#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CARD11	84433	hgsc.bcm.edu	37	7	2977620	2977620	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr7:2977620C>A	ENST00000396946.4	-	8	1467	c.1064G>T	c.(1063-1065)gGa>gTa	p.G355V		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	355					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.G348V(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		ACAGTCCTTTCCCAGGGTCGA	0.562			Mis		DLBCL																																p.G355V			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1064T	7						.						156.0	129.0	138.0					7																	2977620		2203	4300	6503	2944146	SO:0001583	missense	84433	exon8			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1064G>T	7.37:g.2977620C>A	ENSP00000380150:p.Gly355Val		2944146	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	12.56	1.974817	0.34848	.	.	ENSG00000198286	ENST00000396946	T	0.33654	1.4	5.0	5.0	0.66597	.	0.464777	0.22197	N	0.063286	T	0.19327	0.0464	N	0.08118	0	0.50632	D	0.999888	B	0.18610	0.029	B	0.13407	0.009	T	0.06679	-1.0813	10	0.33141	T	0.24	-47.6073	10.8578	0.46808	0.0:0.9135:0.0:0.0865	.	355	Q9BXL7	CAR11_HUMAN	V	355	ENSP00000380150:G355V	ENSP00000380150:G355V	G	-	2	0	CARD11	2944146	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.636000	0.54317	2.318000	0.78349	0.591000	0.81541	GGA		0.562	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
SP8	221833	hgsc.bcm.edu	37	7	20825258	20825258	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr7:20825258C>A	ENST00000361443.4	-	3	361	c.124G>T	c.(124-126)Gcc>Tcc	p.A42S	SP8_ENST00000418710.2_Missense_Mutation_p.A60S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	42	Ser-rich.				dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A42S(1)|p.A60S(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						TTGCAGCTGGCGGAAGAAGAG	0.672																																					p.A42S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G124T	7						.						43.0	43.0	43.0					7																	20825258		2203	4300	6503	20791783	SO:0001583	missense	221833	exon3				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.124G>T	7.37:g.20825258C>A	ENSP00000354482:p.Ala42Ser		20791783	NM_198956	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	1.053	-0.675191	0.03378	.	.	ENSG00000164651	ENST00000297210;ENST00000418710;ENST00000361443	T;T	0.11385	2.84;2.78	3.35	2.45	0.29901	.	0.317189	0.33895	N	0.004442	T	0.04227	0.0117	N	0.08118	0	0.20873	N	0.999838	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.45760	-0.9239	10	0.09084	T	0.74	.	7.2589	0.26191	0.2981:0.6113:0.0:0.0906	.	42;42	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	60;60;42	ENSP00000408792:A60S;ENSP00000354482:A42S	ENSP00000297210:A60S	A	-	1	0	SP8	20791783	0.362000	0.24980	0.917000	0.36280	0.645000	0.38454	0.190000	0.17057	0.233000	0.21120	-2.157000	0.00329	GCC		0.672	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
ADCY1	107	hgsc.bcm.edu	37	7	45662340	45662340	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr7:45662340A>C	ENST00000297323.7	+	4	1040	c.1018A>C	c.(1018-1020)Acg>Ccg	p.T340P	ADCY1_ENST00000432715.1_Missense_Mutation_p.T115P	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	340					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.T340P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TGAATTAGCCACGGTAAGTGC	0.483																																					p.T340P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1018C	7						.						82.0	72.0	75.0					7																	45662340		2203	4300	6503	45628865	SO:0001583	missense	107	exon4			L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1018A>C	7.37:g.45662340A>C	ENSP00000297323:p.Thr340Pro		45628865	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	37	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494678	0.85069	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	T;T	0.81247	-1.47;-1.47	5.03	5.03	0.67393	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.84037	0.5384	L	0.42245	1.32	0.80722	D	1	D;D	0.69078	0.997;0.962	D;P	0.67725	0.953;0.828	T	0.83129	-0.0114	10	0.37606	T	0.19	.	12.7639	0.57380	1.0:0.0:0.0:0.0	.	340;115	Q08828;C9J1J0	ADCY1_HUMAN;.	P	115;340;340	ENSP00000392721:T115P;ENSP00000297323:T340P	ENSP00000297323:T340P	T	+	1	0	ADCY1	45628865	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.299000	0.65716	2.093000	0.63338	0.533000	0.62120	ACG		0.483	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
CST2	1470	hgsc.bcm.edu	37	20	23805934	23805934	+	Silent	SNP	G	G	A	rs201981599		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr20:23805934G>A	ENST00000304725.2	-	2	325	c.255C>T	c.(253-255)ttC>ttT	p.F85F		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	85					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.F85F(1)		breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						CCTCTATGTCGAAGAAGTAAT	0.532																																					p.F85F	Pancreas(193;496 3017 22514 29918)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C255T	20						.						284.0	219.0	241.0					20																	23805934		2203	4300	6503	23753934	SO:0001819	synonymous_variant	1470	exon2			M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.255C>T	20.37:g.23805934G>A			23753934	NM_001322	Q9UCQ7	Silent	SNP	ENST00000304725.2	37	CCDS13161.1																																																																																				0.532	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078352.2		
CHD6	84181	hgsc.bcm.edu	37	20	40053862	40053862	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr20:40053862C>G	ENST00000373233.3	-	29	4479	c.4302G>C	c.(4300-4302)agG>agC	p.R1434S		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1434					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.R1434S(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CTGAGGTTCTCCTGAACATCT	0.507																																					p.R1434S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4302C	20						.						131.0	110.0	117.0					20																	40053862		2203	4300	6503	39487276	SO:0001583	missense	84181	exon29			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4302G>C	20.37:g.40053862C>G	ENSP00000362330:p.Arg1434Ser		39487276	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.963859	0.53507	.	.	ENSG00000124177	ENST00000373233	D	0.86562	-2.14	5.96	4.97	0.65823	.	0.000000	0.64402	D	0.000006	D	0.85885	0.5801	M	0.78801	2.425	0.80722	D	1	B	0.22909	0.077	B	0.24394	0.053	T	0.82252	-0.0549	10	0.42905	T	0.14	-19.0928	10.0896	0.42439	0.0:0.6818:0.2488:0.0694	.	1434	Q8TD26	CHD6_HUMAN	S	1434	ENSP00000362330:R1434S	ENSP00000362330:R1434S	R	-	3	2	CHD6	39487276	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.514000	0.22786	2.827000	0.97445	0.655000	0.94253	AGG		0.507	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
ANKEF1	63926	hgsc.bcm.edu	37	20	10032527	10032527	+	Silent	SNP	A	A	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr20:10032527A>G	ENST00000378380.3	+	7	2189	c.1860A>G	c.(1858-1860)gaA>gaG	p.E620E	ANKEF1_ENST00000488991.1_3'UTR|ANKEF1_ENST00000378392.1_Silent_p.E620E|SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000603542.1_RNA	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	620							calcium ion binding (GO:0005509)	p.E620E(1)									TCCAGCTGGAAAATAGAAAAG	0.363																																					p.E620E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1860G	20						.						36.0	34.0	35.0					20																	10032527		2203	4299	6502	9980527	SO:0001819	synonymous_variant	63926	exon7			AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1860A>G	20.37:g.10032527A>G			9980527	NM_198798	B3KUQ0|Q9H6Y9	Silent	SNP	ENST00000378380.3	37	CCDS13108.1																																																																																				0.363	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096	
SEMG2	6407	hgsc.bcm.edu	37	20	43851148	43851148	+	Missense_Mutation	SNP	G	G	A	rs145586123	byFrequency	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr20:43851148G>A	ENST00000372769.3	+	2	965	c.875G>A	c.(874-876)cGt>cAt	p.R292H		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	292	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.R292H(1)|p.R292L(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				CCGTCTTCACGTACAGAAGAA	0.398																																					p.R292H												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G875A	20						.	G	HIS/ARG	0,4406	2.1+/-5.4	0,0,2203	94.0	88.0	90.0		875	-0.9	0.0	20	dbSNP_134	90	4,8596	3.7+/-12.6	0,4,4296	yes	missense	SEMG2	NM_003008.2	29	0,4,6499	AA,AG,GG		0.0465,0.0,0.0308	benign	292/583	43851148	4,13002	2203	4300	6503	43284562	SO:0001583	missense	6407	exon2				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.875G>A	20.37:g.43851148G>A	ENSP00000361855:p.Arg292His		43284562	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	G	5.553	0.286965	0.10513	0.0	4.65E-4	ENSG00000124157	ENST00000372769	T	0.06449	3.3	1.28	-0.886	0.10590	.	.	.	.	.	T	0.03477	0.0100	N	0.14661	0.345	0.09310	N	1	B;B;B	0.14438	0.005;0.01;0.01	B;B;B	0.12156	0.007;0.007;0.007	T	0.42224	-0.9464	9	0.48119	T	0.1	.	4.015	0.09639	0.4624:0.0:0.5376:0.0	.	292;292;292	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	H	292	ENSP00000361855:R292H	ENSP00000361855:R292H	R	+	2	0	SEMG2	43284562	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.964000	0.03833	-0.275000	0.09219	-0.194000	0.12790	CGT		0.398	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
KCNH5	27133	hgsc.bcm.edu	37	14	63453899	63453899	+	Missense_Mutation	SNP	G	G	A	rs180894715		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr14:63453899G>A	ENST00000322893.7	-	5	708	c.440C>T	c.(439-441)aCg>aTg	p.T147M	KCNH5_ENST00000394964.2_Missense_Mutation_p.T89M|KCNH5_ENST00000394968.1_Missense_Mutation_p.T89M|KCNH5_ENST00000420622.2_Missense_Mutation_p.T147M	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	147					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.T147M(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		GGCAAATTTCGTCCAACCTTA	0.383													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19251	0.0		0.0	False		,,,				2504	0.0				p.T89M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C266T	14						.	G	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	82.0	78.0	80.0		440,440,266	5.7	1.0	14		80	2,8596	2.2+/-6.3	0,2,4297	no	missense,missense,missense	KCNH5	NM_139318.3,NM_172375.1,NM_172376.1	81,81,81	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	147/989,147/612,89/625	63453899	2,13002	2203	4299	6502	62523652	SO:0001583	missense	27133	exon5			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.440C>T	14.37:g.63453899G>A	ENSP00000321427:p.Thr147Met		62523652	NM_172376	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	17.50	3.405912	0.62288	0.0	2.33E-4	ENSG00000140015	ENST00000322893;ENST00000420622;ENST00000394968;ENST00000394964	D;D;D;D	0.98937	-5.25;-5.08;-5.08;-5.07	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97380	0.9143	L	0.44542	1.39	0.80722	D	1	P;P;P;D	0.53885	0.892;0.889;0.759;0.963	B;B;B;B	0.43809	0.21;0.27;0.27;0.432	D	0.97467	1.0038	10	0.49607	T	0.09	.	19.85	0.96736	0.0:0.0:1.0:0.0	.	89;89;147;147	Q86XI1;Q8NCM2-3;Q8NCM2-2;Q8NCM2	.;.;.;KCNH5_HUMAN	M	147;147;89;89	ENSP00000321427:T147M;ENSP00000395439:T147M;ENSP00000378419:T89M;ENSP00000378415:T89M	ENSP00000321427:T147M	T	-	2	0	KCNH5	62523652	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.559000	0.67326	2.697000	0.92050	0.563000	0.77884	ACG		0.383	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
ZNF345	25850	hgsc.bcm.edu	37	19	37367977	37367977	+	Missense_Mutation	SNP	G	G	A	rs143253432		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr19:37367977G>A	ENST00000529555.1	+	2	1033	c.245G>A	c.(244-246)cGa>cAa	p.R82Q	ZNF345_ENST00000420450.1_Missense_Mutation_p.R82Q|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.R82Q			Q14585	ZN345_HUMAN	zinc finger protein 345	82					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R82Q(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CGACATCAGCGAATTCATACT	0.403																																					p.R82Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G245A	19						.	G	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	100.0	106.0	104.0		245,245,245,245,245	2.2	1.0	19	dbSNP_134	104	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	ZNF345	NM_001242472.1,NM_001242474.1,NM_001242475.1,NM_001242476.1,NM_003419.4	43,43,43,43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	82/489,82/489,82/489,82/489,82/489	37367977	1,13005	2203	4300	6503	42059817	SO:0001583	missense	25850	exon3			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.245G>A	19.37:g.37367977G>A	ENSP00000431202:p.Arg82Gln		42059817	NM_003419		Missense_Mutation	SNP	ENST00000529555.1	37	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.438007	0.43326	2.27E-4	0.0	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000331800	T;T;T	0.24723	1.84;1.84;1.84	4.28	2.15	0.27550	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20170	0.0485	L	0.54908	1.71	0.24477	N	0.994366	B	0.31383	0.321	B	0.18561	0.022	T	0.10823	-1.0613	8	.	.	.	.	8.1552	0.31165	0.2079:0.0:0.7921:0.0	.	82	Q14585	ZN345_HUMAN	Q	82	ENSP00000431216:R82Q;ENSP00000431202:R82Q;ENSP00000331120:R82Q	.	R	+	2	0	ZNF345	42059817	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.278000	0.08490	1.128000	0.42052	0.655000	0.94253	CGA		0.403	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1		
