.L332V	NAA30_ENST00000554703.1_3'UTR|NAA30_ENST00000555166.1_Missense_Mutation_p.L74V	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	332	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)	p.L332V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						CGCTTTGAAACTTTATGAAAA	0.313																																					p.L332V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C994G	14						.						78.0	75.0	76.0					14																	57876139		2203	4300	6503	56945892	SO:0001583	missense	122830	exon5			AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.994C>G	14.37:g.57876139C>G	ENSP00000452521:p.Leu332Val		56945892	NM_001011713	Q0IIN2	Missense_Mutation	SNP	ENST00000556492.1	37	CCDS32088.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.10|17.10	3.303408|3.303408	0.60195|0.60195	.|.	.|.	ENSG00000139977|ENSG00000139977	ENST00000555166;ENST00000556492;ENST00000395257|ENST00000298406	T;T|.	0.28454|.	1.61;1.61|.	5.04|5.04	5.04|5.04	0.67666|0.67666	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83353|0.83353	0.5236|0.5236	M|M	0.87038|0.87038	2.855|2.855	0.80722|0.80722	D|D	1|1	D|.	0.60160|.	0.987|.	D|.	0.67900|.	0.954|.	D|D	0.85792|0.85792	0.1368|0.1368	10|5	0.87932|.	D|.	0|.	-3.9384|-3.9384	18.7312|18.7312	0.91735|0.91735	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	332|.	Q147X3|.	NAA30_HUMAN|.	V|K	74;332;295|143	ENSP00000450939:L74V;ENSP00000452521:L332V|.	ENSP00000298406:L332V|.	L|N	+|+	1|3	0|2	NAA30|NAA30	56945892|56945892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.591000|5.591000	0.67536|0.67536	2.486000|2.486000	0.83907|0.83907	0.555000|0.555000	0.69702|0.69702	CTT|AAC		0.313	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412925.1	NM_001011713	
CRYBB2	1415	broad.mit.edu	37	22	25625450	25625450	+	Silent	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr22:25625450C>T	ENST00000398215.2	+	5	525	c.354C>T	c.(352-354)acC>acT	p.T118T		NM_000496.2	NP_000487.1	P43320	CRBB2_HUMAN	crystallin, beta B2	118	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		identical protein binding (GO:0042802)|structural constituent of eye lens (GO:0005212)|structural molecule activity (GO:0005198)	p.T118T(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	10						CCAACTTCACCGGGAAGAAGA	0.547																																					p.T118T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C354T	22						.						43.0	33.0	37.0					22																	25625450		2201	4279	6480	23955450	SO:0001819	synonymous_variant	1415	exon5				CCDS13831.1	22q11.23	2008-06-10			ENSG00000244752	ENSG00000244752			2398	protein-coding gene	gene with protein product		123620		CCA2, CRYB2A, CRYB2		9158139, 8224918	Standard	XM_006724141		Approved		uc003abp.1	P43320	OTTHUMG00000150905	ENST00000398215.2:c.354C>T	22.37:g.25625450C>T			23955450	NM_000496	Q9UCM8	Silent	SNP	ENST00000398215.2	37	CCDS13831.1																																																																																				0.547	CRYBB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320350.1	NM_000496	
EFCAB6	64800	broad.mit.edu	37	22	43950938	43950938	+	Silent	SNP	C	C	T	rs142712637		TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr22:43950938C>T	ENST00000262726.7	-	27	3712	c.3459G>A	c.(3457-3459)ccG>ccA	p.P1153P	EFCAB6_ENST00000461800.1_5'UTR|EFCAB6_ENST00000396231.2_Silent_p.P1001P	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.P1153P(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				AGGTAGGCGGCGGGCCTTTGG	0.527																																					p.P1001P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3003A	22						.	C	,	1,4405	2.1+/-5.4	0,1,2202	74.0	69.0	71.0		3459,3003	-9.8	0.0	22	dbSNP_134	71	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	EFCAB6	NM_022785.3,NM_198856.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	1153/1502,1001/1350	43950938	1,13005	2203	4300	6503	42282271	SO:0001819	synonymous_variant	64800	exon25			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3459G>A	22.37:g.43950938C>T			42282271	NM_198856	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Silent	SNP	ENST00000262726.7	37	CCDS14049.1																																																																																				0.527	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
FCGBP	8857	broad.mit.edu	37	19	40433293	40433293	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr19:40433293C>A	ENST00000221347.6	-	2	983	c.976G>T	c.(976-978)Gaa>Taa	p.E326*		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	326	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)		p.E326*(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TAAGTCACTTCATTCCTTATG	0.562																																					p.E326X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G976T	19						.						59.0	57.0	58.0					19																	40433293		2203	4300	6503	45125133	SO:0001587	stop_gained	8857	exon2			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.976G>T	19.37:g.40433293C>A	ENSP00000221347:p.Glu326*		45125133	NM_003890	O95784	Nonsense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	13.00	2.107475	0.37145	.	.	ENSG00000090920	ENST00000221347	.	.	.	4.36	-6.28	0.02020	.	1.918070	0.02669	N	0.108397	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	3.0838	0.06271	0.0995:0.1575:0.3074:0.4355	.	.	.	.	X	326	.	ENSP00000221347:E326X	E	-	1	0	FCGBP	45125133	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.828000	0.00745	-1.081000	0.03105	-0.727000	0.03589	GAA		0.562	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
XRCC1	7515	broad.mit.edu	37	19	44051065	44051065	+	Missense_Mutation	SNP	C	C	T	rs371113463		TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr19:44051065C>T	ENST00000262887.5	-	11	1811	c.1264G>A	c.(1264-1266)Gga>Aga	p.G422R	XRCC1_ENST00000543982.1_Missense_Mutation_p.G391R			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	422					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)	p.G422R(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				GCTTCATCTCCGCTGCCACCG	0.612								Other BER factors																													p.G422R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1264A	19						.	C	ARG/GLY	0,4406		0,0,2203	63.0	61.0	62.0		1264	5.2	0.1	19		62	1,8599	1.2+/-3.3	0,1,4299	no	missense	XRCC1	NM_006297.2	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	422/634	44051065	1,13005	2203	4300	6503	48742905	SO:0001583	missense	7515	exon11			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1264G>A	19.37:g.44051065C>T	ENSP00000262887:p.Gly422Arg		48742905	NM_006297	Q6IBS4|Q9HCB1	Missense_Mutation	SNP	ENST00000262887.5	37	CCDS12624.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246610	0.22796	0.0	1.16E-4	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982	T;T	0.02606	4.24;4.23	5.19	5.19	0.71726	.	0.679576	0.15363	N	0.266295	T	0.03739	0.0106	L	0.57536	1.79	0.18873	N	0.999982	P;B	0.46656	0.882;0.065	B;B	0.34824	0.19;0.01	T	0.50030	-0.8875	10	0.17369	T	0.5	-13.0362	14.9526	0.71086	0.0:1.0:0.0:0.0	.	391;422	F5H8D7;P18887	.;XRCC1_HUMAN	R	436;422;391	ENSP00000262887:G422R;ENSP00000443671:G391R	ENSP00000262887:G422R	G	-	1	0	XRCC1	48742905	0.777000	0.28628	0.112000	0.21494	0.089000	0.18198	3.384000	0.52478	2.804000	0.96469	0.655000	0.94253	GGA		0.612	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463194.1	NM_006297	
MUC16	94025	broad.mit.edu	37	19	9067143	9067143	+	Missense_Mutation	SNP	G	G	A	rs369202278		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr19:9067143G>A	ENST00000397910.4	-	3	20506	c.20303C>T	c.(20302-20304)gCg>gTg	p.A6768V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6770	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.A6768V(2)|p.A2401V(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCCTGAGTCGCCATCGAGTG	0.483													g|||	1	0.000199681	0.0008	0.0	5008	,	,		22952	0.0		0.0	False		,,,				2504	0.0				p.A6768V												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C20303T	19						.	G	VAL/ALA	2,4400	4.2+/-10.8	0,2,2199	242.0	239.0	240.0		20303	-4.1	0.0	19		240	1,8591	1.2+/-3.3	0,1,4295	no	missense	MUC16	NM_024690.2	64	0,3,6494	AA,AG,GG		0.0116,0.0454,0.0231	possibly-damaging	6768/14508	9067143	3,12991	2201	4296	6497	8928143	SO:0001583	missense	94025	exon3			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20303C>T	19.37:g.9067143G>A	ENSP00000381008:p.Ala6768Val		8928143	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	0.799	-0.756034	0.03019	4.54E-4	1.16E-4	ENSG00000181143	ENST00000397910	T	0.20881	2.04	2.06	-4.13	0.03904	.	.	.	.	.	T	0.07638	0.0192	N	0.04508	-0.205	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.25082	-1.0142	8	0.87932	D	0	.	2.4153	0.04435	0.1704:0.4376:0.2467:0.1454	.	6768	B5ME49	.	V	6768	ENSP00000381008:A6768V	ENSP00000381008:A6768V	A	-	2	0	MUC16	8928143	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.664000	0.00848	-3.322000	0.00187	-2.165000	0.00325	GCG		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NLRP7	199713	broad.mit.edu	37	19	55450436	55450436	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr19:55450436G>A	ENST00000590030.1	-	3	1791	c.1751C>T	c.(1750-1752)gCg>gTg	p.A584V	NLRP7_ENST00000592784.1_Missense_Mutation_p.A584V|NLRP7_ENST00000448121.2_Missense_Mutation_p.A584V|NLRP7_ENST00000588756.1_Missense_Mutation_p.A584V|NLRP7_ENST00000446217.1_Missense_Mutation_p.A612V|NLRP7_ENST00000328092.5_Missense_Mutation_p.A584V|NLRP7_ENST00000340844.2_Missense_Mutation_p.A584V			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	584							ATP binding (GO:0005524)	p.A584V(3)		autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		CACCACCTTCGCCAGCTCCTC	0.493																																					p.A584V												.	.	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.C1751T	19						.						77.0	73.0	75.0					19																	55450436		2203	4300	6503	60142248	SO:0001583	missense	199713	exon4			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1751C>T	19.37:g.55450436G>A	ENSP00000465520:p.Ala584Val		60142248	NM_139176	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.134757	0.00338	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	1.92	-0.316	0.12743	.	0.288824	0.18777	N	0.131456	T	0.16896	0.0406	N	0.05306	-0.075	0.09310	N	1	B;B;B;B	0.17667	0.007;0.007;0.007;0.023	B;B;B;B	0.09377	0.001;0.002;0.002;0.004	T	0.28004	-1.0057	10	0.02654	T	1	.	5.1222	0.14865	0.794:0.0:0.206:0.0	.	612;584;584;584	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	V	584;584;584;612;351	ENSP00000329568:A584V;ENSP00000409137:A584V;ENSP00000339491:A584V;ENSP00000414273:A612V	ENSP00000329568:A584V	A	-	2	0	NLRP7	60142248	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.136000	0.15974	-0.148000	0.11234	-1.263000	0.01449	GCG		0.493	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
ADAM2	2515	broad.mit.edu	37	8	39645654	39645654	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr8:39645654C>T	ENST00000265708.4	-	9	862	c.759G>A	c.(757-759)tgG>tgA	p.W253*	ADAM2_ENST00000379853.2_Intron|ADAM2_ENST00000347580.4_Nonsense_Mutation_p.W234*|ADAM2_ENST00000521880.1_Nonsense_Mutation_p.W253*	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	253	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.W253*(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AAGATGTTTTCCATCTTAAAA	0.294																																					p.W253X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G759A	8						.						92.0	92.0	92.0					8																	39645654		2202	4286	6488	39764811	SO:0001587	stop_gained	2515	exon9			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.759G>A	8.37:g.39645654C>T	ENSP00000265708:p.Trp253*		39764811	NM_001464	P78326|Q9UQQ8	Nonsense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194304	0.78902	.	.	ENSG00000104755	ENST00000347580;ENST00000265708;ENST00000521880	.	.	.	4.57	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9245	0.47184	0.0:0.8092:0.1908:0.0	.	.	.	.	X	234;253;253	.	.	W	-	3	0	ADAM2	39764811	1.000000	0.71417	0.944000	0.38274	0.501000	0.33797	1.379000	0.34340	1.027000	0.39758	0.460000	0.39030	TGG		0.294	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
KCNB2	9312	broad.mit.edu	37	8	73480241	73480241	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr8:73480241G>A	ENST00000523207.1	+	2	860	c.272G>A	c.(271-273)cGg>cAg	p.R91Q		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	91					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.R91Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TTCTTTGATCGGCATCCAGGA	0.483																																					p.R91Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G272A	8						.						82.0	81.0	81.0					8																	73480241		2203	4300	6503	73642795	SO:0001583	missense	9312	exon2			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.272G>A	8.37:g.73480241G>A	ENSP00000430846:p.Arg91Gln		73642795	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	32	5.122195	0.94429	.	.	ENSG00000182674	ENST00000523207	D	0.90069	-2.61	5.93	5.05	0.67936	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.497156	0.14582	U	0.310783	D	0.96367	0.8815	H	0.95260	3.645	0.48288	D	0.999627	D	0.76494	0.999	D	0.73708	0.981	D	0.96805	0.9592	10	0.87932	D	0	.	16.8752	0.86050	0.0:0.1284:0.8716:0.0	.	91	Q92953	KCNB2_HUMAN	Q	91	ENSP00000430846:R91Q	ENSP00000430846:R91Q	R	+	2	0	KCNB2	73642795	1.000000	0.71417	0.964000	0.40570	0.989000	0.77384	9.869000	0.99810	1.513000	0.48852	0.655000	0.94253	CGG		0.483	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
