#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ZNF831	128611	broad.mit.edu	37	20	57766219	57766220	+	Frame_Shift_Ins	INS	-	-	C	rs570895195		TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr20:57766219_57766220insC	ENST00000371030.2	+	1	145_146	c.145_146insC	c.(145-147)gccfs	p.A49fs		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	49	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.T52fs*47(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCAGGGCCTGGCCCCCCCCACT	0.728																																					p.A49fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.145_146insC	20						.			44,3536		1,42,1747						2.3	0.9			18	50,7732		0,50,3841	no	frameshift	ZNF831	NM_178457.1		1,92,5588	A1A1,A1R,RR		0.6425,1.2291,0.8273				94,11268				57199615	SO:0001589	frameshift_variant	128611	exon1			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.153dupC	20.37:g.57766227_57766227dupC	ENSP00000360069:p.Ala49fs		57199614	NM_178457	Q5TDR4|Q8TCP0	Frame_Shift_Ins	INS	ENST00000371030.2	37	CCDS42894.1																																																																																				0.728	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
MARCKSL1	65108	broad.mit.edu	37	1	32800539	32800540	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:32800539_32800540insG	ENST00000329421.7	-	2	591_592	c.246_247insC	c.(244-249)cccaagfs	p.K83fs		NM_023009.6	NP_075385.1	P49006	MRP_HUMAN	MARCKS-like 1	83					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.K83fs*33(2)		breast(1)|large_intestine(3)|lung(1)|ovary(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGGGTCTCCTTGGGGGGGACCT	0.589																																					p.K83fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.247_248insC	1						.																																			32573127	SO:0001589	frameshift_variant	65108	exon2			AF031640	CCDS361.1	1p35.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000175130	ENSG00000175130			7142	protein-coding gene	gene with protein product		602940	"""MARCKS-like protein"""	MLP		9598313	Standard	NM_023009		Approved	F52, MacMARCKS, MLP1	uc001bvd.4	P49006	OTTHUMG00000007589	ENST00000329421.7:c.247dupC	1.37:g.32800546_32800546dupG	ENSP00000362638:p.Lys83fs		32573126	NM_023009	D3DPQ0|Q5TEE6|Q6NXS5	Frame_Shift_Ins	INS	ENST00000329421.7	37	CCDS361.1																																																																																				0.589	MARCKSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020059.3	NM_023009	
HOXB2	3212	broad.mit.edu	37	17	46622001	46622002	+	Frame_Shift_Ins	INS	-	-	G	rs544258654		TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:46622001_46622002insG	ENST00000330070.4	-	1	1439_1440	c.272_273insC	c.(271-273)ccgfs	p.P91fs	HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000502764.2_RNA|HOXB-AS1_ENST00000504972.3_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB2_ENST00000504772.3_5'Flank	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	91					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A92fs*74(1)		NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						ACTcgggggccgggggggcagc	0.698																																					p.P91fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.273_274insC	17						.			17,4051		1,15,2018						-7.6	0.6			18	29,8031		0,29,4001	no	frameshift	HOXB2	NM_002145.3		1,44,6019	A1A1,A1R,RR		0.3598,0.4179,0.3793				46,12082				43977001	SO:0001589	frameshift_variant	3212	exon1				CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.273dupC	17.37:g.46622008_46622008dupG	ENSP00000331741:p.Pro91fs		43977000	NM_002145	P10913|P17485	Frame_Shift_Ins	INS	ENST00000330070.4	37	CCDS11527.1																																																																																				0.698	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2		
TP53	7157	broad.mit.edu	37	17	7579590	7579591	+	Splice_Site	INS	-	-	CT			TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:7579590_7579591insCT	ENST00000269305.4	-	4	286	c.97_97insAG	c.(97-99)tcc>AGtcc	p.S33fs	TP53_ENST00000359597.4_Splice_Site_p.S33fs|TP53_ENST00000413465.2_Splice_Site_p.S33fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Splice_Site_p.S33fs|TP53_ENST00000455263.2_Splice_Site_p.S33fs|TP53_ENST00000445888.2_Splice_Site_p.S33fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	33	Interaction with HRMT1L2.|Transcription activation (acidic).		S -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(8)|p.L35fs*10(3)|p.S33fs*23(1)|p.S33fs*11(1)|p.S33fs*10(1)|p.S33T(1)|p.P13fs*18(1)|p.S33fs*6(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCAAGGGGGACTGTAGATGGG	0.589		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S33fs	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	.	25	Unknown(11)|Whole gene deletion(8)|Deletion - Frameshift(4)|Substitution - Missense(1)|Insertion - Frameshift(1)	large_intestine(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|lung(3)|pancreas(3)|stomach(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|ovary(1)	c.97_98insAG	17	GRCh37	CS971912	TP53	S		.																																			7520316	SO:0001630	splice_region_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.97-1->AG	17.37:g.7579591_7579592dupCT			7520315	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	INS	ENST00000269305.4	37	CCDS11118.1																																																																																				0.589	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Frame_Shift_Ins