SLCO5A1	81796	hgsc.bcm.edu	37	8	70591848	70591848	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr8:70591848T>G	ENST00000260126.4	-	8	2495	c.1789A>C	c.(1789-1791)Aat>Cat	p.N597H	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.N597H|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.N542H	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	597	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.N597H(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TCTGTATAATTCCGTATCTAA	0.413																																					p.N597H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1789C	8						.						115.0	111.0	112.0					8																	70591848		2203	4300	6503	70754402	SO:0001583	missense	81796	exon8			AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1789A>C	8.37:g.70591848T>G	ENSP00000260126:p.Asn597His		70754402	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.437223	0.83885	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.04317	3.65;3.65;3.65	5.8	5.8	0.92144	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Protease inhibitor, Kazal-type (1);	0.211465	0.46758	D	0.000279	T	0.19846	0.0477	M	0.79123	2.44	0.58432	D	0.999998	D;D;D	0.76494	0.998;0.999;0.993	D;D;D	0.70487	0.969;0.949;0.937	T	0.11372	-1.0590	10	0.15499	T	0.54	.	16.1549	0.81657	0.0:0.0:0.0:1.0	.	542;597;597	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	H	597;597;542	ENSP00000260126:N597H;ENSP00000434422:N597H;ENSP00000431611:N542H	ENSP00000260126:N597H	N	-	1	0	SLCO5A1	70754402	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.985000	0.88162	2.209000	0.71365	0.533000	0.62120	AAT		0.413	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
RUNX1T1	862	hgsc.bcm.edu	37	8	92983013	92983013	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr8:92983013G>A	ENST00000523629.1	-	11	1866	c.1412C>T	c.(1411-1413)gCg>gTg	p.A471V	RUNX1T1_ENST00000360348.2_Missense_Mutation_p.A434V|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.A444V|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.A471V|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.A482V|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.A434V|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.A444V|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.A434V	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	471			A -> V (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A434V(2)|p.A471V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TTTCCGCTCCGCCTCAGACAC	0.622																																					p.A471V												RUNX1T1,large_intestine,rectum,Substitution - Missense,0	.	3	Substitution - Missense(3)	large_intestine(3)	c.C1412T	8						.						81.0	65.0	70.0					8																	92983013		2203	4300	6503	93052189	SO:0001583	missense	862	exon12			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1412C>T	8.37:g.92983013G>A	ENSP00000428543:p.Ala471Val		93052189	NM_001198626	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	37	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	37	5.997494	0.97184	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.74450	0.3718	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.988;0.994	T	0.76926	-0.2778	10	0.72032	D	0.01	-13.1985	20.2181	0.98305	0.0:0.0:1.0:0.0	.	482;434;471;444	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	V	471;444;471;434;434;434;482;444	ENSP00000428543:A471V;ENSP00000379520:A444V;ENSP00000265814:A471V;ENSP00000353504:A434V;ENSP00000390137:A434V;ENSP00000428742:A434V;ENSP00000402257:A482V;ENSP00000430728:A444V	ENSP00000265814:A471V	A	-	2	0	RUNX1T1	93052189	1.000000	0.71417	0.974000	0.42286	0.987000	0.75469	9.869000	0.99810	2.785000	0.95823	0.655000	0.94253	GCG		0.622	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
KCNQ3	3786	hgsc.bcm.edu	37	8	133141602	133141602	+	Silent	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr8:133141602C>T	ENST00000388996.4	-	15	2946	c.2526G>A	c.(2524-2526)acG>acA	p.T842T	KCNQ3_ENST00000519445.1_Silent_p.T830T|KCNQ3_ENST00000521134.1_Silent_p.T722T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	842					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.T842T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TGAAGGGGTCCGTGTCTGTGT	0.572																																					p.T842T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2526A	8						.						83.0	70.0	75.0					8																	133141602		2203	4300	6503	133210784	SO:0001819	synonymous_variant	3786	exon15			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2526G>A	8.37:g.133141602C>T			133210784	NM_004519	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	ENST00000388996.4	37	CCDS34943.1																																																																																				0.572	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
PADI3	51702	hgsc.bcm.edu	37	1	17603341	17603341	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr1:17603341G>C	ENST00000375460.3	+	13	1565	c.1525G>C	c.(1525-1527)Ggg>Cgg	p.G509R	MIR3972_ENST00000582732.1_RNA	NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	509			G -> R (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)	p.G509R(2)		breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GTGTGGCCACGGGAGGGCCCT	0.597																																					p.G509R												PADI3,breast,NS,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(1)|breast(1)	c.G1525C	1						.						35.0	37.0	36.0					1																	17603341		2203	4300	6503	17475928	SO:0001583	missense	51702	exon13			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1525G>C	1.37:g.17603341G>C	ENSP00000364609:p.Gly509Arg		17475928	NM_016233	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	37	CCDS179.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822064	0.90873	.	.	ENSG00000142619	ENST00000375460	T	0.61859	0.07	4.79	4.79	0.61399	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79975	0.4539	M	0.90019	3.08	0.58432	D	0.999995	D	0.56968	0.978	D	0.68192	0.956	D	0.84506	0.0619	10	0.66056	D	0.02	-35.0556	16.7573	0.85503	0.0:0.0:1.0:0.0	.	509	Q9ULW8	PADI3_HUMAN	R	509	ENSP00000364609:G509R	ENSP00000364609:G509R	G	+	1	0	PADI3	17475928	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.916000	0.87491	2.377000	0.81083	0.555000	0.69702	GGG		0.597	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
BTBD8	284697	hgsc.bcm.edu	37	1	92612764	92612764	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr1:92612764C>A	ENST00000342818.3	+	8	1194	c.958C>A	c.(958-960)Cta>Ata	p.L320I	BTBD8_ENST00000540648.1_3'UTR	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	320						nucleus (GO:0005634)		p.L320I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		GACGTCTATACTAGAATGCCT	0.328																																					p.L320I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C958A	1						.						168.0	164.0	166.0					1																	92612764		2203	4300	6503	92385352	SO:0001583	missense	284697	exon8			AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.958C>A	1.37:g.92612764C>A	ENSP00000343686:p.Leu320Ile		92385352	NM_183242	Q6V9S5	Missense_Mutation	SNP	ENST00000342818.3	37	CCDS737.1	.	.	.	.	.	.	.	.	.	.	C	12.40	1.926442	0.34002	.	.	ENSG00000189195	ENST00000342818	T	0.67171	-0.25	5.49	2.39	0.29439	.	0.000000	0.45867	D	0.000326	T	0.44222	0.1283	M	0.65498	2.005	0.80722	D	1	B	0.29766	0.256	B	0.24701	0.055	T	0.44907	-0.9297	10	0.59425	D	0.04	-0.9748	7.9997	0.30288	0.0:0.7161:0.1291:0.1548	.	320	Q5XKL5	BTBD8_HUMAN	I	320	ENSP00000343686:L320I	ENSP00000343686:L320I	L	+	1	2	BTBD8	92385352	0.634000	0.27190	0.242000	0.24170	0.583000	0.36354	1.031000	0.30165	0.295000	0.22570	0.557000	0.71058	CTA		0.328	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028372.1	NM_183242	
UCHL5	51377	hgsc.bcm.edu	37	1	192985507	192985507	+	Missense_Mutation	SNP	C	C	T	rs146351256	byFrequency	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr1:192985507C>T	ENST00000367455.4	-	11	1199	c.964G>A	c.(964-966)Gca>Aca	p.A322T	UCHL5_ENST00000367451.4_Missense_Mutation_p.A348T|UCHL5_ENST00000367454.1_Missense_Mutation_p.A321T	NM_001199261.1|NM_015984.3	NP_001186190.1|NP_057068.1	Q9Y5K5	UCHL5_HUMAN	ubiquitin carboxyl-terminal hydrolase L5	322	Interaction with ADRM1.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|forebrain morphogenesis (GO:0048853)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein deubiquitination (GO:0016579)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	endopeptidase inhibitor activity (GO:0004866)|omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|proteasome binding (GO:0070628)|ubiquitin-specific protease activity (GO:0004843)	p.A322T(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(1)|lung(9)|ovary(1)	19						GCTTTCTTTGCGTTCTGTTTT	0.284													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18037	0.0		0.0	False		,,,				2504	0.0				p.A321T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G961A	1						.	C	THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	225.0	219.0	221.0		964,961	5.5	1.0	1	dbSNP_134	221	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	UCHL5	NM_015984.3,NM_001199261.1	58,58	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign,benign	322/330,321/329	192985507	3,13003	2203	4300	6503	191252130	SO:0001583	missense	51377	exon11				CCDS1378.1, CCDS55668.1, CCDS55669.1, CCDS55670.1	1q32	2011-07-06			ENSG00000116750	ENSG00000116750		"""INO80 complex subunits"""	19678	protein-coding gene	gene with protein product	"""INO80 complex subunit R"""	610667				10810093, 16027725	Standard	NM_015984		Approved	UCH37, CGI-70, INO80R	uc001gsm.3	Q9Y5K5	OTTHUMG00000035561	ENST00000367455.4:c.964G>A	1.37:g.192985507C>T	ENSP00000356425:p.Ala322Thr		191252130	NM_001199261	Q5LJA6|Q5LJA7|Q8TBS4|Q96BJ9|Q9H1W5|Q9P0I3|Q9UQN2	Missense_Mutation	SNP	ENST00000367455.4	37	CCDS1378.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	17.27	3.347450	0.61183	2.27E-4	2.33E-4	ENSG00000116750	ENST00000367455;ENST00000367454;ENST00000367450;ENST00000367451	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.5	5.5	0.81552	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1 (1);	0.157689	0.56097	D	0.000028	T	0.34250	0.0891	L	0.40543	1.245	0.80722	D	1	B;B	0.15719	0.014;0.008	B;B	0.10450	0.005;0.002	T	0.08166	-1.0735	10	0.28530	T	0.3	-14.2017	12.7241	0.57159	0.0:0.9253:0.0:0.0747	.	321;322	Q9Y5K5-3;Q9Y5K5	.;UCHL5_HUMAN	T	322;321;361;348	ENSP00000356425:A322T;ENSP00000356424:A321T;ENSP00000356420:A361T;ENSP00000356421:A348T	ENSP00000356420:A361T	A	-	1	0	UCHL5	191252130	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.642000	0.61383	2.588000	0.87417	0.650000	0.86243	GCA		0.284	UCHL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086318.3	NM_015984	
ME3	10873	hgsc.bcm.edu	37	11	86158123	86158123	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr11:86158123C>A	ENST00000393324.3	-	11	1617	c.1364G>T	c.(1363-1365)tGc>tTc	p.C455F	ME3_ENST00000543262.1_Missense_Mutation_p.C455F|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Missense_Mutation_p.C455F	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	455					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.C455F(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				GACCCGGTAGCACTTCTCAGC	0.562																																					p.C455F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1364T	11						.						66.0	58.0	60.0					11																	86158123		2202	4299	6501	85835771	SO:0001583	missense	10873	exon12			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1364G>T	11.37:g.86158123C>A	ENSP00000376998:p.Cys455Phe		85835771	NM_001161586	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958769	0.92726	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.23	5.23	0.72850	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.040960	0.85682	D	0.000000	T	0.66107	0.2756	M	0.83953	2.67	0.80722	D	1	D	0.53885	0.963	P	0.60068	0.868	T	0.68834	-0.5304	9	.	.	.	-5.7787	19.1755	0.93601	0.0:1.0:0.0:0.0	.	455	Q16798	MAON_HUMAN	F	455	ENSP00000352657:C455F;ENSP00000440246:C455F;ENSP00000376998:C455F;ENSP00000431182:C455F	.	C	-	2	0	ME3	85835771	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.619000	0.83057	2.584000	0.87258	0.650000	0.86243	TGC		0.562	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
