#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
APC	324	broad.mit.edu	37	5	112173797	112173798	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AG-A01L-01	TCGA-AG-A01L-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:112173797_112173798insC	ENST00000457016.1	+	16	2886_2887	c.2506_2507insC	c.(2506-2508)tcafs	p.S836fs	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Frame_Shift_Ins_p.S836fs|APC_ENST00000257430.4_Frame_Shift_Ins_p.S836fs			P25054	APC_HUMAN	adenomatous polyposis coli	836	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)|p.S837fs*7(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CAGCTCCTCTTCATCAAGAGGA	0.401		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S836fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)	c.2506_2507insC	5	GRCh37	CM064976	APC	M		.																																			112201697	SO:0001589	frameshift_variant	324	exon16	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2507dupC	5.37:g.112173798_112173798dupC	ENSP00000413133:p.Ser836fs		112201696	NM_000038	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Ins	INS	ENST00000457016.1	37	CCDS4107.1																																																																																				0.401	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
CHST12	55501	broad.mit.edu	37	7	2472319	2472319	+	Silent	SNP	G	G	A	rs577438892	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr7:2472319G>A	ENST00000258711.6	+	2	180	c.45G>A	c.(43-45)tcG>tcA	p.S15S		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	15					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)	p.S15S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		TGCTGGGGTCGGTGTTCATGA	0.672																																					p.S15S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G45A	7						.						52.0	44.0	46.0					7																	2472319		2203	4300	6503	2438845	SO:0001819	synonymous_variant	55501	exon2			AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.45G>A	7.37:g.2472319G>A			2438845	NM_018641	A4D1Z9|Q502W3|Q9NXY7	Silent	SNP	ENST00000258711.6	37	CCDS5333.1																																																																																				0.672	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060170.3	NM_018641	
MAGI2	9863	broad.mit.edu	37	7	77797326	77797326	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr7:77797326C>T	ENST00000354212.4	-	15	2756	c.2503G>A	c.(2503-2505)Ggc>Agc	p.G835S	MAGI2_ENST00000419488.1_Missense_Mutation_p.G821S|MAGI2_ENST00000522391.1_Missense_Mutation_p.G835S	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	835	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.G835S(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGGGTTTTGCCGGCTACTGGA	0.537																																					p.G835S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2503A	7						.						164.0	148.0	153.0					7																	77797326		2203	4300	6503	77635262	SO:0001583	missense	9863	exon15			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2503G>A	7.37:g.77797326C>T	ENSP00000346151:p.Gly835Ser		77635262	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	C	36	5.925043	0.97110	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.54071	0.59;0.74;0.74	5.96	5.96	0.96718	PDZ/DHR/GLGF (4);	0.000000	0.37261	U	0.002175	T	0.66597	0.2805	L	0.61036	1.89	0.80722	D	1	P;D;P	0.62365	0.691;0.991;0.881	B;P;B	0.54965	0.227;0.765;0.227	T	0.67348	-0.5693	10	0.66056	D	0.02	.	19.4074	0.94653	0.0:1.0:0.0:0.0	.	835;821;835	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	S	821;835;835;835	ENSP00000405766:G821S;ENSP00000346151:G835S;ENSP00000428389:G835S	ENSP00000346151:G835S	G	-	1	0	MAGI2	77635262	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.818000	0.86416	2.831000	0.97527	0.650000	0.86243	GGC		0.537	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
GIMAP6	474344	broad.mit.edu	37	7	150325442	150325442	+	Missense_Mutation	SNP	G	G	A	rs149376163		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr7:150325442G>A	ENST00000328902.5	-	3	460	c.244C>T	c.(244-246)Cgg>Tgg	p.R82W	GIMAP6_ENST00000493969.1_Intron	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	82	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)	p.R82W(1)		endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCTCGGCTCCGTCTCTGGGAG	0.587																																					p.R82W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C244T	7						.	G	TRP/ARG	0,4406		0,0,2203	136.0	140.0	139.0		244	3.4	0.0	7	dbSNP_134	139	1,8599	1.2+/-3.3	0,1,4299	no	missense	GIMAP6	NM_024711.5	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	82/293	150325442	1,13005	2203	4300	6503	149956375	SO:0001583	missense	474344	exon3			AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.244C>T	7.37:g.150325442G>A	ENSP00000330374:p.Arg82Trp		149956375	NM_024711	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	37	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	G	18.21	3.572995	0.65765	0.0	1.16E-4	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.34472	1.36	4.29	3.41	0.39046	AIG1 (1);	0.554035	0.18417	N	0.141867	T	0.48554	0.1506	L	0.54323	1.7	0.48511	D	0.999667	P	0.50272	0.933	P	0.58970	0.849	T	0.46911	-0.9157	10	0.72032	D	0.01	.	10.1908	0.43026	0.0:0.7973:0.2027:0.0	.	82	Q6P9H5	GIMA6_HUMAN	W	82;143	ENSP00000330374:R82W	ENSP00000330374:R82W	R	-	1	2	GIMAP6	149956375	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.246000	0.18160	1.048000	0.40298	-0.228000	0.12330	CGG		0.587	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711	
KCNG1	3755	broad.mit.edu	37	20	49620944	49620944	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr20:49620944C>T	ENST00000371571.4	-	3	1459	c.1174G>A	c.(1174-1176)Gcg>Acg	p.A392T	RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'UTR	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	392					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)	p.A392T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						AGCAGGGGCGCGAAGAGGGCG	0.672																																					p.A392T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1174A	20						.						32.0	36.0	35.0					20																	49620944		2203	4300	6503	49054351	SO:0001583	missense	3755	exon3			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.1174G>A	20.37:g.49620944C>T	ENSP00000360626:p.Ala392Thr		49054351	NM_002237	A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	ENST00000371571.4	37	CCDS13436.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.903477	0.52333	.	.	ENSG00000026559	ENST00000371571	D	0.98400	-4.91	5.22	5.22	0.72569	Ion transport (1);	0.203246	0.52532	D	0.000072	D	0.97826	0.9286	M	0.63843	1.955	0.80722	D	1	D	0.56287	0.975	P	0.52424	0.698	D	0.97484	1.0049	9	.	.	.	.	14.4818	0.67587	0.1477:0.8523:0.0:0.0	.	392	Q9UIX4	KCNG1_HUMAN	T	392	ENSP00000360626:A392T	.	A	-	1	0	KCNG1	49054351	0.999000	0.42202	1.000000	0.80357	0.221000	0.24807	3.874000	0.56101	2.433000	0.82419	0.313000	0.20887	GCG		0.672	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079726.4	NM_002237	
MYH7	4625	broad.mit.edu	37	14	23902842	23902842	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr14:23902842T>C	ENST00000355349.3	-	3	262	c.100A>G	c.(100-102)Aag>Gag	p.K34E		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	34					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.K34E(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		ACATCCTTCTTGAGGTCAAAA	0.562																																					p.K34E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A100G	14						.						110.0	96.0	101.0					14																	23902842		2203	4300	6503	22972682	SO:0001583	missense	4625	exon3			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.100A>G	14.37:g.23902842T>C	ENSP00000347507:p.Lys34Glu		22972682	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	37	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019730	0.75275	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.91521	-2.86	4.26	4.26	0.50523	Myosin, N-terminal, SH3-like (1);	.	.	.	.	D	0.94568	0.8250	H	0.94658	3.565	0.58432	D	0.999999	B	0.15473	0.013	B	0.38327	0.271	D	0.94225	0.7471	9	0.66056	D	0.02	.	13.3331	0.60500	0.0:0.0:0.0:1.0	.	34	P12883	MYH7_HUMAN	E	34	ENSP00000347507:K34E	ENSP00000347507:K34E	K	-	1	0	MYH7	22972682	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	1.684000	0.51022	0.454000	0.30748	AAG		0.562	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
FSCB	84075	broad.mit.edu	37	14	44975156	44975156	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr14:44975156C>A	ENST00000340446.4	-	1	1326	c.1035G>T	c.(1033-1035)gaG>gaT	p.E345D	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	345	Pro-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)	p.E345D(1)		breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CAGCCAGAAGCTCTACAGAAG	0.498																																					p.E345D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1035T	14						.						70.0	81.0	77.0					14																	44975156		2203	4300	6503	44044906	SO:0001583	missense	84075	exon1			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1035G>T	14.37:g.44975156C>A	ENSP00000344579:p.Glu345Asp		44044906	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	ENST00000340446.4	37	CCDS9679.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412000	0.25465	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14640	2.49	1.8	0.884	0.19182	.	.	.	.	.	T	0.16727	0.0402	N	0.24115	0.695	0.09310	N	1	D	0.64830	0.994	D	0.65987	0.94	T	0.23440	-1.0188	9	0.25106	T	0.35	.	6.3232	0.21229	0.0:0.8255:0.0:0.1745	.	345	Q5H9T9	FSCB_HUMAN	D	345	ENSP00000344579:E345D	ENSP00000344579:E345D	E	-	3	2	FSCB	44044906	0.000000	0.05858	0.007000	0.13788	0.018000	0.09664	-0.672000	0.05244	0.332000	0.23536	-0.451000	0.05528	GAG		0.498	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
SYNE3	161176	broad.mit.edu	37	14	95921953	95921953	+	Missense_Mutation	SNP	C	C	T	rs112493785		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr14:95921953C>T	ENST00000334258.5	-	5	912	c.898G>A	c.(898-900)Gga>Aga	p.G300R	SYNE3_ENST00000553340.1_Missense_Mutation_p.G300R|SYNE3_ENST00000554873.1_Missense_Mutation_p.G57R|SYNE3_ENST00000557275.1_Missense_Mutation_p.G300R	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	300					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)	p.G300R(2)		breast(1)|endometrium(2)|lung(25)	28						TCCAGTTCTCCGGTGATCTTC	0.617																																					p.G300R												C14orf49,central_nervous_system,brain,Substitution - Missense,0	.	2	Substitution - Missense(2)	large_intestine(1)|central_nervous_system(1)	c.G898A	14						.	C	ARG/GLY	0,4406		0,0,2203	107.0	113.0	111.0		898	-8.1	0.0	14	dbSNP_132	111	1,8599	1.2+/-3.3	0,1,4299	no	missense	C14orf49	NM_152592.3	125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	300/976	95921953	1,13005	2203	4300	6503	94991706	SO:0001583	missense	161176	exon5			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.898G>A	14.37:g.95921953C>T	ENSP00000334308:p.Gly300Arg		94991706	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	C	1.626	-0.520327	0.04171	0.0	1.16E-4	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275;ENST00000553340	T;T;T;T	0.33654	3.67;1.4;3.67;3.1	4.99	-8.14	0.01069	.	1.670270	0.03928	N	0.284762	T	0.16685	0.0401	N	0.12182	0.205	0.09310	N	1	B;B;B	0.14012	0.003;0.009;0.002	B;B;B	0.09377	0.002;0.004;0.001	T	0.15665	-1.0429	10	0.17369	T	0.5	0.1359	8.4086	0.32629	0.0:0.1937:0.3622:0.4441	.	300;300;300	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	R	300;57;300;300	ENSP00000334308:G300R;ENSP00000452154:G57R;ENSP00000450562:G300R;ENSP00000450774:G300R	ENSP00000334308:G300R	G	-	1	0	C14orf49	94991706	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.522000	0.06237	-1.246000	0.02510	0.455000	0.32223	GGA		0.617	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
TNRC6B	23112	broad.mit.edu	37	22	40662788	40662788	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr22:40662788C>T	ENST00000454349.2	+	5	2765	c.2554C>T	c.(2554-2556)Cga>Tga	p.R852*	TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000335727.9_Nonsense_Mutation_p.R852*|TNRC6B_ENST00000402203.1_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	852	Interaction with argonaute proteins.|Pro-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R866*(2)		breast(1)	1						AGGCAACGTTCGACCTTCCAA	0.617																																					p.R852X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C2554T	22						.						31.0	37.0	35.0					22																	40662788		2107	4216	6323	38992734	SO:0001587	stop_gained	23112	exon5			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.2554C>T	22.37:g.40662788C>T	ENSP00000401946:p.Arg852*		38992734	NM_015088	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	C	43	10.036531	0.99323	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	.	.	.	5.46	4.4	0.53042	.	0.062472	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-4.4001	12.7472	0.57287	0.4244:0.5756:0.0:0.0	.	.	.	.	X	852	.	ENSP00000338371:R852X	R	+	1	2	TNRC6B	38992734	1.000000	0.71417	0.936000	0.37596	0.986000	0.74619	2.771000	0.47670	1.230000	0.43646	0.561000	0.74099	CGA		0.617	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
EFCAB6	64800	broad.mit.edu	37	22	43926709	43926709	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr22:43926709C>T	ENST00000262726.7	-	31	4622	c.4369G>A	c.(4369-4371)Gca>Aca	p.A1457T	EFCAB6-AS1_ENST00000431327.3_RNA|EFCAB6_ENST00000396231.2_Missense_Mutation_p.A1305T|EFCAB6_ENST00000461800.1_5'UTR	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1457	EF-hand 16. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Interaction with AR.|Interaction with PARK7.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.A1457T(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CTGAAATCTGCGACGCTTAGC	0.592																																					p.A1305T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3913A	22						.						78.0	68.0	72.0					22																	43926709		2203	4300	6503	42258042	SO:0001583	missense	64800	exon29			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.4369G>A	22.37:g.43926709C>T	ENSP00000262726:p.Ala1457Thr		42258042	NM_198856	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	ENST00000262726.7	37	CCDS14049.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.012689	0.35511	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.08102	3.13;3.13	4.56	3.54	0.40534	EF-hand-like domain (1);	0.521194	0.17829	N	0.160586	T	0.15176	0.0366	L	0.49571	1.57	0.09310	N	0.999991	D	0.76494	0.999	P	0.62560	0.904	T	0.10337	-1.0634	10	0.14656	T	0.56	-6.3559	7.4113	0.27019	0.0:0.7392:0.1689:0.0919	.	1457	Q5THR3	EFCB6_HUMAN	T	1305;1457	ENSP00000379533:A1305T;ENSP00000262726:A1457T	ENSP00000262726:A1457T	A	-	1	0	EFCAB6	42258042	0.021000	0.18746	0.312000	0.25196	0.015000	0.08874	0.512000	0.22755	1.129000	0.42072	0.655000	0.94253	GCA		0.592	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