ACO1	48	broad.mit.edu	37	9	32431754	32431755	+	Frame_Shift_Ins	INS	-	-	A			TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr9:32431754_32431755insA	ENST00000309951.6	+	15	1902_1903	c.1764_1765insA	c.(1765-1767)atcfs	p.I589fs	ACO1_ENST00000541043.1_Frame_Shift_Ins_p.I490fs|ACO1_ENST00000379923.1_Frame_Shift_Ins_p.I589fs	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	589					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.I589fs*5(2)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TTCTGAAAGATATCTGGCCGAC	0.411											OREG0019130	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D588fs												.	.	2	Insertion - Frameshift(2)	large_intestine(2)	c.1764_1765insA	9						.																																			32421755	SO:0001589	frameshift_variant	48	exon15			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1765dupA	9.37:g.32431755_32431755dupA	ENSP00000309477:p.Ile589fs	832	32421754	NM_002197	D3DRK7|Q14652|Q5VZA7	Frame_Shift_Ins	INS	ENST00000309951.6	37	CCDS6525.1																																																																																				0.411	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
EIF2AK1	27102	broad.mit.edu	37	7	6064007	6064008	+	3'UTR	INS	-	-	AGA	rs34244049|rs201127629|rs10672014		TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:6064007_6064008insAGA	ENST00000199389.6	-	0	2335_2336				EIF2AK1_ENST00000536084.1_Intron	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1						negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		ATTTCTGCGGTACCTTCTAGAG	0.495																																					.												.	.	0			.	7						.																																			6030534	SO:0001624	3_prime_UTR_variant	27102	.			BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.*297->TCT	7.37:g.6064007_6064008insAGA			6030533	.	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Splice_Site	INS	ENST00000199389.6	37	CCDS5345.1																																																																																				0.495	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
PMPCB	9512	broad.mit.edu	37	7	102940636	102940636	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:102940636G>C	ENST00000249269.4	+	4	377	c.339G>C	c.(337-339)aaG>aaC	p.K113N	PMPCB_ENST00000428154.1_Missense_Mutation_p.K113N|PMPCB_ENST00000420236.2_Missense_Mutation_p.K8N	NM_004279.2	NP_004270.2	O75439	MPPB_HUMAN	peptidase (mitochondrial processing) beta	113					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.K113N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(9)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCACCAAGAAGAGATCCCAGT	0.373																																					p.K113N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G339C	7						.						123.0	128.0	126.0					7																	102940636		2203	4300	6503	102727872	SO:0001583	missense	9512	exon4			AF054182	CCDS5730.1	7q22.1	2007-07-30			ENSG00000105819	ENSG00000105819			9119	protein-coding gene	gene with protein product		603131				9653160	Standard	XM_005250717		Approved	MPPB, MPPP52	uc003vbl.3	O75439	OTTHUMG00000157205	ENST00000249269.4:c.339G>C	7.37:g.102940636G>C	ENSP00000249269:p.Lys113Asn		102727872	NM_004279	O60416|Q96FV4	Missense_Mutation	SNP	ENST00000249269.4	37	CCDS5730.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.533254	0.27387	.	.	ENSG00000105819	ENST00000249269;ENST00000428154;ENST00000420236	T;T;T	0.43688	0.94;0.94;0.94	5.5	2.27	0.28462	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.042367	0.85682	D	0.000000	T	0.26085	0.0636	N	0.25647	0.755	0.47778	D	0.99951	B;B;B;B;B;B;B	0.15141	0.006;0.002;0.012;0.012;0.007;0.012;0.004	B;B;B;B;B;B;B	0.17098	0.007;0.01;0.017;0.017;0.017;0.017;0.006	T	0.04930	-1.0917	10	0.26408	T	0.33	.	7.9055	0.29759	0.2201:0.1193:0.6605:0.0	.	8;8;113;113;104;113;113	E7ERZ4;B4DM90;A8K1E9;B3KM34;Q96CP5;O75439;G3V0E4	.;.;.;.;.;MPPB_HUMAN;.	N	113;113;8	ENSP00000249269:K113N;ENSP00000390035:K113N;ENSP00000410393:K8N	ENSP00000249269:K113N	K	+	3	2	PMPCB	102727872	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.495000	0.35627	0.698000	0.31739	0.644000	0.83932	AAG		0.373	PMPCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347913.1	NM_004279	
ORC5	5001	broad.mit.edu	37	7	103801610	103801610	+	Silent	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:103801610C>G	ENST00000297431.4	-	12	1201	c.1059G>C	c.(1057-1059)ggG>ggC	p.G353G	ORC5_ENST00000545943.1_Silent_p.G221G	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	353					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)	p.G353G(1)		kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						ATGGTTTTGGCCCAAGGAGAT	0.363																																					p.G353G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1059C	7						.						120.0	123.0	122.0					7																	103801610		2203	4300	6503	103588846	SO:0001819	synonymous_variant	5001	exon12				CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.1059G>C	7.37:g.103801610C>G			103588846	NM_002553	A4D0P8|O60590|O95268	Silent	SNP	ENST00000297431.4	37	CCDS5734.1																																																																																				0.363	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348286.1	NM_002553	
IQCE	23288	broad.mit.edu	37	7	2617958	2617958	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:2617958G>A	ENST00000402050.2	+	7	732	c.548G>A	c.(547-549)cGg>cAg	p.R183Q	IQCE_ENST00000404984.1_Missense_Mutation_p.R132Q|IQCE_ENST00000438376.2_Missense_Mutation_p.R167Q|IQCE_ENST00000325979.7_Missense_Mutation_p.R118Q	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	183						mitochondrion (GO:0005739)		p.R183Q(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		AGGAAGGACCGGCAGATAGAG	0.627																																					p.R183Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G548A	7						.						56.0	65.0	62.0					7																	2617958		2081	4211	6292	2584484	SO:0001583	missense	23288	exon7			AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.548G>A	7.37:g.2617958G>A	ENSP00000385597:p.Arg183Gln		2584484	NM_152558	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Missense_Mutation	SNP	ENST00000402050.2	37	CCDS43542.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704091	0.88924	.	.	