TMEM225	338661	hgsc.bcm.edu	37	11	123753985	123753985	+	Missense_Mutation	SNP	C	C	T	rs77654932		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr11:123753985C>T	ENST00000375026.2	-	4	754	c.538G>A	c.(538-540)Gaa>Aaa	p.E180K		NM_001013743.1	NP_001013765.1	Q6GV28	TM225_HUMAN	transmembrane protein 225	180					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.E180K(1)		endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	28						TCCTTACATTCGTTGTCAGAT	0.443																																					p.E180K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G538A	11						.						110.0	102.0	105.0					11																	123753985		2202	4299	6501	123259195	SO:0001583	missense	338661	exon4			AY634366	CCDS31697.1	11q24.1	2014-06-13			ENSG00000204300	ENSG00000204300			32390	protein-coding gene	gene with protein product	"""PMP22 claudin domain containing"", ""protein phosphatase 1, regulatory subunit 154"""						Standard	XM_006718832		Approved	PMP22CD, PPP1R154	uc001pzi.3	Q6GV28	OTTHUMG00000165959	ENST00000375026.2:c.538G>A	11.37:g.123753985C>T	ENSP00000364166:p.Glu180Lys		123259195	NM_001013743		Missense_Mutation	SNP	ENST00000375026.2	37	CCDS31697.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.546781	0.27652	.	.	ENSG00000204300	ENST00000375026;ENST00000528595	T;T	0.34472	1.39;1.36	3.31	-2.27	0.06846	.	1.519590	0.03921	N	0.283618	T	0.23649	0.0572	N	0.20986	0.625	0.09310	N	1	B	0.25105	0.118	B	0.14578	0.011	T	0.20107	-1.0285	10	0.38643	T	0.18	2.5938	7.8188	0.29276	0.0:0.3397:0.0:0.6603	.	180	Q6GV28	TM225_HUMAN	K	180;130	ENSP00000364166:E180K;ENSP00000431282:E130K	ENSP00000364166:E180K	E	-	1	0	TMEM225	123259195	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.601000	0.05687	-0.512000	0.06505	-0.345000	0.07892	GAA		0.443	TMEM225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387260.1	NM_001013743	
SEC63	11231	hgsc.bcm.edu	37	6	108250659	108250659	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:108250659G>A	ENST00000369002.4	-	2	363	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	RNU6-437P_ENST00000459408.1_RNA	NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	62					liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.R62W(1)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTAATAACCGTAAACGATAC	0.299																																					p.R62W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C184T	6						.						157.0	158.0	158.0					6																	108250659		2202	4297	6499	108357352	SO:0001583	missense	11231	exon2			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.184C>T	6.37:g.108250659G>A	ENSP00000357998:p.Arg62Trp		108357352	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	G	17.46	3.394138	0.62066	.	.	ENSG00000025796	ENST00000369002;ENST00000429168	T;T	0.76448	-1.02;-0.17	5.48	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.67439	0.2893	L	0.34521	1.04	0.53688	D	0.99997	D	0.69078	0.997	P	0.52554	0.702	T	0.71810	-0.4480	10	0.72032	D	0.01	-14.1314	13.3702	0.60709	0.0:0.0:0.5862:0.4138	.	62	Q9UGP8	SEC63_HUMAN	W	62;6	ENSP00000357998:R62W;ENSP00000403144:R6W	ENSP00000357998:R62W	R	-	1	2	SEC63	108357352	1.000000	0.71417	0.999000	0.59377	0.744000	0.42396	2.026000	0.41069	0.631000	0.30412	0.557000	0.71058	CGG		0.299	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151161631	151161631	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:151161631A>T	ENST00000358517.2	+	16	3968	c.3757A>T	c.(3757-3759)Aga>Tga	p.R1253*	PLEKHG1_ENST00000367328.1_Nonsense_Mutation_p.R1253*			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	1253							Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.R1253*(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		GGTGGTCAATAGAAATTTACC	0.408																																					p.R1253X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A3757T	6						.						73.0	72.0	73.0					6																	151161631		2203	4300	6503	151203324	SO:0001587	stop_gained	57480	exon17			AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.3757A>T	6.37:g.151161631A>T	ENSP00000351318:p.Arg1253*		151203324	NM_001029884	Q5T1F2	Nonsense_Mutation	SNP	ENST00000358517.2	37	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	A	44	11.183252	0.99528	.	.	ENSG00000120278	ENST00000367328;ENST00000358517	.	.	.	5.61	5.61	0.85477	.	0.133460	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0994	0.81158	1.0:0.0:0.0:0.0	.	.	.	.	X	1253	.	ENSP00000351318:R1253X	R	+	1	2	PLEKHG1	151203324	1.000000	0.71417	0.999000	0.59377	0.900000	0.52787	3.700000	0.54786	2.261000	0.74972	0.533000	0.62120	AGA		0.408	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
PSMB8	5696	hgsc.bcm.edu	37	6	32810842	32810842	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:32810842C>A	ENST00000374882.3	-	2	222	c.172G>T	c.(172-174)Ggt>Tgt	p.G58C	PSMB9_ENST00000395330.1_5'Flank|PSMB8_ENST00000395339.3_Missense_Mutation_p.G58C|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374881.2_Missense_Mutation_p.G54C	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	58					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.G54C(1)|p.G58C(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	CCGTCCCCACCCAGGGACTGG	0.498																																					p.G54C	NSCLC(48;53 1172 10859 13624 22883)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G160T	6						.						76.0	73.0	74.0					6																	32810842		1511	2709	4220	32918820	SO:0001583	missense	5696	exon2				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.172G>T	6.37:g.32810842C>A	ENSP00000364016:p.Gly58Cys		32918820	NM_004159	B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Missense_Mutation	SNP	ENST00000374882.3	37	CCDS4757.1	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418005	0.25552	.	.	ENSG00000204264	ENST00000395339;ENST00000374882;ENST00000374881	T;T;T	0.38560	1.13;1.77;1.75	5.91	-1.26	0.09376	.	0.797554	0.11795	N	0.528734	T	0.09862	0.0242	L	0.33485	1.01	0.09310	N	1	B;B;B	0.19706	0.038;0.004;0.0	B;B;B	0.17433	0.013;0.018;0.002	T	0.29058	-1.0024	10	0.45353	T	0.12	-2.3013	2.4636	0.04547	0.1135:0.4458:0.1104:0.3303	.	58;54;58	B7Z6U7;P28062-2;P28062	.;.;PSB8_HUMAN	C	58;58;54	ENSP00000378748:G58C;ENSP00000364016:G58C;ENSP00000364015:G54C	ENSP00000364015:G54C	G	-	1	0	PSMB8	32918820	0.001000	0.12720	0.000000	0.03702	0.113000	0.19764	0.156000	0.16382	-0.624000	0.05611	-0.917000	0.02746	GGT		0.498	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076617.3	NM_148919	
VPS52	6293	hgsc.bcm.edu	37	6	33235080	33235080	+	Missense_Mutation	SNP	G	G	A	rs377130721		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:33235080G>A	ENST00000445902.2	-	11	1228	c.1010C>T	c.(1009-1011)tCg>tTg	p.S337L	VPS52_ENST00000436044.2_Missense_Mutation_p.S212L|VPS52_ENST00000478934.1_Intron|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	337					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.S337L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						GCTGCGGAGCGATGGCTTTGA	0.562																																					p.S337L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1010T	6						.	G	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	83.0	77.0	79.0		1010	5.3	1.0	6		79	0,8600		0,0,4300	no	missense	VPS52	NM_022553.4	145	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	337/724	33235080	1,13005	2203	4300	6503	33343058	SO:0001583	missense	6293	exon11			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1010C>T	6.37:g.33235080G>A	ENSP00000409952:p.Ser337Leu		33343058	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	ENST00000445902.2	37	CCDS4770.2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193365	0.78902	2.27E-4	0.0	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	5.3	5.3	0.74995	.	0.053410	0.85682	D	0.000000	T	0.44244	0.1284	M	0.75777	2.31	0.58432	D	0.999999	P	0.41929	0.765	B	0.34093	0.175	T	0.49123	-0.8972	9	0.30854	T	0.27	-18.6301	16.8656	0.86028	0.0:0.0:1.0:0.0	.	337	Q8N1B4	VPS52_HUMAN	L	337;315;212	.	ENSP00000414785:S315L	S	-	2	0	VPS52	33343058	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	7.437000	0.80417	2.932000	0.99384	0.643000	0.83706	TCG		0.562	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
DAXX	1616	hgsc.bcm.edu	37	6	33288608	33288608	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:33288608T>A	ENST00000374542.5	-	3	1148	c.944A>T	c.(943-945)gAt>gTt	p.D315V	DAXX_ENST00000414083.2_Missense_Mutation_p.D240V|DAXX_ENST00000266000.6_Missense_Mutation_p.D315V|DAXX_ENST00000477162.1_Intron|ZBTB22_ENST00000418724.1_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	315	Interaction with histone H3.3.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.D315V(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						TCGGAAGGCATCCTGAGCCAT	0.582			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.D327V			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A980T	6						.						103.0	95.0	98.0					6																	33288608		2203	4300	6503	33396586	SO:0001583	missense	1616	exon3			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.944A>T	6.37:g.33288608T>A	ENSP00000363668:p.Asp315Val		33396586	NM_001141970	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	ENST00000374542.5	37	CCDS4776.1	.	.	.	.	.	.	.	.	.	.	T	19.58	3.855224	0.71719	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083	.	.	.	4.67	4.67	0.58626	.	0.051728	0.85682	D	0.000000	T	0.72550	0.3474	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	D;D;D	0.79784	0.937;0.993;0.993	T	0.77515	-0.2559	9	0.87932	D	0	-19.0275	12.1315	0.53946	0.0:0.0:0.0:1.0	.	327;315;315	B4E1C1;B2R7M0;Q9UER7	.;.;DAXX_HUMAN	V	315;315;240	.	ENSP00000266000:D315V	D	-	2	0	DAXX	33396586	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.613000	0.74192	1.974000	0.57490	0.523000	0.50628	GAT		0.582	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
KIAA1586	57691	hgsc.bcm.edu	37	6	56918018	56918018	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:56918018A>G	ENST00000370733.4	+	4	928	c.721A>G	c.(721-723)Aaa>Gaa	p.K241E	KIAA1586_ENST00000545356.1_Missense_Mutation_p.K214E	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	241							nucleic acid binding (GO:0003676)	p.K241E(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ACAAAATAATAAAAATATTGA	0.294																																					p.K241E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A721G	6						.						23.0	26.0	25.0					6																	56918018		2147	4254	6401	57025977	SO:0001583	missense	57691	exon4			AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.721A>G	6.37:g.56918018A>G	ENSP00000359768:p.Lys241Glu		57025977	NM_020931	A8K4M3|Q8IW25	Missense_Mutation	SNP	ENST00000370733.4	37	CCDS34480.1	.	.	.	.	.	.	.	.	.	.	a	2.456	-0.325239	0.05350	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.31247	1.51;1.5	4.07	1.58	0.23477	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	0.09310	N	0.999991	B;B	0.23891	0.093;0.093	B;B	0.25987	0.065;0.065	T	0.45071	-0.9286	9	0.05721	T	0.95	-8.5602	3.0775	0.06251	0.673:0.0:0.1163:0.2108	.	214;241	F5H2N6;Q9HCI6	.;K1586_HUMAN	E	241;214	ENSP00000359768:K241E;ENSP00000445507:K214E	ENSP00000359768:K241E	K	+	1	0	KIAA1586	57025977	1.000000	0.71417	0.367000	0.25926	0.511000	0.34104	1.759000	0.38420	0.214000	0.20742	0.383000	0.25322	AAA		0.294	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041033.1	NM_020931	
SYNE1	23345	hgsc.bcm.edu	37	6	152652170	152652170	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr6:152652170G>T	ENST00000367255.5	-	78	14251	c.13650C>A	c.(13648-13650)tgC>tgA	p.C4550*	SYNE1_ENST00000265368.4_Nonsense_Mutation_p.C4550*|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.C4479*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.C4479*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4550					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.C4550*(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACCGGTGACTGCACTTTTGTA	0.413										HNSCC(10;0.0054)																											p.C4479X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C13437A	6						.						152.0	157.0	155.0					6																	152652170		2203	4300	6503	152693863	SO:0001587	stop_gained	23345	exon77			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13650C>A	6.37:g.152652170G>T	ENSP00000356224:p.Cys4550*		152693863	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	56	25.329121	0.99964	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	.	.	.	6.03	-6.06	0.02165	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	.	19.4531	0.94876	0.2542:0.0:0.7458:0.0	.	.	.	.	X	4550;4479;4550;4479	.	ENSP00000265368:C4550X	C	-	3	2	SYNE1	152693863	0.784000	0.28713	0.225000	0.23894	0.578000	0.36192	0.116000	0.15561	-1.108000	0.03000	-0.302000	0.09304	TGC		0.413	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