ZFHX4	79776	broad.mit.edu	37	8	77766101	77766101	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr8:77766101A>G	ENST00000521891.2	+	10	7392	c.6944A>G	c.(6943-6945)aAa>aGa	p.K2315R	ZFHX4_ENST00000518282.1_Missense_Mutation_p.K2289R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.K2270R|ZFHX4_ENST00000455469.2_Missense_Mutation_p.K2270R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.K2299R(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TACCAGTGTAAAAAGTGCAAT	0.383										HNSCC(33;0.089)																											p.K2315R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6944G	8						.						104.0	101.0	102.0					8																	77766101		1956	4148	6104	77928656	SO:0001583	missense	79776	exon10				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6944A>G	8.37:g.77766101A>G	ENSP00000430497:p.Lys2315Arg		77928656	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659011	0.67586	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	4.34	4.34	0.51931	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.47455	U	0.000237	T	0.56659	0.2000	M	0.81497	2.545	0.58432	D	0.99999	D;D;D	0.69078	0.997;0.996;0.996	D;D;D	0.80764	0.994;0.99;0.99	T	0.63708	-0.6576	10	0.72032	D	0.01	.	13.9681	0.64221	1.0:0.0:0.0:0.0	.	2270;2270;2315	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	2315;2299;2270;2270;2289	ENSP00000430497:K2315R;ENSP00000399605:K2270R;ENSP00000050961:K2270R;ENSP00000430848:K2289R	ENSP00000050961:K2270R	K	+	2	0	ZFHX4	77928656	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.087000	0.94110	1.956000	0.56807	0.528000	0.53228	AAA		0.383	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
COL22A1	169044	broad.mit.edu	37	8	139626111	139626111	+	Splice_Site	SNP	G	G	A	rs202129460		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr8:139626111G>A	ENST00000303045.6	-	56	4423	c.3977C>T	c.(3976-3978)cCg>cTg	p.P1326L	COL22A1_ENST00000435777.1_Splice_Site_p.P1306L|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1326	Collagen-like 13.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.P1326L(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AAAACTCACCGGTGGGCCCCT	0.478										HNSCC(7;0.00092)																											p.P1326L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3977T	8						.	G	LEU/PRO	0,4406		0,0,2203	132.0	139.0	137.0		3977	4.8	1.0	8		137	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice	COL22A1	NM_152888.1	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	1326/1627	139626111	1,13005	2203	4300	6503	139695293	SO:0001630	splice_region_variant	169044	exon56			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3978+1C>T	8.37:g.139626111G>A			139695293	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318246	0.40996	0.0	1.16E-4	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.96685	-4.09;-4.09	4.75	4.75	0.60458	.	0.283649	0.24999	N	0.033932	D	0.95274	0.8467	M	0.83852	2.665	0.53688	D	0.999976	P;P	0.45126	0.82;0.851	B;B	0.37047	0.155;0.24	D	0.95619	0.8679	10	0.66056	D	0.02	.	13.1056	0.59246	0.0:0.0:1.0:0.0	.	1306;1326	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	L	1326;1306;1019	ENSP00000303153:P1326L;ENSP00000387655:P1306L	ENSP00000303153:P1326L	P	-	2	0	COL22A1	139695293	1.000000	0.71417	0.978000	0.43139	0.989000	0.77384	3.017000	0.49615	2.446000	0.82766	0.555000	0.69702	CCG		0.478	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	Missense_Mutation
OLFM3	118427	broad.mit.edu	37	1	102296359	102296359	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr1:102296359C>A	ENST00000338858.5	-	3	300	c.301G>T	c.(301-303)Gaa>Taa	p.E101*	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000359814.3_Nonsense_Mutation_p.E101*|OLFM3_ENST00000536598.1_Nonsense_Mutation_p.E6*|OLFM3_ENST00000370103.4_Nonsense_Mutation_p.E81*			Q96PB7	NOE3_HUMAN	olfactomedin 3	101					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.E101*(1)|p.E81*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TTTAAGACTTCAATAGACTGG	0.348																																					p.E81X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G241T	1						.						106.0	107.0	107.0					1																	102296359		2203	4300	6503	102068947	SO:0001587	stop_gained	118427	exon3			AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.301G>T	1.37:g.102296359C>A	ENSP00000345192:p.Glu101*		102068947	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Nonsense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	C	37	6.082726	0.97267	.	.	ENSG00000118733	ENST00000370103;ENST00000338858;ENST00000536598;ENST00000359814	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0172	0.97481	0.0:1.0:0.0:0.0	.	.	.	.	X	81;101;6;101	.	ENSP00000345192:E101X	E	-	1	0	OLFM3	102068947	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	5.962000	0.70364	2.814000	0.96858	0.585000	0.79938	GAA		0.348	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
TRIM33	51592	broad.mit.edu	37	1	115005840	115005840	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr1:115005840C>G	ENST00000358465.2	-	4	892	c.809G>C	c.(808-810)gGt>gCt	p.G270A	TRIM33_ENST00000369543.2_Missense_Mutation_p.G270A|TRIM33_ENST00000450349.2_5'UTR	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	270					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G270A(1)		breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGGCGTTGACCAGATGCTCC	0.343			T	RET	papillary thyroid																																p.G270A			Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G809C	1						.						62.0	58.0	59.0					1																	115005840		2203	4300	6503	114807363	SO:0001583	missense	51592	exon4			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.809G>C	1.37:g.115005840C>G	ENSP00000351250:p.Gly270Ala		114807363	NM_015906	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.1|26.1	4.702771|4.702771	0.88924|0.88924	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000358465;ENST00000369543|ENST00000448034	T;T|.	0.56611|.	0.45;0.45|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Zinc finger, RING-type (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.47135|0.47135	0.1429|0.1429	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	D;B|.	0.89917|.	1.0;0.066|.	D;B|.	0.87578|.	0.998;0.105|.	T|T	0.38134|0.38134	-0.9675|-0.9675	10|5	0.16896|.	T|.	0.51|.	-14.4216|-14.4216	19.7863|19.7863	0.96440|0.96440	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	270;270|.	Q9UPN9-2;Q9UPN9|.	.;TRI33_HUMAN|.	A|L	270|7	ENSP00000351250:G270A;ENSP00000358556:G270A|.	ENSP00000351250:G270A|.	G|V	-|-	2|1	0|0	TRIM33|TRIM33	114807363|114807363	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	4.871000|4.871000	0.63042|0.63042	2.665000|2.665000	0.90641|0.90641	0.655000|0.655000	0.94253|0.94253	GGT|GTC		0.343	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
ITGA10	8515	broad.mit.edu	37	1	145533128	145533128	+	Missense_Mutation	SNP	G	G	A	rs587701227		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr1:145533128G>A	ENST00000369304.3	+	11	1398	c.1223G>A	c.(1222-1224)cGc>cAc	p.R408H	ITGA10_ENST00000538811.1_Missense_Mutation_p.R277H|ITGA10_ENST00000539363.1_Missense_Mutation_p.R265H	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	408					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)	p.R408H(1)		NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGAGGCCACCGCCTTTTCCCC	0.577													G|||	1	0.000199681	0.0	0.0014	5008	,	,		14990	0.0		0.0	False		,,,				2504	0.0				p.R408H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1223A	1						.						62.0	58.0	59.0					1																	145533128		2203	4300	6503	144244485	SO:0001583	missense	8515	exon11			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1223G>A	1.37:g.145533128G>A	ENSP00000358310:p.Arg408His		144244485	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	G	8.976	0.974056	0.18736	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.25085	1.82;1.82;1.82	4.71	-2.28	0.06826	.	0.719495	0.13270	N	0.400596	T	0.05318	0.0141	L	0.46741	1.465	0.29451	N	0.858498	B;B;B;B	0.21753	0.06;0.016;0.059;0.006	B;B;B;B	0.20767	0.031;0.013;0.009;0.008	T	0.44862	-0.9300	10	0.08837	T	0.75	.	7.5075	0.27553	0.3853:0.11:0.5047:0.0	.	374;277;265;408	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	H	408;374;265;277	ENSP00000358310:R408H;ENSP00000439894:R265H;ENSP00000440011:R277H	ENSP00000358310:R408H	R	+	2	0	ITGA10	144244485	0.001000	0.12720	0.557000	0.28306	0.563000	0.35712	0.248000	0.18198	-0.810000	0.04375	-0.797000	0.03246	CGC		0.577	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
ASTN1	460	broad.mit.edu	37	1	176838004	176838004	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr1:176838004C>T	ENST00000367654.3	-	22	3858	c.3647G>A	c.(3646-3648)cGa>cAa	p.R1216Q	ASTN1_ENST00000367657.3_Missense_Mutation_p.R1208Q|ASTN1_ENST00000361833.2_Missense_Mutation_p.R1208Q|ASTN1_ENST00000424564.2_Missense_Mutation_p.R1208Q	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1216					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R1208Q(3)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ATCCTCACATCGCCAGGTGAA	0.468																																					p.R1208Q												.	.	3	Substitution - Missense(3)	ovary(1)|large_intestine(1)|endometrium(1)	c.G3623A	1						.						119.0	117.0	117.0					1																	176838004		2203	4300	6503	175104627	SO:0001583	missense	460	exon22			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3647G>A	1.37:g.176838004C>T	ENSP00000356626:p.Arg1216Gln		175104627	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	C	36	5.937872	0.97122	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.27557	1.66;2.07;2.07;1.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.48333	0.1494	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.43343	-0.9397	10	0.87932	D	0	-29.5501	19.9003	0.96983	0.0:1.0:0.0:0.0	.	1208;1208	O14525-2;B1AJS1	.;.	Q	1208;1208;1216;1208;1208	ENSP00000356629:R1208Q;ENSP00000354536:R1208Q;ENSP00000356626:R1216Q;ENSP00000395041:R1208Q	ENSP00000354536:R1208Q	R	-	2	0	ASTN1	175104627	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.679000	0.84048	2.808000	0.96608	0.655000	0.94253	CGA		0.468	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
ARID1A	8289	broad.mit.edu	37	1	27088759	27088759	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr1:27088759C>T	ENST00000324856.7	+	7	2739	c.2368C>T	c.(2368-2370)Cag>Tag	p.Q790*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q407*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q790*|RN7SL501P_ENST00000578818.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	790					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q790*(2)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTCCTACCAGCAGAACTCCAT	0.587			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.Q790X			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	.	2	Substitution - Nonsense(2)	large_intestine(1)|endometrium(1)	c.C2368T	1						.						63.0	65.0	64.0					1																	27088759		2203	4300	6503	26961346	SO:0001587	stop_gained	8289	exon7			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2368C>T	1.37:g.27088759C>T	ENSP00000320485:p.Gln790*		26961346	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	37	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	39	7.350800	0.98228	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-6.9554	18.667	0.91493	0.0:1.0:0.0:0.0	.	.	.	.	X	790;790;407	.	ENSP00000320485:Q790X	Q	+	1	0	ARID1A	26961346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.498000	0.66931	2.824000	0.97209	0.655000	0.94253	CAG		0.587	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
RASSF5	83593	broad.mit.edu	37	1	206757739	206757739	+	Silent	SNP	G	G	A	rs372473374		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr1:206757739G>A	ENST00000355294.4	+	4	768	c.711G>A	c.(709-711)acG>acA	p.T237T	RASSF5_ENST00000491368.1_3'UTR|EIF2D_ENST00000472709.2_Intron|RASSF5_ENST00000367117.3_Silent_p.T237T|RASSF5_ENST00000304534.8_Silent_p.T84T	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5	237					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.T237T(1)|p.T84T(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GCACCTACACGGGTTTCATCA	0.612											OREG0014174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T237T	GBM(162;656 1984 11916 22872 31529)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G711A	1						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	45.0	48.0	47.0		711,711,252	-9.4	0.8	1		47	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	RASSF5	NM_182663.2,NM_182664.2,NM_182665.2	,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,	237/419,237/337,84/266	206757739	1,13005	2203	4300	6503	204824362	SO:0001819	synonymous_variant	83593	exon4			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.711G>A	1.37:g.206757739G>A		2162	204824362	NM_182663	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Silent	SNP	ENST00000355294.4	37	CCDS30998.1																																																																																				0.612	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088469.1	NM_031437	