ENSG00000106012	ENST00000402050;ENST00000404984;ENST00000415271;ENST00000438376;ENST00000325979;ENST00000423395;ENST00000422276	T;T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19;3.19	5.5	5.5	0.81552	.	0.125660	0.51477	D	0.000091	T	0.26593	0.0650	M	0.71581	2.175	0.36221	D	0.851975	D;D;D;D;D;D	0.89917	0.997;0.987;1.0;0.997;0.987;1.0	P;P;D;P;P;D	0.83275	0.826;0.661;0.975;0.877;0.584;0.996	T	0.08310	-1.0728	10	0.49607	T	0.09	-33.4197	12.3018	0.54878	0.0819:0.0:0.9181:0.0	.	118;167;118;183;183;167	B4DXN1;B4DDX4;Q6IPM2-2;Q6IPM2;B3KRY4;Q6IPM2-4	.;.;.;IQCE_HUMAN;.;.	Q	183;132;219;167;118;118;118	ENSP00000385597:R183Q;ENSP00000385945:R132Q;ENSP00000404643:R219Q;ENSP00000396178:R167Q;ENSP00000313772:R118Q;ENSP00000413570:R118Q	ENSP00000313772:R118Q	R	+	2	0	IQCE	2584484	0.998000	0.40836	1.000000	0.80357	0.963000	0.63663	2.027000	0.41078	2.572000	0.86782	0.563000	0.77884	CGG		0.627	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325063.2	NM_152558	
DNAH11	8701	broad.mit.edu	37	7	21583072	21583072	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:21583072T>C	ENST00000409508.3	+	1	240	c.209T>C	c.(208-210)cTg>cCg	p.L70P	DNAH11_ENST00000328843.6_Missense_Mutation_p.L70P	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	70	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L70P(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GCGATGATGCTGGGGTTCACG	0.642									Kartagener syndrome																												p.L70P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T209C	7						.						22.0	26.0	25.0					7																	21583072		1927	4121	6048	21549597	SO:0001583	missense	8701	exon1	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.209T>C	7.37:g.21583072T>C	ENSP00000475939:p.Leu70Pro		21549597	NM_003777	Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37		.	.	.	.	.	.	.	.	.	.	T	13.08	2.130458	0.37630	.	.	ENSG00000105877	ENST00000328843	T	0.26660	1.72	3.99	3.99	0.46301	.	3.606890	0.00682	N	0.000683	T	0.41696	0.1170	L	0.34521	1.04	0.44834	D	0.997844	D	0.71674	0.998	D	0.63488	0.915	T	0.15549	-1.0433	10	0.59425	D	0.04	.	9.4709	0.38842	0.0:0.0:0.0:1.0	.	70	Q96DT5	DYH11_HUMAN	P	70	ENSP00000330671:L70P	ENSP00000330671:L70P	L	+	2	0	DNAH11	21549597	0.981000	0.34729	0.630000	0.29268	0.105000	0.19272	2.298000	0.43602	1.821000	0.53095	0.460000	0.39030	CTG		0.642	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6	NM_003777	
SKAP2	8935	broad.mit.edu	37	7	26778460	26778460	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:26778460C>A	ENST00000345317.2	-	6	736	c.423G>T	c.(421-423)tgG>tgT	p.W141C	SKAP2_ENST00000539623.1_5'UTR|SKAP2_ENST00000489977.1_5'UTR	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	141	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.W141C(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						TGAGAGCACACCACCGTTTCT	0.338																																					p.W141C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G423T	7						.						116.0	115.0	115.0					7																	26778460		2203	4300	6503	26744985	SO:0001583	missense	8935	exon6				CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.423G>T	7.37:g.26778460C>A	ENSP00000005587:p.Trp141Cys		26744985	NM_003930	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142534	0.77888	.	.	ENSG00000005020	ENST00000345317;ENST00000535331;ENST00000432747	T;T	0.27402	1.67;1.67	5.7	5.7	0.88788	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.69305	0.3096	H	0.96175	3.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79381	-0.1827	10	0.87932	D	0	-9.3935	16.7512	0.85487	0.0:1.0:0.0:0.0	.	126;141	B7Z5N4;O75563	.;SKAP2_HUMAN	C	141;126;126	ENSP00000005587:W141C;ENSP00000408163:W126C	ENSP00000005587:W141C	W	-	3	0	SKAP2	26744985	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.032000	0.70918	2.696000	0.92011	0.561000	0.74099	TGG		0.338	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1		
RALA	5898	broad.mit.edu	37	7	39745751	39745751	+	Silent	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:39745751A>T	ENST00000005257.2	+	5	908	c.528A>T	c.(526-528)cgA>cgT	p.R176R	AC004837.5_ENST00000435766.1_RNA|RALA_ENST00000468201.1_3'UTR	NM_005402.3	NP_005393.2	P11233	RALA_HUMAN	v-ral simian leukemia viral oncogene homolog A (ras related)	176					actin cytoskeleton reorganization (GO:0031532)|chemotaxis (GO:0006935)|cytokinesis (GO:0000910)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|membrane raft localization (GO:0051665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of filopodium assembly (GO:0051491)|Ras protein signal transduction (GO:0007265)|regulation of exocytosis (GO:0017157)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R176R(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(9)|skin(3)	16						GAGAAATTCGAGCGAGAAAGA	0.323																																					p.R176R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A528T	7						.						61.0	67.0	65.0					7																	39745751		2203	4298	6501	39712276	SO:0001819	synonymous_variant	5898	exon5				CCDS5460.1	7p22-p15	2014-05-09			ENSG00000006451	ENSG00000006451			9839	protein-coding gene	gene with protein product	"""RAS-like protein A"", ""Ras-related protein Ral-A"", ""Ras family small GTP binding protein RALA"", ""ras related GTP binding protein A"""	179550		RAL		3292391	Standard	NM_005402		Approved		uc003thd.3	P11233	OTTHUMG00000128775	ENST00000005257.2:c.528A>T	7.37:g.39745751A>T			39712276	NM_005402	A4D1W3	Silent	SNP	ENST00000005257.2	37	CCDS5460.1																																																																																				0.323	RALA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250696.2	NM_005402	