CEP89	84902	broad.mit.edu	37	19	33372823	33372823	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr19:33372823G>A	ENST00000305768.5	-	18	2150	c.2062C>T	c.(2062-2064)Cag>Tag	p.Q688*		NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	688					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)		p.Q688*(1)		breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						CGCATCTCCTGCCGGTACTGG	0.652																																					p.Q688X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2062T	19						.						38.0	28.0	31.0					19																	33372823		2203	4300	6503	38064663	SO:0001587	stop_gained	84902	exon18			AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.2062C>T	19.37:g.33372823G>A	ENSP00000306105:p.Gln688*		38064663	NM_032816	B9EGA6|Q8N5J8	Nonsense_Mutation	SNP	ENST00000305768.5	37	CCDS32987.1	.	.	.	.	.	.	.	.	.	.	g	26.3	4.725362	0.89298	.	.	ENSG00000121289	ENST00000305768	.	.	.	5.76	2.38	0.29361	.	0.631105	0.14995	N	0.286499	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	-5.6234	8.691	0.34267	0.0722:0.0:0.6499:0.2779	.	.	.	.	X	688	.	ENSP00000306105:Q688X	Q	-	1	0	CEP89	38064663	1.000000	0.71417	0.962000	0.40283	0.178000	0.23041	1.332000	0.33805	0.315000	0.23110	0.556000	0.70494	CAG		0.652	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451300.2	NM_032816	
ZNF793	390927	broad.mit.edu	37	19	38028005	38028005	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr19:38028005A>T	ENST00000587143.1	+	6	680	c.445A>T	c.(445-447)Aat>Tat	p.N149Y	ZNF793_ENST00000445217.1_Missense_Mutation_p.N149Y|ZNF793_ENST00000542455.1_Missense_Mutation_p.N149Y|ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000589319.1_Intron			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N149Y(1)		kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTGAACCATAATTTAGACTT	0.358																																					p.N149Y	Melanoma(44;400 1431 1499 19093)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A445T	19						.						44.0	42.0	43.0					19																	38028005		1814	4073	5887	42719845	SO:0001583	missense	390927	exon8			AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.445A>T	19.37:g.38028005A>T	ENSP00000468605:p.Asn149Tyr		42719845	NM_001013659	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	ENST00000587143.1	37	CCDS46062.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.589798	0.46214	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	T;T	0.07800	3.16;3.16	4.15	1.89	0.25635	.	0.568533	0.14678	N	0.304928	T	0.05823	0.0152	L	0.45228	1.405	0.09310	N	1	P	0.35982	0.531	B	0.31191	0.125	T	0.38845	-0.9642	10	0.16896	T	0.51	.	5.6397	0.17557	0.6537:0.1766:0.0:0.1697	.	149	E9PGN4	.	Y	149;149;149;148	ENSP00000444355:N149Y;ENSP00000396402:N149Y	ENSP00000318811:N148Y	N	+	1	0	ZNF793	42719845	0.000000	0.05858	0.253000	0.24343	0.942000	0.58702	0.392000	0.20801	0.189000	0.20188	0.533000	0.62120	AAT		0.358	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
ARHGEF1	9138	broad.mit.edu	37	19	42396742	42396742	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr19:42396742C>T	ENST00000354532.3	+	7	584	c.436C>T	c.(436-438)Cag>Tag	p.Q146*	ARHGEF1_ENST00000337665.4_Nonsense_Mutation_p.Q161*|ARHGEF1_ENST00000378152.4_Nonsense_Mutation_p.Q128*|ARHGEF1_ENST00000599846.1_Nonsense_Mutation_p.Q146*|ARHGEF1_ENST00000347545.4_Nonsense_Mutation_p.Q113*	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	146	RGSL.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q161*(1)		breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GGTGCAAAGCCAGCAGGTAGC	0.662																																					p.Q113X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C337T	19						.						39.0	40.0	40.0					19																	42396742		2203	4300	6503	47088582	SO:0001587	stop_gained	9138	exon6			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.436C>T	19.37:g.42396742C>T	ENSP00000346532:p.Gln146*		47088582	NM_198977	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Nonsense_Mutation	SNP	ENST00000354532.3	37	CCDS12591.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153113	0.78001	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000316079;ENST00000337665;ENST00000378152	.	.	.	4.32	4.32	0.51571	.	0.165430	0.39759	N	0.001273	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-23.0337	14.7275	0.69354	0.0:1.0:0.0:0.0	.	.	.	.	X	146;113;182;161;128	.	ENSP00000323044:Q182X	Q	+	1	0	ARHGEF1	47088582	0.995000	0.38212	0.986000	0.45419	0.457000	0.32468	3.640000	0.54350	2.157000	0.67596	0.306000	0.20318	CAG		0.662	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000463360.1	NM_199002	
BCAM	4059	broad.mit.edu	37	19	45322958	45322958	+	Missense_Mutation	SNP	C	C	T	rs376176106		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr19:45322958C>T	ENST00000270233.6	+	13	1760	c.1738C>T	c.(1738-1740)Cgc>Tgc	p.R580C	BCAM_ENST00000589651.1_Missense_Mutation_p.R580C	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	580					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)	p.R580C(1)		central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CCCCTGCTGCCGCCAGCGGCG	0.647																																					p.R580C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1738T	19						.		CYS/ARG,CYS/ARG	0,4364		0,0,2182	16.0	19.0	18.0		1738,1738	3.0	1.0	19		18	2,8508		0,2,4253	no	missense,missense	BCAM	NM_001013257.1,NM_005581.3	180,180	0,2,6435	TT,TC,CC		0.0235,0.0,0.0155	benign,benign	580/589,580/629	45322958	2,12872	2182	4255	6437	50014798	SO:0001583	missense	4059	exon13			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1738C>T	19.37:g.45322958C>T	ENSP00000270233:p.Arg580Cys		50014798	NM_001013257	A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	ENST00000270233.6	37	CCDS12644.1	.	.	.	.	.	.	.	.	.	.	.	7.155	0.584470	0.13749	0.0	2.35E-4	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.60299	0.2;0.24	4.08	3.04	0.35103	.	.	.	.	.	T	0.30696	0.0773	N	0.03608	-0.345	0.31357	N	0.681868	B	0.02656	0.0	B	0.01281	0.0	T	0.22417	-1.0217	9	0.45353	T	0.12	-23.0305	6.0449	0.19753	0.0:0.1279:0.0:0.8721	.	580	P50895	BCAM_HUMAN	C	580	ENSP00000270233:R580C;ENSP00000375817:R580C	ENSP00000270233:R580C	R	+	1	0	BCAM	50014798	1.000000	0.71417	0.999000	0.59377	0.015000	0.08874	1.530000	0.36007	0.576000	0.29452	-0.425000	0.05940	CGC		0.647	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453220.1	NM_005581	
ANGPT1	284	broad.mit.edu	37	8	108359322	108359322	+	IGR	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr8:108359322C>T								ANGPT1 (10572 upstream) : RNA5SP275 (537399 downstream)														p.E101K(1)									ATGTAATTCTCAAGCTGCAAG	0.433																																					p.E101K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G301A	8						.						112.0	108.0	109.0					8																	108359322		2203	4300	6503	108428498	SO:0001628	intergenic_variant	284	exon2																															8.37:g.108359322C>T			108428498	NM_001146		Missense_Mutation	SNP		37		.	.	.	.	.	.	.	.	.	.	C	33	5.238976	0.95240	.	.	ENSG00000154188	ENST00000517746;ENST00000297450	T;T	0.44083	0.93;0.93	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.67636	0.2914	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66590	-0.5885	10	0.54805	T	0.06	.	20.3501	0.98811	0.0:1.0:0.0:0.0	.	101;101	Q5HYA0;Q15389	.;ANGP1_HUMAN	K	101	ENSP00000428340:E101K;ENSP00000297450:E101K	ENSP00000297450:E101K	E	-	1	0	ANGPT1	108428498	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.995000	0.70631	2.807000	0.96579	0.650000	0.86243	GAG	0	0.433								
CSMD3	114788	broad.mit.edu	37	8	113529433	113529433	+	Missense_Mutation	SNP	C	C	T	rs138068999		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr8:113529433C>T	ENST00000297405.5	-	28	4830	c.4586G>A	c.(4585-4587)cGt>cAt	p.R1529H	CSMD3_ENST00000455883.2_Missense_Mutation_p.R1425H|CSMD3_ENST00000343508.3_Missense_Mutation_p.R1489H|CSMD3_ENST00000352409.3_Missense_Mutation_p.R1529H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1529	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R1529H(2)|p.R1489H(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCCTGGGTCACGACACGCAGT	0.413										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		14260	0.0		0.0	False		,,,				2504	0.0				p.R1529H												.	.	3	Substitution - Missense(3)	kidney(2)|large_intestine(1)	c.G4586A	8						.	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	55.0	49.0	51.0		4274,4586,4466	3.8	1.0	8	dbSNP_134	51	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	CSMD3	NM_052900.2,NM_198123.1,NM_198124.1	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	1425/3539,1529/3708,1489/3668	113529433	2,13004	2203	4300	6503	113598609	SO:0001583	missense	114788	exon28			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4586G>A	8.37:g.113529433C>T	ENSP00000297405:p.Arg1529His		113598609	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	21.3	4.129748	0.77549	0.0	2.33E-4	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	4.7	3.81	0.43845	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.70098	0.3185	L	0.41632	1.29	0.33293	D	0.563809	D;D;D	0.89917	1.0;1.0;0.997	D;D;P	0.76071	0.977;0.987;0.862	T	0.76661	-0.2877	10	0.39692	T	0.17	.	14.2188	0.65812	0.1506:0.8494:0.0:0.0	.	1425;1529;1489	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	H	1489;1529;869;1425;1529	ENSP00000345799:R1489H;ENSP00000297405:R1529H;ENSP00000341558:R869H;ENSP00000412263:R1425H;ENSP00000343124:R1529H	ENSP00000297405:R1529H	R	-	2	0	CSMD3	113598609	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.894000	0.56250	1.159000	0.42565	0.585000	0.79938	CGT		0.413	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
FER1L6	654463	broad.mit.edu	37	8	125109516	125109516	+	Missense_Mutation	SNP	G	G	A	rs190405294	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr8:125109516G>A	ENST00000522917.1	+	36	4906	c.4700G>A	c.(4699-4701)cGc>cAc	p.R1567H	FER1L6_ENST00000399018.1_Missense_Mutation_p.R1567H|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1567						integral component of membrane (GO:0016021)		p.R1567H(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AACAAGGGCCGCCTGCAGATG	0.463													G|||	9	0.00179712	0.0061	0.0	5008	,	,		15110	0.001		0.0	False		,,,				2504	0.0				p.R1567H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4700A	8						.	G	HIS/ARG	17,3809		0,17,1896	83.0	80.0	81.0		4700	5.8	1.0	8		81	1,8293		0,1,4146	yes	missense	FER1L6	NM_001039112.2	29	0,18,6042	AA,AG,GG		0.0121,0.4443,0.1485	benign	1567/1858	125109516	18,12102	1913	4147	6060	125178697	SO:0001583	missense	654463	exon36			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4700G>A	8.37:g.125109516G>A	ENSP00000428280:p.Arg1567His		125178697	NM_001039112		Missense_Mutation	SNP	ENST00000522917.1	37	CCDS43767.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.40	3.380225	0.61845	0.004443	1.21E-4	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.86297	-2.1;-2.1	5.85	5.85	0.93711	C2 calcium/lipid-binding domain, CaLB (1);	0.297938	0.30611	U	0.009249	D	0.85720	0.5762	L	0.54323	1.7	0.36042	D	0.840182	B	0.23058	0.079	B	0.17979	0.02	D	0.85092	0.0952	10	0.62326	D	0.03	-11.2725	18.4185	0.90579	0.0:0.0:1.0:0.0	.	1567	Q2WGJ9	FR1L6_HUMAN	H	1567	ENSP00000428280:R1567H;ENSP00000381982:R1567H	ENSP00000381982:R1567H	R	+	2	0	FER1L6	125178697	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	3.618000	0.54188	2.779000	0.95612	0.650000	0.86243	CGC		0.463	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
ASAP1	50807	broad.mit.edu	37	8	131070229	131070229	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr8:131070229C>T	ENST00000518721.1	-	29	3513	c.3286G>A	c.(3286-3288)Gtc>Atc	p.V1096I	ASAP1_ENST00000357668.1_Missense_Mutation_p.V1096I	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	1096	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)	p.V1096I(1)		breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TCCCCTGTGACGATAATCACT	0.498																																					p.V1096I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3286A	8						.						318.0	245.0	270.0					8																	131070229		2203	4300	6503	131139411	SO:0001583	missense	50807	exon28			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.3286G>A	8.37:g.131070229C>T	ENSP00000429900:p.Val1096Ile		131139411	NM_018482	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	37	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.7|29.7	5.026989|5.026989	0.93518|0.93518	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000524124;ENST00000519483|ENST00000343135;ENST00000357668;ENST00000518721	.|T;T	.|0.57107	.|0.42;0.42	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Src homology-3 domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63367|0.63367	0.2505|0.2505	L|L	0.31578|0.31578	0.945|0.945	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.999;0.999	.|D;D;D	.|0.79784	.|0.993;0.993;0.991	T|T	0.67397|0.67397	-0.5681|-0.5681	5|10	.|0.87932	.|D	.|0	.|.	17.8947|17.8947	0.88883|0.88883	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1096;1096;1099	.|B2RNV3;Q9ULH1;Q9ULH1-2	.|.;ASAP1_HUMAN;.	H|I	916;452|1099;1096;1096	.|ENSP00000350297:V1096I;ENSP00000429900:V1096I	.|ENSP00000344591:V1099I	R|V	-|-	2|1	0|0	ASAP1|ASAP1	131139411|131139411	1.000000|1.000000	0.71417|0.71417	0.931000|0.931000	0.37212|0.37212	0.777000|0.777000	0.43975|0.43975	7.696000|7.696000	0.84270|0.84270	2.436000|2.436000	0.82500|0.82500	0.655000|0.655000	0.94253|0.94253	CGT|GTC		0.498	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