NF1	4763	hgsc.bcm.edu	37	17	29654605	29654605	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr17:29654605C>T	ENST00000358273.4	+	38	5740	c.5357C>T	c.(5356-5358)tCg>tTg	p.S1786L	NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Missense_Mutation_p.S1765L	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1786	Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.S1786L(2)|p.S1786*(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATTATGCTTCGGAAATTGAA	0.458			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.S1765L		yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	.	14	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)|Substitution - Nonsense(1)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|ovary(1)	c.C5294T	17	GRCh37	CS001442	NF1	S		.						88.0	86.0	86.0					17																	29654605		2203	4300	6503	26678731	SO:0001583	missense	4763	exon37	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5357C>T	17.37:g.29654605C>T	ENSP00000351015:p.Ser1786Leu		26678731	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	C	32	5.174632	0.94807	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	D;D;D	0.85629	-2.01;-2.01;-2.01	5.99	5.99	0.97316	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.93067	0.7793	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	P;D;D	0.71184	0.581;0.972;0.966	D	0.93103	0.6510	10	0.72032	D	0.01	.	19.5155	0.95162	0.0:1.0:0.0:0.0	.	815;1765;1786	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	L	1786;1765;1431	ENSP00000351015:S1786L;ENSP00000348498:S1765L;ENSP00000389907:S1431L	ENSP00000348498:S1765L	S	+	2	0	NF1	26678731	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.456000	0.80751	2.846000	0.97976	0.644000	0.83932	TCG		0.458	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ABCC12	94160	hgsc.bcm.edu	37	16	48175165	48175165	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr16:48175165C>T	ENST00000311303.3	-	3	720	c.375G>A	c.(373-375)atG>atA	p.M125I	ABCC12_ENST00000448542.1_Missense_Mutation_p.M125I|ABCC12_ENST00000416054.1_Missense_Mutation_p.M125I	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	125	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.M125I(1)		NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CCACGATGTCCATCAACACGC	0.572																																					p.M125I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G375A	16						.						127.0	95.0	106.0					16																	48175165		2201	4300	6501	46732666	SO:0001583	missense	94160	exon3			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.375G>A	16.37:g.48175165C>T	ENSP00000311030:p.Met125Ile		46732666	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	C	8.448	0.852361	0.17106	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.89270	-2.49;-2.26;-2.26	5.75	4.8	0.61643	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, transmembrane domain (1);	0.153864	0.64402	D	0.000016	D	0.82370	0.5022	N	0.25890	0.77	0.45261	D	0.998266	B;B	0.18968	0.032;0.006	B;B	0.20577	0.018;0.03	T	0.77169	-0.2686	10	0.33940	T	0.23	.	13.7028	0.62620	0.0:0.9248:0.0:0.0752	.	125;125	Q96J65-2;Q96J65	.;MRP9_HUMAN	I	125	ENSP00000311030:M125I;ENSP00000401855:M125I;ENSP00000413046:M125I	ENSP00000311030:M125I	M	-	3	0	ABCC12	46732666	1.000000	0.71417	0.998000	0.56505	0.002000	0.02628	1.291000	0.33330	1.438000	0.47492	-0.253000	0.11424	ATG		0.572	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
SALL1	6299	hgsc.bcm.edu	37	16	51174641	51174641	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr16:51174641G>A	ENST00000251020.4	-	2	1525	c.1492C>T	c.(1492-1494)Cgc>Tgc	p.R498C	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.R401C|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	498					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R498C(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCTTTGTGGCGCTGAAAGTGG	0.512																																					p.R498C	GBM(103;1352 1446 1855 4775 8890)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1492T	16						.						107.0	105.0	106.0					16																	51174641		2198	4300	6498	49732142	SO:0001583	missense	6299	exon2			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1492C>T	16.37:g.51174641G>A	ENSP00000251020:p.Arg498Cys		49732142	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	G	19.71	3.879139	0.72294	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07444	3.19;3.19	5.29	5.29	0.74685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.34571	0.0902	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.09662	-1.0664	10	0.37606	T	0.19	.	18.9361	0.92586	0.0:0.0:1.0:0.0	.	498	Q9NSC2	SALL1_HUMAN	C	498;401;462	ENSP00000251020:R498C;ENSP00000407914:R401C	ENSP00000251020:R498C	R	-	1	0	SALL1	49732142	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.788000	0.75105	2.458000	0.83093	0.563000	0.77884	CGC		0.512	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
BBS2	583	hgsc.bcm.edu	37	16	56545127	56545127	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr16:56545127C>T	ENST00000245157.5	-	3	835	c.415G>A	c.(415-417)Ggt>Agt	p.G139S	BBS2_ENST00000568104.1_Missense_Mutation_p.G139S|BBS2_ENST00000561951.1_5'UTR	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	139					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)	p.G139S(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						CAATTGCCACCAATAATCGCA	0.403									Bardet-Biedl syndrome																												p.G139S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G415A	16						.						126.0	108.0	114.0					16																	56545127		2198	4300	6498	55102628	SO:0001583	missense	583	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.415G>A	16.37:g.56545127C>T	ENSP00000245157:p.Gly139Ser		55102628	NM_031885	Q96CM0|Q96SN9	Missense_Mutation	SNP	ENST00000245157.5	37	CCDS32451.1	.	.	.	.	.	.	.	.	.	.	C	36	5.838097	0.97009	.	.	ENSG00000125124	ENST00000245157	D	0.96041	-3.89	5.9	5.9	0.94986	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.98277	0.9429	M	0.90019	3.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.98539	1.0631	10	0.72032	D	0.01	-21.0868	20.2799	0.98512	0.0:1.0:0.0:0.0	.	139;139	A8K0N9;Q9BXC9	.;BBS2_HUMAN	S	139	ENSP00000245157:G139S	ENSP00000245157:G139S	G	-	1	0	BBS2	55102628	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.695000	0.84257	2.800000	0.96347	0.643000	0.83706	GGT		0.403	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
GLG1	2734	hgsc.bcm.edu	37	16	74499592	74499592	+	Silent	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr16:74499592G>A	ENST00000422840.2	-	19	2648	c.2649C>T	c.(2647-2649)gtC>gtT	p.V883V	GLG1_ENST00000205061.5_Silent_p.V883V|GLG1_ENST00000447066.2_Silent_p.V872V|Y_RNA_ENST00000384794.1_RNA	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	883					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.V883V(1)		breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						TCTGCTTGCAGACCCTCATGA	0.488																																					p.V872V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2616T	16						.						210.0	203.0	205.0					16																	74499592		2198	4300	6498	73057093	SO:0001819	synonymous_variant	2734	exon18				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2649C>T	16.37:g.74499592G>A			73057093	NM_001145666	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Silent	SNP	ENST00000422840.2	37	CCDS45527.1																																																																																				0.488	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
ROCK1	6093	hgsc.bcm.edu	37	18	18547733	18547733	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr18:18547733C>A	ENST00000399799.2	-	26	4112	c.3172G>T	c.(3172-3174)Gaa>Taa	p.E1058*		NM_005406.2	NP_005397.1	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein kinase 1	1058					actin cytoskeleton organization (GO:0030036)|apical constriction (GO:0003383)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|bleb assembly (GO:0032060)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of focal adhesion assembly (GO:0051894)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E1058*(2)		NS(1)|breast(4)|central_nervous_system(1)|large_intestine(8)|lung(2)	16	Melanoma(1;0.165)					TCATTCAGTTCCTTCTGATGT	0.343																																					p.E1058X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.G3172T	18						.						246.0	241.0	243.0					18																	18547733		2203	4300	6503	16801731	SO:0001587	stop_gained	6093	exon26				CCDS11870.2	18q11.2	2013-01-10			ENSG00000067900	ENSG00000067900	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10251	protein-coding gene	gene with protein product		601702				8617235	Standard	NM_005406		Approved	p160ROCK	uc002kte.3	Q13464	OTTHUMG00000131723	ENST00000399799.2:c.3172G>T	18.37:g.18547733C>A	ENSP00000382697:p.Glu1058*		16801731	NM_005406	B0YJ91|Q2KHM4|Q59GZ4	Nonsense_Mutation	SNP	ENST00000399799.2	37	CCDS11870.2	.	.	.	.	.	.	.	.	.	.	C	49	15.574565	0.99838	.	.	ENSG00000067900	ENST00000399799	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.954	0.92650	0.0:1.0:0.0:0.0	.	.	.	.	X	1058	.	ENSP00000382697:E1058X	E	-	1	0	ROCK1	16801731	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.466000	0.83321	0.585000	0.79938	GAA		0.343	ROCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254641.2	NM_005406	
CNDP2	55748	hgsc.bcm.edu	37	18	72178242	72178242	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr18:72178242C>A	ENST00000324262.4	+	6	967	c.651C>A	c.(649-651)ttC>ttA	p.F217L	CNDP2_ENST00000579847.1_Missense_Mutation_p.F217L|CNDP2_ENST00000324301.8_Missense_Mutation_p.F133L	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	217					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.F217L(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		GCTACTTTTTCATCGAGGTAC	0.493																																					p.F217L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C651A	18						.						95.0	80.0	85.0					18																	72178242		2203	4300	6503	70329222	SO:0001583	missense	55748	exon6			AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.651C>A	18.37:g.72178242C>A	ENSP00000325548:p.Phe217Leu		70329222	NM_018235	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Missense_Mutation	SNP	ENST00000324262.4	37	CCDS12006.1	.	.	.	.	.	.	.	.	.	.	C	13.38	2.218595	0.39201	.	.	ENSG00000133313	ENST00000324262;ENST00000324301	T;T	0.56776	0.44;0.44	6.08	5.04	0.67666	Peptidase M20, dimerisation (1);	0.000000	0.85682	D	0.000000	T	0.51601	0.1684	M	0.79475	2.455	0.80722	D	1	B;B;B	0.29671	0.254;0.062;0.029	B;B;B	0.25884	0.064;0.046;0.025	T	0.48927	-0.8991	10	0.30078	T	0.28	1.1409	12.6212	0.56603	0.0:0.8609:0.0:0.1391	.	122;133;217	B4DPF1;Q96KP4-2;Q96KP4	.;.;CNDP2_HUMAN	L	217;133	ENSP00000325548:F217L;ENSP00000325756:F133L	ENSP00000325548:F217L	F	+	3	2	CNDP2	70329222	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.503000	0.35715	2.894000	0.99253	0.591000	0.81541	TTC		0.493	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
IGSF11	152404	hgsc.bcm.edu	37	3	118621493	118621493	+	Silent	SNP	G	G	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr3:118621493G>T	ENST00000393775.2	-	7	1475	c.1170C>A	c.(1168-1170)ggC>ggA	p.G390G	IGSF11_ENST00000354673.2_Silent_p.G389G|IGSF11_ENST00000489689.1_Silent_p.G366G|IGSF11_ENST00000441144.2_Silent_p.G365G|IGSF11_ENST00000425327.2_Silent_p.G389G|IGSF11_ENST00000491903.1_Silent_p.G362G	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	390					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.G389G(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TACTGACTGAGCCATTGCTCC	0.537																																					p.G389G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1167A	3						.						133.0	101.0	112.0					3																	118621493		2203	4300	6503	120104183	SO:0001819	synonymous_variant	152404	exon9			AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.1170C>A	3.37:g.118621493G>T			120104183	NM_152538	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Silent	SNP	ENST00000393775.2	37	CCDS46891.1																																																																																				0.537	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355075.2		