AEBP1	165	broad.mit.edu	37	7	44153252	44153252	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:44153252G>A	ENST00000223357.3	+	21	3174	c.2869G>A	c.(2869-2871)Gcg>Acg	p.A957T	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.A532T	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	957	Interaction with PTEN. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.A957T(1)		NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GACAGCCCACGCGGAGGGCTA	0.622																																					p.A957T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2869A	7						.						68.0	70.0	69.0					7																	44153252		2203	4300	6503	44119777	SO:0001583	missense	165	exon21			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2869G>A	7.37:g.44153252G>A	ENSP00000223357:p.Ala957Thr		44119777	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	-	26.3	4.723323	0.89298	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.51071	0.72;0.72	4.94	4.94	0.65067	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.000000	0.85682	D	0.000000	T	0.78168	0.4241	H	0.94264	3.515	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.85099	0.0956	10	0.87932	D	0	-26.7182	18.1495	0.89669	0.0:0.0:1.0:0.0	.	532;957	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	T	957;532	ENSP00000223357:A957T;ENSP00000398878:A532T	ENSP00000223357:A957T	A	+	1	0	AEBP1	44119777	1.000000	0.71417	0.915000	0.36163	0.722000	0.41435	7.895000	0.87343	2.473000	0.83533	0.645000	0.84053	GCG		0.622	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
LIMK1	3984	broad.mit.edu	37	7	73535496	73535496	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:73535496G>A	ENST00000336180.2	+	16	1860	c.1809G>A	c.(1807-1809)tgG>tgA	p.W603*	LIMK1_ENST00000418310.1_Nonsense_Mutation_p.W633*|LIMK1_ENST00000538333.3_Nonsense_Mutation_p.W569*	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	603	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.W603*(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	TGGAACACTGGCTGGAGACCC	0.677																																					p.W603X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G1809A	7						.						58.0	54.0	56.0					7																	73535496		2203	4300	6503	73173432	SO:0001587	stop_gained	3984	exon16			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1809G>A	7.37:g.73535496G>A	ENSP00000336740:p.Trp603*		73173432	NM_002314	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Nonsense_Mutation	SNP	ENST00000336180.2	37	CCDS5563.1	.	.	.	.	.	.	.	.	.	.	G	37	6.492174	0.97612	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	.	.	.	4.3	4.3	0.51218	.	0.063657	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4637	14.7078	0.69203	0.0:0.0:1.0:0.0	.	.	.	.	X	633;603;603;569	.	ENSP00000336740:W603X	W	+	3	0	LIMK1	73173432	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	5.952000	0.70282	2.157000	0.67596	0.456000	0.33151	TGG		0.677	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252335.2	NM_002314	
DTX2	113878	broad.mit.edu	37	7	76131644	76131644	+	Silent	SNP	C	C	T	rs141587206	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:76131644C>T	ENST00000324432.5	+	9	1770	c.1260C>T	c.(1258-1260)tcC>tcT	p.S420S	DTX2_ENST00000446820.2_Silent_p.S373S|DTX2_ENST00000446600.1_Silent_p.S329S|DTX2_ENST00000413936.2_Silent_p.S420S|DTX2_ENST00000430490.2_Silent_p.S420S|DTX2_ENST00000307569.8_Silent_p.S373S	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	420					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S420S(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						AGAAGCTGTCCACAGCGTCTG	0.582													.|||	206	0.0411342	0.0961	0.0202	5008	,	,		17191	0.0089		0.0328	False		,,,				2504	0.0235				p.S420S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1260T	7						.						77.0	61.0	66.0					7																	76131644		2199	4295	6494	75969580	SO:0001819	synonymous_variant	113878	exon7				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1260C>T	7.37:g.76131644C>T			75969580	NM_001102595	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	CCDS5587.1																																																																																				0.582	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
GRM3	2913	broad.mit.edu	37	7	86394606	86394606	+	Missense_Mutation	SNP	G	G	A	rs267601603		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:86394606G>A	ENST00000361669.2	+	2	1244	c.145G>A	c.(145-147)Gaa>Aaa	p.E49K	GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.E49K|GRM3_ENST00000394720.2_Missense_Mutation_p.E47K|GRM3_ENST00000536043.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	49					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.E49K(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TCCTATTAACGAAAAAGGCAC	0.408																																					p.E49K	GBM(52;969 1098 3139 52280)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G145A	7						.						114.0	115.0	114.0					7																	86394606		2203	4300	6503	86232542	SO:0001583	missense	2913	exon2				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.145G>A	7.37:g.86394606G>A	ENSP00000355316:p.Glu49Lys		86232542	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	ENST00000361669.2	37	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900098	0.72754	.	.	ENSG00000198822	ENST00000361669;ENST00000439827;ENST00000394720;ENST00000421579;ENST00000441140	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.75012	0.3792	L	0.58583	1.82	0.80722	D	1	D;P	0.53312	0.959;0.828	B;B	0.36378	0.223;0.219	T	0.75706	-0.3224	10	0.26408	T	0.33	.	17.9854	0.89154	0.0:0.0:1.0:0.0	.	49;49	G5E9K2;Q14832	.;GRM3_HUMAN	K	49;49;47;49;49	ENSP00000355316:E49K;ENSP00000398767:E49K;ENSP00000378209:E47K;ENSP00000390037:E49K;ENSP00000407490:E49K	ENSP00000355316:E49K	E	+	1	0	GRM3	86232542	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.692000	0.84203	2.732000	0.93576	0.655000	0.94253	GAA		0.408	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		