CSMD1	64478	broad.mit.edu	37	8	3019722	3019722	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr8:3019722C>T	ENST00000520002.1	-	39	6361	c.5806G>A	c.(5806-5808)Gac>Aac	p.D1936N	CSMD1_ENST00000539096.1_Missense_Mutation_p.D1935N|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Missense_Mutation_p.D1935N|CSMD1_ENST00000602557.1_Missense_Mutation_p.D1936N|CSMD1_ENST00000602723.1_Missense_Mutation_p.D1936N|CSMD1_ENST00000400186.3_Missense_Mutation_p.D1936N|CSMD1_ENST00000542608.1_Missense_Mutation_p.D1935N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1936	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.D1664N(1)|p.D1935N(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAGAGCACGTCGTTCACCATG	0.512																																					p.R1935Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G5804A	8						.						89.0	93.0	92.0					8																	3019722		1977	4165	6142	3007129	SO:0001583	missense	64478	exon38					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5806G>A	8.37:g.3019722C>T	ENSP00000430733:p.Asp1936Asn		3007129	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.143256|4.143256	0.77888|0.77888	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.2;-0.2;-0.2|.	5.38|5.38	5.38|5.38	0.77491|0.77491	Complement control module (2);Sushi/SCR/CCP (3);|.	0.063724|.	0.64402|.	D|.	0.000008|.	T|T	0.69205|0.69205	0.3085|0.3085	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	D;B;D;P|.	0.89917|.	1.0;0.09;0.967;0.842|.	D;B;P;B|.	0.87578|.	0.998;0.376;0.652;0.41|.	T|T	0.64715|0.64715	-0.6342|-0.6342	10|5	0.21540|.	T|.	0.41|.	.|.	19.0734|19.0734	0.93150|0.93150	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1936;1936;1935;1936|.	E5RIG2;Q96PZ7;F5H2I8;Q96PZ7-4|.	.;CSMD1_HUMAN;.;.|.	N|Q	1936;1936;1797;1935;1935;1935|1415	ENSP00000383047:D1936N;ENSP00000430733:D1936N;ENSP00000441462:D1935N;ENSP00000446243:D1935N;ENSP00000441675:D1935N|.	ENSP00000320445:D1797N|.	D|R	-|-	1|2	0|0	CSMD1|CSMD1	3007129|3007129	1.000000|1.000000	0.71417|0.71417	0.898000|0.898000	0.35279|0.35279	0.529000|0.529000	0.34654|0.34654	5.328000|5.328000	0.65887|0.65887	2.664000|2.664000	0.90586|0.90586	0.655000|0.655000	0.94253|0.94253	GAC|CGA		0.512	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
KCNQ3	3786	broad.mit.edu	37	8	133152333	133152333	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr8:133152333G>A	ENST00000388996.4	-	11	1978	c.1558C>T	c.(1558-1560)Cga>Tga	p.R520*	KCNQ3_ENST00000519445.1_Nonsense_Mutation_p.R520*|KCNQ3_ENST00000521134.1_Nonsense_Mutation_p.R400*	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	520					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.R520*(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CTGACGGCTCGGATGGCGGCC	0.607																																					p.R520X												.	.	2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)	c.C1558T	8						.						59.0	63.0	62.0					8																	133152333		2203	4300	6503	133221515	SO:0001587	stop_gained	3786	exon11			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1558C>T	8.37:g.133152333G>A	ENSP00000373648:p.Arg520*		133221515	NM_004519	A2VCT8|B4DJY4|E7EQ89	Nonsense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	G	37	6.046189	0.97231	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	.	.	.	6.03	4.08	0.47627	.	0.062532	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5201	15.7279	0.77777	0.0:0.0:0.6884:0.3116	.	.	.	.	X	520;400;520;509;399	.	ENSP00000373648:R520X	R	-	1	2	KCNQ3	133221515	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	0.726000	0.25984	1.555000	0.49500	-0.152000	0.13540	CGA		0.607	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
NRAS	4893	broad.mit.edu	37	1	115256530	115256530	+	Missense_Mutation	SNP	G	G	T	rs121913254		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:115256530G>T	ENST00000369535.4	-	3	434	c.181C>A	c.(181-183)Caa>Aaa	p.Q61K		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61K(595)|p.Q61E(9)|p.Q61L(3)|p.Q61R(2)|p.G60>?(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TACTCTTCTTGTCCAGCTGTA	0.458	Q61K(CHP212_AUTONOMIC_GANGLIA)|Q61K(HCC15_LUNG)|Q61K(HS936T_SKIN)|Q61K(HS944T_SKIN)|Q61K(HT1080_SOFT_TISSUE)|Q61K(HUT78_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(M07E_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(NCIH1299_LUNG)|Q61K(NCIH2087_LUNG)|Q61K(OCILY19_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61K(SKNAS_AUTONOMIC_GANGLIA)|Q61K(SKNSH_AUTONOMIC_GANGLIA)|Q61K(TYKNU_OVARY)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61K			Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,haematopoietic_and_lymphoid_tissue,NS,Substitution - Missense,0	.	610	Substitution - Missense(609)|Complex(1)	skin(372)|haematopoietic_and_lymphoid_tissue(73)|thyroid(55)|NS(29)|large_intestine(28)|soft_tissue(16)|lung(12)|autonomic_ganglia(6)|liver(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|cervix(2)|endometrium(2)|pancreas(2)|meninges(1)|kidney(1)|biliary_tract(1)|stomach(1)|ovary(1)|bone(1)	c.C181A	1						.						180.0	156.0	164.0					1																	115256530		2203	4300	6503	115058053	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.181C>A	1.37:g.115256530G>T	ENSP00000358548:p.Gln61Lys		115058053	NM_002524	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	G	33	5.255564	0.95336	.	.	ENSG00000213281	ENST00000369535	D	0.83506	-1.73	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.91845	0.7419	H	0.95850	3.73	0.80722	D	1	P	0.51791	0.948	P	0.54759	0.76	D	0.93711	0.7024	10	0.62326	D	0.03	.	18.6626	0.91477	0.0:0.0:1.0:0.0	.	61	P01111	RASN_HUMAN	K	61	ENSP00000358548:Q61K	ENSP00000358548:Q61K	Q	-	1	0	NRAS	115058053	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.520000	0.98027	2.624000	0.88883	0.655000	0.94253	CAA		0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	
FLG	2312	broad.mit.edu	37	1	152280074	152280074	+	Missense_Mutation	SNP	G	G	A	rs140376327		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:152280074G>A	ENST00000368799.1	-	3	7323	c.7288C>T	c.(7288-7290)Cgg>Tgg	p.R2430W	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2430	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R2430W(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCCGGTCCGTCCATGGGCG	0.592									Ichthyosis				G|||	1	0.000199681	0.0	0.0	5008	,	,		20890	0.0		0.001	False		,,,				2504	0.0				p.R2430W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7288T	1						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	255.0	238.0	244.0		7288	1.6	0.0	1	dbSNP_134	244	4,8596	4.3+/-15.6	0,4,4296	no	missense	FLG	NM_002016.1	101	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	benign	2430/4062	152280074	5,13001	2203	4300	6503	150546698	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7288C>T	1.37:g.152280074G>A	ENSP00000357789:p.Arg2430Trp		150546698	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	7.286	0.610080	0.14066	2.27E-4	4.65E-4	ENSG00000143631	ENST00000368799	T	0.01745	4.66	4.55	1.57	0.23409	.	.	.	.	.	T	0.00666	0.0022	L	0.41027	1.25	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.45234	-0.9275	9	0.51188	T	0.08	.	7.4395	0.27174	0.0906:0.3128:0.5966:0.0	.	2430	P20930	FILA_HUMAN	W	2430	ENSP00000357789:R2430W	ENSP00000357789:R2430W	R	-	1	2	FLG	150546698	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.114000	0.10757	0.105000	0.17753	-0.347000	0.07816	CGG		0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SPRR2E	6704	broad.mit.edu	37	1	153066193	153066193	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:153066193C>A	ENST00000368751.1	-	2	109	c.35G>T	c.(34-36)tGc>tTc	p.C12F	SPRR2E_ENST00000368750.3_Missense_Mutation_p.C12F|SPRR2B_ENST00000368752.4_Intron			P22531	SPR2E_HUMAN	small proline-rich protein 2E	12					epidermis development (GO:0008544)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)	structural molecule activity (GO:0005198)	p.C12S(1)|p.C12F(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGGTGGCTGGCAGGGCTGCTT	0.572																																					p.C12F												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G35T	1						.						55.0	58.0	57.0					1																	153066193		2202	4292	6494	151332817	SO:0001583	missense	6704	exon2			AF333955	CCDS30866.1	1q21-q22	2008-02-05			ENSG00000203785	ENSG00000203785			11265	protein-coding gene	gene with protein product						8325635	Standard	NM_001024209		Approved		uc001fbh.3	P22531	OTTHUMG00000014397	ENST00000368751.1:c.35G>T	1.37:g.153066193C>A	ENSP00000357740:p.Cys12Phe		151332817	NM_001024209	Q5T9T4|Q96RM2	Missense_Mutation	SNP	ENST00000368751.1	37	CCDS30866.1	.	.	.	.	.	.	.	.	.	.	C	8.180	0.793582	0.16327	.	.	ENSG00000203785	ENST00000368751;ENST00000368750	T;T	0.50548	0.74;0.74	4.17	4.17	0.49024	.	0.000000	0.38272	N	0.001742	T	0.57154	0.2034	.	.	.	0.31058	N	0.714417	D	0.76494	0.999	D	0.85130	0.997	T	0.59386	-0.7464	9	0.87932	D	0	.	11.9734	0.53075	0.0:1.0:0.0:0.0	.	12	P22531	SPR2E_HUMAN	F	12	ENSP00000357740:C12F;ENSP00000357739:C12F	ENSP00000357739:C12F	C	-	2	0	SPRR2E	151332817	1.000000	0.71417	1.000000	0.80357	0.515000	0.34225	1.222000	0.32515	1.865000	0.54081	0.411000	0.27672	TGC		0.572	SPRR2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040054.1		
CCDC185	164127	broad.mit.edu	37	1	223567884	223567884	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:223567884C>T	ENST00000366875.3	+	1	1170	c.1067C>T	c.(1066-1068)cCg>cTg	p.P356L		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		356								p.P356L(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		CAGGAGAGCCCGCGCCAGGAG	0.687																																					p.P356L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1067T	1						.						12.0	16.0	15.0					1																	223567884		2191	4288	6479	221634507	SO:0001583	missense	164127	exon1																														ENST00000366875.3:c.1067C>T	1.37:g.223567884C>T	ENSP00000355840:p.Pro356Leu		221634507	NM_152610	Q8N746|Q8NA93	Missense_Mutation	SNP	ENST00000366875.3	37	CCDS1537.1	.	.	.	.	.	.	.	.	.	.	C	1.799	-0.477609	0.04414	.	.	ENSG00000178395	ENST00000366875	T	0.19532	2.14	4.27	-4.2	0.03823	.	.	.	.	.	T	0.07052	0.0179	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33214	-0.9877	9	0.25106	T	0.35	.	0.6551	0.00833	0.3787:0.2702:0.1723:0.1789	.	356	Q8N715	CA065_HUMAN	L	356	ENSP00000355840:P356L	ENSP00000355840:P356L	P	+	2	0	C1orf65	221634507	0.000000	0.05858	0.001000	0.08648	0.214000	0.24535	-0.961000	0.03845	-0.862000	0.04089	-1.636000	0.00776	CCG		0.687	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092718.1		
EPHA10	284656	broad.mit.edu	37	1	38227114	38227114	+	Silent	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:38227114G>A	ENST00000373048.4	-	3	812	c.813C>T	c.(811-813)tgC>tgT	p.C271C	EPHA10_ENST00000427468.2_Silent_p.C271C|EPHA10_ENST00000319637.6_Silent_p.C271C	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	271					ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)	p.C271C(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATCCCGCGCTGCAGCTGCAGC	0.677																																					p.C271C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C813T	1						.						31.0	34.0	33.0					1																	38227114		2164	4194	6358	37999701	SO:0001819	synonymous_variant	284656	exon3			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.813C>T	1.37:g.38227114G>A			37999701	NM_001099439	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	37	CCDS41305.1																																																																																				0.677	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
RIMKLA	284716	broad.mit.edu	37	1	42880166	42880166	+	Missense_Mutation	SNP	G	G	A	rs536295712	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:42880166G>A	ENST00000431473.3	+	5	826	c.697G>A	c.(697-699)Gtc>Atc	p.V233I		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	233	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)	p.V192I(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TGGCGTGGGCGTCAAGTGTCC	0.517													G|||	2	0.000399361	0.0	0.0	5008	,	,		20395	0.0		0.0	False		,,,				2504	0.002				p.V233I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G697A	1						.						177.0	155.0	162.0					1																	42880166		2203	4300	6503	42652753	SO:0001583	missense	284716	exon5			BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.697G>A	1.37:g.42880166G>A	ENSP00000414330:p.Val233Ile		42652753	NM_173642	Q5VUS5	Missense_Mutation	SNP	ENST00000431473.3	37	CCDS466.2	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586955	0.46110	.	.	ENSG00000177181	ENST00000431473	.	.	.	5.22	5.22	0.72569	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.054243	0.64402	D	0.000001	T	0.40619	0.1124	N	0.21142	0.635	0.39778	D	0.972259	P	0.38617	0.64	B	0.36534	0.227	T	0.40683	-0.9550	9	0.38643	T	0.18	-4.5018	16.2864	0.82724	0.0:0.0:1.0:0.0	.	233	Q8IXN7	RIMKA_HUMAN	I	233	.	ENSP00000414330:V233I	V	+	1	0	RIMKLA	42652753	1.000000	0.71417	0.951000	0.38953	0.768000	0.43524	5.605000	0.67634	2.442000	0.82660	0.555000	0.69702	GTC		0.517	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019174.3	NM_173642	
GBP1	2633	broad.mit.edu	37	1	89522749	89522749	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:89522749C>T	ENST00000370473.4	-	7	1162	c.943G>A	c.(943-945)Gca>Aca	p.A315T	GBP1_ENST00000484970.1_5'Flank	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	315					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)	p.A315T(1)		endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		GCCAGGACTGCGTTCTCCATG	0.527																																					p.A315T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G943A	1						.						116.0	99.0	105.0					1																	89522749		2203	4300	6503	89295337	SO:0001583	missense	2633	exon7			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.943G>A	1.37:g.89522749C>T	ENSP00000359504:p.Ala315Thr		89295337	NM_002053	D3DT26|Q5T8M1	Missense_Mutation	SNP	ENST00000370473.4	37	CCDS718.1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.694842	0.48202	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.02944	4.1	4.8	4.8	0.61643	Guanylate-binding protein, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.05960	0.0155	M	0.90309	3.105	0.34370	D	0.691986	D	0.58268	0.982	P	0.47102	0.537	T	0.11084	-1.0602	10	0.52906	T	0.07	.	15.3412	0.74300	0.0:1.0:0.0:0.0	.	315	P32455	GBP1_HUMAN	T	315;278	ENSP00000359504:A315T	ENSP00000359504:A315T	A	-	1	0	GBP1	89295337	0.245000	0.23899	0.962000	0.40283	0.212000	0.24457	0.662000	0.25038	2.210000	0.71456	0.491000	0.48974	GCA		0.527	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029289.3	NM_002053	