SRPRB	58477	hgsc.bcm.edu	37	3	133534487	133534487	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr3:133534487T>G	ENST00000466490.2	+	6	749	c.464T>G	c.(463-465)gTg>gGg	p.V155G		NM_021203.3	NP_067026.3	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, B subunit	155					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|small GTPase mediated signal transduction (GO:0007264)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)	p.V155G(1)		breast(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(2)	12						GTGAAAGATGTGGCTGAGTTT	0.433																																					p.V155G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T464G	3						.						239.0	235.0	236.0					3																	133534487		2203	4300	6503	135017177	SO:0001583	missense	58477	exon6			AK075531	CCDS3081.1	3q22.1	2004-01-29			ENSG00000144867	ENSG00000144867			24085	protein-coding gene	gene with protein product						7844142, 10859309	Standard	NM_021203		Approved	APMCF1	uc003epx.2	Q9Y5M8	OTTHUMG00000159753	ENST00000466490.2:c.464T>G	3.37:g.133534487T>G	ENSP00000418401:p.Val155Gly		135017177	NM_021203	Q6P595|Q8N2D8	Missense_Mutation	SNP	ENST00000466490.2	37	CCDS3081.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.734273	0.89482	.	.	ENSG00000144867	ENST00000466490	T	0.17213	2.29	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51896	-0.8647	10	0.87932	D	0	-18.3908	16.3473	0.83146	0.0:0.0:0.0:1.0	.	155	Q9Y5M8	SRPRB_HUMAN	G	155	ENSP00000418401:V155G	ENSP00000418401:V155G	V	+	2	0	SRPRB	135017177	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.408000	0.80041	2.320000	0.78422	0.528000	0.53228	GTG		0.433	SRPRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357170.2		
TAS2R10	50839	hgsc.bcm.edu	37	12	10978664	10978664	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:10978664T>C	ENST00000240619.2	-	1	293	c.205A>G	c.(205-207)Ata>Gta	p.I69V		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	69					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.I69V(1)		breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GGAGAGAATATCTGTATAAAT	0.333																																					p.I69V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A205G	12						.						43.0	47.0	46.0					12																	10978664		2203	4299	6502	10869931	SO:0001583	missense	50839	exon1			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.205A>G	12.37:g.10978664T>C	ENSP00000240619:p.Ile69Val		10869931	NM_023921	Q3MIM9|Q6NTD9	Missense_Mutation	SNP	ENST00000240619.2	37	CCDS8634.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.729998	0.00687	.	.	ENSG00000121318	ENST00000240619	T	0.37584	1.19	4.15	-1.3	0.09259	.	1.455470	0.04292	N	0.345755	T	0.12774	0.0310	N	0.03948	-0.315	0.09310	N	1	B	0.10296	0.003	B	0.16289	0.015	T	0.22626	-1.0211	10	0.02654	T	1	.	3.088	0.06284	0.1868:0.3221:0.0:0.4911	.	69	Q9NYW0	T2R10_HUMAN	V	69	ENSP00000240619:I69V	ENSP00000240619:I69V	I	-	1	0	TAS2R10	10869931	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-1.992000	0.01476	-0.012000	0.14223	-0.462000	0.05337	ATA		0.333	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399934.1		
GPR133	283383	hgsc.bcm.edu	37	12	131616324	131616324	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:131616324G>A	ENST00000261654.5	+	21	2789	c.2230G>A	c.(2230-2232)Gac>Aac	p.D744N	GPR133_ENST00000543617.1_Missense_Mutation_p.D263N|GPR133_ENST00000376682.4_Missense_Mutation_p.D430N|GPR133_ENST00000540207.1_3'UTR|GPR133_ENST00000535015.1_Missense_Mutation_p.D776N	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	744					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D744N(1)		NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		GATCAGCGCCGACAACTACAA	0.577																																					p.D744N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2230A	12						.						204.0	149.0	167.0					12																	131616324		2203	4300	6503	130182277	SO:0001583	missense	283383	exon21			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2230G>A	12.37:g.131616324G>A	ENSP00000261654:p.Asp744Asn		130182277	NM_198827	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	ENST00000261654.5	37	CCDS9272.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593587	0.46214	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000543617	T;T;T;T	0.41758	1.24;1.25;0.99;1.01	4.48	3.58	0.41010	GPCR, family 2-like (1);	0.115379	0.56097	U	0.000027	T	0.25005	0.0607	L	0.33293	1	0.48901	D	0.99972	P;B;B	0.37688	0.605;0.191;0.072	B;B;B	0.28011	0.085;0.031;0.021	T	0.03829	-1.1000	10	0.17832	T	0.49	.	10.3185	0.43751	0.0999:0.0:0.9001:0.0	.	776;97;744	B7ZLF7;Q9NSM3;Q6QNK2	.;.;GP133_HUMAN	N	744;776;430;263	ENSP00000261654:D744N;ENSP00000444425:D776N;ENSP00000365872:D430N;ENSP00000438021:D263N	ENSP00000261654:D744N	D	+	1	0	GPR133	130182277	1.000000	0.71417	0.233000	0.24025	0.985000	0.73830	8.150000	0.89634	0.845000	0.35118	0.491000	0.48974	GAC		0.577	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399356.1	NM_198827	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A	12						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	25289551	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		25289551	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
TMEM117	84216	hgsc.bcm.edu	37	12	44770472	44770472	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:44770472A>G	ENST00000266534.3	+	7	990	c.863A>G	c.(862-864)aAa>aGa	p.K288R	TMEM117_ENST00000536799.1_Missense_Mutation_p.K184R|TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_Intron	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	288						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.K288R(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		TTCTTCCAGAAAATCTTCAAG	0.393																																					p.K288R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A863G	12						.						114.0	106.0	109.0					12																	44770472		2203	4300	6503	43056739	SO:0001583	missense	84216	exon7			BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.863A>G	12.37:g.44770472A>G	ENSP00000266534:p.Lys288Arg		43056739	NM_032256		Missense_Mutation	SNP	ENST00000266534.3	37	CCDS8745.1	.	.	.	.	.	.	.	.	.	.	A	8.249	0.808581	0.16467	.	.	ENSG00000139173	ENST00000266534;ENST00000536799;ENST00000417623	T;T	0.42900	0.96;0.96	5.39	4.17	0.49024	.	0.254513	0.47093	D	0.000258	T	0.15998	0.0385	N	0.04880	-0.145	0.30660	N	0.754504	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.22243	-1.0222	10	0.07175	T	0.84	-13.0998	4.9853	0.14187	0.7158:0.0:0.1441:0.1401	.	184;288	F5H3Q2;Q9H0C3	.;TM117_HUMAN	R	288;184;36	ENSP00000266534:K288R;ENSP00000445243:K184R	ENSP00000266534:K288R	K	+	2	0	TMEM117	43056739	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.107000	0.50329	2.165000	0.68154	0.528000	0.53228	AAA		0.393	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403969.1	NM_032256	
AVPR1A	552	hgsc.bcm.edu	37	12	63541337	63541337	+	Silent	SNP	G	G	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:63541337G>T	ENST00000299178.2	-	2	1164	c.1059C>A	c.(1057-1059)ggC>ggA	p.G353G		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	353					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.G353G(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GAAGGAGATGGCCACTAAAAA	0.408																																					p.G353G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1059A	12						.						161.0	153.0	156.0					12																	63541337		2203	4300	6503	61827604	SO:0001819	synonymous_variant	552	exon2			L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.1059C>A	12.37:g.63541337G>T			61827604	NM_000706		Silent	SNP	ENST00000299178.2	37	CCDS8965.1																																																																																				0.408	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1		
METTL25	84190	hgsc.bcm.edu	37	12	82796889	82796889	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:82796889A>C	ENST00000248306.3	+	5	1328	c.1259A>C	c.(1258-1260)gAa>gCa	p.E420A	METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	420							methyltransferase activity (GO:0008168)	p.E420A(1)									TTATCTGAAGAATTTGAAAAC	0.373																																					p.E420A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1259C	12						.						86.0	81.0	83.0					12																	82796889		2203	4300	6503	81321020	SO:0001583	missense	84190	exon5			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.1259A>C	12.37:g.82796889A>C	ENSP00000248306:p.Glu420Ala		81321020	NM_032230	Q9H5Y3	Missense_Mutation	SNP	ENST00000248306.3	37	CCDS9024.1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.818497	0.71028	.	.	ENSG00000127720	ENST00000248306;ENST00000550298	T;T	0.44881	1.36;0.91	5.49	5.49	0.81192	.	0.154834	0.53938	D	0.000042	T	0.47655	0.1457	M	0.64567	1.98	0.48395	D	0.99964	P	0.46621	0.881	P	0.47864	0.559	T	0.39231	-0.9624	10	0.15499	T	0.54	-15.5835	15.5739	0.76359	1.0:0.0:0.0:0.0	.	420	Q8N6Q8	CL026_HUMAN	A	420;55	ENSP00000248306:E420A;ENSP00000449730:E55A	ENSP00000248306:E420A	E	+	2	0	C12orf26	81321020	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.539000	0.90637	2.076000	0.62316	0.482000	0.46254	GAA		0.373	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408192.1	NM_032230	
EP400	57634	hgsc.bcm.edu	37	12	132490750	132490750	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr12:132490750G>A	ENST00000333577.4	+	15	3246	c.3137G>A	c.(3136-3138)aGg>aAg	p.R1046K	EP400_ENST00000389561.2_Missense_Mutation_p.R1010K|EP400_ENST00000332482.4_Missense_Mutation_p.R973K|EP400_ENST00000330386.6_Missense_Mutation_p.R1010K|EP400_ENST00000389562.2_Missense_Mutation_p.R1009K			Q96L91	EP400_HUMAN	E1A binding protein p400	1046	Interactions with RUVBL1 and RUVBL2.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.R1009K(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GCTGCCGAGAGGATGAATATC	0.557																																					p.R1009K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3026A	12						.						99.0	92.0	94.0					12																	132490750		2203	4300	6503	131056703	SO:0001583	missense	57634	exon14			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.3137G>A	12.37:g.132490750G>A	ENSP00000333602:p.Arg1046Lys		131056703	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	ENST00000333577.4	37		.	.	.	.	.	.	.	.	.	.	G	14.65	2.599929	0.46318	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296;ENST00000542457	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	5.53	5.53	0.82687	.	0.142484	0.64402	D	0.000004	D	0.88897	0.6562	L	0.55103	1.725	0.34108	D	0.662706	P;P;P	0.46859	0.885;0.792;0.885	P;B;P	0.48189	0.57;0.415;0.57	D	0.87900	0.2690	10	0.10377	T	0.69	.	19.0592	0.93080	0.0:0.0:1.0:0.0	.	1010;1010;1009	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	K	1046;1010;1009;973;1010;1010;1010	ENSP00000333602:R1046K;ENSP00000374212:R1010K;ENSP00000374213:R1009K;ENSP00000331737:R973K;ENSP00000330620:R1010K	ENSP00000330620:R1010K	R	+	2	0	EP400	131056703	1.000000	0.71417	0.954000	0.39281	0.811000	0.45836	4.442000	0.59988	2.605000	0.88082	0.655000	0.94253	AGG		0.557	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
NPAP1	23742	hgsc.bcm.edu	37	15	24922476	24922476	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr15:24922476G>A	ENST00000329468.2	+	1	1936	c.1462G>A	c.(1462-1464)Gta>Ata	p.V488I		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	488	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.V488I(2)									TAATTCAGTCGTAGGAGCAGC	0.512																																					p.V488I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1462A	15						.						188.0	198.0	195.0					15																	24922476		2203	4300	6503	22473569	SO:0001583	missense	23742	exon1			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1462G>A	15.37:g.24922476G>A	ENSP00000333735:p.Val488Ile		22473569	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	8.200	0.798045	0.16327	.	.	ENSG00000185823	ENST00000329468	T	0.04917	3.53	2.07	-4.13	0.03904	.	6.428760	0.00447	N	0.000086	T	0.04497	0.0123	L	0.29908	0.895	0.09310	N	1	B	0.23854	0.092	B	0.13407	0.009	T	0.34875	-0.9811	10	0.15952	T	0.53	.	4.5352	0.12024	0.2848:0.2157:0.4995:0.0	.	488	Q9NZP6	CO002_HUMAN	I	488	ENSP00000333735:V488I	ENSP00000333735:V488I	V	+	1	0	C15orf2	22473569	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.612000	0.00884	-1.139000	0.02881	0.313000	0.20887	GTA		0.512	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