DYNC1I1	1780	broad.mit.edu	37	7	95665000	95665000	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:95665000G>C	ENST00000324972.6	+	13	1544	c.1351G>C	c.(1351-1353)Gac>Cac	p.D451H	DYNC1I1_ENST00000447467.2_Missense_Mutation_p.D434H|DYNC1I1_ENST00000497626.1_3'UTR|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.D414H|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.D431H|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.D434H|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.D414H	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	451					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.D451H(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CCCAACGGGAGACGTCAATAA	0.468																																					p.D451H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1351C	7						.						316.0	254.0	275.0					7																	95665000		2203	4300	6503	95502936	SO:0001583	missense	1780	exon13			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1351G>C	7.37:g.95665000G>C	ENSP00000320130:p.Asp451His		95502936	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	37	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096306	0.56075	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.1	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90140	0.6919	M	0.88450	2.955	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0	D;D;D;D;D	0.77557	0.977;0.99;0.99;0.985;0.99	D	0.91353	0.5106	10	0.72032	D	0.01	-3.803	19.0933	0.93238	0.0:0.0:1.0:0.0	.	434;431;434;451;414	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	H	434;451;414;431;414;434	ENSP00000392337:D434H;ENSP00000320130:D451H;ENSP00000438377:D414H;ENSP00000398118:D431H;ENSP00000352348:D414H;ENSP00000412444:D434H	ENSP00000320130:D451H	D	+	1	0	DYNC1I1	95502936	1.000000	0.71417	0.999000	0.59377	0.024000	0.10985	9.657000	0.98554	2.830000	0.97506	0.585000	0.79938	GAC		0.468	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
NPTX2	4885	broad.mit.edu	37	7	98257841	98257841	+	Missense_Mutation	SNP	C	C	G	rs553029244		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:98257841C>G	ENST00000265634.3	+	5	1361	c.1196C>G	c.(1195-1197)cCg>cGg	p.P399R		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	399	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.P399R(1)		breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			ACAAACATGCCGGGCAACATC	0.562																																					p.P399R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1196G	7						.						94.0	76.0	82.0					7																	98257841		2203	4300	6503	98095777	SO:0001583	missense	4885	exon5				CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.1196C>G	7.37:g.98257841C>G	ENSP00000265634:p.Pro399Arg		98095777	NM_002523	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	ENST00000265634.3	37	CCDS5657.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159711	0.78226	.	.	ENSG00000106236	ENST00000265634	T	0.06142	3.34	5.94	5.94	0.96194	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.192567	0.56097	D	0.000024	T	0.11324	0.0276	N	0.16368	0.405	0.80722	D	1	D	0.62365	0.991	D	0.64144	0.922	T	0.35151	-0.9800	10	0.08179	T	0.78	-16.6299	19.3514	0.94389	0.0:1.0:0.0:0.0	.	399	P47972	NPTX2_HUMAN	R	399	ENSP00000265634:P399R	ENSP00000265634:P399R	P	+	2	0	NPTX2	98095777	1.000000	0.71417	0.869000	0.34112	0.989000	0.77384	6.077000	0.71275	2.826000	0.97356	0.561000	0.74099	CCG		0.562	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334982.1	NM_002523	
DOCK4	9732	broad.mit.edu	37	7	111462470	111462470	+	Missense_Mutation	SNP	G	G	A	rs186031092	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr7:111462470G>A	ENST00000437633.1	-	27	3134	c.2878C>T	c.(2878-2880)Cgc>Tgc	p.R960C	DOCK4-AS1_ENST00000452714.1_RNA|DOCK4_ENST00000428084.1_Missense_Mutation_p.R960C	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	960					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)	p.R948C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				ATCTCCGGGCGTATCAATATT	0.368																																					p.R960C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2878T	7						.						84.0	76.0	79.0					7																	111462470		1853	4091	5944	111249706	SO:0001583	missense	9732	exon27				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.2878C>T	7.37:g.111462470G>A	ENSP00000404179:p.Arg960Cys		111249706	NM_014705	O14584|O94824|Q8NB45	Missense_Mutation	SNP	ENST00000437633.1	37	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440123	0.83993	.	.	ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250	T;T	0.65916	-0.18;-0.18	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.73666	0.3616	M	0.69823	2.125	0.80722	D	1	D;D;D	0.71674	0.997;0.997;0.998	P;P;P	0.58520	0.776;0.696;0.84	T	0.76113	-0.3078	10	0.62326	D	0.03	.	13.3017	0.60328	0.0:0.0:0.8415:0.1585	.	996;960;960	Q149N5;Q8N1I0;Q8N1I0-2	.;DOCK4_HUMAN;.	C	948;960;960;948;959	ENSP00000410746:R960C;ENSP00000404179:R960C	ENSP00000345432:R948C	R	-	1	0	DOCK4	111249706	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.351000	0.59398	2.614000	0.88457	0.650000	0.86243	CGC		0.368	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	
SOGA1	140710	broad.mit.edu	37	20	35431473	35431473	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr20:35431473G>A	ENST00000357779.3	-	11	2737	c.2411C>T	c.(2410-2412)gCa>gTa	p.A804V	SOGA1_ENST00000279034.6_Missense_Mutation_p.A804V|SOGA1_ENST00000237536.4_Missense_Mutation_p.A1042V|SOGA1_ENST00000456801.2_Missense_Mutation_p.A645V			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	804					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A804V(1)		endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						GTCGGGCCCTGCCCGCTCCCC	0.642																																					p.A1042V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3125T	20						.						17.0	20.0	19.0					20																	35431473		2135	4248	6383	34864887	SO:0001583	missense	140710	exon11			AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.2411C>T	20.37:g.35431473G>A	ENSP00000350424:p.Ala804Val		34864887	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	G	9.893	1.204711	0.22205	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.18174	2.23;2.23;2.24;2.24	5.58	4.63	0.57726	.	0.861437	0.10477	N	0.670105	T	0.13543	0.0328	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23904	-1.0175	10	0.33940	T	0.23	3.1044	13.6715	0.62427	0.076:0.0:0.924:0.0	.	804	O94964-4	.	V	1042;804;645;804	ENSP00000237536:A1042V;ENSP00000279034:A804V;ENSP00000413886:A645V;ENSP00000350424:A804V	ENSP00000237536:A1042V	A	-	2	0	KIAA0889	34864887	0.100000	0.21855	0.008000	0.14137	0.232000	0.25224	2.735000	0.47377	1.357000	0.45904	0.563000	0.77884	GCA		0.642	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