MTR	4548	broad.mit.edu	37	1	236998969	236998969	+	Silent	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr1:236998969C>T	ENST00000366577.5	+	14	1705	c.1311C>T	c.(1309-1311)tcC>tcT	p.S437S	MTR_ENST00000535889.1_Silent_p.S437S	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	437	Pterin-binding. {ECO:0000255|PROSITE- ProRule:PRU00334}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)	p.S437S(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TAATTGCTTCCGAGCCAGACA	0.438																																					p.S437S												.	.	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C1311T	1						.						237.0	200.0	213.0					1																	236998969		2203	4300	6503	235065592	SO:0001819	synonymous_variant	4548	exon14			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.1311C>T	1.37:g.236998969C>T			235065592	NM_000254	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Silent	SNP	ENST00000366577.5	37	CCDS1614.1																																																																																				0.438	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096632.2	NM_000254	
HTR3B	9177	broad.mit.edu	37	11	113816765	113816765	+	Missense_Mutation	SNP	G	G	A	rs200815025		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr11:113816765G>A	ENST00000260191.2	+	9	1489	c.1232G>A	c.(1231-1233)cGc>cAc	p.R411H	HTR3B_ENST00000537778.1_Missense_Mutation_p.R400H	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	411	HA-stretch.				cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)	p.R411H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	CTCCTGTCCCGCTTTGACCGA	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		15084	0.0		0.001	False		,,,				2504	0.0				p.R411H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1232A	11						.						81.0	73.0	76.0					11																	113816765		2201	4296	6497	113321975	SO:0001583	missense	9177	exon9			AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.1232G>A	11.37:g.113816765G>A	ENSP00000260191:p.Arg411His		113321975	NM_006028	B0YJ23|Q0VJC3	Missense_Mutation	SNP	ENST00000260191.2	37	CCDS8364.1	.	.	.	.	.	.	.	.	.	.	G	9.620	1.133594	0.21041	.	.	ENSG00000149305	ENST00000260191;ENST00000537778	T;T	0.22539	1.95;1.95	5.48	2.57	0.30868	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.258863	0.37906	N	0.001883	T	0.16300	0.0392	L	0.35723	1.085	0.28872	N	0.894895	B;B	0.15141	0.012;0.01	B;B	0.10450	0.005;0.002	T	0.11792	-1.0573	10	0.59425	D	0.04	-4.0172	9.504	0.39035	0.2265:0.0:0.7735:0.0	.	400;411	O95264-2;O95264	.;5HT3B_HUMAN	H	411;400	ENSP00000260191:R411H;ENSP00000443118:R400H	ENSP00000260191:R411H	R	+	2	0	HTR3B	113321975	0.061000	0.20836	0.877000	0.34402	0.083000	0.17756	0.393000	0.20817	0.281000	0.22233	0.491000	0.48974	CGC		0.557	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398842.1	NM_006028	
ZNF408	79797	broad.mit.edu	37	11	46726469	46726469	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr11:46726469C>T	ENST00000311764.2	+	5	1449	c.1219C>T	c.(1219-1221)Cgg>Tgg	p.R407W		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.R407W(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCGTGGGGTGCGGCCCTTCCC	0.587																																					p.R407W	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1219T	11						.						62.0	61.0	61.0					11																	46726469		2201	4299	6500	46683045	SO:0001583	missense	79797	exon5			AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1219C>T	11.37:g.46726469C>T	ENSP00000309606:p.Arg407Trp		46683045	NM_024741		Missense_Mutation	SNP	ENST00000311764.2	37	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.718704	0.68844	.	.	ENSG00000175213	ENST00000311764	T	0.20332	2.08	5.57	4.67	0.58626	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40469	N	0.001097	T	0.40719	0.1128	M	0.93462	3.42	0.49130	D	0.999757	D;D	0.53151	0.958;0.958	P;P	0.45794	0.493;0.493	T	0.58375	-0.7647	10	0.87932	D	0	-30.0805	12.506	0.55981	0.0:0.861:0.0:0.139	.	399;407	B4DXY4;Q9H9D4	.;ZN408_HUMAN	W	407	ENSP00000309606:R407W	ENSP00000309606:R407W	R	+	1	2	ZNF408	46683045	0.976000	0.34144	0.982000	0.44146	0.945000	0.59286	0.478000	0.22212	1.492000	0.48499	0.563000	0.77884	CGG		0.587	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
PPFIA1	8500	broad.mit.edu	37	11	70172850	70172850	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr11:70172850G>T	ENST00000253925.7	+	7	1071	c.856G>T	c.(856-858)Gat>Tat	p.D286Y	CTA-797E19.2_ENST00000526017.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.D286Y|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	286					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)	p.D286Y(1)		breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			ACTGGAAGAGGATCTGGACAC	0.418																																					p.D286Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G856T	11						.						153.0	155.0	154.0					11																	70172850		2200	4294	6494	69850498	SO:0001583	missense	8500	exon7			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.856G>T	11.37:g.70172850G>T	ENSP00000253925:p.Asp286Tyr		69850498	NM_003626	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.083689	0.55861	.	.	ENSG00000131626	ENST00000253925;ENST00000389547	T;T	0.79141	-1.24;-1.24	4.68	4.68	0.58851	.	0.064286	0.64402	U	0.000015	D	0.86418	0.5928	M	0.73962	2.25	0.80722	D	1	D;D	0.62365	0.989;0.991	P;P	0.61592	0.88;0.891	D	0.88557	0.3120	10	0.87932	D	0	.	16.9973	0.86371	0.0:0.0:1.0:0.0	.	286;286	Q13136;Q13136-2	LIPA1_HUMAN;.	Y	286	ENSP00000253925:D286Y;ENSP00000374198:D286Y	ENSP00000253925:D286Y	D	+	1	0	PPFIA1	69850498	1.000000	0.71417	0.103000	0.21229	0.124000	0.20399	9.638000	0.98445	2.327000	0.79052	0.655000	0.94253	GAT		0.418	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
TENM4	26011	broad.mit.edu	37	11	78381535	78381535	+	Missense_Mutation	SNP	C	C	T	rs140341040	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr11:78381535C>T	ENST00000278550.7	-	32	6317	c.5855G>A	c.(5854-5856)cGc>cAc	p.R1952H		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1952					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.R1952H(2)|p.R1952L(2)									AGAAGAGAGGCGGTCATTCTT	0.542													C|||	2	0.000399361	0.0	0.0	5008	,	,		21705	0.002		0.0	False		,,,				2504	0.0				p.R1952H												.	.	4	Substitution - Missense(4)	large_intestine(2)|lung(2)	c.G5855A	11						.						72.0	75.0	74.0					11																	78381535		1997	4159	6156	78059183	SO:0001583	missense	26011	exon32			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5855G>A	11.37:g.78381535C>T	ENSP00000278550:p.Arg1952His		78059183	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	CCDS44688.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	C	16.16	3.044927	0.55110	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.90444	-2.67;0.72	4.93	3.08	0.35506	.	0.112900	0.64402	N	0.000008	D	0.94000	0.8078	M	0.75447	2.3	0.58432	D	0.999998	D	0.89917	1.0	D	0.78314	0.991	D	0.93007	0.6428	9	.	.	.	.	11.7033	0.51583	0.0:0.8566:0.0:0.1434	.	1952	Q6N022	TEN4_HUMAN	H	1952;416	ENSP00000278550:R1952H;ENSP00000431711:R416H	.	R	-	2	0	ODZ4	78059183	0.995000	0.38212	1.000000	0.80357	0.995000	0.86356	3.125000	0.50469	0.802000	0.34089	-0.126000	0.14955	CGC		0.542	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
PHLDB1	23187	broad.mit.edu	37	11	118498785	118498785	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr11:118498785C>G	ENST00000361417.2	+	7	1657	c.1246C>G	c.(1246-1248)Cta>Gta	p.L416V	PHLDB1_ENST00000356063.5_Missense_Mutation_p.L416V	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	416								p.L416V(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TGAGCGGGTGCTAACAACCAG	0.637																																					p.L416V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1246G	11						.						72.0	75.0	74.0					11																	118498785		2200	4295	6495	118003995	SO:0001583	missense	23187	exon6				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.1246C>G	11.37:g.118498785C>G	ENSP00000354498:p.Leu416Val		118003995	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	ENST00000361417.2	37	CCDS8401.1	.	.	.	.	.	.	.	.	.	.	C	5.064	0.197537	0.09652	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000356063	T;T	0.33654	1.4;1.41	4.79	-9.08	0.00720	.	0.462873	0.21680	N	0.070721	T	0.19805	0.0476	L	0.34521	1.04	0.09310	N	1	B;B;B	0.32573	0.084;0.376;0.001	B;B;B	0.31751	0.037;0.135;0.005	T	0.14309	-1.0477	10	0.14252	T	0.57	-11.9462	16.0443	0.80707	0.0913:0.7168:0.0:0.1919	.	416;416;416	Q86UU1-3;Q86UU1-2;Q86UU1	.;.;PHLB1_HUMAN	V	416;175;416	ENSP00000354498:L416V;ENSP00000348359:L416V	ENSP00000348359:L416V	L	+	1	2	PHLDB1	118003995	0.000000	0.05858	0.000000	0.03702	0.658000	0.38924	-0.172000	0.09868	-1.280000	0.02402	0.462000	0.41574	CTA		0.637	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
HIST1H4D	8360	broad.mit.edu	37	6	26189065	26189065	+	Silent	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr6:26189065C>T	ENST00000340756.2	-	1	239	c.240G>A	c.(238-240)aaG>aaA	p.K80K		NM_003539.3	NP_003530.1	P62805	H4_HUMAN	histone cluster 1, H4d	80					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.K80K(1)		breast(2)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)	8		all_hematologic(11;0.196)				CTGTGACTGTCTTGCGTTTGG	0.527																																					p.K80K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G240A	6						.						140.0	120.0	127.0					6																	26189065		2203	4300	6503	26297044	SO:0001819	synonymous_variant	8360	exon1			X60482	CCDS4589.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000188987	ENSG00000277157		"""Histones / Replication-dependent"""	4782	protein-coding gene	gene with protein product		602823	"""H4 histone family, member B"", ""histone 1, H4d"""	H4FB		9119399, 12408966	Standard	NM_003539		Approved	H4/b	uc003ngu.3	P62805	OTTHUMG00000014423	ENST00000340756.2:c.240G>A	6.37:g.26189065C>T			26297044	NM_003539	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000340756.2	37	CCDS4589.1																																																																																				0.527	HIST1H4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040085.1	NM_003539	
VWA7	80737	broad.mit.edu	37	6	31735458	31735458	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr6:31735458T>C	ENST00000375688.4	-	11	1777	c.1577A>G	c.(1576-1578)cAg>cGg	p.Q526R	SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Missense_Mutation_p.Q526R|VWA7_ENST00000447450.1_Missense_Mutation_p.Q526R			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	526						extracellular region (GO:0005576)		p.Q526R(1)									TGTGATCTTCTGGAGCAGCCC	0.567																																					p.Q526R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1577G	6						.						118.0	118.0	118.0					6																	31735458		2203	4300	6503	31843437	SO:0001583	missense	80737	exon11				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1577A>G	6.37:g.31735458T>C	ENSP00000364840:p.Gln526Arg		31843437	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	0.136	-1.107666	0.01813	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.29142	2.81;2.59;1.58	4.95	-2.9	0.05648	.	1.091170	0.06950	N	0.814491	T	0.07234	0.0183	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37596	-0.9699	10	0.16896	T	0.51	-0.7677	7.725	0.28755	0.0:0.5182:0.1542:0.3276	.	526	Q9Y334	G7C_HUMAN	R	526	ENSP00000364840:Q526R;ENSP00000364838:Q526R;ENSP00000390554:Q526R	ENSP00000364838:Q526R	Q	-	2	0	C6orf27	31843437	0.007000	0.16637	0.033000	0.17914	0.349000	0.29174	-0.450000	0.06803	-0.714000	0.04975	-0.379000	0.06801	CAG		0.567	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
PRPH2	5961	broad.mit.edu	37	6	42689824	42689824	+	Silent	SNP	G	G	A	rs61755775		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr6:42689824G>A	ENST00000230381.5	-	1	488	c.249C>T	c.(247-249)taC>taT	p.Y83Y		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	83					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)		p.Y83Y(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			CCAGGGCGTCGTAGCAGATCT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		18497	0.0		0.001	False		,,,				2504	0.0				p.Y83Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C249T	6						.	G		0,4406		0,0,2203	89.0	72.0	78.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	249	-9.0	0.0	6	dbSNP_129	78	7,8593	5.7+/-21.5	0,7,4293	no	coding-synonymous	PRPH2	NM_000322.4		0,7,6496	AA,AG,GG		0.0814,0.0,0.0538		83/347	42689824	7,12999	2203	4300	6503	42797802	SO:0001819	synonymous_variant	5961	exon1				CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.249C>T	6.37:g.42689824G>A			42797802	NM_000322	Q5TFH5|Q6DK65	Silent	SNP	ENST00000230381.5	37	CCDS4871.1																																																																																				0.517	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322	
GABRR1	2569	broad.mit.edu	37	6	89910948	89910948	+	Silent	SNP	C	C	T	rs371490411		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr6:89910948C>T	ENST00000454853.2	-	3	320	c.210G>A	c.(208-210)tcG>tcA	p.S70S	GABRR1_ENST00000369451.3_5'UTR|GABRR1_ENST00000435811.1_Silent_p.S53S	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	70					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.S64S(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TTGTCAGAGGCGATTTGGTGA	0.478																																					p.S70S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G210A	6						.	C		1,4405	2.1+/-5.4	0,1,2202	240.0	204.0	216.0		210	-11.5	0.4	6		216	0,8600		0,0,4300	no	coding-synonymous	GABRR1	NM_002042.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		70/480	89910948	1,13005	2203	4300	6503	89967667	SO:0001819	synonymous_variant	2569	exon3				CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.210G>A	6.37:g.89910948C>T			89967667	NM_002042	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Silent	SNP	ENST00000454853.2	37	CCDS5019.2																																																																																				0.478	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2		
SCML4	256380	broad.mit.edu	37	6	108042008	108042008	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr6:108042008C>T	ENST00000369020.3	-	6	1117	c.872G>A	c.(871-873)cGc>cAc	p.R291H	SCML4_ENST00000369025.2_Missense_Mutation_p.R49H|SCML4_ENST00000479803.1_5'UTR|SCML4_ENST00000369021.3_Missense_Mutation_p.R262H|SCML4_ENST00000369022.2_Missense_Mutation_p.R233H	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	291	SAM.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R262H(1)		endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		GGGGCTAGTGCGGGGACCACC	0.632																																					p.R291H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G872A	6						.						48.0	55.0	53.0					6																	108042008		2203	4300	6503	108148701	SO:0001583	missense	256380	exon6				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.872G>A	6.37:g.108042008C>T	ENSP00000358016:p.Arg291His		108148701	NM_198081	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	CCDS5060.2	.	.	.	.	.	.	.	.	.	.	C	9.253	1.041281	0.19669	.	.	ENSG00000146285	ENST00000369022;ENST00000369025;ENST00000369020;ENST00000369021	T;T;T	0.52057	0.88;0.87;0.68	5.19	2.47	0.30058	.	0.622280	0.17209	N	0.182794	T	0.49029	0.1533	M	0.70275	2.135	0.09310	N	1	B;P;D	0.76494	0.004;0.602;0.999	B;B;D	0.67382	0.003;0.051;0.951	T	0.40887	-0.9539	10	0.48119	T	0.1	.	10.5252	0.44943	0.0:0.7892:0.0:0.2108	.	291;291;262	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	H	233;49;291;262	ENSP00000358018:R233H;ENSP00000358016:R291H;ENSP00000358017:R262H	ENSP00000358016:R291H	R	-	2	0	SCML4	108148701	0.589000	0.26807	0.001000	0.08648	0.127000	0.20565	0.944000	0.29043	0.355000	0.24131	0.650000	0.86243	CGC		0.632	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128	