OR52L1	338751	broad.mit.edu	37	11	6007249	6007249	+	Silent	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr11:6007249C>T	ENST00000332249.4	-	1	966	c.912G>A	c.(910-912)gcG>gcA	p.A304A		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A289A(2)|p.A304A(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGATTGAGCGCAGGTGGCA	0.473																																					p.A304A	Melanoma(121;653 1666 10547 22796 51255)											.	.	3	Substitution - coding silent(3)	endometrium(2)|large_intestine(1)	c.G912A	11						.						66.0	67.0	67.0					11																	6007249		2073	4230	6303	5963825	SO:0001819	synonymous_variant	338751	exon1			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.912G>A	11.37:g.6007249C>T			5963825	NM_001005173	B2RPA6|Q6IFK9	Silent	SNP	ENST00000332249.4	37	CCDS44529.1																																																																																				0.473	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
C11orf49	79096	broad.mit.edu	37	11	47176746	47176746	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr11:47176746G>A	ENST00000278460.7	+	5	444	c.385G>A	c.(385-387)Gcc>Acc	p.A129T	C11orf49_ENST00000395460.2_Missense_Mutation_p.A129T|C11orf49_ENST00000536126.1_Missense_Mutation_p.A32T|C11orf49_ENST00000543718.1_Missense_Mutation_p.A45T|C11orf49_ENST00000527268.1_3'UTR|C11orf49_ENST00000378615.3_Missense_Mutation_p.A129T|C11orf49_ENST00000378618.2_Missense_Mutation_p.A129T	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	129						nucleus (GO:0005634)		p.A129T(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						CATGGACGATGCCATGGACTG	0.522																																					p.A129T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G385A	11						.						341.0	284.0	304.0					11																	47176746		2201	4299	6500	47133322	SO:0001583	missense	79096	exon5			AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.385G>A	11.37:g.47176746G>A	ENSP00000278460:p.Ala129Thr		47133322	NM_024113	D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Missense_Mutation	SNP	ENST00000278460.7	37	CCDS7925.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678672	0.88542	.	.	ENSG00000149179	ENST00000536126;ENST00000278460;ENST00000378618;ENST00000395460;ENST00000378615;ENST00000543718;ENST00000526827	T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81	5.66	5.66	0.87406	.	0.050511	0.85682	D	0.000000	T	0.54791	0.1880	M	0.74881	2.28	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.865;0.998;0.999	D;D;B;D;D	0.87578	0.998;0.998;0.391;0.972;0.981	T	0.56105	-0.8034	10	0.72032	D	0.01	-17.9197	19.756	0.96291	0.0:0.0:1.0:0.0	.	45;45;129;129;129	F5H6E0;B4DEG1;E9PAX7;Q9H6J7-2;Q9H6J7	.;.;.;.;CK049_HUMAN	T	32;129;129;129;129;45;55	ENSP00000438207:A32T;ENSP00000278460:A129T;ENSP00000367881:A129T;ENSP00000378844:A129T;ENSP00000367878:A129T;ENSP00000437689:A45T;ENSP00000433707:A55T	ENSP00000278460:A129T	A	+	1	0	C11orf49	47133322	1.000000	0.71417	0.938000	0.37757	0.620000	0.37586	6.982000	0.76173	2.665000	0.90641	0.655000	0.94253	GCC		0.522	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391218.1	NM_024113	
MS4A13	503497	broad.mit.edu	37	11	60285636	60285636	+	Missense_Mutation	SNP	C	C	T	rs184120879	byFrequency	TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr11:60285636C>T	ENST00000527948.1	+	2	638	c.80C>T	c.(79-81)aCg>aTg	p.T27M	MS4A13_ENST00000378186.2_Missense_Mutation_p.T27M|MS4A13_ENST00000437058.2_Missense_Mutation_p.T27M|MS4A13_ENST00000378185.2_Missense_Mutation_p.T27M			Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 13	72						integral component of membrane (GO:0016021)		p.T27M(1)		endometrium(3)|large_intestine(1)|lung(2)|skin(2)	8						GCCTTTGGAACGTATGAACCT	0.308													C|||	2	0.000399361	0.0	0.0	5008	,	,		18587	0.002		0.0	False		,,,				2504	0.0				p.T27M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C80T	11						.						117.0	119.0	119.0					11																	60285636		2203	4300	6503	60042212	SO:0001583	missense	503497	exon3			AY324188	CCDS31571.1, CCDS41653.1, CCDS60801.1	11q12.2	2005-12-05	2005-12-05		ENSG00000204979	ENSG00000204979			16674	protein-coding gene	gene with protein product							Standard	NM_001012417		Approved		uc001nps.3	Q5J8X5	OTTHUMG00000167615	ENST00000527948.1:c.80C>T	11.37:g.60285636C>T	ENSP00000432713:p.Thr27Met		60042212	NM_001100909	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000527948.1	37		2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	0.426	-0.905724	0.02453	.	.	ENSG00000204979	ENST00000378186;ENST00000378185;ENST00000437058;ENST00000527948	T;T;T;T	0.35789	2.17;1.84;1.41;1.29	5.65	-5.08	0.02929	.	0.752361	0.12237	N	0.486851	T	0.26231	0.0640	L	0.60455	1.87	0.09310	N	1	B;B;B	0.31548	0.28;0.28;0.328	B;B;B	0.28139	0.051;0.082;0.086	T	0.14008	-1.0488	10	0.87932	D	0	-4.4699	5.2451	0.15493	0.2808:0.3386:0.0:0.3805	.	27;27;27	Q5J8X5-3;Q5J8X5-2;Q5J8X5	.;.;M4A13_HUMAN	M	27	ENSP00000367428:T27M;ENSP00000367427:T27M;ENSP00000415535:T27M;ENSP00000432713:T27M	ENSP00000367427:T27M	T	+	2	0	MS4A13	60042212	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.604000	0.02076	-1.268000	0.02439	-2.086000	0.00376	ACG		0.308	MS4A13-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000395411.1	NM_001012417	
ALDH3B1	221	broad.mit.edu	37	11	67789269	67789269	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr11:67789269G>A	ENST00000539229.1	+	8	991	c.875G>A	c.(874-876)cGg>cAg	p.R292Q	ALDH3B1_ENST00000342456.6_Missense_Mutation_p.R256Q|ALDH3B1_ENST00000434449.1_3'UTR|ALDH3B1_ENST00000316367.6_Intron|ALDH3B1_ENST00000007633.8_Missense_Mutation_p.R292Q	NM_001161473.1	NP_001154945.1	P43353	AL3B1_HUMAN	aldehyde dehydrogenase 3 family, member B1	293					alcohol metabolic process (GO:0006066)|aldehyde catabolic process (GO:0046185)|cellular response to oxidative stress (GO:0034599)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)										CAGTTCCAGCGGCTGCGGGCA	0.642																																					p.R256Q												.	.	0			c.G767A	11						.						52.0	62.0	59.0					11																	67789269		2200	4294	6494	67545845	SO:0001583	missense	221	exon6			U10868	CCDS73335.1, CCDS73336.1	11q13	2010-04-27			ENSG00000006534	ENSG00000006534	1.2.1.5	"""Aldehyde dehydrogenases"""	410	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 7"", ""aldehyde dehydrogenase 3B1"""	600466		ALDH7		9161417, 7828891	Standard	NM_000694		Approved		uc001ona.3	P43353	OTTHUMG00000154910	ENST00000539229.1:c.875G>A	11.37:g.67789269G>A	ENSP00000474034:p.Arg292Gln		67545845	NM_001030010	A3FMP9|Q53XL5|Q8N515|Q96CK8	Missense_Mutation	SNP	ENST00000539229.1	37																																																																																					0.642	ALDH3B1-204	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_000694	
MMP7	4316	broad.mit.edu	37	11	102401356	102401356	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr11:102401356C>T	ENST00000260227.4	-	1	128	c.76G>A	c.(76-78)Ggc>Agc	p.G26S		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	26					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.G26S(1)		large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	TCACTCATGCCTCCCGCCTCC	0.547																																					p.G26S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G76A	11						.						74.0	61.0	65.0					11																	102401356		2203	4299	6502	101906566	SO:0001583	missense	4316	exon1			Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.76G>A	11.37:g.102401356C>T	ENSP00000260227:p.Gly26Ser		101906566	NM_002423	Q9BTK9	Missense_Mutation	SNP	ENST00000260227.4	37	CCDS8317.1	.	.	.	.	.	.	.	.	.	.	C	9.762	1.170479	0.21621	.	.	ENSG00000137673	ENST00000260227	T	0.38240	1.15	4.98	4.05	0.47172	Peptidoglycan binding-like (1);	1.077680	0.07196	N	0.856659	T	0.31071	0.0785	L	0.57536	1.79	0.09310	N	1	B;P;B	0.37781	0.172;0.608;0.144	B;B;B	0.32980	0.041;0.156;0.024	T	0.17776	-1.0358	10	0.08179	T	0.78	1.0644	9.827	0.40919	0.0:0.8992:0.0:0.1008	.	26;26;26	B4DDW4;Q53GF1;P09237	.;.;MMP7_HUMAN	S	26	ENSP00000260227:G26S	ENSP00000260227:G26S	G	-	1	0	MMP7	101906566	0.005000	0.15991	0.027000	0.17364	0.405000	0.30901	0.740000	0.26188	2.482000	0.83794	0.655000	0.94253	GGC		0.547	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109633.2		
CEP85L	387119	broad.mit.edu	37	6	118786676	118786676	+	Silent	SNP	A	A	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:118786676A>G	ENST00000368491.3	-	13	2931	c.2310T>C	c.(2308-2310)acT>acC	p.T770T	CEP85L_ENST00000368488.5_Silent_p.T773T	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	770						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.T770T(1)									ACAGCTTTTTAGTGAGTGTTT	0.393																																					p.T773T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T2319C	6						.						233.0	221.0	225.0					6																	118786676		1970	4166	6136	118893369	SO:0001819	synonymous_variant	387119	exon14			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.2310T>C	6.37:g.118786676A>G			118893369	NM_001178035	A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Silent	SNP	ENST00000368491.3	37	CCDS43498.1																																																																																				0.393	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041996.2	NM_001042475	
GABBR1	2550	broad.mit.edu	37	6	29576462	29576462	+	Silent	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:29576462G>A	ENST00000377034.4	-	16	2243	c.1908C>T	c.(1906-1908)ggC>ggT	p.G636G	GABBR1_ENST00000355973.3_Silent_p.G519G|GABBR1_ENST00000377012.4_Silent_p.G519G|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377016.4_Silent_p.G574G	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	636					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.G636G(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CCAGTGAGCAGCCCACAGCAG	0.562																																					p.G574G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1722T	6						.						141.0	112.0	122.0					6																	29576462		1511	2709	4220	29684441	SO:0001819	synonymous_variant	2550	exon15			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1908C>T	6.37:g.29576462G>A			29684441	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	ENST00000377034.4	37	CCDS4663.1																																																																																				0.562	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
SKIV2L	6499	broad.mit.edu	37	6	31930842	31930842	+	Silent	SNP	C	C	T	rs377050125		TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:31930842C>T	ENST00000375394.2	+	13	1490	c.1377C>T	c.(1375-1377)aaC>aaT	p.N459N	SKIV2L_ENST00000544581.1_Silent_p.N266N	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	459	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)	p.N459N(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CCGTCCCCAACGCCCTTGAGT	0.582																																					p.N459N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1377T	6						.	C		0,3022		0,0,1511	124.0	94.0	105.0		1377	-9.7	0.1	6		105	1,5417		0,1,2708	no	coding-synonymous	SKIV2L	NM_006929.4		0,1,4219	TT,TC,CC		0.0185,0.0,0.0118		459/1247	31930842	1,8439	1511	2709	4220	32038821	SO:0001819	synonymous_variant	6499	exon13				CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.1377C>T	6.37:g.31930842C>T			32038821	NM_006929	O15005|Q12902|Q15476|Q5ST66	Silent	SNP	ENST00000375394.2	37	CCDS4731.1																																																																																				0.582	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
PTK7	5754	broad.mit.edu	37	6	43111350	43111351	+	Missense_Mutation	DNP	GC	GC	CT	rs139041676		TCGA-AG-A00H-01	TCGA-AG-A00H-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:43111350_43111351GC>CT	ENST00000230419.4	+	14	2464_2465	c.2243_2244GC>CT	c.(2242-2244)tGC>tCT	p.C748S	PTK7_ENST00000349241.2_Missense_Mutation_p.C618S|PTK7_ENST00000352931.2_Missense_Mutation_p.C692S|PTK7_ENST00000481273.1_Missense_Mutation_p.C756S|PTK7_ENST00000345201.2_Missense_Mutation_p.C708S	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	748					actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.C748>?(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GAGATGGAATGCCTCAACGGTG	0.658											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.												.	.	1	Complex(1)	large_intestine(1)	c.2123_2124CT	6						.																																			43219329	SO:0001583	missense	5754	exon13			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	Exception_encountered	6.37:g.43111350_43111351delinsCT	ENSP00000230419:p.Cys748Ser	913	43219328	NM_152880	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	DNP	ENST00000230419.4	37	CCDS4884.1																																																																																				0.658	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		