RASSF2	9770	broad.mit.edu	37	20	4776522	4776522	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr20:4776522G>A	ENST00000379400.3	-	5	421	c.226C>T	c.(226-228)Cgc>Tgc	p.R76C	RASSF2_ENST00000379376.2_Missense_Mutation_p.R76C|RASSF2_ENST00000478553.1_5'Flank	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2	76					bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R76C(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						GGTCGAATGCGTTCGTTGTCA	0.617																																					p.R76C	Melanoma(158;1891 3343 50738)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C226T	20						.						133.0	123.0	127.0					20																	4776522		2203	4300	6503	4724522	SO:0001583	missense	9770	exon4			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.226C>T	20.37:g.4776522G>A	ENSP00000368710:p.Arg76Cys		4724522	NM_170774	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	Missense_Mutation	SNP	ENST00000379400.3	37	CCDS13083.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545666	0.65198	.	.	ENSG00000101265	ENST00000379400;ENST00000379376	T;T	0.10960	2.82;2.82	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.31040	0.0784	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	P	0.62885	0.908	T	0.01500	-1.1339	10	0.35671	T	0.21	.	12.4217	0.55524	0.0:0.0:0.8321:0.1678	.	76	P50749	RASF2_HUMAN	C	76	ENSP00000368710:R76C;ENSP00000368684:R76C	ENSP00000368684:R76C	R	-	1	0	RASSF2	4724522	1.000000	0.71417	0.997000	0.53966	0.489000	0.33432	5.022000	0.64078	2.665000	0.90641	0.563000	0.77884	CGC		0.617	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077828.1	NM_014737	
SEMG2	6407	broad.mit.edu	37	20	43851702	43851702	+	Nonsense_Mutation	SNP	C	C	T	rs546357756		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr20:43851702C>T	ENST00000372769.3	+	2	1519	c.1429C>T	c.(1429-1431)Cga>Tga	p.R477*		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	477	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)	p.R477*(1)		autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				AGAAGAAAGACGACTCAACTA	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		23707	0.0		0.0	False		,,,				2504	0.0				p.R477X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1429T	20						.						80.0	80.0	80.0					20																	43851702		2203	4300	6503	43285116	SO:0001587	stop_gained	6407	exon2				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1429C>T	20.37:g.43851702C>T	ENSP00000361855:p.Arg477*		43285116	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Nonsense_Mutation	SNP	ENST00000372769.3	37	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.686047	0.47991	.	.	ENSG00000124157	ENST00000372769	.	.	.	1.38	-2.06	0.07298	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	1.7879	0.03045	0.2797:0.3394:0.0:0.3808	.	.	.	.	X	477	.	ENSP00000361855:R477X	R	+	1	2	SEMG2	43285116	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.664000	0.05292	-0.689000	0.05149	-0.182000	0.12963	CGA		0.393	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
LRRC16B	90668	broad.mit.edu	37	14	24533523	24533523	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr14:24533523C>T	ENST00000342740.5	+	32	3202	c.3048C>T	c.(3046-3048)ttC>ttT	p.F1016F	LRRC16B_ENST00000334420.7_Silent_p.F112F	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1016						cytoplasm (GO:0005737)		p.F1016F(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		TGGAGGACTTCTTCAGCCGAA	0.587																																					p.F1016F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3048T	14						.						69.0	57.0	61.0					14																	24533523		2203	4300	6503	23603363	SO:0001819	synonymous_variant	90668	exon32			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.3048C>T	14.37:g.24533523C>T			23603363	NM_138360	Q8TEF7|Q96HS9	Silent	SNP	ENST00000342740.5	37	CCDS32054.1																																																																																				0.587	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
CECR1	51816	broad.mit.edu	37	22	17672656	17672656	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr22:17672656C>T	ENST00000399839.1	-	5	1068	c.798G>A	c.(796-798)gtG>gtA	p.V266V	CECR1_ENST00000330232.4_Silent_p.V25V|CECR1_ENST00000480276.1_5'UTR|CECR1_ENST00000449907.2_Silent_p.V224V|CECR1_ENST00000399837.2_Silent_p.V266V|CECR1_ENST00000262607.3_Silent_p.V266V	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	266					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)	p.V266V(1)		endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GGTAAGTCTTCACTGACCACT	0.488																																					p.V25V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G75A	22						.						153.0	146.0	148.0					22																	17672656		2203	4300	6503	16052656	SO:0001819	synonymous_variant	51816	exon2			AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.798G>A	22.37:g.17672656C>T			16052656	NM_177405	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Silent	SNP	ENST00000399839.1	37	CCDS13742.1																																																																																				0.488	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1		