FBN1	2200	hgsc.bcm.edu	37	15	48760704	48760704	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr15:48760704G>A	ENST00000316623.5	-	37	4942	c.4487C>T	c.(4486-4488)aCg>aTg	p.T1496M		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1496	EGF-like 26; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T1496M(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ACTGATGCACGTGGTTGGATC	0.483																																					p.T1496M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4487T	15						.						118.0	95.0	103.0					15																	48760704		2198	4296	6494	46547996	SO:0001583	missense	2200	exon37			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4487C>T	15.37:g.48760704G>A	ENSP00000325527:p.Thr1496Met		46547996	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	37	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145520	0.37825	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.92965	-3.14	5.64	4.72	0.59763	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.297658	0.42053	N	0.000777	D	0.85860	0.5795	L	0.33710	1.025	0.80722	D	1	B	0.24675	0.109	B	0.17979	0.02	T	0.81752	-0.0789	10	0.33141	T	0.24	.	10.2982	0.43637	0.1495:0.0:0.8505:0.0	.	1496	P35555	FBN1_HUMAN	M	1496;64;386	ENSP00000325527:T1496M	ENSP00000325527:T1496M	T	-	2	0	FBN1	46547996	0.980000	0.34600	0.980000	0.43619	0.816000	0.46133	1.904000	0.39868	1.616000	0.50265	0.650000	0.86243	ACG		0.483	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
HMG20A	10363	hgsc.bcm.edu	37	15	77770689	77770689	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr15:77770689G>C	ENST00000381714.3	+	9	1172	c.744G>C	c.(742-744)gaG>gaC	p.E248D	HMG20A_ENST00000336216.4_Missense_Mutation_p.E248D	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	248					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E248D(2)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						AGTTTGAGGAGAGGAATGCAG	0.557																																					p.E248D												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G744C	15						.						77.0	69.0	72.0					15																	77770689		2196	4294	6490	75557744	SO:0001583	missense	10363	exon9			AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.744G>C	15.37:g.77770689G>C	ENSP00000371133:p.Glu248Asp		75557744	NM_018200	A6NHY3|D3DW78|Q53G31|Q9NSF6	Missense_Mutation	SNP	ENST00000381714.3	37	CCDS10295.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368232	0.82463	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	T;T	0.70749	-0.51;-0.51	5.86	1.78	0.24846	.	0.000000	0.85682	D	0.000000	T	0.78470	0.4288	M	0.78456	2.415	0.52099	D	0.999947	D	0.60160	0.987	P	0.59424	0.857	T	0.75442	-0.3316	10	0.46703	T	0.11	-17.7482	9.244	0.37513	0.3499:0.0:0.6501:0.0	.	248	Q9NP66	HM20A_HUMAN	D	248	ENSP00000336856:E248D;ENSP00000371133:E248D	ENSP00000336856:E248D	E	+	3	2	HMG20A	75557744	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.837000	0.39201	0.073000	0.16731	0.563000	0.77884	GAG		0.557	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
KIAA1024	23251	hgsc.bcm.edu	37	15	79749445	79749445	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr15:79749445C>T	ENST00000305428.3	+	2	1031	c.956C>T	c.(955-957)cCg>cTg	p.P319L		NM_015206.2	NP_056021.1	Q9UPX6	K1024_HUMAN	KIAA1024	319						integral component of membrane (GO:0016021)		p.P319L(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(2)|pancreas(2)|prostate(1)	49						GTGTATTCCCCGGTTCCTGAC	0.517																																					p.P319L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C956T	15						.						129.0	136.0	134.0					15																	79749445		2196	4293	6489	77536500	SO:0001583	missense	23251	exon2			AB028947	CCDS32306.1	15q25.1	2007-12-12				ENSG00000169330			29172	protein-coding gene	gene with protein product						10470851	Standard	NM_015206		Approved		uc002bew.1	Q9UPX6		ENST00000305428.3:c.956C>T	15.37:g.79749445C>T	ENSP00000307461:p.Pro319Leu		77536500	NM_015206	A7MD43	Missense_Mutation	SNP	ENST00000305428.3	37	CCDS32306.1	.	.	.	.	.	.	.	.	.	.	C	19.65	3.866838	0.72065	.	.	ENSG00000169330	ENST00000305428	T	0.32272	1.46	5.01	5.01	0.66863	.	0.182021	0.48767	D	0.000164	T	0.54127	0.1839	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.53429	-0.8440	9	.	.	.	.	16.5141	0.84294	0.0:1.0:0.0:0.0	.	319	Q9UPX6	K1024_HUMAN	L	319	ENSP00000307461:P319L	.	P	+	2	0	KIAA1024	77536500	1.000000	0.71417	0.495000	0.27527	0.921000	0.55340	5.290000	0.65661	2.312000	0.78011	0.591000	0.81541	CCG		0.517	KIAA1024-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416718.1	NM_015206	
EVC2	132884	hgsc.bcm.edu	37	4	5667311	5667311	+	Silent	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr4:5667311C>A	ENST00000344408.5	-	8	989	c.936G>T	c.(934-936)ctG>ctT	p.L312L	EVC2_ENST00000310917.2_Silent_p.L232L|EVC2_ENST00000344938.1_Silent_p.L312L	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	312					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L312L(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CAGCCCAGGTCAGCACAAGGG	0.567																																					p.L232L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G696T	4						.						160.0	103.0	122.0					4																	5667311		2203	4300	6503	5718212	SO:0001819	synonymous_variant	132884	exon8			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.936G>T	4.37:g.5667311C>A			5718212	NM_001166136	Q86YT3|Q86YT4|Q8NG49	Silent	SNP	ENST00000344408.5	37	CCDS3382.2																																																																																				0.567	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
ANKRD17	26057	hgsc.bcm.edu	37	4	74008069	74008069	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr4:74008069C>T	ENST00000358602.4	-	13	2235	c.2119G>A	c.(2119-2121)Ggt>Agt	p.G707S	ANKRD17_ENST00000509867.2_Missense_Mutation_p.G594S|ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000330838.6_Missense_Mutation_p.G707S	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	707					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.G707S(1)		NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTATGGCCACCTTTTGCTGCT	0.403																																					p.G707S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2119A	4						.						104.0	108.0	107.0					4																	74008069		2203	4300	6503	74226933	SO:0001583	missense	26057	exon13			AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.2119G>A	4.37:g.74008069C>T	ENSP00000351416:p.Gly707Ser		74226933	NM_198889	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	C	33	5.229797	0.95173	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.62941	-0.01;-0.01;-0.01	5.53	5.53	0.82687	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000005	T	0.66858	0.2832	N	0.20881	0.62	0.52099	D	0.999945	D;P;D;D;D	0.89917	1.0;0.914;0.982;0.981;0.986	D;P;D;D;D	0.91635	0.999;0.863;0.972;0.968;0.968	T	0.57837	-0.7742	10	0.08599	T	0.76	.	19.8832	0.96905	0.0:1.0:0.0:0.0	.	228;707;707;707;594	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	S	707;707;707;594;707	ENSP00000351416:G707S;ENSP00000332265:G707S;ENSP00000427151:G594S	ENSP00000332265:G707S	G	-	1	0	ANKRD17	74226933	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.764000	0.85297	2.772000	0.95346	0.644000	0.83932	GGT		0.403	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
WDFY3	23001	hgsc.bcm.edu	37	4	85661380	85661380	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr4:85661380T>A	ENST00000295888.4	-	39	6831	c.6424A>T	c.(6424-6426)Agc>Tgc	p.S2142C	WDFY3_ENST00000322366.6_Missense_Mutation_p.S2142C	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2142					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.S2142C(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GCCAGACAGCTAATGAATTCT	0.423																																					p.S2142C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6424T	4						.						134.0	134.0	134.0					4																	85661380		2203	4300	6503	85880404	SO:0001583	missense	23001	exon39			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6424A>T	4.37:g.85661380T>A	ENSP00000295888:p.Ser2142Cys		85880404	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.621376	0.66787	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.64438	-0.1;-0.1	5.16	5.16	0.70880	.	0.095546	0.64402	D	0.000001	T	0.41213	0.1149	N	0.03608	-0.345	0.49213	D	0.99976	P	0.39903	0.694	B	0.40165	0.321	T	0.44697	-0.9311	10	0.25751	T	0.34	.	15.2795	0.73770	0.0:0.0:0.0:1.0	.	2142	Q8IZQ1	WDFY3_HUMAN	C	2142	ENSP00000318466:S2142C;ENSP00000295888:S2142C	ENSP00000295888:S2142C	S	-	1	0	WDFY3	85880404	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	4.672000	0.61597	2.067000	0.61834	0.383000	0.25322	AGC		0.423	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
BMPR1B	658	hgsc.bcm.edu	37	4	96035970	96035970	+	Silent	SNP	T	T	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr4:96035970T>C	ENST00000515059.1	+	5	526	c.243T>C	c.(241-243)tgT>tgC	p.C81C	BMPR1B_ENST00000264568.4_Silent_p.C81C|BMPR1B_ENST00000440890.2_Silent_p.C111C|BMPR1B_ENST00000502683.1_Silent_p.C81C|BMPR1B_ENST00000394931.1_Silent_p.C81C	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	81					BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)	p.C81C(1)		breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		ATTTTCAGTGTCGGGTAAGGT	0.428																																					p.C81C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T243C	4						.						227.0	223.0	224.0					4																	96035970		2203	4299	6502	96254993	SO:0001819	synonymous_variant	658	exon5			D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.243T>C	4.37:g.96035970T>C			96254993	NM_001203	B2R953|B4DSV1|P78366	Silent	SNP	ENST00000515059.1	37	CCDS3642.1																																																																																				0.428	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253609.3	NM_001203	
DRP2	1821	hgsc.bcm.edu	37	X	100492613	100492613	+	Missense_Mutation	SNP	G	G	A	rs144183424		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chrX:100492613G>A	ENST00000395209.3	+	5	814	c.287G>A	c.(286-288)cGc>cAc	p.R96H	DRP2_ENST00000538510.1_Missense_Mutation_p.R96H|DRP2_ENST00000402866.1_Missense_Mutation_p.R96H|DRP2_ENST00000541709.1_Missense_Mutation_p.R18H	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	96					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R93H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						TGCAGCGCTCGCCTAGAGGCC	0.418																																					p.R96H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G287A	X						.	G	HIS/ARG,HIS/ARG	1,3834		0,1,1631,571	95.0	89.0	91.0		53,287	5.9	1.0	X	dbSNP_134	91	0,6728		0,0,2428,1872	no	missense,missense	DRP2	NM_001171184.1,NM_001939.2	29,29	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging	18/880,96/958	100492613	1,10562	2203	4300	6503	100379269	SO:0001583	missense	1821	exon5			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.287G>A	X.37:g.100492613G>A	ENSP00000378635:p.Arg96His		100379269	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	CCDS14480.2	.	.	.	.	.	.	.	.	.	.	g	16.50	3.141959	0.57044	2.61E-4	0.0	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.46425	0.1392	L	0.42581	1.335	0.58432	D	0.999998	D	0.69078	0.997	P	0.56865	0.808	T	0.16482	-1.0401	10	0.13108	T	0.6	-13.8798	19.1513	0.93491	0.0:0.0:1.0:0.0	.	96	Q13474	DRP2_HUMAN	H	96;96;18;96	ENSP00000385038:R96H;ENSP00000378635:R96H;ENSP00000444752:R18H;ENSP00000441051:R96H	ENSP00000362007:R96H	R	+	2	0	DRP2	100379269	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.611000	0.82962	2.473000	0.83533	0.540000	0.68198	CGC		0.418	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
CXorf58	254158	hgsc.bcm.edu	37	X	23945402	23945402	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chrX:23945402G>A	ENST00000379211.3	+	6	1019	c.470G>A	c.(469-471)cGt>cAt	p.R157H		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	157								p.R157H(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						AAATTTCACCGTATAATTATG	0.328																																					p.R157H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G470A	X						.						112.0	109.0	110.0					X																	23945402		2203	4299	6502	23855323	SO:0001583	missense	254158	exon6			AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.470G>A	X.37:g.23945402G>A	ENSP00000368511:p.Arg157His		23855323	NM_152761		Missense_Mutation	SNP	ENST00000379211.3	37	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	G	2.468	-0.322641	0.05350	.	.	ENSG00000165182	ENST00000379211	T	0.29917	1.55	5.59	-2.49	0.06403	.	2.609730	0.01114	N	0.005649	T	0.09335	0.0230	N	0.00500	-1.43	0.09310	N	1	B;B	0.16396	0.017;0.017	B;B	0.10450	0.005;0.005	T	0.15780	-1.0425	10	0.30854	T	0.27	1.0927	5.1851	0.15180	0.4735:0.2577:0.2688:0.0	.	157;157	B7ZLS7;Q96LI9	.;CX058_HUMAN	H	157	ENSP00000368511:R157H	ENSP00000368511:R157H	R	+	2	0	CXorf58	23855323	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.253000	0.18296	-0.692000	0.05128	-0.512000	0.04463	CGT		0.328	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	