COL12A1	1303	broad.mit.edu	37	6	75851849	75851849	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:75851849G>C	ENST00000322507.8	-	27	5165	c.4856C>G	c.(4855-4857)aCt>aGt	p.T1619S	COL12A1_ENST00000345356.6_Missense_Mutation_p.T455S|COL12A1_ENST00000416123.2_Missense_Mutation_p.T1619S|COL12A1_ENST00000483888.2_Missense_Mutation_p.T1619S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1619	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)	p.T1619S(1)		breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TTTGAGGGAAGTGCTGGTCTC	0.463																																					p.T1619S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4856G	6						.						206.0	202.0	203.0					6																	75851849		2131	4252	6383	75908569	SO:0001583	missense	1303	exon27			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4856C>G	6.37:g.75851849G>C	ENSP00000325146:p.Thr1619Ser		75908569	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.633|6.633	0.485183|0.485183	0.12641|0.12641	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|T;T;T;T	.|0.57436	.|0.4;0.4;0.4;0.4	6.16|6.16	0.422|0.422	0.16457|0.16457	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.167788	.|0.49916	.|D	.|0.000131	T|T	0.33323|0.33323	0.0859|0.0859	M|M	0.82823|0.82823	2.61|2.61	0.09310|0.09310	N|N	0.999994|0.999994	.|B;B	.|0.25235	.|0.099;0.121	.|B;B	.|0.29663	.|0.102;0.105	T|T	0.44236|0.44236	-0.9341|-0.9341	5|10	.|0.22706	.|T	.|0.39	.|.	11.7829|11.7829	0.52026|0.52026	0.3836:0.0:0.6164:0.0|0.3836:0.0:0.6164:0.0	.|.	.|455;1619	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	Q|S	360|1619;1619;455;1619;1619	.|ENSP00000325146:T1619S;ENSP00000305147:T455S;ENSP00000412864:T1619S;ENSP00000421216:T1619S	.|ENSP00000325146:T1619S	H|T	-|-	3|2	2|0	COL12A1|COL12A1	75908569|75908569	0.070000|0.070000	0.21116|0.21116	0.039000|0.039000	0.18376|0.18376	0.442000|0.442000	0.32017|0.32017	0.419000|0.419000	0.21247|0.21247	-0.136000|-0.136000	0.11475|0.11475	-0.142000|-0.142000	0.14014|0.14014	CAC|ACT		0.463	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
GJA10	84694	broad.mit.edu	37	6	90605410	90605410	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:90605410A>T	ENST00000369352.1	+	1	1223	c.1223A>T	c.(1222-1224)gAc>gTc	p.D408V	Y_RNA_ENST00000517082.1_RNA	NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	396					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)		p.D408V(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		CACTGCAGAGACAGTGAAGGC	0.537																																					p.D408V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1223T	6						.						79.0	77.0	77.0					6																	90605410		2203	4300	6503	90662131	SO:0001583	missense	84694	exon1			AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.1223A>T	6.37:g.90605410A>T	ENSP00000358358:p.Asp408Val		90662131	NM_032602	B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	ENST00000369352.1	37	CCDS5025.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884251	0.33255	.	.	ENSG00000135355	ENST00000369352	D	0.97752	-4.52	5.39	-4.11	0.03928	.	1.727610	0.03040	N	0.153244	D	0.89283	0.6671	L	0.44542	1.39	0.09310	N	0.999998	B	0.12013	0.005	B	0.10450	0.005	D	0.84350	0.0532	10	0.30078	T	0.28	.	3.7367	0.08514	0.4261:0.1121:0.362:0.0999	.	408	Q969M2	CXA10_HUMAN	V	408	ENSP00000358358:D408V	ENSP00000358358:D408V	D	+	2	0	GJA10	90662131	0.001000	0.12720	0.173000	0.22940	0.845000	0.48019	0.069000	0.14552	-0.460000	0.07003	0.460000	0.39030	GAC		0.537	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041505.1	NM_032602	
EYA4	2070	broad.mit.edu	37	6	133789714	133789714	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr6:133789714C>A	ENST00000367895.5	+	11	1279	c.815C>A	c.(814-816)tCc>tAc	p.S272Y	EYA4_ENST00000452339.2_Missense_Mutation_p.S218Y|EYA4_ENST00000355286.6_Missense_Mutation_p.S249Y|EYA4_ENST00000531901.1_Missense_Mutation_p.S272Y|EYA4_ENST00000430974.2_Missense_Mutation_p.S218Y|EYA4_ENST00000525849.1_Missense_Mutation_p.S249Y|EYA4_ENST00000431403.2_Missense_Mutation_p.S272Y|EYA4_ENST00000355167.3_Missense_Mutation_p.S272Y	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	272					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)	p.S272Y(1)		breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GATTATCCATCCTATACAGCC	0.388																																					p.S249Y	Melanoma(57;398 1237 3528 4702 7415)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C746A	6						.						107.0	98.0	101.0					6																	133789714		2203	4299	6502	133831407	SO:0001583	missense	2070	exon10			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.815C>A	6.37:g.133789714C>A	ENSP00000356870:p.Ser272Tyr		133831407	NM_172103	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950617	0.73787	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.87406	0.6169	L	0.46741	1.465	0.80722	D	1	D;D;D;D;D;D	0.76494	0.997;0.999;0.998;0.998;0.998;0.997	D;D;D;D;D;D	0.74348	0.976;0.983;0.952;0.952;0.976;0.964	D	0.87935	0.2713	10	0.87932	D	0	-12.1799	19.7445	0.96247	0.0:1.0:0.0:0.0	.	272;218;218;249;272;272	F2Z2Y1;E7ESD5;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;.;EYA4_HUMAN	Y	218;218;272;272;249;272;249;272	ENSP00000395916:S218Y;ENSP00000388670:S218Y;ENSP00000356870:S272Y;ENSP00000347294:S272Y;ENSP00000347434:S249Y;ENSP00000432770:S272Y;ENSP00000433219:S249Y;ENSP00000404558:S272Y	ENSP00000347294:S272Y	S	+	2	0	EYA4	133831407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.739000	0.93911	0.655000	0.94253	TCC		0.388	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
ALKBH5	54890	broad.mit.edu	37	17	18110226	18110226	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr17:18110226G>A	ENST00000399138.4	+	3	954	c.949G>A	c.(949-951)Gac>Aac	p.D317N	ALKBH5_ENST00000541285.1_5'UTR	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	317					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)	p.D317N(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					AAACAACAGGGACCCTGCTCT	0.567																																					p.D317N	Ovarian(166;154 1953 40235 46283 46309)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G949A	17						.						176.0	182.0	180.0					17																	18110226		1935	4121	6056	18050951	SO:0001583	missense	54890	exon3			AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.949G>A	17.37:g.18110226G>A	ENSP00000382091:p.Asp317Asn		18050951	NM_017758	B4DVJ4|D3DXC6|Q9NXD6	Missense_Mutation	SNP	ENST00000399138.4	37	CCDS42272.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745487	0.49151	.	.	ENSG00000091542	ENST00000261650;ENST00000500385;ENST00000399138	.	.	.	5.56	5.56	0.83823	.	0.296096	0.37857	N	0.001902	T	0.36744	0.0978	N	0.19112	0.55	0.38740	D	0.953873	B	0.32160	0.358	B	0.26770	0.073	T	0.31998	-0.9923	9	0.31617	T	0.26	-14.2187	15.0521	0.71881	0.0:0.1416:0.8584:0.0	.	317	Q6P6C2-2	.	N	317;306;317	.	ENSP00000261650:D317N	D	+	1	0	ALKBH5	18050951	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.309000	0.51903	2.618000	0.88619	0.655000	0.94253	GAC		0.567	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132069.3	NM_017758	
CCDC144NL	339184	broad.mit.edu	37	17	20799111	20799111	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr17:20799111C>A	ENST00000327925.5	-	1	342	c.223G>T	c.(223-225)Gat>Tat	p.D75Y	RP11-344E13.3_ENST00000577860.1_RNA|RNU6-1178P_ENST00000516674.1_RNA|RP11-344E13.3_ENST00000582324.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000577537.1_RNA|RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	75								p.D75Y(1)		large_intestine(3)|lung(3)|skin(1)	7						AGGCGGACATCGTGCTGGAGC	0.652																																					p.D75Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G223T	17						.						70.0	84.0	79.0					17																	20799111		2203	4292	6495	20739703	SO:0001583	missense	339184	exon1				CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.223G>T	17.37:g.20799111C>A	ENSP00000328054:p.Asp75Tyr		20739703	NM_001004306		Missense_Mutation	SNP	ENST00000327925.5	37	CCDS32591.1	.	.	.	.	.	.	.	.	.	.	c	8.955	0.969182	0.18659	.	.	ENSG00000205212	ENST00000327925	T	0.24151	1.87	.	.	.	.	.	.	.	.	T	0.28764	0.0713	N	0.19112	0.55	0.09310	N	1	D	0.89917	1.0	D	0.76575	0.988	T	0.18304	-1.0341	7	0.66056	D	0.02	.	.	.	.	.	75	Q6NUI1	C144L_HUMAN	Y	75	ENSP00000328054:D75Y	ENSP00000328054:D75Y	D	-	1	0	CCDC144NL	20739703	0.065000	0.20965	0.002000	0.10522	0.047000	0.14425	0.160000	0.16462	-0.401000	0.07644	0.154000	0.16183	GAT		0.652	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
ASIC2	40	broad.mit.edu	37	17	32483463	32483463	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr17:32483463C>T	ENST00000359872.6	-	1	850	c.89G>A	c.(88-90)cGc>cAc	p.R30H		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	30					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)	p.R30H(1)								Amiloride(DB00594)	GAAGATGTGGCGGATGCCATG	0.627																																					p.R30H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G89A	17						.						45.0	52.0	50.0					17																	32483463		2200	4296	6496	29507576	SO:0001583	missense	40	exon1			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.89G>A	17.37:g.32483463C>T	ENSP00000352934:p.Arg30His		29507576	NM_001094	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	37	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.537527	0.45176	.	.	ENSG00000108684	ENST00000359872	T	0.64991	-0.13	4.96	4.96	0.65561	.	.	.	.	.	T	0.69851	0.3157	L	0.45470	1.425	0.53005	D	0.999962	D	0.62365	0.991	P	0.60236	0.871	T	0.67968	-0.5533	9	0.37606	T	0.19	.	15.7471	0.77955	0.0:1.0:0.0:0.0	.	30	Q16515	ACCN1_HUMAN	H	30	ENSP00000352934:R30H	ENSP00000352934:R30H	R	-	2	0	ACCN1	29507576	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.647000	0.83462	2.559000	0.86315	0.655000	0.94253	CGC		0.627	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
CSH1	1442	broad.mit.edu	37	17	61972821	61972821	+	Intron	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr17:61972821C>T	ENST00000316193.8	-	4	598				CSH1_ENST00000329882.8_Silent_p.A156A|CSH1_ENST00000453363.3_Intron	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)							extracellular region (GO:0005576)	metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						TGACCCCTGGCGCCACCCTCA	0.567									Russell-Silver syndrome																												p.A156A												.	.	0			c.G468A	17						.						73.0	75.0	74.0					17																	61972821		2194	4300	6494	59326553	SO:0001627	intron_variant	1442	exon4	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.456+11G>A	17.37:g.61972821C>T			59326553	NM_022640	P01243|Q0VDB1|Q14407	Silent	SNP	ENST00000316193.8	37	CCDS11649.1																																																																																				0.567	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416040.1	NM_001317	
PRKAR1A	5573	broad.mit.edu	37	17	66518949	66518949	+	Nonsense_Mutation	SNP	C	C	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr17:66518949C>G	ENST00000589228.1	+	3	358	c.230C>G	c.(229-231)tCa>tGa	p.S77*	PRKAR1A_ENST00000392711.1_Nonsense_Mutation_p.S77*|PRKAR1A_ENST00000586397.1_Nonsense_Mutation_p.S77*|PRKAR1A_ENST00000358598.2_Nonsense_Mutation_p.S77*|PRKAR1A_ENST00000536854.2_Nonsense_Mutation_p.S77*|PRKAR1A_ENST00000588188.2_Nonsense_Mutation_p.S77*	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	77	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)	p.S77*(2)		adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					CGTACAGACTCAAGGGAGGAT	0.498			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.S77X	Ovarian(167;637 1670 33025 39608 46699 51856)	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	.	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)	c.C230G	17						.						84.0	81.0	82.0					17																	66518949		2203	4300	6503	64030544	SO:0001587	stop_gained	5573	exon3	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.230C>G	17.37:g.66518949C>G	ENSP00000464977:p.Ser77*		64030544	NM_212472	K7ER48|Q567S7	Nonsense_Mutation	SNP	ENST00000589228.1	37	CCDS11678.1	.	.	.	.	.	.	.	.	.	.	C	38	7.031972	0.98013	.	.	ENSG00000108946	ENST00000358598;ENST00000392711;ENST00000392710;ENST00000536854	.	.	.	5.96	5.96	0.96718	.	0.055972	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-23.3383	20.3866	0.98944	0.0:1.0:0.0:0.0	.	.	.	.	X	77	.	ENSP00000351410:S77X	S	+	2	0	PRKAR1A	64030544	1.000000	0.71417	0.961000	0.40146	0.861000	0.49209	7.818000	0.86416	2.826000	0.97356	0.650000	0.86243	TCA		0.498	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
RAB37	326624	broad.mit.edu	37	17	72736994	72736994	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr17:72736994G>T	ENST00000392613.5	+	2	237	c.181G>T	c.(181-183)Gcc>Tcc	p.A61S	RAB37_ENST00000392615.5_Intron|RAB37_ENST00000392614.4_Missense_Mutation_p.A66S|RAB37_ENST00000402449.4_Intron|RAB37_ENST00000340415.3_Intron|RAB37_ENST00000528438.1_Missense_Mutation_p.A34S|RAB37_ENST00000392610.1_Missense_Mutation_p.A61S|RAB37_ENST00000392612.3_Intron	NM_001006638.2	NP_001006639.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family	61					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)	p.A61S(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						AACCTTCATAGCCACCGTCGG	0.597																																					p.A61S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G181T	17						.						106.0	104.0	104.0					17																	72736994		2203	4300	6503	70248589	SO:0001583	missense	326624	exon2			BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282	ENST00000392613.5:c.181G>T	17.37:g.72736994G>T	ENSP00000376389:p.Ala61Ser		70248589	NM_001006638	A8MXF5|A8MYT0|Q8IWA7	Missense_Mutation	SNP	ENST00000392613.5	37	CCDS32722.1	.	.	.	.	.	.	.	.	.	.	G	9.308	1.054918	0.19907	.	.	ENSG00000172794	ENST00000528438;ENST00000392614;ENST00000392613;ENST00000533530;ENST00000392610	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	5.1	5.1	0.69264	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.62307	0.2417	N	0.05012	-0.13	0.80722	D	1	B;B	0.22604	0.072;0.033	B;B	0.27887	0.084;0.062	T	0.60954	-0.7160	10	0.02654	T	1	.	17.2957	0.87170	0.0:0.0:1.0:0.0	.	66;61	A8MYT0;Q96AX2	.;RAB37_HUMAN	S	34;66;61;61;61	ENSP00000432086:A34S;ENSP00000376390:A66S;ENSP00000376389:A61S;ENSP00000376387:A61S	ENSP00000376387:A61S	A	+	1	0	RAB37	70248589	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	7.309000	0.78937	2.386000	0.81285	0.561000	0.74099	GCC		0.597	RAB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258872.2	NM_175738	