PLD2	5338	broad.mit.edu	37	17	4719185	4719185	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr17:4719185C>T	ENST00000263088.6	+	14	1542	c.1411C>T	c.(1411-1413)Cga>Tga	p.R471*	PLD2_ENST00000572940.1_Nonsense_Mutation_p.R471*	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	471	Catalytic.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)	p.R471*(1)		autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CCTGCACTACCGACTGACTGA	0.572											OREG0024105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R471X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1411T	17						.						193.0	158.0	170.0					17																	4719185		2203	4300	6503	4666151	SO:0001587	stop_gained	5338	exon14			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.1411C>T	17.37:g.4719185C>T	ENSP00000263088:p.Arg471*	621	4666151	NM_002663	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Nonsense_Mutation	SNP	ENST00000263088.6	37	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	C	39	7.392471	0.98255	.	.	ENSG00000129219	ENST00000263088	.	.	.	5.58	3.51	0.40186	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7731	11.6446	0.51253	0.4906:0.5094:0.0:0.0	.	.	.	.	X	471	.	ENSP00000263088:R471X	R	+	1	2	PLD2	4666151	0.048000	0.20356	1.000000	0.80357	0.999000	0.98932	0.122000	0.15687	0.639000	0.30564	0.655000	0.94253	CGA		0.572	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248Q	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,haematopoietic_and_lymphoid_tissue,lymph_node,Substitution - Missense,0	.	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	c.G743A	17	GRCh37	CM920675	TP53	M	rs11540652	.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	7518263	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		7518263	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP19-5	337972	broad.mit.edu	37	21	31874312	31874312	+	Missense_Mutation	SNP	G	G	A	rs142713888		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr21:31874312G>A	ENST00000334151.2	-	1	123	c.97C>T	c.(97-99)Cgc>Tgc	p.R33C		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	33						intermediate filament (GO:0005882)		p.R33C(1)		endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CCCAGTCTGCGGAAGCTGCCA	0.587																																					p.R33C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C97T	21						.	G	CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	136.0	124.0	128.0		97	-9.4	0.0	21	dbSNP_134	128	0,8600		0,0,4300	no	missense	KRTAP19-5	NM_181611.1	180	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	33/73	31874312	3,13003	2203	4300	6503	30796183	SO:0001583	missense	337972	exon1			AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.97C>T	21.37:g.31874312G>A	ENSP00000334985:p.Arg33Cys		30796183	NM_181611	A4IF22	Missense_Mutation	SNP	ENST00000334151.2	37	CCDS13597.1	.	.	.	.	.	.	.	.	.	.	G	9.976	1.226806	0.22542	6.81E-4	0.0	ENSG00000186977	ENST00000334151	T	0.10477	2.87	4.71	-9.43	0.00607	.	.	.	.	.	T	0.06280	0.0162	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.39292	-0.9621	8	0.87932	D	0	.	4.6993	0.12820	0.2416:0.442:0.2274:0.089	.	33	Q3LI72	KR195_HUMAN	C	33	ENSP00000334985:R33C	ENSP00000334985:R33C	R	-	1	0	KRTAP19-5	30796183	0.000000	0.05858	0.000000	0.03702	0.238000	0.25445	-0.422000	0.07043	-2.657000	0.00421	-0.226000	0.12346	CGC		0.587	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128226.2		
TCEB3B	51224	broad.mit.edu	37	18	44561290	44561290	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr18:44561290C>T	ENST00000332567.4	-	1	698	c.346G>A	c.(346-348)Gcg>Acg	p.A116T	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	116					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A116T(1)		breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGGGCCGTCGCGTTTTCTGGG	0.662																																					p.A116T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G346A	18						.						45.0	53.0	50.0					18																	44561290		2199	4296	6495	42815288	SO:0001583	missense	51224	exon1			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.346G>A	18.37:g.44561290C>T	ENSP00000331302:p.Ala116Thr		42815288	NM_016427	Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	37	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	C	5.944	0.358254	0.11239	.	.	ENSG00000206181	ENST00000332567	T	0.06687	3.27	2.61	-5.22	0.02806	.	1.448910	0.05242	U	0.512412	T	0.03477	0.0100	N	0.22421	0.69	0.09310	N	1	P	0.46020	0.871	B	0.33521	0.165	T	0.20806	-1.0264	10	0.22706	T	0.39	2.3089	1.5561	0.02585	0.1498:0.3783:0.2263:0.2456	.	116	Q8IYF1	ELOA2_HUMAN	T	116	ENSP00000331302:A116T	ENSP00000331302:A116T	A	-	1	0	TCEB3B	42815288	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.541000	0.06099	-2.991000	0.00279	-0.534000	0.04291	GCG		0.662	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
SEMA5B	54437	broad.mit.edu	37	3	122634670	122634670	+	Missense_Mutation	SNP	C	C	T	rs557492984		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr3:122634670C>T	ENST00000357599.3	-	13	2142	c.1756G>A	c.(1756-1758)Gag>Aag	p.E586K	SEMA5B_ENST00000195173.4_Missense_Mutation_p.E586K|SEMA5B_ENST00000451055.2_Missense_Mutation_p.E640K	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	586					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.E640K(1)|p.E586K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GAGCTGTCCTCGAGTGTGCTG	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18020	0.0		0.0	False		,,,				2504	0.0				p.E586K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1756A	3						.						138.0	130.0	133.0					3																	122634670		2203	4300	6503	124117360	SO:0001583	missense	54437	exon13			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1756G>A	3.37:g.122634670C>T	ENSP00000350215:p.Glu586Lys		124117360	NM_001031702	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277445	0.80580	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	4.64	3.75	0.43078	.	0.000000	0.85682	D	0.000000	T	0.37758	0.1015	L	0.55990	1.75	0.48395	D	0.999643	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.75020	0.962;0.978;0.985	T	0.05582	-1.0876	10	0.36615	T	0.2	.	11.8535	0.52425	0.0:0.8233:0.1767:0.0	.	528;586;586	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	K	586;586;528;640;586	ENSP00000350215:E586K;ENSP00000195173:E586K;ENSP00000389588:E640K;ENSP00000377208:E586K	ENSP00000195173:E586K	E	-	1	0	SEMA5B	124117360	1.000000	0.71417	0.805000	0.32314	0.992000	0.81027	5.197000	0.65141	1.147000	0.42369	0.561000	0.74099	GAG		0.607	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
EPHB1	2047	broad.mit.edu	37	3	134884859	134884859	+	Silent	SNP	G	G	A	rs375267802	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr3:134884859G>A	ENST00000398015.3	+	8	2005	c.1635G>A	c.(1633-1635)tcG>tcA	p.S545S	EPHB1_ENST00000493838.1_Silent_p.S106S	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	545					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)	p.S545S(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						TTGCTGGCTCGGCAGCGGCCG	0.552													G|||	2	0.000399361	0.0015	0.0	5008	,	,		16972	0.0		0.0	False		,,,				2504	0.0				p.S545S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1635A	3						.	G		4,4234		0,4,2115	120.0	140.0	133.0		1635	-11.2	0.8	3		133	0,8478		0,0,4239	no	coding-synonymous	EPHB1	NM_004441.4		0,4,6354	AA,AG,GG		0.0,0.0944,0.0315		545/985	134884859	4,12712	2119	4239	6358	136367549	SO:0001819	synonymous_variant	2047	exon8			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1635G>A	3.37:g.134884859G>A			136367549	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	ENST00000398015.3	37	CCDS46921.1																																																																																				0.552	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
PYDC2	152138	broad.mit.edu	37	3	191179140	191179140	+	Silent	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr3:191179140C>T	ENST00000518817.1	+	1	189	c.189C>T	c.(187-189)tcC>tcT	p.S63S		NM_001083308.1	NP_001076777.1	Q56P42	PYDC2_HUMAN	pyrin domain containing 2	63	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S63S(1)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10						CCAGCCACTCCTGCAGCTACT	0.527																																					p.S63S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C189T	3						.						74.0	82.0	79.0					3																	191179140		2175	4292	6467	192661834	SO:0001819	synonymous_variant	152138	exon1					3q28	2008-07-29				ENSG00000253548			33512	protein-coding gene	gene with protein product		615701				17178784	Standard	NM_001083308		Approved	POP2	uc011bso.2	Q56P42		ENST00000518817.1:c.189C>T	3.37:g.191179140C>T			192661834	NM_001083308		Silent	SNP	ENST00000518817.1	37																																																																																					0.527	PYDC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000343231.2	NM_001083308	
PDZRN3	23024	broad.mit.edu	37	3	73432830	73432830	+	Missense_Mutation	SNP	C	C	T	rs150622040		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr3:73432830C>T	ENST00000263666.4	-	10	3001	c.2887G>A	c.(2887-2889)Gcg>Acg	p.A963T	PDZRN3_ENST00000466780.1_Missense_Mutation_p.A620T|PDZRN3_ENST00000535920.1_Missense_Mutation_p.A685T|PDZRN3_ENST00000462146.2_Missense_Mutation_p.A620T|PDZRN3_ENST00000479530.1_Missense_Mutation_p.A680T|PDZRN3_ENST00000466348.1_5'Flank	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	963					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A963T(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		TCGCTCACCGCGTCGTCGTCG	0.667																																					p.A963T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2887A	3						.	C	THR/ALA	0,4406		0,0,2203	72.0	70.0	71.0		2887	4.3	0.9	3	dbSNP_134	71	1,8599		0,1,4299	no	missense	PDZRN3	NM_015009.1	58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	963/1067	73432830	1,13005	2203	4300	6503	73515520	SO:0001583	missense	23024	exon10			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.2887G>A	3.37:g.73432830C>T	ENSP00000263666:p.Ala963Thr		73515520	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Missense_Mutation	SNP	ENST00000263666.4	37	CCDS33789.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.32|14.32	2.498915|2.498915	0.44455|0.44455	0.0|0.0	1.16E-4|1.16E-4	ENSG00000121440|ENSG00000121440	ENST00000263666;ENST00000535920;ENST00000462146;ENST00000466780;ENST00000479530|ENST00000416926	T;T;T;T;T|.	0.40476|.	1.03;1.03;1.03;1.03;1.03|.	5.21|5.21	4.34|4.34	0.51931|0.51931	.|.	0.105141|.	0.64402|.	D|.	0.000004|.	T|T	0.55862|0.55862	0.1947|0.1947	L|L	0.31371|0.31371	0.925|0.925	0.80722|0.80722	D|D	1|1	D;D;P;D|.	0.89917|.	0.985;1.0;0.871;1.0|.	P;D;B;D|.	0.87578|.	0.798;0.998;0.137;0.995|.	T|T	0.59123|0.59123	-0.7513|-0.7513	10|6	0.14656|0.59425	T|D	0.56|0.04	.|.	13.3663|13.3663	0.60687|0.60687	0.0:0.9231:0.0:0.0769|0.0:0.9231:0.0:0.0769	.|.	685;680;680;963|.	F5H8I9;B7ZAG0;B7Z5X9;Q9UPQ7|.	.;.;.;PZRN3_HUMAN|.	T|H	963;685;620;620;680|682	ENSP00000263666:A963T;ENSP00000442026:A685T;ENSP00000418168:A620T;ENSP00000418484:A620T;ENSP00000418624:A680T|.	ENSP00000263666:A963T|ENSP00000392657:R682H	A|R	-|-	1|2	0|0	PDZRN3|PDZRN3	73515520|73515520	1.000000|1.000000	0.71417|0.71417	0.949000|0.949000	0.38748|0.38748	0.788000|0.788000	0.44548|0.44548	3.884000|3.884000	0.56175|0.56175	1.190000|1.190000	0.43042|0.43042	0.563000|0.563000	0.77884|0.77884	GCG|CGC		0.667	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
ATP13A5	344905	broad.mit.edu	37	3	193080216	193080216	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr3:193080216G>A	ENST00000342358.4	-	5	607	c.490C>T	c.(490-492)Cat>Tat	p.H164Y		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	164						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.H164Y(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AATGTCTGATGGATGTCAGAG	0.423																																					p.H164Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C490T	3						.						149.0	139.0	143.0					3																	193080216		2203	4300	6503	194562910	SO:0001583	missense	344905	exon5			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.490C>T	3.37:g.193080216G>A	ENSP00000341942:p.His164Tyr		194562910	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661983	0.29515	.	.	ENSG00000187527	ENST00000342358	T	0.79033	-1.23	5.42	4.55	0.56014	ATPase, P-type cation-transporter, N-terminal (2);	0.163240	0.43416	N	0.000573	T	0.73799	0.3633	L	0.53249	1.67	0.40721	D	0.982664	B	0.21071	0.051	B	0.33799	0.17	T	0.66740	-0.5847	10	0.13108	T	0.6	-8.4755	12.4327	0.55583	0.0822:0.0:0.9178:0.0	.	164	Q4VNC0	AT135_HUMAN	Y	164	ENSP00000341942:H164Y	ENSP00000341942:H164Y	H	-	1	0	ATP13A5	194562910	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	4.415000	0.59809	1.431000	0.47355	0.655000	0.94253	CAT		0.423	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
ACVR1B	91	broad.mit.edu	37	12	52370257	52370257	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr12:52370257C>T	ENST00000257963.4	+	3	555	c.478C>T	c.(478-480)Cag>Tag	p.Q160*	ACVR1B_ENST00000426655.2_Nonsense_Mutation_p.Q160*|ACVR1B_ENST00000415850.2_Nonsense_Mutation_p.Q160*|ACVR1B_ENST00000541224.1_Nonsense_Mutation_p.Q160*|ACVR1B_ENST00000542485.1_Nonsense_Mutation_p.Q108*	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	160					activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.Q160*(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TCACAACCGCCAGAGACTGGA	0.512																																					p.Q108X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C322T	12						.						178.0	164.0	169.0					12																	52370257		2203	4300	6503	50656524	SO:0001587	stop_gained	91	exon3				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.478C>T	12.37:g.52370257C>T	ENSP00000257963:p.Gln160*		50656524	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Nonsense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577285	0.86645	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	19.35	0.94379	0.0:1.0:0.0:0.0	.	.	.	.	X	160;160;160;160;108	.	ENSP00000257963:Q160X	Q	+	1	0	ACVR1B	50656524	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.950000	0.70265	2.652000	0.90054	0.462000	0.41574	CAG		0.512	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