JADE3	9767	hgsc.bcm.edu	37	X	46918065	46918065	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chrX:46918065G>A	ENST00000218343.4	+	11	2356	c.2058G>A	c.(2056-2058)atG>atA	p.M686I	PHF16_ENST00000397189.1_Missense_Mutation_p.M686I	NM_014735.3	NP_055550.1												p.M686I(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						CGAGTGAGATGTTCTGTGACC	0.498																																					p.M686I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2058A	X						.						52.0	45.0	48.0					X																	46918065		2203	4300	6503	46803009	SO:0001583	missense	9767	exon11																														ENST00000218343.4:c.2058G>A	X.37:g.46918065G>A	ENSP00000218343:p.Met686Ile		46803009	NM_014735		Missense_Mutation	SNP	ENST00000218343.4	37	CCDS14271.1	.	.	.	.	.	.	.	.	.	.	G	8.215	0.801249	0.16397	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	T;T	0.48522	0.81;0.81	5.73	3.77	0.43336	.	1.465190	0.03466	N	0.212969	T	0.32466	0.0830	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.17899	-1.0354	10	0.30854	T	0.27	.	5.8232	0.18538	0.2884:0.0:0.5625:0.149	.	686	Q92613	JADE3_HUMAN	I	686	ENSP00000380373:M686I;ENSP00000218343:M686I	ENSP00000218343:M686I	M	+	3	0	PHF16	46803009	0.002000	0.14202	0.120000	0.21714	0.945000	0.59286	-0.075000	0.11431	1.167000	0.42706	0.600000	0.82982	ATG		0.498	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056376.1		
ZNF449	203523	hgsc.bcm.edu	37	X	134481166	134481166	+	Silent	SNP	A	A	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chrX:134481166A>T	ENST00000339249.4	+	2	263	c.123A>T	c.(121-123)gcA>gcT	p.A41A	ZNF449_ENST00000370760.3_Silent_p.A41A|ZNF449_ENST00000370761.3_Silent_p.A41A	NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	41	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A41A(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					ACAGAGAAGCAGCTGGGCCTC	0.473																																					p.A41A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A123T	X						.						95.0	89.0	91.0					X																	134481166		2203	4300	6503	134308832	SO:0001819	synonymous_variant	203523	exon2			AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.123A>T	X.37:g.134481166A>T			134308832	NM_152695	Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Silent	SNP	ENST00000339249.4	37	CCDS14649.1																																																																																				0.473	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058411.1	NM_152695	
APLF	200558	hgsc.bcm.edu	37	2	68740774	68740774	+	Nonsense_Mutation	SNP	T	T	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr2:68740774T>G	ENST00000303795.4	+	5	755	c.584T>G	c.(583-585)tTa>tGa	p.L195*		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	195					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)	p.L195*(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GCAGAACATTTAAGTGATCAA	0.373																																					p.L195X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.T584G	2						.						96.0	97.0	97.0					2																	68740774		2203	4299	6502	68594278	SO:0001587	stop_gained	200558	exon5			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.584T>G	2.37:g.68740774T>G	ENSP00000307004:p.Leu195*		68594278	NM_173545	A8K476|Q53P47|Q53PB9|Q53QU0	Nonsense_Mutation	SNP	ENST00000303795.4	37	CCDS1888.1	.	.	.	.	.	.	.	.	.	.	t	34	5.402069	0.96030	.	.	ENSG00000169621	ENST00000303795	.	.	.	6.17	-1.85	0.07784	.	0.712055	0.13786	N	0.362847	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4747	0.16690	0.1313:0.371:0.0:0.4978	.	.	.	.	X	195	.	ENSP00000307004:L195X	L	+	2	0	APLF	68594278	0.004000	0.15560	0.000000	0.03702	0.996000	0.88848	0.120000	0.15647	-0.539000	0.06273	0.533000	0.62120	TTA		0.373	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251759.1	NM_173545	
ANTXR1	84168	hgsc.bcm.edu	37	2	69409753	69409753	+	Silent	SNP	T	T	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr2:69409753T>G	ENST00000303714.4	+	16	1636	c.1314T>G	c.(1312-1314)cgT>cgG	p.R438R	RNU6-1216P_ENST00000362590.2_RNA|RNA5SP96_ENST00000516041.1_RNA	NM_032208.2	NP_115584.1	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1	438					actin cytoskeleton reorganization (GO:0031532)|reproductive process (GO:0022414)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|lamellipodium membrane (GO:0031258)	actin filament binding (GO:0051015)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|transmembrane signaling receptor activity (GO:0004888)	p.R438R(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						ACAATATGCGTCGGCCTTCTT	0.438									Familial Infantile Hemangioma																												p.R438R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1314G	2						.						124.0	120.0	122.0					2																	69409753		2203	4300	6503	69263257	SO:0001819	synonymous_variant	84168	exon16	Familial Cancer Database	Infantile Capillary Hemangioma, HCI, Hereditary Capillary Hemangioma	AF421380	CCDS1892.1, CCDS46313.1, CCDS46314.1	2p13.1	2006-04-12			ENSG00000169604	ENSG00000169604			21014	protein-coding gene	gene with protein product	"""anthrax toxin receptor"", ""tumor endothelial marker 8 precursor"""	606410				10947988, 11559528	Standard	NM_032208		Approved	TEM8, FLJ21776, FLJ10601, ATR	uc002sfg.3	Q9H6X2	OTTHUMG00000129575	ENST00000303714.4:c.1314T>G	2.37:g.69409753T>G			69263257	NM_032208	A8K7U8|J7K7G4|J7KF88|Q4ZFV6|Q53QD8|Q96P02|Q9NVP3	Silent	SNP	ENST00000303714.4	37	CCDS1892.1																																																																																				0.438	ANTXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251770.2	NM_032208	
FAM171B	165215	hgsc.bcm.edu	37	2	187627527	187627527	+	Missense_Mutation	SNP	C	C	T	rs148878744		TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr2:187627527C>T	ENST00000304698.5	+	8	2661	c.2458C>T	c.(2458-2460)Cgc>Tgc	p.R820C		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	820						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)	p.R820C(1)		NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						GCGAGAGGAACGCCCACTGAT	0.428													C|||	1	0.000199681	0.0	0.0	5008	,	,		19768	0.001		0.0	False		,,,				2504	0.0				p.R820C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2458T	2						.	C	CYS/ARG	0,4406		0,0,2203	81.0	81.0	81.0		2458	5.1	1.0	2	dbSNP_134	81	1,8595	1.2+/-3.3	0,1,4297	no	missense	FAM171B	NM_177454.3	180	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	820/827	187627527	1,13001	2203	4298	6501	187335772	SO:0001583	missense	165215	exon8			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2458C>T	2.37:g.187627527C>T	ENSP00000304108:p.Arg820Cys		187335772	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	37	CCDS33347.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.14	3.038953	0.55003	0.0	1.16E-4	ENSG00000144369	ENST00000304698	T	0.58210	0.35	6.02	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	L	0.60455	1.87	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.64506	0.926;0.926	T	0.68070	-0.5506	10	0.87932	D	0	-12.2673	13.976	0.64273	0.2559:0.7441:0.0:0.0	.	820;821	Q6P995;A8K122	F171B_HUMAN;.	C	820	ENSP00000304108:R820C	ENSP00000304108:R820C	R	+	1	0	FAM171B	187335772	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.975000	0.40569	2.850000	0.98022	0.650000	0.86243	CGC		0.428	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
ECM2	1842	hgsc.bcm.edu	37	9	95277476	95277476	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr9:95277476G>T	ENST00000344604.5	-	4	640	c.491C>A	c.(490-492)tCt>tAt	p.S164Y	CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Intron	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	164					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.S164Y(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						ACTGAGTAGAGAATAGGAGAC	0.328																																					p.S164Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C491A	9						.						31.0	30.0	30.0					9																	95277476		2203	4300	6503	94317297	SO:0001583	missense	1842	exon4			AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.491C>A	9.37:g.95277476G>T	ENSP00000344758:p.Ser164Tyr		94317297	NM_001393	B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	ENST00000344604.5	37	CCDS6698.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.485172	0.26598	.	.	ENSG00000106823	ENST00000344604	T	0.51325	0.71	5.32	0.134	0.14771	.	1.799990	0.02395	N	0.080075	T	0.31295	0.0792	N	0.14661	0.345	0.09310	N	1	P	0.44578	0.838	B	0.41988	0.372	T	0.11665	-1.0578	10	0.33141	T	0.24	.	3.9167	0.09227	0.3631:0.0:0.4798:0.157	.	164	O94769	ECM2_HUMAN	Y	164	ENSP00000344758:S164Y	ENSP00000344758:S164Y	S	-	2	0	ECM2	94317297	0.000000	0.05858	0.000000	0.03702	0.979000	0.70002	-0.341000	0.07811	-0.161000	0.10983	0.650000	0.86243	TCT		0.328	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053091.1	NM_001393	
SETX	23064	hgsc.bcm.edu	37	9	135172276	135172276	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr9:135172276C>G	ENST00000224140.5	-	14	6129	c.5947G>C	c.(5947-5949)Gag>Cag	p.E1983Q	SETX_ENST00000372169.2_Missense_Mutation_p.E1983Q|SETX_ENST00000393220.1_Missense_Mutation_p.E1983Q	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1983					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)	p.E1983Q(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATACCTACCTCTGTCAGTAGA	0.403																																					p.E1983Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5947C	9						.						139.0	113.0	122.0					9																	135172276		2203	4300	6503	134162097	SO:0001583	missense	23064	exon14			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.5947G>C	9.37:g.135172276C>G	ENSP00000224140:p.Glu1983Gln		134162097	NM_015046	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	ENST00000224140.5	37	CCDS6947.1	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134792	0.56828	.	.	ENSG00000107290	ENST00000224140;ENST00000436441;ENST00000372169;ENST00000393220	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.53	5.53	0.82687	.	0.168428	0.40144	N	0.001164	D	0.86306	0.5901	N	0.25647	0.755	0.41871	D	0.990279	D;D;D	0.89917	0.98;1.0;1.0	D;D;D	0.91635	0.966;0.999;0.998	D	0.86889	0.2047	10	0.48119	T	0.1	.	18.0171	0.89245	0.0:1.0:0.0:0.0	.	1983;1983;1983	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	Q	1983;225;1983;1983	ENSP00000224140:E1983Q;ENSP00000409143:E225Q;ENSP00000361242:E1983Q;ENSP00000376913:E1983Q	ENSP00000224140:E1983Q	E	-	1	0	SETX	134162097	0.998000	0.40836	1.000000	0.80357	0.202000	0.24057	4.027000	0.57239	2.601000	0.87937	0.563000	0.77884	GAG		0.403	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054774.3	NM_015046	
MYPN	84665	hgsc.bcm.edu	37	10	69959139	69959139	+	Silent	SNP	G	G	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr10:69959139G>A	ENST00000358913.5	+	17	3788	c.3300G>A	c.(3298-3300)ccG>ccA	p.P1100P	MYPN_ENST00000354393.2_Silent_p.P825P|MYPN_ENST00000540630.1_Silent_p.P1100P	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1100	Ig-like 4.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)	p.P1100P(1)		breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GTGGTTTACCGCCCCCGGAGC	0.512																																					p.P1100P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3300A	10						.						58.0	50.0	52.0					10																	69959139		2203	4300	6503	69629145	SO:0001819	synonymous_variant	84665	exon17			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3300G>A	10.37:g.69959139G>A			69629145	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	ENST00000358913.5	37	CCDS7275.1																																																																																				0.512	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