SLX4	84464	broad.mit.edu	37	16	3647637	3647637	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr16:3647637A>T	ENST00000294008.3	-	7	2066	c.1426T>A	c.(1426-1428)Tct>Act	p.S476T		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	476	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GTGGTTTCAGAGTCCTGGACT	0.527								Direct reversal of damage																													p.S476T												.	.	0			c.T1426A	16						.						72.0	81.0	78.0					16																	3647637		2197	4300	6497	3587638	SO:0001583	missense	84464	exon7			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1426T>A	16.37:g.3647637A>T	ENSP00000294008:p.Ser476Thr		3587638	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	37	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	A	11.18	1.561977	0.27915	.	.	ENSG00000188827	ENST00000294008	T	0.01203	5.18	5.34	1.71	0.24356	.	0.615347	0.15485	N	0.259849	T	0.01421	0.0046	L	0.48642	1.525	0.09310	N	1	P	0.49090	0.919	B	0.42692	0.395	T	0.50898	-0.8773	10	0.59425	D	0.04	.	4.9973	0.14245	0.4757:0.1689:0.3554:0.0	.	476	Q8IY92	SLX4_HUMAN	T	476	ENSP00000294008:S476T	ENSP00000294008:S476T	S	-	1	0	SLX4	3587638	0.008000	0.16893	0.194000	0.23346	0.529000	0.34654	-0.133000	0.10451	0.016000	0.14998	0.533000	0.62120	TCT		0.527	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
LONP2	83752	broad.mit.edu	37	16	48295390	48295390	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr16:48295390A>G	ENST00000285737.4	+	5	872	c.779A>G	c.(778-780)gAt>gGt	p.D260G	LONP2_ENST00000535754.1_Missense_Mutation_p.D216G	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal									p.D260G(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						ACTTTAGAAGATGAAGATGAA	0.348																																					p.D260G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A779G	16						.						153.0	152.0	152.0					16																	48295390		2200	4300	6500	46852891	SO:0001583	missense	83752	exon5			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.779A>G	16.37:g.48295390A>G	ENSP00000285737:p.Asp260Gly		46852891	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	37	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	A	14.36	2.513586	0.44763	.	.	ENSG00000102910	ENST00000285737;ENST00000535754;ENST00000416006	T;T	0.33438	1.41;1.43	5.88	5.88	0.94601	.	0.377476	0.32624	N	0.005843	T	0.30696	0.0773	L	0.43152	1.355	0.44006	D	0.996711	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.04373	-1.0956	10	0.87932	D	0	-18.7683	16.2898	0.82742	1.0:0.0:0.0:0.0	.	216;260	B7ZKL7;Q86WA8	.;LONP2_HUMAN	G	260;216;216	ENSP00000285737:D260G;ENSP00000445426:D216G	ENSP00000285737:D260G	D	+	2	0	LONP2	46852891	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.630000	0.61297	2.250000	0.74265	0.482000	0.46254	GAT		0.348	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
CES1	1066	broad.mit.edu	37	16	55844459	55844459	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr16:55844459G>A	ENST00000361503.4	-	11	1415	c.1285C>T	c.(1285-1287)Cca>Tca	p.P429S	CES1_ENST00000422046.2_Missense_Mutation_p.P428S|CES1_ENST00000360526.3_Missense_Mutation_p.P430S			P23141	EST1_HUMAN	carboxylesterase 1	429					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.P430S(1)							all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	ATCACAGATGGGACACCAAAC	0.517																																					p.P428S	NSCLC(162;1801 2756 42904 52896)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1282T	16						.						176.0	181.0	180.0					16																	55844459		2198	4300	6498	54401960	SO:0001583	missense	1066	exon11			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.1285C>T	16.37:g.55844459G>A	ENSP00000355193:p.Pro429Ser		54401960	NM_001266	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	ENST00000361503.4	37	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	18.50	3.637158	0.67130	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.71461	-0.57;-0.57;-0.57	4.69	4.69	0.59074	Carboxylesterase, type B (1);	0.000000	0.64402	D	0.000008	T	0.80979	0.4728	M	0.75447	2.3	0.47862	D	0.999538	D;D;P	0.63046	0.96;0.992;0.951	P;P;P	0.61592	0.827;0.891;0.735	T	0.83003	-0.0176	10	0.59425	D	0.04	.	13.1724	0.59606	0.0:0.0:1.0:0.0	.	428;429;430	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	S	430;429;428;294	ENSP00000353720:P430S;ENSP00000355193:P429S;ENSP00000390492:P428S	ENSP00000353720:P430S	P	-	1	0	CES1	54401960	1.000000	0.71417	0.426000	0.26672	0.020000	0.10135	3.285000	0.51716	2.182000	0.69389	0.456000	0.33151	CCA		0.517	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
TERF2IP	54386	broad.mit.edu	37	16	75690361	75690361	+	Missense_Mutation	SNP	C	C	T	rs367821647		TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr16:75690361C>T	ENST00000300086.4	+	3	1149	c.1052C>T	c.(1051-1053)gCg>gTg	p.A351V		NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	351					negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A351V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						GCCTTCTTAGCGTCTGGTCAG	0.433																																					p.A351V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1052T	16						.	C	VAL/ALA	0,4396		0,0,2198	171.0	177.0	175.0		1052	2.3	1.0	16		175	1,8599	1.2+/-3.3	0,1,4299	no	missense	TERF2IP	NM_018975.3	64	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	benign	351/400	75690361	1,12995	2198	4300	6498	74247862	SO:0001583	missense	54386	exon3			AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.1052C>T	16.37:g.75690361C>T	ENSP00000300086:p.Ala351Val		74247862	NM_018975	B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Missense_Mutation	SNP	ENST00000300086.4	37	CCDS32491.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.714504	0.48622	0.0	1.16E-4	ENSG00000166848	ENST00000300086	T	0.41400	1.0	5.75	2.31	0.28768	.	0.377447	0.30528	N	0.009429	T	0.20251	0.0487	N	0.08118	0	0.26290	N	0.978138	B	0.23249	0.082	B	0.12837	0.008	T	0.14559	-1.0468	10	0.56958	D	0.05	-16.531	7.3858	0.26882	0.6076:0.3156:0.0767:0.0	.	351	Q9NYB0	TE2IP_HUMAN	V	351	ENSP00000300086:A351V	ENSP00000300086:A351V	A	+	2	0	TERF2IP	74247862	1.000000	0.71417	0.977000	0.42913	0.930000	0.56654	2.109000	0.41863	0.454000	0.26884	0.591000	0.81541	GCG		0.433	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000435519.1	NM_018975	
SLC6A1	6529	broad.mit.edu	37	3	11070971	11070971	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr3:11070971G>A	ENST00000287766.4	+	12	1677	c.1256G>A	c.(1255-1257)cGc>cAc	p.R419H	SLC6A1_ENST00000536032.1_Missense_Mutation_p.R241H	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	419					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)	p.R419H(1)		breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	CTCCGCAACCGCAGAGAGCTC	0.572																																					p.R419H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1256A	3						.						89.0	77.0	81.0					3																	11070971		2203	4300	6503	11045971	SO:0001583	missense	6529	exon12				CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.1256G>A	3.37:g.11070971G>A	ENSP00000287766:p.Arg419His		11045971	NM_003042	Q8N4K8	Missense_Mutation	SNP	ENST00000287766.4	37	CCDS2603.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534134	0.85812	.	.	ENSG00000157103	ENST00000287766;ENST00000536032	T;T	0.75589	-0.95;-0.95	5.69	5.69	0.88448	.	0.089576	0.48286	D	0.000186	D	0.84129	0.5404	L	0.55017	1.72	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.83182	-0.0088	10	0.48119	T	0.1	.	19.8099	0.96542	0.0:0.0:1.0:0.0	.	419	P30531	SC6A1_HUMAN	H	419;241	ENSP00000287766:R419H;ENSP00000445171:R241H	ENSP00000287766:R419H	R	+	2	0	SLC6A1	11045971	0.998000	0.40836	0.999000	0.59377	0.997000	0.91878	7.837000	0.86796	2.691000	0.91804	0.655000	0.94253	CGC		0.572	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042	
PIK3CA	5290	broad.mit.edu	37	3	178921553	178921553	+	Missense_Mutation	SNP	T	T	A	rs121913284		TCGA-AG-A00H-01	TCGA-AG-A00H-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr3:178921553T>A	ENST00000263967.3	+	5	1192	c.1035T>A	c.(1033-1035)aaT>aaA	p.N345K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	345	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.N345K(44)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTACGTGAATGTAAATATTC	0.308		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.N345K	Colon(199;1504 1750 3362 26421 31210 32040)		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA,breast,NS,Substitution - Missense,0	.	44	Substitution - Missense(44)	breast(27)|endometrium(6)|large_intestine(6)|central_nervous_system(5)	c.T1035A	3						.						67.0	66.0	66.0					3																	178921553		1807	4074	5881	180404247	SO:0001583	missense	5290	exon5				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1035T>A	3.37:g.178921553T>A	ENSP00000263967:p.Asn345Lys		180404247	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002090	0.54254	.	.	ENSG00000121879	ENST00000263967	T	0.70164	-0.46	5.41	3.03	0.35002	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75465	-0.3308	10	0.49607	T	0.09	-21.0442	9.7159	0.40274	0.0:0.1415:0.0:0.8585	.	345	P42336	PK3CA_HUMAN	K	345	ENSP00000263967:N345K	ENSP00000263967:N345K	N	+	3	2	PIK3CA	180404247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.030000	0.41108	0.441000	0.26529	0.402000	0.26972	AAT		0.308	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ARPP21	10777	broad.mit.edu	37	3	35833951	35833951	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr3:35833951G>A	ENST00000187397.4	+	19	2566	c.2110G>A	c.(2110-2112)Gtg>Atg	p.V704M	ARPP21_ENST00000476052.1_3'UTR|ARPP21_ENST00000444190.1_Missense_Mutation_p.V685M|ARPP21_ENST00000458225.1_Missense_Mutation_p.V705M|ARPP21_ENST00000417925.1_Missense_Mutation_p.V705M|ARPP21_ENST00000337271.5_Missense_Mutation_p.V685M	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	704	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)	p.V704M(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GAGTCAGAACGTGATAAATAA	0.468																																					p.V704M												.	.	2	Substitution - Missense(2)	large_intestine(1)|prostate(1)	c.G2110A	3						.						158.0	145.0	149.0					3																	35833951		2203	4300	6503	35808955	SO:0001583	missense	10777	exon19			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2110G>A	3.37:g.35833951G>A	ENSP00000187397:p.Val704Met		35808955	NM_016300	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	ENST00000187397.4	37	CCDS2661.1	.	.	.	.	.	.	.	.	.	.	G	12.48	1.949519	0.34377	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	5.71	0.437	0.16555	.	0.331639	0.25964	N	0.027168	T	0.37732	0.1014	L	0.36672	1.1	0.09310	N	0.999992	P;D;P;P	0.53619	0.906;0.961;0.848;0.906	B;P;B;B	0.44359	0.329;0.447;0.163;0.329	T	0.26677	-1.0096	10	0.45353	T	0.12	-2.568	4.5612	0.12161	0.1534:0.3192:0.4348:0.0926	.	705;227;704;685	Q9UBL0-3;Q9UBL0-5;Q9UBL0;Q9UBL0-4	.;.;ARP21_HUMAN;.	M	705;685;685;704;705	ENSP00000414351:V705M;ENSP00000337792:V685M;ENSP00000405276:V685M;ENSP00000187397:V704M;ENSP00000412326:V705M	ENSP00000187397:V704M	V	+	1	0	ARPP21	35808955	0.141000	0.22595	0.043000	0.18650	0.772000	0.43724	0.441000	0.21611	0.048000	0.15891	0.655000	0.94253	GTG		0.468	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253334.2	NM_198399	
ACKR2	1238	broad.mit.edu	37	3	42906323	42906323	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr3:42906323G>T	ENST00000422265.1	+	3	504	c.329G>T	c.(328-330)tGg>tTg	p.W110L	ACKR2_ENST00000442925.1_Missense_Mutation_p.W110L|RP11-141M3.5_ENST00000471537.1_RNA|CYP8B1_ENST00000437102.1_Intron|KRBOX1_ENST00000426937.1_Intron|ACKR2_ENST00000273145.2_Missense_Mutation_p.W110L	NM_001296.4	NP_001287.2	O00590	ACKR2_HUMAN	atypical chemokine receptor 2	110					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|multicellular organismal development (GO:0007275)|neutrophil activation (GO:0042119)|receptor-mediated endocytosis (GO:0006898)	actin filament (GO:0005884)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-X-C chemokine receptor activity (GO:0016494)|chemokine receptor activity (GO:0004950)|scavenger receptor activity (GO:0005044)	p.W110L(1)									GCCTGGCATTGGGTCTTCGGG	0.493																																					p.W110L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G329T	3						.						155.0	155.0	155.0					3																	42906323		2203	4300	6503	42881327	SO:0001583	missense	1238	exon3			U94888	CCDS2706.1	3p21.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144648	ENSG00000144648		"""GPCR / Class A : Chemokine receptors : Atypical"""	1565	protein-coding gene	gene with protein product		602648	"""chemokine binding protein 2"""	CMKBR9, CCBP2		9364936, 9405404, 16148	Standard	NM_001296		Approved	CCR10, D6, CCR9	uc003cme.3	O00590	OTTHUMG00000133040	ENST00000422265.1:c.329G>T	3.37:g.42906323G>T	ENSP00000416996:p.Trp110Leu		42881327	NM_001296	B2R8Y8|O00537|Q53YA1|Q86UN9|Q96A02	Missense_Mutation	SNP	ENST00000422265.1	37	CCDS2706.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691509	0.88735	.	.	ENSG00000144648	ENST00000442925;ENST00000422265;ENST00000273145	T;T;T	0.77358	-1.09;-1.09;-1.09	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000279	D	0.92054	0.7482	H	0.96239	3.79	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94434	0.7652	9	.	.	.	.	17.485	0.87684	0.0:0.0:1.0:0.0	.	110;110	O00590;Q7Z7I1	CCBP2_HUMAN;.	L	110	ENSP00000396150:W110L;ENSP00000416996:W110L;ENSP00000273145:W110L	.	W	+	2	0	CCBP2	42881327	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	5.596000	0.67570	2.477000	0.83638	0.563000	0.77884	TGG		0.493	ACKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256645.2	NM_001296	