MMP11	4320	broad.mit.edu	37	22	24122836	24122836	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr22:24122836A>G	ENST00000215743.3	+	4	602	c.550A>G	c.(550-552)Aag>Gag	p.K184E	MMP11_ENST00000477567.1_3'UTR	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	184					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.K184E(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	CTTCTTCCCCAAGACTCACCG	0.612																																					p.K184E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A550G	22						.						67.0	65.0	66.0					22																	24122836		2203	4300	6503	22452836	SO:0001583	missense	4320	exon4				CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.550A>G	22.37:g.24122836A>G	ENSP00000215743:p.Lys184Glu		22452836	NM_005940	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	ENST00000215743.3	37	CCDS13816.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.313137	0.81358	.	.	ENSG00000099953	ENST00000215743	T	0.13657	2.57	4.33	4.33	0.51752	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.092863	0.64402	D	0.000001	T	0.08358	0.0208	N	0.05510	-0.035	0.58432	D	0.999992	P	0.48640	0.913	B	0.41174	0.349	T	0.22906	-1.0203	10	0.72032	D	0.01	.	13.7466	0.62879	1.0:0.0:0.0:0.0	.	184	P24347	MMP11_HUMAN	E	184	ENSP00000215743:K184E	ENSP00000215743:K184E	K	+	1	0	MMP11	22452836	0.999000	0.42202	0.999000	0.59377	0.976000	0.68499	4.209000	0.58493	2.193000	0.70182	0.529000	0.55759	AAG		0.612	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319891.2	NM_005940	
DNASE2	1777	broad.mit.edu	37	19	12989212	12989212	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:12989212G>A	ENST00000222219.3	-	5	785	c.693C>T	c.(691-693)ttC>ttT	p.F231F	CTD-2265O21.7_ENST00000592400.1_RNA|DNASE2_ENST00000538460.1_Silent_p.F176F	NM_001375.2	NP_001366.1	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal	231					apoptotic DNA fragmentation (GO:0006309)|DNA metabolic process (GO:0006259)|erythrocyte differentiation (GO:0030218)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|lysosome (GO:0005764)	deoxyribonuclease II activity (GO:0004531)|DNA binding (GO:0003677)	p.F231F(1)		breast(1)|large_intestine(1)|lung(4)|ovary(1)	7						CAAATTTGCTGAACTTGGCAA	0.547																																					p.F231F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C693T	19						.						99.0	112.0	107.0					19																	12989212		2203	4300	6503	12850212	SO:0001819	synonymous_variant	1777	exon5			AF045937	CCDS12284.1	19p13.2	2012-10-02			ENSG00000105612	ENSG00000105612	3.1.22.1		2960	protein-coding gene	gene with protein product		126350		DNL, DNL2		1586130	Standard	NM_001375		Approved		uc002mvn.1	O00115		ENST00000222219.3:c.693C>T	19.37:g.12989212G>A			12850212	NM_001375	B2RD06|B7Z4K6|O43910	Silent	SNP	ENST00000222219.3	37	CCDS12284.1																																																																																				0.547	DNASE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451790.1		
ZNF568	374900	broad.mit.edu	37	19	37440531	37440531	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:37440531C>T	ENST00000333987.7	+	7	982	c.476C>T	c.(475-477)gCg>gTg	p.A159V	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.A95V	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A159V(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAAAAGTTGCGAAAATATTT	0.348																																					p.A159V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C476T	19						.						76.0	70.0	72.0					19																	37440531		1825	4083	5908	42132371	SO:0001583	missense	374900	exon7			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.476C>T	19.37:g.37440531C>T	ENSP00000334685:p.Ala159Val		42132371	NM_198539	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	37	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	C	9.086	1.000416	0.19121	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.07800	3.16;3.16	4.17	1.88	0.25563	.	0.995063	0.08135	N	0.992462	T	0.05960	0.0155	L	0.27053	0.805	0.09310	N	1	B	0.32781	0.384	B	0.21546	0.035	T	0.37753	-0.9692	10	0.66056	D	0.02	.	6.6885	0.23158	0.3643:0.4583:0.1774:0.0	.	159	Q3ZCX4	ZN568_HUMAN	V	159;95	ENSP00000334685:A159V;ENSP00000394514:A95V	ENSP00000334685:A159V	A	+	2	0	ZNF568	42132371	0.000000	0.05858	0.029000	0.17559	0.797000	0.45037	-0.560000	0.05964	0.442000	0.26555	0.655000	0.94253	GCG		0.348	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
ZNF570	148268	broad.mit.edu	37	19	37975202	37975202	+	Silent	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:37975202C>G	ENST00000330173.1	+	5	1207	c.678C>G	c.(676-678)gtC>gtG	p.V226V	ZNF570_ENST00000388801.3_Silent_p.V23V|ZNF570_ENST00000586475.1_Silent_p.V282V	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V226V(1)		endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTGAAAAAGTCTTCAGCCAGA	0.363																																					p.V226V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C678G	19						.						111.0	129.0	123.0					19																	37975202		2203	4299	6502	42667042	SO:0001819	synonymous_variant	148268	exon5			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.678C>G	19.37:g.37975202C>G			42667042	NM_144694	A1L472|B4DMP1	Silent	SNP	ENST00000330173.1	37	CCDS12504.1																																																																																				0.363	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1	NM_144694	