C10orf35	219738	hgsc.bcm.edu	37	10	71391546	71391546	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr10:71391546C>T	ENST00000373279.4	+	3	206	c.47C>T	c.(46-48)cCc>cTc	p.P16L	C10orf35_ENST00000491890.1_3'UTR	NM_145306.2	NP_660349.1	Q96D05	CJ035_HUMAN	chromosome 10 open reading frame 35	16						integral component of membrane (GO:0016021)		p.P16L(1)		breast(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GATGACGACCCCCGAGTGAGG	0.597																																					p.P16L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C47T	10						.						160.0	118.0	132.0					10																	71391546		2203	4300	6503	71061552	SO:0001583	missense	219738	exon3			BC013587	CCDS7295.1	10q22.2	2003-11-21			ENSG00000171224	ENSG00000171224			23519	protein-coding gene	gene with protein product						12477932	Standard	NM_145306		Approved		uc001jpq.4	Q96D05	OTTHUMG00000018383	ENST00000373279.4:c.47C>T	10.37:g.71391546C>T	ENSP00000362376:p.Pro16Leu		71061552	NM_145306		Missense_Mutation	SNP	ENST00000373279.4	37	CCDS7295.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507392	0.85282	.	.	ENSG00000171224	ENST00000373279;ENST00000421716	.	.	.	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000008	T	0.77336	0.4115	M	0.63843	1.955	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.79050	-0.1962	9	0.72032	D	0.01	-7.6925	16.703	0.85364	0.0:1.0:0.0:0.0	.	16	Q96D05	CJ035_HUMAN	L	16;58	.	ENSP00000362376:P16L	P	+	2	0	C10orf35	71061552	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	4.829000	0.62737	2.551000	0.86045	0.491000	0.48974	CCC		0.597	C10orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048454.1	NM_145306	
APC	324	hgsc.bcm.edu	37	5	112175147	112175147	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr5:112175147G>T	ENST00000457016.1	+	16	4236	c.3856G>T	c.(3856-3858)Gaa>Taa	p.E1286*	APC_ENST00000508376.2_Nonsense_Mutation_p.E1286*|APC_ENST00000257430.4_Nonsense_Mutation_p.E1286*|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1286	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.E1286*(7)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCTGAAGATGAAATAGGATG	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.E1268X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,right,Substitution - Nonsense,0	.	9	Substitution - Nonsense(7)|Unknown(1)|Deletion - Frameshift(1)	large_intestine(7)|soft_tissue(1)|skin(1)	c.G3802T	5	GRCh37	CM940071	APC	M		.						55.0	57.0	56.0					5																	112175147		2202	4300	6502	112203046	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3856G>T	5.37:g.112175147G>T	ENSP00000413133:p.Glu1286*		112203046	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	G	40	7.991415	0.98599	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.03	6.03	0.97812	.	0.179817	0.47455	D	0.000223	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-25.935	20.1672	0.98154	0.0:0.0:1.0:0.0	.	.	.	.	X	1286	.	.	E	+	1	0	APC	112203046	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.137000	0.71710	2.861000	0.98227	0.655000	0.94253	GAA		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
GM2A	2760	hgsc.bcm.edu	37	5	150646436	150646436	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr5:150646436C>T	ENST00000357164.3	+	3	713	c.388C>T	c.(388-390)Cgt>Tgt	p.R130C		NM_000405.4|NM_001167607.1	NP_000396.2|NP_001161079.1	P17900	SAP3_HUMAN	GM2 ganglioside activator	130					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|learning or memory (GO:0007611)|lipid storage (GO:0019915)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	apical cortex (GO:0045179)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|mitochondrion (GO:0005739)	beta-N-acetylhexosaminidase activity (GO:0004563)|lipid transporter activity (GO:0005319)|phospholipase activator activity (GO:0016004)	p.R130C(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|upper_aerodigestive_tract(2)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGAGCCCCTGCGTACCTATGG	0.512																																					p.R130C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C388T	5						.						100.0	98.0	99.0					5																	150646436		2203	4300	6503	150626629	SO:0001583	missense	2760	exon3				CCDS4313.1	5q33.1	2010-03-17	2004-05-20		ENSG00000196743	ENSG00000196743			4367	protein-coding gene	gene with protein product	"""cerebroside sulfate activator protein"", ""sphingolipid activator protein 3"""	613109	"""GM2 ganglioside activator protein"""			115863, 1915857	Standard	NM_000405		Approved	SAP-3	uc003ltr.4	P17900	OTTHUMG00000130124	ENST00000357164.3:c.388C>T	5.37:g.150646436C>T	ENSP00000349687:p.Arg130Cys		150626629	NM_001167607	B2R699|D3DQH6|Q14426|Q14428|Q6LBL5	Missense_Mutation	SNP	ENST00000357164.3	37	CCDS4313.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.976121|3.976121	0.74360|0.74360	.|.	.|.	ENSG00000196743|ENSG00000196743	ENST00000523004|ENST00000523466;ENST00000357164	.|T;T	.|0.70399	.|-0.48;-0.48	5.7|5.7	4.83|4.83	0.62350|0.62350	.|MD-2-related lipid-recognition (1);	.|0.180058	.|0.64402	.|D	.|0.000012	T|T	0.67439|0.67439	0.2893|0.2893	L|L	0.27053|0.27053	0.805|0.805	0.41166|0.41166	D|D	0.986136|0.986136	.|D;D;D	.|0.89917	.|1.0;0.998;0.997	.|P;P;P	.|0.55455	.|0.776;0.448;0.491	T|T	0.70579|0.70579	-0.4833|-0.4833	5|10	.|0.72032	.|D	.|0.01	-9.6758|-9.6758	8.55|8.55	0.33447|0.33447	0.1519:0.77:0.0:0.0781|0.1519:0.77:0.0:0.0781	.|.	.|130;88;130	.|B4DQM5;Q14427;P17900	.|.;.;SAP3_HUMAN	V|C	88|145;130	.|ENSP00000429100:R145C;ENSP00000349687:R130C	.|ENSP00000349687:R130C	A|R	+|+	2|1	0|0	GM2A|GM2A	150626629|150626629	0.999000|0.999000	0.42202|0.42202	0.978000|0.978000	0.43139|0.43139	0.886000|0.886000	0.51366|0.51366	2.797000|2.797000	0.47877|0.47877	1.409000|1.409000	0.46915|0.46915	0.655000|0.655000	0.94253|0.94253	GCG|CGT		0.512	GM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252432.1	NM_000405	
F2RL1	2150	hgsc.bcm.edu	37	5	76129107	76129107	+	Silent	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	.	.	.	.	Unknown	Unknown	Somatic	Phase_I	Capture	.			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr5:76129107C>A	ENST00000296677.4	+	2	881	c.675C>A	c.(673-675)acC>acA	p.T225T		NM_005242.4	NP_005233	P55085	PAR2_HUMAN	coagulation factor II (thrombin) receptor-like 1	225					blood coagulation (GO:0007596)|chemokine (C-C motif) ligand 2 secretion (GO:0035926)|chemokine secretion (GO:0090195)|defense response to virus (GO:0051607)|establishment of endothelial barrier (GO:0061028)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|interleukin-1 beta secretion (GO:0050702)|interleukin-10 secretion (GO:0072608)|leukocyte migration (GO:0050900)|leukocyte proliferation (GO:0070661)|mature dendritic cell differentiation (GO:0097029)|negative regulation of chemokine secretion (GO:0090198)|negative regulation of JNK cascade (GO:0046329)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neutrophil activation (GO:0042119)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of cell migration (GO:0030335)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of eosinophil degranulation (GO:0043311)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of neutrophil mediated killing of gram-negative bacterium (GO:0070963)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of renin secretion into blood stream (GO:1900135)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasodilation (GO:0045909)|regulation of blood coagulation (GO:0030193)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of JNK cascade (GO:0046328)|T cell activation involved in immune response (GO:0002286)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)	p.T225T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	13		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;7.7e-51)|Epithelial(54;2.77e-45)|all cancers(79;3.47e-41)		ACATCACGACCTGTCATGATG	0.502																																					p.T225T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C675A	5						.						111.0	97.0	102.0					5																	76129107		2203	4300	6503	76164863	SO:0001819	synonymous_variant	2150	exon2			BC018130	CCDS4033.1	5q13	2012-08-08			ENSG00000164251	ENSG00000164251		"""GPCR / Class A : Protease activated receptors"""	3538	protein-coding gene	gene with protein product	"""proteinase-activated receptor-2"""	600933		GPR11		7937743, 7556175	Standard	NM_005242		Approved	PAR2	uc003keo.3	P55085	OTTHUMG00000102118	ENST00000296677.4:c.675C>A	5.37:g.76129107C>A			76164863	NM_005242	Q13317|Q13346|Q53XJ8	Silent	SNP	ENST00000296677.4	37	CCDS4033.1																																																																																				0.502	F2RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219957.2		
RNF130	55819	hgsc.bcm.edu	37	5	179382668	179382668	+	Splice_Site	SNP	C	C	A			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr5:179382668C>A	ENST00000261947.4	-	8	1550	c.1152G>T	c.(1150-1152)agG>agT	p.R384S	RNF130_ENST00000521389.1_Splice_Site_p.V416L|RNF130_ENST00000520564.1_5'UTR|RNF130_ENST00000522208.2_Intron	NM_001280801.1	NP_001267730.1			ring finger protein 130									p.V416L(1)		breast(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	17	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AACCATTCTACCCTATGGAAT	0.368																																					p.V416L	GBM(24;432 554 38471 39699 51728)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1246T	5						.						62.0	65.0	64.0					5																	179382668		2202	4300	6502	179315274	SO:0001630	splice_region_variant	55819	exon9			AF155650	CCDS4451.1, CCDS64340.1	5q35.3	2013-01-09			ENSG00000113269	ENSG00000113269		"""RING-type (C3HC4) zinc fingers"""	18280	protein-coding gene	gene with protein product						10806348	Standard	NM_018434		Approved	GP, G1RZFP, GOLIATH	uc003mll.1	Q86XS8	OTTHUMG00000130909	ENST00000261947.4:c.1151-1G>T	5.37:g.179382668C>A			179315274	NM_018434		Missense_Mutation	SNP	ENST00000261947.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.60|13.60	2.286063|2.286063	0.40394|0.40394	.|.	.|.	ENSG00000113269|ENSG00000113269	ENST00000261947|ENST00000521389	T|T	0.04454|0.04275	3.62|3.66	5.18|5.18	4.31|4.31	0.51392|0.51392	.|.	.|0.381207	.|0.25166	.|N	.|0.032632	T|T	0.03220|0.03220	0.0094|0.0094	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B|B	0.13594|0.02656	0.008|0.0	B|B	0.14578|0.04013	0.011|0.001	T|T	0.47156|0.47156	-0.9139|-0.9139	9|10	0.72032|0.59425	D|D	0.01|0.04	.|.	11.5252|11.5252	0.50576|0.50576	0.0:0.916:0.0:0.084|0.0:0.916:0.0:0.084	.|.	401|416	Q59EL1|Q86XS8	.|GOLI_HUMAN	S|L	384|416	ENSP00000261947:R384S|ENSP00000430237:V416L	ENSP00000261947:R384S|ENSP00000430237:V416L	R|V	-|-	3|1	2|0	RNF130|RNF130	179315274|179315274	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.807000|0.807000	0.45602|0.45602	2.045000|2.045000	0.41250|0.41250	1.297000|1.297000	0.44761|0.44761	0.591000|0.591000	0.81541|0.81541	AGG|GTA		0.368	RNF130-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374205.1	NM_018434	Missense_Mutation
CDCA5	113130	hgsc.bcm.edu	37	11	64846661	64846661	+	Splice_Site	SNP	T	T	C			TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454			SOLID	TCGA-AG-A015-01A-01W-A005-10	TCGA-AG-A015-10A-01W-A005-10	g.chr11:64846661T>C	ENST00000275517.3	-	6	851		c.e6-2		CDCA5_ENST00000404147.3_Missense_Mutation_p.Q281R	NM_080668.3	NP_542399.1	Q96FF9	CDCA5_HUMAN	cell division cycle associated 5						double-strand break repair (GO:0006302)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|regulation of cohesin localization to chromatin (GO:0071922)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)	p.?(1)		large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CTCCGTTTTCTGAGGGAAGAG	0.557																																					.												.	.	1	Unknown(1)	large_intestine(1)	.	11						.						50.0	44.0	46.0					11																	64846661		2201	4297	6498	64603237	SO:0001630	splice_region_variant	113130	.			BG354578	CCDS8091.1	11q13.1	2011-01-31			ENSG00000146670	ENSG00000146670			14626	protein-coding gene	gene with protein product	"""sororin"""	609374				12188893, 15837422	Standard	NM_080668		Approved		uc001ocp.2	Q96FF9	OTTHUMG00000150420	ENST00000275517.3:c.679-2A>G	11.37:g.64846661T>C			64603237	.	A8K625	Splice_Site	SNP	ENST00000275517.3	37	CCDS8091.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.73|14.73	2.623113|2.623113	0.46840|0.46840	.|.	.|.	ENSG00000146670|ENSG00000146670	ENST00000275517|ENST00000404147	.|T	.|0.47869	.|0.83	3.19|3.19	3.19|3.19	0.36642|0.36642	.|.	.|.	.|.	.|.	.|.	.|T	.|0.48447	.|0.1500	.|.	.|.	.|.	0.22171|0.22171	N|N	0.999311|0.999311	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.43718	.|-0.9374	.|6	.|0.87932	.|D	.|0	.|.	8.1541|8.1541	0.31158|0.31158	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	.|R	-1|281	.|ENSP00000385711:Q281R	.|ENSP00000385711:Q281R	.|Q	-|-	.|2	.|0	CDCA5|CDCA5	64603237|64603237	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.915000|0.915000	0.54546|0.54546	4.588000|4.588000	0.60999|0.60999	1.724000|1.724000	0.51502|0.51502	0.528000|0.528000	0.53228|0.53228	.|CAG		0.557	CDCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385186.1	NM_080668	Intron