ACVR1B	91	broad.mit.edu	37	12	52374974	52374974	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr12:52374974G>A	ENST00000257963.4	+	4	879	c.802G>A	c.(802-804)Gac>Aac	p.D268N	ACVR1B_ENST00000426655.2_Missense_Mutation_p.D268N|ACVR1B_ENST00000415850.2_Missense_Mutation_p.D268N|ACVR1B_ENST00000541224.1_Missense_Mutation_p.D268N|ACVR1B_ENST00000542485.1_Missense_Mutation_p.D216N	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	268	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)	p.D268N(2)		breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	TATTGCTGCTGACAATAAAGG	0.468											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D216N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G646A	12						.						89.0	87.0	88.0					12																	52374974		2203	4300	6503	50661241	SO:0001583	missense	91	exon4				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.802G>A	12.37:g.52374974G>A	ENSP00000257963:p.Asp268Asn	984	50661241	NM_020327	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	ENST00000257963.4	37	CCDS8816.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261561	0.80358	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2	5.13	5.13	0.70059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97188	0.9081	M	0.86420	2.815	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.999	D	0.97777	1.0230	10	0.87932	D	0	.	18.9833	0.92762	0.0:0.0:1.0:0.0	.	268;268;268;268	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	N	268;268;268;268;216	ENSP00000257963:D268N;ENSP00000442656:D268N;ENSP00000390477:D268N;ENSP00000397550:D268N;ENSP00000442885:D216N	ENSP00000257963:D268N	D	+	1	0	ACVR1B	50661241	1.000000	0.71417	0.995000	0.50966	0.289000	0.27227	9.869000	0.99810	2.567000	0.86603	0.655000	0.94253	GAC		0.468	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397000.1	NM_020328	
LRP1	4035	broad.mit.edu	37	12	57550649	57550649	+	Missense_Mutation	SNP	A	A	C	rs199896480|rs368316421		TCGA-AG-A01L-01	TCGA-AG-A01L-01	A	A	A	A	A	A	Unknown	Wildtype	None	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr12:57550649A>C	ENST00000243077.3	+	10	1973	c.1507A>C	c.(1507-1509)Acc>Ccc	p.T503P		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	503	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CAAGGCGCGGACCTGCCGCTG	0.642																																					p.T503P												.	.	0			c.A1507C	12						.						27.0	26.0	26.0					12																	57550649		2203	4300	6503	55836916	SO:0001583	missense	4035	exon10			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.1507A>C	12.37:g.57550649A>C	ENSP00000243077:p.Thr503Pro		55836916	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.049289	0.55218	.	.	ENSG00000123384	ENST00000243077	D	0.90563	-2.69	5.12	5.12	0.69794	Epidermal growth factor-like (1);	0.000000	0.64402	D	0.000001	D	0.95191	0.8441	M	0.85542	2.76	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.95411	0.8498	10	0.59425	D	0.04	.	13.2108	0.59822	1.0:0.0:0.0:0.0	.	503	Q07954	LRP1_HUMAN	P	503	ENSP00000243077:T503P	ENSP00000243077:T503P	T	+	1	0	LRP1	55836916	1.000000	0.71417	0.998000	0.56505	0.693000	0.40251	7.231000	0.78106	2.288000	0.76882	0.482000	0.46254	ACC		0.642	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
NTRK3	4916	broad.mit.edu	37	15	88678541	88678541	+	Missense_Mutation	SNP	G	G	A	rs145157285		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr15:88678541G>A	ENST00000360948.2	-	9	1156	c.995C>T	c.(994-996)aCg>aTg	p.T332M	NTRK3_ENST00000557856.1_Missense_Mutation_p.T332M|NTRK3_ENST00000355254.2_Missense_Mutation_p.T332M|NTRK3_ENST00000540489.2_Missense_Mutation_p.T332M|NTRK3_ENST00000394480.2_Missense_Mutation_p.T332M|NTRK3_ENST00000317501.3_Missense_Mutation_p.T332M|NTRK3_ENST00000558676.1_Missense_Mutation_p.T332M|NTRK3_ENST00000357724.2_Missense_Mutation_p.T332M|NTRK3_ENST00000542733.2_Missense_Mutation_p.T234M	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	332	Ig-like C2-type 2.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T332M(3)	ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCAGTGCAGCGTTGGTGGGGG	0.602			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)			G|||	1	0.000199681	0.0	0.0	5008	,	,		17971	0.001		0.0	False		,,,				2504	0.0				p.T332M			Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	.	3	Substitution - Missense(3)	large_intestine(3)	c.C995T	15						.	G	MET/THR,MET/THR,MET/THR	0,4402		0,0,2201	72.0	74.0	73.0		995,995,995	5.3	0.6	15	dbSNP_134	73	2,8596	2.2+/-6.3	0,2,4297	yes	missense,missense,missense	NTRK3	NM_001007156.2,NM_001012338.2,NM_002530.3	81,81,81	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	332/613,332/840,332/826	88678541	2,12998	2201	4299	6500	86479545	SO:0001583	missense	4916	exon9			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.995C>T	15.37:g.88678541G>A	ENSP00000354207:p.Thr332Met		86479545	NM_001007156	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	37	CCDS32322.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	13.48	2.249763	0.39797	0.0	2.33E-4	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.28	5.28	0.74379	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.153551	0.56097	D	0.000027	D	0.82825	0.5121	M	0.90198	3.095	0.43819	D	0.996386	D;D;D;D;D;D	0.76494	0.998;0.999;0.998;0.998;0.999;0.999	P;D;D;P;D;D	0.67725	0.761;0.938;0.932;0.761;0.923;0.953	D	0.85907	0.1438	10	0.87932	D	0	.	11.3995	0.49862	0.0821:0.0:0.9179:0.0	.	234;332;332;332;332;332	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	M	332;332;332;332;234;332;332	ENSP00000377990:T332M;ENSP00000354207:T332M;ENSP00000350356:T332M;ENSP00000347397:T332M;ENSP00000437773:T234M;ENSP00000444673:T332M;ENSP00000318328:T332M	ENSP00000318328:T332M	T	-	2	0	NTRK3	86479545	0.678000	0.27586	0.632000	0.29296	0.219000	0.24729	2.064000	0.41432	2.454000	0.82982	0.563000	0.77884	ACG		0.602	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
SV2B	9899	broad.mit.edu	37	15	91795147	91795147	+	Missense_Mutation	SNP	G	G	A	rs143979505		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr15:91795147G>A	ENST00000394232.1	+	3	1020	c.550G>A	c.(550-552)Gtc>Atc	p.V184I	SV2B_ENST00000545111.2_Missense_Mutation_p.V33I|SV2B_ENST00000330276.4_Missense_Mutation_p.V184I|SV2B_ENST00000557291.1_3'UTR	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	184					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.V184I(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GTCTCTGGCCGTCAATGCCTC	0.567																																					p.V184I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G550A	15						.	G	ILE/VAL,ILE/VAL	0,4396		0,0,2198	147.0	118.0	128.0		97,550	-10.8	0.1	15	dbSNP_134	128	2,8594	2.2+/-6.3	0,2,4296	yes	missense,missense	SV2B	NM_001167580.1,NM_014848.4	29,29	0,2,6494	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	33/533,184/684	91795147	2,12990	2198	4298	6496	89596151	SO:0001583	missense	9899	exon4			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.550G>A	15.37:g.91795147G>A	ENSP00000377779:p.Val184Ile		89596151	NM_014848	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	ENST00000394232.1	37	CCDS10370.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804130	0.31869	0.0	2.33E-4	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.72167	-0.63;-0.63;-0.63	5.38	-10.8	0.00216	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.464311	0.26812	N	0.022373	T	0.31263	0.0791	N	0.02247	-0.625	0.18873	N	0.999983	B	0.06786	0.001	B	0.11329	0.006	T	0.41734	-0.9492	10	0.07813	T	0.8	-5.6354	12.5431	0.56184	0.6661:0.2445:0.0894:0.0	.	184	Q7L1I2	SV2B_HUMAN	I	33;184;184	ENSP00000443243:V33I;ENSP00000377779:V184I;ENSP00000332818:V184I	ENSP00000332818:V184I	V	+	1	0	SV2B	89596151	0.561000	0.26578	0.118000	0.21660	0.994000	0.84299	0.477000	0.22196	-2.034000	0.00924	-0.253000	0.11424	GTC		0.567	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
CHD2	1106	broad.mit.edu	37	15	93545489	93545489	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr15:93545489C>A	ENST00000394196.4	+	33	5288	c.4220C>A	c.(4219-4221)tCt>tAt	p.S1407Y	CHD2_ENST00000557381.1_Missense_Mutation_p.S1407Y	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1407					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)	p.S1407Y(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			caaatgagttctaggaaagac	0.383																																					p.S1407Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4220A	15						.						123.0	122.0	122.0					15																	93545489		2197	4298	6495	91346493	SO:0001583	missense	1106	exon33			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4220C>A	15.37:g.93545489C>A	ENSP00000377747:p.Ser1407Tyr		91346493	NM_001271	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	C	13.02	2.112775	0.37242	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	T;T	0.02709	4.19;4.19	4.89	2.95	0.34219	.	0.000000	0.34110	U	0.004245	T	0.02767	0.0083	N	0.22421	0.69	0.80722	D	1	P;P	0.49447	0.875;0.924	B;P	0.44811	0.272;0.461	T	0.58869	-0.7560	10	0.66056	D	0.02	-5.0328	7.2564	0.26179	0.0:0.7363:0.1699:0.0939	.	1407;1407	O14647;O14647-2	CHD2_HUMAN;.	Y	1407	ENSP00000377747:S1407Y;ENSP00000451366:S1407Y	ENSP00000377747:S1407Y	S	+	2	0	CHD2	91346493	0.856000	0.29760	0.921000	0.36526	0.983000	0.72400	1.377000	0.34317	0.548000	0.28955	0.655000	0.94253	TCT		0.383	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
PCDH10	57575	broad.mit.edu	37	4	134072724	134072724	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr4:134072724G>A	ENST00000264360.5	+	1	2255	c.1429G>A	c.(1429-1431)Gtg>Atg	p.V477M	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	477	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V477M(2)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGAAAACAACGTGCCTGGCGC	0.597																																					p.V477M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1429A	4						.						81.0	78.0	79.0					4																	134072724		2203	4300	6503	134292174	SO:0001583	missense	57575	exon1			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1429G>A	4.37:g.134072724G>A	ENSP00000264360:p.Val477Met		134292174	NM_032961	Q4W5F6|Q96SF0	Missense_Mutation	SNP	ENST00000264360.5	37	CCDS34063.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338613	0.60963	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.52983	0.64	4.71	4.71	0.59529	Cadherin (3);Cadherin-like (1);	0.000000	0.40818	N	0.001004	T	0.65396	0.2687	L	0.59436	1.845	0.54753	D	0.999987	D;D	0.89917	1.0;0.995	D;D	0.91635	0.999;0.931	T	0.67019	-0.5776	10	0.54805	T	0.06	.	16.6083	0.84837	0.0:0.0:1.0:0.0	.	477;477	Q9P2E7;Q96SF0	PCD10_HUMAN;.	M	477	ENSP00000264360:V477M	ENSP00000264360:V477M	V	+	1	0	PCDH10	134292174	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.821000	0.86641	2.436000	0.82500	0.655000	0.94253	GTG		0.597	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000364457.2	NM_032961	
VEGFC	7424	broad.mit.edu	37	4	177649044	177649044	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr4:177649044G>A	ENST00000280193.2	-	3	855	c.440C>T	c.(439-441)gCg>gTg	p.A147V	VEGFC_ENST00000507638.1_5'UTR	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	147					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)	p.A147V(1)		biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		GGTGTTTGTCGCGACTCCAAA	0.493																																					p.A147V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C440T	4						.						116.0	118.0	118.0					4																	177649044		2005	4176	6181	177886038	SO:0001583	missense	7424	exon3			BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.440C>T	4.37:g.177649044G>A	ENSP00000280193:p.Ala147Val		177886038	NM_005429	B2R9Q8	Missense_Mutation	SNP	ENST00000280193.2	37	CCDS43285.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211846	0.58452	.	.	ENSG00000150630	ENST00000280193	.	.	.	5.72	5.72	0.89469	Platelet-derived growth factor (PDGF) (3);	0.116055	0.64402	D	0.000015	T	0.40347	0.1113	L	0.33485	1.01	0.51482	D	0.999926	P	0.45044	0.849	B	0.30179	0.112	T	0.39375	-0.9617	9	0.40728	T	0.16	-16.2654	20.2406	0.98372	0.0:0.0:1.0:0.0	.	147	P49767	VEGFC_HUMAN	V	147	.	ENSP00000280193:A147V	A	-	2	0	VEGFC	177886038	1.000000	0.71417	0.982000	0.44146	0.361000	0.29550	7.273000	0.78527	2.857000	0.98124	0.650000	0.86243	GCG		0.493	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361991.1	NM_005429	
PTPN13	5783	broad.mit.edu	37	4	87726444	87726444	+	Silent	SNP	T	T	C			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr4:87726444T>C	ENST00000411767.2	+	44	6730	c.6667T>C	c.(6667-6669)Tta>Cta	p.L2223L	PTPN13_ENST00000316707.6_Silent_p.L2032L|PTPN13_ENST00000436978.1_Silent_p.L2228L|PTPN13_ENST00000427191.2_Silent_p.L2204L|PTPN13_ENST00000511467.1_Silent_p.L2228L			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	2223	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.L2228L(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TCTTCAAGAATTAAAACCTTT	0.318																																					p.L2032L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T6094C	4						.						66.0	65.0	65.0					4																	87726444		1800	4060	5860	87945468	SO:0001819	synonymous_variant	5783	exon41				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.6667T>C	4.37:g.87726444T>C			87945468	NM_080684	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	ENST00000411767.2	37	CCDS47094.1																																																																																				0.318	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
TUBB7P	56604	broad.mit.edu	37	4	190904398	190904398	+	IGR	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr4:190904398G>A								FRG1 (20039 upstream) : RNA5SP174 (31894 downstream)																							TCTCATCTGCGTTTTCTATGA	0.512																																					p.R195C												.	.	0			c.C583T	4						.						20.0	32.0	29.0					4																	190904398		1806	3882	5688	191141392	SO:0001628	intergenic_variant	56604	exon4																															4.37:g.190904398G>A			191141392	NM_020040		Silent	SNP		37																																																																																				0	0.512								