ALAS1	211	broad.mit.edu	37	3	52236599	52236599	+	Silent	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr3:52236599G>A	ENST00000394965.2	+	4	636	c.276G>A	c.(274-276)ccG>ccA	p.P92P	ALAS1_ENST00000469224.1_Silent_p.P92P|ALAS1_ENST00000484952.1_Silent_p.P92P|ALAS1_ENST00000310271.2_Silent_p.P92P	NM_000688.5	NP_000679.1	P13196	HEM1_HUMAN	aminolevulinate, delta-, synthase 1	92					cellular lipid metabolic process (GO:0044255)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5-aminolevulinate synthase activity (GO:0003870)|pyridoxal phosphate binding (GO:0030170)	p.P92P(1)		endometrium(3)|kidney(3)|large_intestine(7)|liver(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)	CACAGCTTCCGTCTGGACACC	0.537																																					p.P92P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G276A	3						.						69.0	62.0	65.0					3																	52236599		2203	4300	6503	52211639	SO:0001819	synonymous_variant	211	exon4			X56351	CCDS2847.1	3p21	2004-11-18			ENSG00000023330	ENSG00000023330	2.3.1.37		396	protein-coding gene	gene with protein product		125290		ALAS3, ALAS			Standard	NM_000688		Approved		uc003dcz.2	P13196	OTTHUMG00000158108	ENST00000394965.2:c.276G>A	3.37:g.52236599G>A			52211639	NM_000688		Silent	SNP	ENST00000394965.2	37	CCDS2847.1	.	.	.	.	.	.	.	.	.	.	G	9.103	1.004600	0.19199	.	.	ENSG00000023330	ENST00000441729	.	.	.	5.23	-7.82	0.01205	.	.	.	.	.	T	0.49253	0.1546	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60073	-0.7334	5	0.72032	D	0.01	-12.7331	1.7733	0.03016	0.4731:0.1778:0.1121:0.237	.	.	.	.	H	92	.	ENSP00000392725:R92H	R	+	2	0	ALAS1	52211639	0.000000	0.05858	0.402000	0.26371	0.984000	0.73092	-3.366000	0.00496	-1.170000	0.02769	-0.123000	0.14984	CGT		0.537	ALAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350207.1		
RNF168	165918	broad.mit.edu	37	3	196214300	196214300	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr3:196214300C>A	ENST00000318037.3	-	3	1122	c.528G>T	c.(526-528)gaG>gaT	p.E176D		NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	176	Glu-rich.				cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E176D(1)		NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		TTGCCAGTTCCTCATCACTTT	0.453																																					p.E176D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G528T	3						.						551.0	510.0	524.0					3																	196214300		2203	4300	6503	197698697	SO:0001583	missense	165918	exon3			AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.528G>T	3.37:g.196214300C>A	ENSP00000320898:p.Glu176Asp		197698697	NM_152617	Q8NA67|Q96NS4	Missense_Mutation	SNP	ENST00000318037.3	37	CCDS3317.1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.784725	0.70222	.	.	ENSG00000163961	ENST00000318037	T	0.10860	2.83	5.41	-1.32	0.09201	.	0.000000	0.56097	D	0.000022	T	0.27629	0.0679	M	0.80183	2.485	0.43782	D	0.996314	D	0.76494	0.999	P	0.62885	0.908	T	0.05194	-1.0900	10	0.66056	D	0.02	-12.0857	12.4329	0.55583	0.0:0.5338:0.0:0.4662	.	176	Q8IYW5	RN168_HUMAN	D	176	ENSP00000320898:E176D	ENSP00000320898:E176D	E	-	3	2	RNF168	197698697	0.986000	0.35501	0.846000	0.33378	0.956000	0.61745	0.474000	0.22148	-0.340000	0.08388	-0.238000	0.12139	GAG		0.453	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
KRAS	3845	broad.mit.edu	37	12	25378562	25378562	+	Missense_Mutation	SNP	C	C	T	rs121913527		TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr12:25378562C>T	ENST00000256078.4	-	4	499	c.436G>A	c.(436-438)Gca>Aca	p.A146T	KRAS_ENST00000311936.3_Missense_Mutation_p.A146T|AC087239.1_ENST00000594112.1_5'Flank|KRAS_ENST00000557334.1_Intron	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	146			A -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.A146T(75)|p.A146P(7)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CTTGTCTTTGCTGATGTTTCA	0.323	A146T(AMO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|A146T(LS1034_LARGE_INTESTINE)|A146T(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.A146T	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,large_intestine,NS,Substitution - Missense,0	.	82	Substitution - Missense(82)	large_intestine(69)|haematopoietic_and_lymphoid_tissue(11)|lung(2)	c.G436A	12						.						207.0	188.0	195.0					12																	25378562		2203	4300	6503	25269829	SO:0001583	missense	3845	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.436G>A	12.37:g.25378562C>T	ENSP00000256078:p.Ala146Thr		25269829	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	33	5.234460	0.95207	.	.	ENSG00000133703	ENST00000311936;ENST00000256078	D;D	0.88741	-2.42;-2.42	5.52	5.52	0.82312	Small GTP-binding protein domain (1);	0.045975	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;0.963	D;P	0.76071	0.987;0.876	D	0.97524	1.0075	10	0.72032	D	0.01	.	18.7849	0.91951	0.0:1.0:0.0:0.0	.	146;146	P01116-2;P01116	.;RASK_HUMAN	T	146	ENSP00000308495:A146T;ENSP00000256078:A146T	ENSP00000256078:A146T	A	-	1	0	KRAS	25269829	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.762000	0.85270	2.757000	0.94681	0.585000	0.79938	GCA		0.323	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TMBIM4	51643	broad.mit.edu	37	12	66541706	66541706	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr12:66541706G>C	ENST00000358230.3	-	4	448	c.328C>G	c.(328-330)Ctg>Gtg	p.L110V	TMBIM4_ENST00000556010.1_Missense_Mutation_p.L110V|TMBIM4_ENST00000398033.4_Missense_Mutation_p.L110V|TMBIM4_ENST00000539652.1_Missense_Mutation_p.L110V|TMBIM4_ENST00000286424.7_Missense_Mutation_p.L157V|TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000542724.1_Missense_Mutation_p.L79V	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	110					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)		p.L110V(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		GCCACAGTCAGAGCTTCCAAC	0.323																																					p.L110V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C328G	12						.						44.0	43.0	43.0					12																	66541706		1817	4081	5898	64827973	SO:0001583	missense	51643	exon4			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.328C>G	12.37:g.66541706G>C	ENSP00000350965:p.Leu110Val		64827973	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	37	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	G	9.667	1.145724	0.21288	.	.	ENSG00000155957	ENST00000556010;ENST00000358230;ENST00000426857;ENST00000286424;ENST00000398033;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.19	3.31	0.37934	.	0.457457	0.21973	N	0.066433	T	0.34861	0.0912	L	0.39326	1.205	0.36374	D	0.861509	B;B;B;B;B	0.16166	0.003;0.003;0.001;0.016;0.0	B;B;B;B;B	0.17979	0.02;0.011;0.02;0.009;0.012	T	0.24476	-1.0159	9	.	.	.	1.7822	8.175	0.31276	0.082:0.3025:0.6155:0.0	.	110;157;110;79;110	E7EWY5;G3XAA5;E7EQ00;G3V1M2;Q9HC24	.;.;.;.;TMBI4_HUMAN	V	110;110;110;157;110;110;156;79	ENSP00000451688:L110V;ENSP00000350965:L110V;ENSP00000286424:L157V;ENSP00000381114:L110V;ENSP00000441291:L79V	.	L	-	1	2	TMBIM4	64827973	0.998000	0.40836	0.995000	0.50966	0.815000	0.46073	0.646000	0.24797	0.663000	0.31027	0.585000	0.79938	CTG		0.323	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
TGM5	9333	broad.mit.edu	37	15	43531101	43531101	+	Missense_Mutation	SNP	G	G	T	rs140691294		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr15:43531101G>T	ENST00000220420.5	-	9	1266	c.1259C>A	c.(1258-1260)aCg>aAg	p.T420K	TGM5_ENST00000349114.4_Missense_Mutation_p.T338K	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	420					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.T420K(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	AACAGAACTCGTGTCCTGGTG	0.493																																					p.T338K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1013A	15						.						188.0	149.0	163.0					15																	43531101		2202	4299	6501	41318393	SO:0001583	missense	9333	exon8			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1259C>A	15.37:g.43531101G>T	ENSP00000220420:p.Thr420Lys		41318393	NM_004245	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	ENST00000220420.5	37	CCDS32212.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176291	0.57692	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	T;T	0.66099	-0.19;-0.19	5.55	5.55	0.83447	.	0.504943	0.19830	N	0.105102	T	0.71576	0.3356	L	0.39514	1.22	0.41761	D	0.989711	D;D	0.71674	0.969;0.998	P;D	0.63793	0.904;0.918	T	0.73917	-0.3831	10	0.87932	D	0	-16.5279	17.0051	0.86391	0.0:0.0:1.0:0.0	.	338;420	O43548-2;O43548	.;TGM5_HUMAN	K	420;338;419	ENSP00000220420:T420K;ENSP00000220419:T338K	ENSP00000220420:T420K	T	-	2	0	TGM5	41318393	1.000000	0.71417	0.923000	0.36655	0.113000	0.19764	5.198000	0.65147	2.620000	0.88729	0.563000	0.77884	ACG		0.493	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432257.1	NM_004245	
CRMP1	1400	broad.mit.edu	37	4	5862769	5862769	+	Silent	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr4:5862769G>A	ENST00000397890.2	-	3	511	c.297C>T	c.(295-297)ggC>ggT	p.G99G	CRMP1_ENST00000324989.7_Silent_p.G213G|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Silent_p.G97G	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	99					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.G213G(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TCGTGGTCCCGCCCACCAGTG	0.577																																					p.G99G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T	4						.						91.0	83.0	86.0					4																	5862769		2203	4300	6503	5913670	SO:0001819	synonymous_variant	1400	exon3			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.297C>T	4.37:g.5862769G>A			5913670	NM_001313	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000397890.2	37	CCDS43207.1																																																																																				0.577	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358871.1	NM_001313	
NLGN4X	57502	broad.mit.edu	37	X	5811130	5811130	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chrX:5811130C>A	ENST00000381095.3	-	6	2806	c.2179G>T	c.(2179-2181)Gaa>Taa	p.E727*	NLGN4X_ENST00000381092.1_Nonsense_Mutation_p.E727*|NLGN4X_ENST00000538097.1_Nonsense_Mutation_p.E727*|NLGN4X_ENST00000275857.6_Nonsense_Mutation_p.E727*|NLGN4X_ENST00000381093.2_Nonsense_Mutation_p.E747*	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	727					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)	p.E727*(1)|p.E727K(1)		breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						ATGATCTCTTCGTTCTGGATG	0.552																																					p.E727X												.	.	2	Substitution - Missense(1)|Substitution - Nonsense(1)	large_intestine(2)	c.G2179T	X						.						156.0	116.0	130.0					X																	5811130		2203	4300	6503	5821130	SO:0001587	stop_gained	57502	exon6			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.2179G>T	X.37:g.5811130C>A	ENSP00000370485:p.Glu727*		5821130	NM_020742	Q6UX10|Q9ULG0	Nonsense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	41	8.696672	0.98918	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	.	.	.	3.82	3.82	0.43975	.	0.489617	0.15194	N	0.275364	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	14.222	0.65833	0.0:1.0:0.0:0.0	.	.	.	.	X	727;747;727;727;727	.	ENSP00000275857:E727X	E	-	1	0	NLGN4X	5821130	1.000000	0.71417	0.906000	0.35671	0.071000	0.16799	6.528000	0.73807	1.508000	0.48769	0.513000	0.50165	GAA		0.552	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
PHKA2	5256	broad.mit.edu	37	X	18923928	18923928	+	Silent	SNP	T	T	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chrX:18923928T>C	ENST00000379942.4	-	26	3521	c.2856A>G	c.(2854-2856)aaA>aaG	p.K952K		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	952					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.K952K(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCAGGAGATTTTTCATATCGA	0.448																																					p.K952K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2856G	X						.						164.0	148.0	153.0					X																	18923928		2203	4300	6503	18833849	SO:0001819	synonymous_variant	5256	exon26				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2856A>G	X.37:g.18923928T>C			18833849	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	ENST00000379942.4	37	CCDS14190.1																																																																																				0.448	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
FAM47B	170062	broad.mit.edu	37	X	34962201	34962201	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chrX:34962201G>A	ENST00000329357.5	+	1	1289	c.1253G>A	c.(1252-1254)cGt>cAt	p.R418H		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	418								p.R418H(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						CCCAAGACTCGTCGGGTGTCC	0.562																																					p.R418H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1253A	X						.						68.0	61.0	63.0					X																	34962201		2202	4300	6502	34872122	SO:0001583	missense	170062	exon1			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1253G>A	X.37:g.34962201G>A	ENSP00000328307:p.Arg418His		34872122	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	G	2.596	-0.294170	0.05568	.	.	ENSG00000189132	ENST00000329357	T	0.16457	2.34	0.158	-0.317	0.12736	.	.	.	.	.	T	0.16257	0.0391	M	0.78049	2.395	0.09310	N	1	B	0.31174	0.311	B	0.24974	0.057	T	0.22034	-1.0228	8	0.46703	T	0.11	.	.	.	.	.	418	Q8NA70	FA47B_HUMAN	H	418	ENSP00000328307:R418H	ENSP00000328307:R418H	R	+	2	0	FAM47B	34872122	0.039000	0.19947	0.002000	0.10522	0.003000	0.03518	-0.809000	0.04510	-1.095000	0.03050	-1.093000	0.02169	CGT		0.562	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
F8	2157	broad.mit.edu	37	X	154158723	154158723	+	Silent	SNP	C	C	T	rs200593763		TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chrX:154158723C>T	ENST00000360256.4	-	14	3542	c.3342G>A	c.(3340-3342)tcG>tcA	p.S1114S		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1114	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)	p.S1114S(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCTTAAAGAACGACATATCTG	0.413																																					p.S1114S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G3342A	X						.	T		0,3835		0,0,1632,571	72.0	67.0	69.0		3342	-3.0	0.0	X		69	1,6724		0,1,2426,1871	no	coding-synonymous	F8	NM_000132.3		0,1,4058,2442	TT,TC,CC,C		0.0149,0.0,0.0095		1114/2352	154158723	1,10559	2203	4298	6501	153811917	SO:0001819	synonymous_variant	2157	exon14			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3342G>A	X.37:g.154158723C>T			153811917	NM_000132	Q14286|Q5HY69	Silent	SNP	ENST00000360256.4	37	CCDS35457.1																																																																																				0.413	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058869.4		
PXDN	7837	broad.mit.edu	37	2	1667405	1667405	+	Silent	SNP	G	G	A	rs202202761		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr2:1667405G>A	ENST00000252804.4	-	12	1589	c.1539C>T	c.(1537-1539)gtC>gtT	p.V513V	PXDN_ENST00000483018.1_5'Flank	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	513	Ig-like C2-type 3.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.V513V(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GGTGGGCCACGACCTTCTGGG	0.547																																					p.V513V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1539T	2						.	G		0,4064		0,0,2032	84.0	92.0	89.0		1539	-11.6	0.0	2		89	1,8323		0,1,4161	no	coding-synonymous	PXDN	NM_012293.1		0,1,6193	AA,AG,GG		0.012,0.0,0.0081		513/1480	1667405	1,12387	2032	4162	6194	1646412	SO:0001819	synonymous_variant	7837	exon12			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.1539C>T	2.37:g.1667405G>A			1646412	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	G	8.726	0.915479	0.17907	0.0	1.2E-4	ENSG00000130508	ENST00000433670	.	.	.	5.79	-11.6	0.00059	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.35671	D	0.813346	.	.	.	.	.	.	T	0.69924	-0.5013	4	.	.	.	-32.7278	14.2933	0.66295	0.3444:0.4676:0.188:0.0	.	.	.	.	L	509	.	.	S	-	2	0	PXDN	1646412	0.000000	0.05858	0.015000	0.15790	0.901000	0.52897	-1.548000	0.02184	-3.704000	0.00118	-0.136000	0.14681	TCG		0.547	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
TTC27	55622	broad.mit.edu	37	2	32958948	32958948	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr2:32958948G>T	ENST00000317907.4	+	11	1518	c.1287G>T	c.(1285-1287)aaG>aaT	p.K429N		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	429								p.K429N(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						AACGCCTGAAGATTTTCTATT	0.358																																					p.K379N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1137T	2						.						152.0	140.0	144.0					2																	32958948		2203	4300	6503	32812452	SO:0001583	missense	55622	exon11			BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.1287G>T	2.37:g.32958948G>T	ENSP00000313953:p.Lys429Asn		32812452	NM_001193509	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	37	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985332	0.53934	.	.	ENSG00000018699	ENST00000317907	T	0.31510	1.49	5.42	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.49389	0.1554	M	0.69823	2.125	0.48395	D	0.999642	D	0.76494	0.999	D	0.68943	0.961	T	0.48151	-0.9060	10	0.49607	T	0.09	-17.7025	8.6741	0.34167	0.1752:0.0:0.8248:0.0	.	429	Q6P3X3	TTC27_HUMAN	N	429	ENSP00000313953:K429N	ENSP00000313953:K429N	K	+	3	2	TTC27	32812452	1.000000	0.71417	0.947000	0.38551	0.385000	0.30292	2.039000	0.41193	1.260000	0.44134	0.650000	0.86243	AAG		0.358	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
SP140L	93349	broad.mit.edu	37	2	231254710	231254710	+	Silent	SNP	A	A	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr2:231254710A>T	ENST00000415673.2	+	11	1022	c.936A>T	c.(934-936)ggA>ggT	p.G312G	SP140L_ENST00000396563.4_Intron|SP140L_ENST00000243810.6_Silent_p.G312G|SP140L_ENST00000444636.1_Silent_p.G312G	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	312	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G312G(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						GGGTGAAGGGAATTTTACATA	0.398																																					p.G312G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A936T	2						.						111.0	102.0	105.0					2																	231254710		1831	4096	5927	230962954	SO:0001819	synonymous_variant	93349	exon11			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.936A>T	2.37:g.231254710A>T			230962954	NM_138402	Q2M375|Q4ZG65|Q9BSP3	Silent	SNP	ENST00000415673.2	37	CCDS46538.1																																																																																				0.398	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374538.1	NM_138402	
CNTLN	54875	broad.mit.edu	37	9	17457636	17457636	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr9:17457636C>A	ENST00000380647.3	+	19	3313	c.3229C>A	c.(3229-3231)Cca>Aca	p.P1077T	CNTLN_ENST00000425824.1_Missense_Mutation_p.P1077T|CNTLN_ENST00000262360.5_Missense_Mutation_p.P1077T			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1077					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.P1077T(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGTAACATTTCCACGGATACA	0.353																																					p.P1077T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3229A	9						.						76.0	75.0	76.0					9																	17457636		1816	4081	5897	17447636	SO:0001583	missense	54875	exon19			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3229C>A	9.37:g.17457636C>A	ENSP00000370021:p.Pro1077Thr		17447636	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	37	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348547	0.41599	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.18657	2.2;2.2;2.47	5.37	4.46	0.54185	.	.	.	.	.	T	0.32194	0.0821	M	0.67953	2.075	0.22933	N	0.998547	D;B;B	0.60575	0.988;0.004;0.004	P;B;B	0.58721	0.844;0.018;0.012	T	0.17410	-1.0370	9	0.18710	T	0.47	.	4.9122	0.13827	0.133:0.5886:0.1974:0.081	.	1077;1077;1077	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	T	1077	ENSP00000370021:P1077T;ENSP00000392798:P1077T;ENSP00000262360:P1077T	ENSP00000262360:P1077T	P	+	1	0	CNTLN	17447636	0.345000	0.24835	0.899000	0.35326	0.794000	0.44872	0.741000	0.26202	1.373000	0.46208	0.591000	0.81541	CCA		0.353	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
NPR2	4882	broad.mit.edu	37	9	35792684	35792684	+	Silent	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr9:35792684C>T	ENST00000342694.2	+	1	534	c.279C>T	c.(277-279)ccC>ccT	p.P93P		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	93					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.P93P(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	ACCATGACCCCGACCTGCTGT	0.652																																					p.P93P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C279T	9						.						118.0	107.0	110.0					9																	35792684		2203	4300	6503	35782684	SO:0001819	synonymous_variant	4882	exon1			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.279C>T	9.37:g.35792684C>T			35782684	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Silent	SNP	ENST00000342694.2	37	CCDS6590.1																																																																																				0.652	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
APBA1	320	broad.mit.edu	37	9	72131035	72131035	+	Silent	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr9:72131035G>A	ENST00000265381.4	-	2	1314	c.1092C>T	c.(1090-1092)acC>acT	p.T364T		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	364					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.T364T(1)		endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GCGAACGGATGGTCCTGGTTT	0.632																																					p.T364T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1092T	9						.						139.0	106.0	117.0					9																	72131035		2203	4300	6503	71320855	SO:0001819	synonymous_variant	320	exon2			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1092C>T	9.37:g.72131035G>A			71320855	NM_001163	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	37	CCDS6630.1																																																																																				0.632	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
C9orf171	389799	broad.mit.edu	37	9	135413023	135413023	+	Missense_Mutation	SNP	G	G	A	rs375659445		TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr9:135413023G>A	ENST00000343036.2	+	5	716	c.668G>A	c.(667-669)cGg>cAg	p.R223Q	C9orf171_ENST00000393216.2_Missense_Mutation_p.R187Q	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	223								p.R223Q(1)		large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						CTGCAGCACCGGTACCTGCAG	0.572																																					p.R223Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G668A	9						.	G	GLN/ARG	0,4406		0,0,2203	103.0	104.0	104.0		668	2.1	1.0	9		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	C9orf171	NM_207417.1	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	223/321	135413023	1,13005	2203	4300	6503	134402844	SO:0001583	missense	389799	exon5			AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.668G>A	9.37:g.135413023G>A	ENSP00000343290:p.Arg223Gln		134402844	NM_207417	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	37	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257966	0.80246	0.0	1.16E-4	ENSG00000188523	ENST00000343036;ENST00000393216	T;T	0.22539	1.95;1.95	5.36	2.13	0.27403	.	0.236354	0.30920	N	0.008601	T	0.27524	0.0676	L	0.54323	1.7	0.27912	N	0.938567	P;D	0.69078	0.948;0.997	B;P	0.53549	0.322;0.729	T	0.06516	-1.0822	10	0.66056	D	0.02	.	7.2066	0.25911	0.4083:0.0:0.5917:0.0	.	187;223	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	Q	223;187	ENSP00000343290:R223Q;ENSP00000376909:R187Q	ENSP00000343290:R223Q	R	+	2	0	C9orf171	134402844	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.008000	0.29872	0.640000	0.30582	0.591000	0.81541	CGG		0.572	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
SACS	26278	broad.mit.edu	37	13	23914840	23914840	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr13:23914840C>G	ENST00000382292.3	-	9	3448	c.3175G>C	c.(3175-3177)Gaa>Caa	p.E1059Q	SACS_ENST00000382298.3_Missense_Mutation_p.E1059Q|SACS_ENST00000402364.1_Missense_Mutation_p.E309Q			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1059					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.E912Q(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTAGTACTTCTATATCAGGG	0.383																																					p.E1059Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3175C	13						.						111.0	114.0	113.0					13																	23914840		2203	4300	6503	22812840	SO:0001583	missense	26278	exon10			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.3175G>C	13.37:g.23914840C>G	ENSP00000371729:p.Glu1059Gln		22812840	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399570	0.42512	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.89552	-2.37;-2.53;-2.37	5.96	4.21	0.49690	.	0.107333	0.64402	D	0.000006	D	0.82765	0.5108	L	0.34521	1.04	0.38552	D	0.949482	B	0.23735	0.09	B	0.20384	0.029	T	0.81300	-0.0995	10	0.49607	T	0.09	.	12.338	0.55079	0.0:0.8167:0.1185:0.0648	.	1059	Q9NZJ4	SACS_HUMAN	Q	1059;309;1059	ENSP00000371729:E1059Q;ENSP00000385844:E309Q;ENSP00000371735:E1059Q	ENSP00000371729:E1059Q	E	-	1	0	SACS	22812840	1.000000	0.71417	0.580000	0.28601	0.923000	0.55619	4.489000	0.60309	1.519000	0.48950	0.585000	0.79938	GAA		0.383	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
NBEA	26960	broad.mit.edu	37	13	35770298	35770298	+	Missense_Mutation	SNP	A	A	T	rs368594146		TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr13:35770298A>T	ENST00000400445.3	+	31	5759	c.5225A>T	c.(5224-5226)aAt>aTt	p.N1742I	NBEA_ENST00000540320.1_Missense_Mutation_p.N1742I|NBEA_ENST00000379939.2_Missense_Mutation_p.N1739I|NBEA_ENST00000310336.4_Missense_Mutation_p.N1742I	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1742					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)		p.N1742I(1)		NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AAAGGCATCAATGTGAAGGAA	0.423																																					p.N1742I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A5225T	13						.						85.0	83.0	83.0					13																	35770298		1889	4135	6024	34668298	SO:0001583	missense	26960	exon31			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5225A>T	13.37:g.35770298A>T	ENSP00000383295:p.Asn1742Ile		34668298	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341628	0.81911	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.63417	-0.04;-0.04;-0.03;-0.04	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.77260	0.4104	M	0.67397	2.05	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.68765	0.96;0.959	T	0.79524	-0.1768	10	0.72032	D	0.01	.	16.179	0.81887	1.0:0.0:0.0:0.0	.	1742;1739	Q8NFP9;Q5T321	NBEA_HUMAN;.	I	1742;1742;1739;1742;369	ENSP00000440951:N1742I;ENSP00000383295:N1742I;ENSP00000369271:N1739I;ENSP00000308534:N1742I	ENSP00000308534:N1742I	N	+	2	0	NBEA	34668298	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	8.730000	0.91510	2.232000	0.73038	0.477000	0.44152	AAT		0.423	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