SCML2	10389	broad.mit.edu	37	X	18348761	18348761	+	Nonsense_Mutation	SNP	T	T	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chrX:18348761T>A	ENST00000251900.4	-	3	196	c.37A>T	c.(37-39)Aag>Tag	p.K13*		NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	13					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K13*(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					TTCTCCTTCTTGACATCCATG	0.328																																					p.K13X	Esophageal Squamous(100;1252 1965 19021 35517)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A37T	X						.						74.0	64.0	67.0					X																	18348761		2202	4298	6500	18258682	SO:0001587	stop_gained	10389	exon3			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.37A>T	X.37:g.18348761T>A	ENSP00000251900:p.Lys13*		18258682	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Nonsense_Mutation	SNP	ENST00000251900.4	37	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	T	36	5.697012	0.96802	.	.	ENSG00000102098	ENST00000251900;ENST00000442000	.	.	.	4.15	2.98	0.34508	.	1.230160	0.06241	N	0.690364	.	.	.	.	.	.	0.38440	D	0.946687	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.7235	0.23342	0.0:0.1138:0.0:0.8862	.	.	.	.	X	13	.	ENSP00000251900:K13X	K	-	1	0	SCML2	18258682	0.955000	0.32602	0.118000	0.21660	0.957000	0.61999	1.424000	0.34848	0.743000	0.32719	0.412000	0.27726	AAG		0.328	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
ZXDA	7789	broad.mit.edu	37	X	57935200	57935200	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chrX:57935200T>G	ENST00000358697.4	-	1	1867	c.1655A>C	c.(1654-1656)aAa>aCa	p.K552T		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	552	Required for interaction with ZXDC.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K552T(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						TGTGAAGAGTTTATTACAAGA	0.483																																					p.K552T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1655C	X						.						50.0	46.0	48.0					X																	57935200		2201	4279	6480	57951925	SO:0001583	missense	7789	exon1			L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.1655A>C	X.37:g.57935200T>G	ENSP00000351530:p.Lys552Thr		57951925	NM_007156	Q9UJP7	Missense_Mutation	SNP	ENST00000358697.4	37	CCDS14376.1	.	.	.	.	.	.	.	.	.	.	.	15.46	2.839390	0.51057	.	.	ENSG00000198205	ENST00000358697	T	0.35421	1.31	3.15	3.15	0.36227	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.054870	0.64402	D	0.000001	T	0.45175	0.1329	M	0.62723	1.935	0.80722	D	1	P	0.41546	0.754	P	0.51945	0.685	T	0.33445	-0.9868	9	.	.	.	.	8.9853	0.35990	0.0:0.0:0.0:1.0	.	552	P98168	ZXDA_HUMAN	T	552	ENSP00000351530:K552T	.	K	-	2	0	ZXDA	57951925	1.000000	0.71417	0.996000	0.52242	0.904000	0.53231	6.818000	0.75257	1.471000	0.48121	0.339000	0.21740	AAA		0.483	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156	
PLP1	5354	broad.mit.edu	37	X	103040643	103040643	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chrX:103040643T>A	ENST00000303958.2	+	2	283	c.137T>A	c.(136-138)cTa>cAa	p.L46Q	PLP1_ENST00000418604.1_Missense_Mutation_p.L46Q|PLP1_ENST00000361621.2_Missense_Mutation_p.L46Q	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	46			L -> P (in HLD1/SPG2). {ECO:0000269|PubMed:15712223, ECO:0000269|PubMed:9934976}.|L -> R (in HLD1). {ECO:0000269|PubMed:9894878}.		astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)	p.L46Q(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						ACAGAAAAGCTAATTGAGACC	0.493																																					p.L46Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T137A	X	GRCh37	CM991053|CM993196	PLP1	M		.						204.0	182.0	190.0					X																	103040643		2203	4300	6503	102927299	SO:0001583	missense	5354	exon2			M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.137T>A	X.37:g.103040643T>A	ENSP00000305152:p.Leu46Gln		102927299	NM_199478	P04400|P06905|Q502Y1|Q6FHZ6	Missense_Mutation	SNP	ENST00000303958.2	37	CCDS14513.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246937	0.80024	.	.	ENSG00000123560	ENST00000434483;ENST00000429977;ENST00000455268;ENST00000422393;ENST00000433491;ENST00000418604;ENST00000443502;ENST00000303958;ENST00000361621;ENST00000428755	D;D;D;D;D;D;D;D;D	0.99494	-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01;-6.01	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	M	0.68317	2.08	0.58432	D	0.99999	D;D;D	0.89917	0.999;1.0;0.99	D;D;P	0.91635	0.998;0.999;0.637	D	0.99143	1.0856	10	0.44086	T	0.13	0.2692	12.5455	0.56197	0.0:0.0:0.0:1.0	.	46;46;46	B1B1G6;P60201;P60201-2	.;MYPR_HUMAN;.	Q	46	ENSP00000403335:L46Q;ENSP00000399913:L46Q;ENSP00000409802:L46Q;ENSP00000413931:L46Q;ENSP00000393391:L46Q;ENSP00000405750:L46Q;ENSP00000391853:L46Q;ENSP00000305152:L46Q;ENSP00000354860:L46Q	ENSP00000305152:L46Q	L	+	2	0	PLP1	102927299	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	7.698000	0.84413	1.869000	0.54173	0.486000	0.48141	CTA		0.493	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057743.2		
INHBB	3625	broad.mit.edu	37	2	121106898	121106898	+	Silent	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr2:121106898C>T	ENST00000295228.3	+	2	718	c.672C>T	c.(670-672)agC>agT	p.S224S		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	224					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)	p.S224S(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				TCAAGCGCAGCGGCTGGCATA	0.637																																					p.S224S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C672T	2						.						106.0	106.0	106.0					2																	121106898		2203	4300	6503	120823368	SO:0001819	synonymous_variant	3625	exon2				CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.672C>T	2.37:g.121106898C>T			120823368	NM_002193	Q53T31|Q8N1D3	Silent	SNP	ENST00000295228.3	37	CCDS2132.1																																																																																				0.637	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
WIPF1	7456	broad.mit.edu	37	2	175431807	175431807	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr2:175431807C>T	ENST00000392547.2	-	7	1546	c.1447G>A	c.(1447-1449)Gaa>Aaa	p.E483K	WIPF1_ENST00000392546.2_Missense_Mutation_p.E483K|WIPF1_ENST00000272746.5_Missense_Mutation_p.E483K|WIPF1_ENST00000467149.1_5'UTR|WIPF1_ENST00000409891.1_Missense_Mutation_p.E483K|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000359761.3_Missense_Mutation_p.E483K|AC018890.6_ENST00000442996.1_RNA	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	483					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)	p.E483K(1)		NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						CTCCGGCTTTCGTTTCTTGCC	0.473																																					p.E483K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1447A	2						.						112.0	111.0	111.0					2																	175431807		2203	4300	6503	175140053	SO:0001583	missense	7456	exon7			AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.1447G>A	2.37:g.175431807C>T	ENSP00000376330:p.Glu483Lys		175140053	NM_001077269	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	ENST00000392547.2	37	CCDS2260.1	.	.	.	.	.	.	.	.	.	.	C	36	5.792639	0.96945	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891	T;T;T;T;T	0.44083	1.51;1.51;1.51;1.51;0.93	5.78	5.78	0.91487	.	0.061993	0.64402	D	0.000004	T	0.58047	0.2095	M	0.65975	2.015	0.80722	D	1	D;D;D	0.65815	0.995;0.995;0.991	P;P;P	0.53760	0.734;0.668;0.546	T	0.57946	-0.7723	10	0.52906	T	0.07	.	20.0216	0.97506	0.0:1.0:0.0:0.0	.	483;483;483	O43516-3;O43516-2;O43516	.;.;WIPF1_HUMAN	K	483;339;483;483;483;483	ENSP00000376330:E483K;ENSP00000272746:E483K;ENSP00000352802:E483K;ENSP00000376329:E483K;ENSP00000386431:E483K	ENSP00000272746:E483K	E	-	1	0	WIPF1	175140053	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	6.262000	0.72514	2.735000	0.93741	0.650000	0.86243	GAA		0.473	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387	
CCDC141	285025	broad.mit.edu	37	2	179730505	179730505	+	Missense_Mutation	SNP	C	C	T	rs150991367	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr2:179730505C>T	ENST00000420890.2	-	17	2830	c.2713G>A	c.(2713-2715)Gag>Aag	p.E905K	CCDC141_ENST00000295723.5_Missense_Mutation_p.E330K	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	905								p.E330K(1)|p.E905K(1)		NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCATTTATCTCGTCTCTCATG	0.522													C|||	3	0.000599042	0.0008	0.0014	5008	,	,		19796	0.0		0.001	False		,,,				2504	0.0				p.E905K												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G2713A	2						.						357.0	321.0	333.0					2																	179730505		2203	4300	6503	179438750	SO:0001583	missense	285025	exon17			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2713G>A	2.37:g.179730505C>T	ENSP00000395995:p.Glu905Lys		179438750	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		3	0.0013736263736263737	2	0.0040650406504065045	0	0.0	0	0.0	1	0.0013192612137203166	C	25.6	4.653187	0.88056	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	T;T;T;T	0.57907	0.37;1.3;1.3;1.01	6.07	5.17	0.71159	.	0.264939	0.28921	N	0.013709	T	0.53738	0.1815	L	0.29908	0.895	0.30866	N	0.732976	D	0.65815	0.995	P	0.54499	0.754	T	0.59123	-0.7513	10	0.44086	T	0.13	-7.6071	14.5535	0.68084	0.0:0.9277:0.0:0.0723	.	330	Q6ZP82	CC141_HUMAN	K	905;349;330;905	ENSP00000395995:E905K;ENSP00000344627:E349K;ENSP00000295723:E330K;ENSP00000390190:E905K	ENSP00000295723:E330K	E	-	1	0	CCDC141	179438750	0.996000	0.38824	0.792000	0.32020	0.076000	0.17211	3.760000	0.55235	1.516000	0.48900	0.650000	0.86243	GAG		0.522	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
B3GNT7	93010	broad.mit.edu	37	2	232262679	232262679	+	Silent	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr2:232262679C>T	ENST00000287590.5	+	2	510	c.249C>T	c.(247-249)gaC>gaT	p.D83D	B3GNT7_ENST00000479618.1_3'UTR|AC017104.6_ENST00000415129.1_RNA	NM_145236.2	NP_660279.1	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7	83					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.D83D(1)		endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)	17		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		AGGCCTGGGACGTGACCACCA	0.597																																					p.D83D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C249T	2						.						44.0	50.0	48.0					2																	232262679		1952	4133	6085	231970923	SO:0001819	synonymous_variant	93010	exon2			AK000770	CCDS46540.1	2q36.1	2013-02-21			ENSG00000156966	ENSG00000156966		"""Beta 3-glycosyltransferases"""	18811	protein-coding gene	gene with protein product		615313				12061784	Standard	NM_145236		Approved	beta3GnT7	uc002vrs.3	Q8NFL0	OTTHUMG00000153880	ENST00000287590.5:c.249C>T	2.37:g.232262679C>T			231970923	NM_145236	B3KWY4|B7WNP0	Silent	SNP	ENST00000287590.5	37	CCDS46540.1																																																																																				0.597	B3GNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332827.1	NM_145236	
COL6A3	1293	broad.mit.edu	37	2	238283544	238283544	+	Missense_Mutation	SNP	G	G	A	rs369810455		TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr2:238283544G>A	ENST00000295550.4	-	8	3642	c.3190C>T	c.(3190-3192)Cgg>Tgg	p.R1064W	COL6A3_ENST00000392003.2_Missense_Mutation_p.R657W|COL6A3_ENST00000409809.1_Missense_Mutation_p.R858W|COL6A3_ENST00000353578.4_Missense_Mutation_p.R858W|COL6A3_ENST00000392004.3_Missense_Mutation_p.R858W|COL6A3_ENST00000472056.1_Missense_Mutation_p.R457W|COL6A3_ENST00000346358.4_Missense_Mutation_p.R864W|COL6A3_ENST00000347401.3_Missense_Mutation_p.R863W	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1064	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.		R -> Q (in UCMD; dbSNP:rs112638391). {ECO:0000269|PubMed:15689448}.		axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1064W(2)|p.R858W(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		ACGCGGACCCGGTCCTGGCCC	0.592																																					p.R457W												.	.	3	Substitution - Missense(3)	urinary_tract(2)|large_intestine(1)	c.C1369T	2						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	57.0	57.0	57.0		3190,1969,2572,1369,2572	4.4	0.5	2		57	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	COL6A3	NM_004369.3,NM_057164.4,NM_057165.4,NM_057166.4,NM_057167.3	101,101,101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1064/3178,657/1037,858/1238,457/2571,858/2972	238283544	1,13005	2203	4300	6503	237948283	SO:0001583	missense	1293	exon5			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.3190C>T	2.37:g.238283544G>A	ENSP00000295550:p.Arg1064Trp		237948283	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578035	0.65878	0.0	1.16E-4	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358;ENST00000392004;ENST00000392003	D;D;D;D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76;-1.76	5.33	4.44	0.53790	von Willebrand factor, type A (3);	0.304703	0.23429	N	0.048267	D	0.88923	0.6569	L	0.61218	1.895	0.40860	D	0.983828	D;D;D;D;D	0.89917	1.0;0.998;0.999;1.0;0.998	D;D;D;D;P	0.79784	0.993;0.953;0.954;0.992;0.88	D	0.89908	0.4049	10	0.72032	D	0.01	.	12.7842	0.57496	0.0:0.0:0.5524:0.4476	.	457;657;858;858;1064	E9PFQ6;A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;.;CO6A3_HUMAN	W	1064;863;858;457;858;864;858;657	ENSP00000295550:R1064W;ENSP00000315609:R863W;ENSP00000315873:R858W;ENSP00000418285:R457W;ENSP00000386844:R858W;ENSP00000295546:R864W;ENSP00000375861:R858W;ENSP00000375860:R657W	ENSP00000295550:R1064W	R	-	1	2	COL6A3	237948283	1.000000	0.71417	0.520000	0.27837	0.826000	0.46750	2.984000	0.49353	1.361000	0.45981	-0.182000	0.12963	CGG		0.592	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
C9orf64	84267	broad.mit.edu	37	9	86559713	86559713	+	Silent	SNP	G	G	A	rs36082863	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr9:86559713G>A	ENST00000376344.3	-	3	1005	c.789C>T	c.(787-789)ctC>ctT	p.L263L	C9orf64_ENST00000314700.1_Silent_p.L122L	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	263								p.L263L(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						GCAAACCTTTGAGAAGCTTCT	0.358													G|||	45	0.00898562	0.031	0.0029	5008	,	,		17977	0.0		0.002	False		,,,				2504	0.0				p.L263L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C789T	9						.	G		122,4284	90.6+/-129.3	1,120,2082	79.0	79.0	79.0		789	-4.8	0.5	9	dbSNP_126	79	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous	C9orf64	NM_032307.3		1,122,6380	AA,AG,GG		0.0233,2.769,0.9534		263/342	86559713	124,12882	2203	4300	6503	85749533	SO:0001819	synonymous_variant	84267	exon3			AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.789C>T	9.37:g.86559713G>A			85749533	NM_032307	B2RPI6|Q8N2B1|Q9BT18	Silent	SNP	ENST00000376344.3	37	CCDS6666.2																																																																																				0.358	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1	NM_032307	