EDNRB	1910	broad.mit.edu	37	13	78477673	78477673	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr13:78477673C>T	ENST00000334286.5	-	2	789	c.553G>A	c.(553-555)Gtg>Atg	p.V185M	EDNRB_ENST00000446573.1_Missense_Mutation_p.V185M|EDNRB_ENST00000377211.4_Missense_Mutation_p.V275M	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	185					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)	p.V185M(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GTGATTCCCACAGAGGCTTTC	0.433																																					p.V185M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G553A	13	GRCh37	CM081580	EDNRB	M		.						75.0	72.0	73.0					13																	78477673		2203	4300	6503	77375674	SO:0001583	missense	1910	exon2			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.553G>A	13.37:g.78477673C>T	ENSP00000335311:p.Val185Met		77375674	NM_001122659	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	ENST00000334286.5	37	CCDS9461.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.884180	0.91814	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.72167	-0.63;-0.63;-0.63	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.82848	0.5126	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;0.991;1.0	D;D;D	0.81914	0.991;0.937;0.995	D	0.83797	0.0234	10	0.87932	D	0	-18.3762	19.6906	0.95999	0.0:1.0:0.0:0.0	.	185;275;185	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	M	275;185;185	ENSP00000366416:V275M;ENSP00000403401:V185M;ENSP00000335311:V185M	ENSP00000335311:V185M	V	-	1	0	EDNRB	77375674	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	7.484000	0.81180	2.627000	0.88993	0.650000	0.86243	GTG		0.433	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276505.1		
CNNM2	54805	broad.mit.edu	37	10	104679743	104679743	+	Silent	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr10:104679743C>T	ENST00000369878.4	+	1	1694	c.1506C>T	c.(1504-1506)ttC>ttT	p.F502F	CNNM2_ENST00000433628.2_Silent_p.F502F|CNNM2_ENST00000369875.3_Silent_p.F502F	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	502	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.F502F(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		ACTTGGCCTTCGTGGATCCCG	0.502																																					p.F502F												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1506T	10						.						124.0	126.0	125.0					10																	104679743		2203	4300	6503	104669733	SO:0001819	synonymous_variant	54805	exon1			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1506C>T	10.37:g.104679743C>T			104669733	NM_199077	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	ENST00000369878.4	37	CCDS44474.1																																																																																				0.502	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050113.3	NM_017649	
ADD3	120	broad.mit.edu	37	10	111883966	111883966	+	Silent	SNP	T	T	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr10:111883966T>C	ENST00000356080.4	+	10	1702	c.1335T>C	c.(1333-1335)acT>acC	p.T445T	ADD3_ENST00000277900.8_Silent_p.T445T|ADD3_ENST00000360162.3_Silent_p.T445T	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	445						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.T445T(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		CACCAAATACTTACATGAAAG	0.438																																					p.T445T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1335C	10						.						116.0	105.0	109.0					10																	111883966		2203	4300	6503	111873956	SO:0001819	synonymous_variant	120	exon10			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.1335T>C	10.37:g.111883966T>C			111873956	NM_019903	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Silent	SNP	ENST00000356080.4	37	CCDS7561.1																																																																																				0.438	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
SKIDA1	387640	broad.mit.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Silent_p.E343E	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A	10						.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	21845492	SO:0001819	synonymous_variant	387640	exon4			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	10.37:g.21805486C>T			21845492	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																				0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
P4HA1	5033	broad.mit.edu	37	10	74810943	74810943	+	Silent	SNP	T	T	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr10:74810943T>C	ENST00000307116.2	-	7	884	c.768A>G	c.(766-768)aaA>aaG	p.K256K	P4HA1_ENST00000373008.2_Silent_p.K256K|P4HA1_ENST00000394890.2_Silent_p.K256K|P4HA1_ENST00000440381.1_Silent_p.K256K|P4HA1_ENST00000263556.3_Silent_p.K256K|P4HA1_ENST00000412021.2_Silent_p.K256K			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	256					collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)	p.K256K(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TATTGACATCTTTTTCTTTAG	0.373																																					p.K256K	Colon(147;367 2405 2662 52127)											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A768G	10						.						139.0	139.0	139.0					10																	74810943		2203	4300	6503	74480949	SO:0001819	synonymous_variant	5033	exon8				CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.768A>G	10.37:g.74810943T>C			74480949	NM_001142595	C9JL12|Q15082|Q15083|Q5VSQ5	Silent	SNP	ENST00000307116.2	37																																																																																					0.373	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	NM_000917	
ZRANB1	54764	broad.mit.edu	37	10	126655346	126655346	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr10:126655346C>G	ENST00000359653.4	+	2	1369	c.998C>G	c.(997-999)aCa>aGa	p.T333R		NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	333					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.T333R(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		ATATTGCTTACAGAGGTAAGT	0.353																																					p.T333R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C998G	10						.						179.0	151.0	160.0					10																	126655346		2203	4300	6503	126645336	SO:0001583	missense	54764	exon2			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.998C>G	10.37:g.126655346C>G	ENSP00000352676:p.Thr333Arg		126645336	NM_017580	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	37	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380898	0.82792	.	.	ENSG00000019995	ENST00000359653	T	0.18016	2.24	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.40645	0.1125	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	T	0.05162	-1.0902	10	0.72032	D	0.01	-2.6552	20.2789	0.98501	0.0:1.0:0.0:0.0	.	333	Q9UGI0	ZRAN1_HUMAN	R	333	ENSP00000352676:T333R	ENSP00000352676:T333R	T	+	2	0	ZRANB1	126645336	1.000000	0.71417	0.982000	0.44146	0.638000	0.38207	7.461000	0.80834	2.788000	0.95919	0.650000	0.86243	ACA		0.353	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580	
LRRTM2	26045	broad.mit.edu	37	5	138208732	138208732	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A00H-01	TCGA-AG-A00H-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr5:138208732A>C	ENST00000274711.6	-	2	1896	c.1518T>G	c.(1516-1518)tgT>tgG	p.C506W	CTNNA1_ENST00000520400.1_Intron|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000518825.1_Intron|LRRTM2_ENST00000521094.2_Missense_Mutation_p.C67W|CTNNA1_ENST00000540387.1_5'Flank|LRRTM2_ENST00000518785.1_3'UTR|LRRTM2_ENST00000523537.1_5'Flank|CTNNA1_ENST00000355078.5_Intron	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	506					long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.C506W(1)		NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCAGCTGCTGACACTTGCACT	0.373																																					p.C506W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1518G	5						.						167.0	161.0	163.0					5																	138208732		1905	4129	6034	138236631	SO:0001583	missense	26045	exon2			AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.1518T>G	5.37:g.138208732A>C	ENSP00000274711:p.Cys506Trp		138236631	NM_015564	A0AVL3|A8K4U9|B7ZLN8|Q7L770	Missense_Mutation	SNP	ENST00000274711.6	37	CCDS47272.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.611738	0.28712	.	.	ENSG00000146006	ENST00000521094;ENST00000274711	T	0.51325	0.71	5.79	2.19	0.27852	.	0.000000	0.85682	D	0.000000	T	0.48804	0.1520	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.83275	0.984;0.996	T	0.33317	-0.9873	10	0.33141	T	0.24	.	8.9717	0.35910	0.7878:0.0:0.2122:0.0	.	372;506	B7Z4G4;O43300	.;LRRT2_HUMAN	W	67;506	ENSP00000274711:C506W	ENSP00000274711:C506W	C	-	3	2	LRRTM2	138236631	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.039000	0.41193	0.469000	0.27268	0.533000	0.62120	TGT		0.373	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374043.2		
CYFIP2	26999	broad.mit.edu	37	5	156751064	156751064	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A00H-01	TCGA-AG-A00H-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr5:156751064C>T	ENST00000521420.1	+	15	1820	c.1729C>T	c.(1729-1731)Cat>Tat	p.H577Y	CYFIP2_ENST00000318218.6_Missense_Mutation_p.H628Y|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000541131.1_Missense_Mutation_p.H528Y|CYFIP2_ENST00000522463.1_Missense_Mutation_p.H407Y|CYFIP2_ENST00000347377.6_Missense_Mutation_p.H603Y|CYFIP2_ENST00000520960.1_3'UTR|CYFIP2_ENST00000435847.2_Missense_Mutation_p.H302Y|CYFIP2_ENST00000377576.3_Missense_Mutation_p.H603Y					cytoplasmic FMR1 interacting protein 2									p.H628Y(2)		breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTTCTTCACACATCTGCTCAA	0.552																																					p.H603Y												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1807T	5						.						85.0	82.0	83.0					5																	156751064		2016	4178	6194	156683642	SO:0001583	missense	26999	exon16			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.1729C>T	5.37:g.156751064C>T	ENSP00000430904:p.His577Tyr		156683642	NM_001037333		Missense_Mutation	SNP	ENST00000521420.1	37		.	.	.	.	.	.	.	.	.	.	C	9.790	1.177791	0.21787	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03;2.03;2.03	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.21062	0.0507	N	0.04355	-0.22	0.80722	D	1	B;B;B;B;B;P	0.40180	0.027;0.009;0.014;0.007;0.0;0.705	B;B;B;B;B;P	0.55785	0.016;0.042;0.02;0.014;0.001;0.784	T	0.03221	-1.1059	10	0.05833	T	0.94	-34.3135	20.2963	0.98556	0.0:1.0:0.0:0.0	.	467;407;577;603;603;628	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	Y	628;407;577;603;603;528;302	ENSP00000325817:H628Y;ENSP00000428009:H407Y;ENSP00000430904:H577Y;ENSP00000313567:H603Y;ENSP00000366799:H603Y;ENSP00000444645:H528Y;ENSP00000403793:H302Y	ENSP00000325817:H628Y	H	+	1	0	CYFIP2	156683642	1.000000	0.71417	0.830000	0.32933	0.935000	0.57460	7.776000	0.85560	2.813000	0.96785	0.655000	0.94253	CAT		0.552	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
APC	324	broad.mit.edu	37	5	112173283	112173284	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-AG-A00H-01	TCGA-AG-A00H-01			TT	TT	TT	TT	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr5:112173283_112173284delTT	ENST00000457016.1	+	16	2372_2373	c.1992_1993delTT	c.(1990-1995)actttafs	p.L666fs	APC_ENST00000257430.4_Frame_Shift_Del_p.L666fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Del_p.L666fs			P25054	APC_HUMAN	adenomatous polyposis coli	666	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.L665fs*8(2)|p.T664T(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTCTACAAACTTTATTACAACA	0.337		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.646_647del	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	4	Deletion - Frameshift(2)|Unknown(1)|Substitution - coding silent(1)	large_intestine(3)|skin(1)	c.1938_1939del	5	GRCh37	CD005360	APC	D		.																																			112201183	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1992_1993delTT	5.37:g.112173283_112173284delTT	ENSP00000413133:p.Leu666fs		112201182	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.337	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
TENM2	57451	broad.mit.edu	37	5	167617454	167617454	+	Silent	SNP	G	G	A			TCGA-AG-A00H-01	TCGA-AG-A00H-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A00H-01	TCGA-AG-A00H-01	g.chr5:167617454G>A	ENST00000518659.1	+	14	2721	c.2682G>A	c.(2680-2682)acG>acA	p.T894T	TENM2_ENST00000519204.1_Silent_p.T773T|TENM2_ENST00000403607.2_Silent_p.T718T|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000545108.1_Silent_p.T894T|TENM2_ENST00000520394.1_Silent_p.T662T	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	894					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.T894T(1)|p.T727T(1)									AGGGCCAGACGGATTGGCCCG	0.572																																					p.T885T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2655A	5						.						51.0	51.0	51.0					5																	167617454		1958	4144	6102	167550032	SO:0001819	synonymous_variant	57451	exon14			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.2682G>A	5.37:g.167617454G>A			167550032	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																					0.572	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