N6AMT2	221143	broad.mit.edu	37	13	21306020	21306020	+	Silent	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr13:21306020G>A	ENST00000382758.1	-	4	515	c.468C>T	c.(466-468)acC>acT	p.T156T	N6AMT2_ENST00000382754.4_Silent_p.T156T			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	156						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)	p.T156T(1)		endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GGTACTTGACGGTTTCCGATG	0.463																																					p.T156T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C468T	13						.						126.0	119.0	122.0					13																	21306020		2203	4300	6503	20204020	SO:0001819	synonymous_variant	221143	exon4			AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.468C>T	13.37:g.21306020G>A			20204020	NM_174928	B5G4V1	Silent	SNP	ENST00000382758.1	37	CCDS9293.1																																																																																				0.463	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044083.1	NM_174928	
CHAMP1	283489	broad.mit.edu	37	13	115089492	115089493	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-AG-A01L-01	TCGA-AG-A01L-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr13:115089492_115089493GC>TT	ENST00000361283.1	+	3	484_485	c.175_176GC>TT	c.(175-177)GCa>TTa	p.A59L		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	59					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A59>?(1)									CCAGAAAAGTGCAAAGTTATTT	0.376																																					.												.	.	1	Complex(1)	large_intestine(1)	c.175_176TT	13						.																																			114107595	SO:0001583	missense	283489	exon3			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	Exception_encountered	13.37:g.115089492_115089493delinsTT	ENSP00000354730:p.Ala59Leu		114107594	NM_001164145	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	DNP	ENST00000361283.1	37	CCDS9545.1																																																																																				0.376	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436	
TET1	80312	broad.mit.edu	37	10	70333380	70333380	+	Silent	SNP	T	T	C			TCGA-AG-A01L-01	TCGA-AG-A01L-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	SOLID			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr10:70333380T>C	ENST00000373644.4	+	2	1494	c.1285T>C	c.(1285-1287)Ttg>Ctg	p.L429L		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	429					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)	p.L429L(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TGTCCCAGACTTGCCTGTCTT	0.468																																					p.L429L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1285C	10						.						139.0	127.0	131.0					10																	70333380		2203	4300	6503	70003386	SO:0001819	synonymous_variant	80312	exon2			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1285T>C	10.37:g.70333380T>C			70003386	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																				0.468	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
HARS2	23438	broad.mit.edu	37	5	140075196	140075196	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:140075196G>A	ENST00000230771.3	+	5	726	c.503G>A	c.(502-504)cGt>cAt	p.R168H	HARS2_ENST00000437649.2_Intron|HARS2_ENST00000508522.1_Missense_Mutation_p.R143H|HARS2_ENST00000432671.2_Intron|HARS2_ENST00000435019.2_Missense_Mutation_p.R128H|HARS2_ENST00000448069.2_Intron	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	168					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)	p.R168H(2)		NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCAAGGCCGTTATAGGGAG	0.488																																					p.R168H												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G503A	5						.						141.0	136.0	138.0					5																	140075196		2203	4300	6503	140055380	SO:0001583	missense	23438	exon5			U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.503G>A	5.37:g.140075196G>A	ENSP00000230771:p.Arg168His		140055380	NM_012208	B4DDY8	Missense_Mutation	SNP	ENST00000230771.3	37	CCDS4238.1	.	.	.	.	.	.	.	.	.	.	g	28.7	4.946222	0.92593	.	.	ENSG00000112855	ENST00000230771;ENST00000509299;ENST00000435019;ENST00000508522;ENST00000427675	T;D;T;T	0.96830	-0.48;-4.14;-0.48;-0.48	6.17	6.17	0.99709	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.99124	0.9698	H	0.98996	4.395	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.995;0.995;0.995;0.995	D	0.98667	1.0686	10	0.87932	D	0	-9.1108	20.8794	0.99867	0.0:0.0:1.0:0.0	.	54;143;168;168	E9PD60;B4DDY8;B2R7G6;P49590	.;.;.;SYHM_HUMAN	H	168;174;128;143;40	ENSP00000230771:R168H;ENSP00000425695:R174H;ENSP00000412887:R128H;ENSP00000423616:R143H	ENSP00000230771:R168H	R	+	2	0	HARS2	140055380	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	CGT		0.488	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251670.2	NM_012208	
PCDHA11	56138	broad.mit.edu	37	5	140250915	140250915	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:140250915G>A	ENST00000398640.2	+	1	2227	c.2227G>A	c.(2227-2229)Gcg>Acg	p.A743T	PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	743	6 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A743T(2)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCTCCCGCGCGGTGGGGAG	0.682																																					p.A743T												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G2227A	5						.						29.0	31.0	31.0					5																	140250915		2203	4300	6503	140231099	SO:0001583	missense	56138	exon1			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.2227G>A	5.37:g.140250915G>A	ENSP00000381636:p.Ala743Thr		140231099	NM_031861	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.627210	0.28978	.	.	ENSG00000249158	ENST00000398640	T	0.15139	2.45	4.6	4.6	0.57074	.	.	.	.	.	T	0.24851	0.0603	M	0.87971	2.92	0.23906	N	0.9965	B;B	0.31413	0.322;0.035	B;B	0.24394	0.053;0.033	T	0.15665	-1.0429	9	0.46703	T	0.11	.	10.6973	0.45907	0.0888:0.0:0.9112:0.0	.	743;743	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	T	743	ENSP00000381636:A743T	ENSP00000381636:A743T	A	+	1	0	PCDHA11	140231099	1.000000	0.71417	0.988000	0.46212	0.148000	0.21650	2.756000	0.47549	2.093000	0.63338	0.655000	0.94253	GCG		0.682	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
C5orf49	134121	broad.mit.edu	37	5	7832094	7832094	+	Missense_Mutation	SNP	G	G	A	rs187132919	byFrequency	TCGA-AG-A01L-01	TCGA-AG-A01L-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:7832094G>A	ENST00000399810.2	-	3	781	c.313C>T	c.(313-315)Cgc>Tgc	p.R105C	C5orf49_ENST00000509627.1_Missense_Mutation_p.R103C	NM_001089584.2	NP_001083053.1	A4QMS7	CE049_HUMAN	chromosome 5 open reading frame 49	105								p.R105C(1)		large_intestine(3)|lung(5)|skin(1)	9						TGATTGATGCGCTTCCCATAG	0.542													G|||	2	0.000399361	0.0	0.0	5008	,	,		19571	0.002		0.0	False		,,,				2504	0.0				p.R105C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C313T	5						.						156.0	162.0	160.0					5																	7832094		2036	4183	6219	7885094	SO:0001583	missense	134121	exon3				CCDS43300.1	5p15.31	2008-07-16			ENSG00000215217	ENSG00000215217			27028	protein-coding gene	gene with protein product						12477932	Standard	NM_001089584		Approved	LOC134121	uc003jea.5	A4QMS7	OTTHUMG00000161897	ENST00000399810.2:c.313C>T	5.37:g.7832094G>A	ENSP00000382708:p.Arg105Cys		7885094	NM_001089584		Missense_Mutation	SNP	ENST00000399810.2	37	CCDS43300.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	15.82	2.945505	0.53079	.	.	ENSG00000215217	ENST00000399810;ENST00000509627	T;T	0.32753	1.44;1.44	4.72	3.85	0.44370	.	.	.	.	.	T	0.30293	0.0760	M	0.61703	1.905	0.50039	D	0.999847	B	0.25521	0.128	B	0.17722	0.019	T	0.13710	-1.0499	9	0.72032	D	0.01	-32.1385	10.3946	0.44192	0.0945:0.0:0.9055:0.0	.	105	A4QMS7	CE049_HUMAN	C	105;103	ENSP00000382708:R105C;ENSP00000426019:R103C	ENSP00000382708:R105C	R	-	1	0	C5orf49	7885094	0.998000	0.40836	0.994000	0.49952	0.457000	0.32468	3.291000	0.51764	1.117000	0.41842	0.555000	0.69702	CGC		0.542	C5orf49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000366322.1	NM_001089584	
PRDM9	56979	broad.mit.edu	37	5	23527040	23527040	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:23527040C>T	ENST00000296682.3	+	11	2025	c.1843C>T	c.(1843-1845)Cgg>Tgg	p.R615W		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	615					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.R615W(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GGAGTGTGGGCGGGGCTTTAG	0.627										HNSCC(3;0.000094)																											p.R615W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1843T	5						.						26.0	28.0	28.0					5																	23527040		1782	3781	5563	23562797	SO:0001583	missense	56979	exon11			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1843C>T	5.37:g.23527040C>T	ENSP00000296682:p.Arg615Trp		23562797	NM_020227	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	C	9.892	1.204407	0.22205	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.36157	1.27	1.89	0.993	0.19825	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.440100	0.05127	N	0.491844	T	0.60314	0.2259	M	0.79926	2.475	0.35884	D	0.829131	D	0.89917	1.0	D	0.87578	0.998	T	0.53858	-0.8379	10	0.59425	D	0.04	-6.2673	6.3724	0.21489	0.5272:0.4728:0.0:0.0	.	615	Q9NQV7	PRDM9_HUMAN	W	615;381	ENSP00000296682:R615W	ENSP00000253473:R381W	R	+	1	2	PRDM9	23562797	0.624000	0.27102	0.974000	0.42286	0.229000	0.25112	1.799000	0.38824	0.343000	0.23821	-0.373000	0.07131	CGG		0.627	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
OSMR	9180	broad.mit.edu	37	5	38924610	38924610	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:38924610C>T	ENST00000274276.3	+	14	2359	c.1957C>T	c.(1957-1959)Caa>Taa	p.Q653*		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	653	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.Q653*(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					TACTGAATCTCAACCTGGTTT	0.448																																					p.Q653X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1957T	5						.						133.0	120.0	124.0					5																	38924610		2203	4300	6503	38960367	SO:0001587	stop_gained	9180	exon14			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.1957C>T	5.37:g.38924610C>T	ENSP00000274276:p.Gln653*		38960367	NM_003999	Q6P4E8|Q96QJ6	Nonsense_Mutation	SNP	ENST00000274276.3	37	CCDS3928.1	.	.	.	.	.	.	.	.	.	.	C	41	8.875500	0.98986	.	.	ENSG00000145623	ENST00000274276	.	.	.	5.97	5.97	0.96955	.	0.057992	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	17.1328	0.86730	0.0:1.0:0.0:0.0	.	.	.	.	X	653	.	ENSP00000274276:Q653X	Q	+	1	0	OSMR	38960367	0.916000	0.31088	0.414000	0.26521	0.575000	0.36095	3.790000	0.55461	2.835000	0.97688	0.591000	0.81541	CAA		0.448	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000207609.2	NM_003999	
CKMT2	1160	broad.mit.edu	37	5	80559399	80559399	+	Silent	SNP	C	C	T	rs150638385		TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:80559399C>T	ENST00000424301.2	+	10	1342	c.1104C>T	c.(1102-1104)taC>taT	p.Y368Y	CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2_ENST00000437669.1_Silent_p.Y368Y|CKMT2_ENST00000254035.4_Silent_p.Y368Y|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000500148.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	368	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.Y368Y(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	CAGATGTGTACGACATTTCCA	0.458													C|||	1	0.000199681	0.0	0.0	5008	,	,		12934	0.0		0.001	False		,,,				2504	0.0				p.Y368Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1104T	5						.	C	,,	3,4403	6.2+/-15.9	0,3,2200	127.0	117.0	120.0		1104,1104,1104	-10.8	0.3	5	dbSNP_134	120	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CKMT2	NM_001099735.1,NM_001099736.1,NM_001825.2	,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,	368/420,368/420,368/420	80559399	3,13003	2203	4300	6503	80595155	SO:0001819	synonymous_variant	1160	exon10				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.1104C>T	5.37:g.80559399C>T			80595155	NM_001825	Q6ICS8|Q8N1E1	Silent	SNP	ENST00000424301.2	37	CCDS4053.1																																																																																				0.458	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369600.1	NM_001825	
PCDHGB2	56103	broad.mit.edu	37	5	140740387	140740387	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr5:140740387C>T	ENST00000522605.1	+	1	685	c.685C>T	c.(685-687)Cga>Tga	p.R229*	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	229	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R229*(2)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCCAAATCCGAATCAAAGT	0.542																																					p.R229X												.	.	2	Substitution - Nonsense(2)	large_intestine(2)	c.C685T	5						.						84.0	85.0	84.0					5																	140740387		2037	4192	6229	140720571	SO:0001587	stop_gained	56103	exon1			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.685C>T	5.37:g.140740387C>T	ENSP00000429018:p.Arg229*		140720571	NM_018923	Q3MIJ3|Q9UN65	Nonsense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	11.78	1.740719	0.30865	.	.	ENSG00000253910	ENST00000522605	.	.	.	5.54	1.47	0.22746	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2725	0.15632	0.4354:0.3857:0.1084:0.0705	.	.	.	.	X	229	.	ENSP00000429018:R229X	R	+	1	2	PCDHGB2	140720571	0.000000	0.05858	0.863000	0.33907	0.001000	0.01503	-2.801000	0.00761	0.776000	0.33473	-1.014000	0.02459	CGA		0.542	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
MIR99AHG	388815	broad.mit.edu	37	21	17443447	17443447	+	lincRNA	SNP	C	C	T			TCGA-AG-A01L-01	TCGA-AG-A01L-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A01L-01	TCGA-AG-A01L-01	g.chr21:17443447C>T	ENST00000458468.1	+	0	41					NR_027790.1													p.T5M(1)									GATCTGAGAACGCTGTCTGGG	0.468																																					.												.	.	1	Substitution - Missense(1)	large_intestine(1)	.	21						.						124.0	120.0	121.0					21																	17443447		2203	4300	6503	16365318			388815	.																															21.37:g.17443447C>T			16365318	.		Missense_Mutation	SNP	ENST00000458468.1	37																																																																																					0.468	LINC00478-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000158029.1		