ZNF607	84775	broad.mit.edu	37	19	38190600	38190600	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:38190600A>C	ENST00000355202.4	-	5	1027	c.432T>G	c.(430-432)tgT>tgG	p.C144W	ZNF607_ENST00000395835.3_Missense_Mutation_p.C143W|CTD-2528L19.4_ENST00000586606.2_Intron	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C144W(1)		cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			TAAACTTTTCACATTGATCAG	0.373																																					p.C144W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T432G	19						.						148.0	146.0	147.0					19																	38190600		2203	4300	6503	42882440	SO:0001583	missense	84775	exon5			AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.432T>G	19.37:g.38190600A>C	ENSP00000347338:p.Cys144Trp		42882440	NM_032689	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	ENST00000355202.4	37	CCDS33006.1	.	.	.	.	.	.	.	.	.	.	A	6.081	0.383188	0.11524	.	.	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.40225	1.04;1.04	2.1	2.1	0.27182	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71736	0.3375	H	0.97682	4.055	0.21822	N	0.999521	D;D	0.89917	0.993;1.0	P;D	0.91635	0.858;0.999	T	0.59327	-0.7475	9	0.87932	D	0	.	5.2394	0.15464	0.8403:0.0:0.1597:0.0	.	144;143	Q96SK3;F5H141	ZN607_HUMAN;.	W	144;143	ENSP00000347338:C144W;ENSP00000438015:C143W	ENSP00000347338:C144W	C	-	3	2	ZNF607	42882440	0.001000	0.12720	0.026000	0.17262	0.012000	0.07955	-0.124000	0.10595	0.952000	0.37798	0.459000	0.35465	TGT		0.373	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689	
RYR1	6261	broad.mit.edu	37	19	38987109	38987109	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:38987109A>G	ENST00000359596.3	+	41	6724	c.6724A>G	c.(6724-6726)Atc>Gtc	p.I2242V	RYR1_ENST00000355481.4_Missense_Mutation_p.I2242V|RYR1_ENST00000360985.3_Missense_Mutation_p.I2242V			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2242	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.I2242V(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTTCTGCCGAATCAGCCGGCA	0.627																																					p.I2242V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A6724G	19						.						49.0	52.0	51.0					19																	38987109		2203	4300	6503	43678949	SO:0001583	missense	6261	exon41			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.6724A>G	19.37:g.38987109A>G	ENSP00000352608:p.Ile2242Val		43678949	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.434978	0.43224	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.88818	-2.43;-2.43;-2.43	4.91	4.91	0.64330	Intracellular calcium-release channel (1);	0.000000	0.64402	U	0.000002	D	0.92734	0.7690	L	0.56769	1.78	0.45172	D	0.998182	P;D	0.53151	0.948;0.958	D;D	0.70716	0.949;0.97	D	0.93328	0.6698	10	0.66056	D	0.02	.	14.3703	0.66836	1.0:0.0:0.0:0.0	.	2242;2242	P21817-2;P21817	.;RYR1_HUMAN	V	2242	ENSP00000352608:I2242V;ENSP00000347667:I2242V;ENSP00000354254:I2242V	ENSP00000347667:I2242V	I	+	1	0	RYR1	43678949	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.139000	0.94554	2.061000	0.61500	0.454000	0.30748	ATC		0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
CYP2A6	1548	broad.mit.edu	37	19	41355745	41355746	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:41355745_41355746GA>TT	ENST00000301141.5	-	2	340_341	c.320_321TC>AA	c.(319-321)tTC>tAA	p.F107*	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	107					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.F107>?(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGACCCAGTCGAAGGTGGCTTG	0.644																																					.												.	.	1	Complex(1)	large_intestine(1)	c.320_321AA	19						.																																			46047586	SO:0001587	stop_gained	1548	exon2			AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.320_321delinsTT	19.37:g.41355745_41355746delinsTT	ENSP00000301141:p.Phe107*		46047585	NM_000762	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Nonsense_Mutation	DNP	ENST00000301141.5	37	CCDS12568.1																																																																																				0.644	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
ARHGAP35	2909	broad.mit.edu	37	19	47424699	47424699	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:47424699C>A	ENST00000404338.3	+	1	2767	c.2767C>A	c.(2767-2769)Ccc>Acc	p.P923T		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	923					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)	p.P923T(1)									CACAAGCATCCCCTGTAGCCA	0.433																																					p.P923T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2767A	19						.						119.0	118.0	118.0					19																	47424699		1919	4136	6055	52116539	SO:0001583	missense	2909	exon1			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2767C>A	19.37:g.47424699C>A	ENSP00000385720:p.Pro923Thr		52116539	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	C	2.644	-0.283492	0.05642	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.06449	3.3	5.79	5.79	0.91817	.	0.237636	0.43110	D	0.000604	T	0.06508	0.0167	L	0.29908	0.895	0.39034	D	0.960002	B	0.28933	0.228	B	0.25614	0.062	T	0.45293	-0.9271	10	0.16896	T	0.51	-25.8602	18.8035	0.92028	0.0:1.0:0.0:0.0	.	923	Q9NRY4-2	.	T	923	ENSP00000385720:P923T	ENSP00000324820:P923T	P	+	1	0	ARHGAP35	52116539	0.081000	0.21417	1.000000	0.80357	0.995000	0.86356	0.875000	0.28079	2.743000	0.94032	0.655000	0.94253	CCC		0.433	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
GLTSCR1	29998	broad.mit.edu	37	19	48198221	48198221	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:48198221C>A	ENST00000396720.3	+	9	3154	c.2960C>A	c.(2959-2961)aCc>aAc	p.T987N	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	987								p.T987N(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CAGACCTCCACCAGCCTGGGG	0.726																																					p.T987N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2960A	19						.						9.0	11.0	11.0					19																	48198221		1810	4044	5854	52890033	SO:0001583	missense	29998	exon9			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.2960C>A	19.37:g.48198221C>A	ENSP00000379946:p.Thr987Asn		52890033	NM_015711	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	C	3.975	-0.007611	0.07773	.	.	ENSG00000063169	ENST00000396720	T	0.35605	1.3	3.43	1.21	0.21127	.	.	.	.	.	T	0.19446	0.0467	N	0.14661	0.345	0.09310	N	1	B	0.29716	0.255	B	0.31812	0.136	T	0.26643	-1.0097	9	0.25106	T	0.35	.	5.8355	0.18605	0.0:0.732:0.0:0.268	.	987	Q9NZM4	GSCR1_HUMAN	N	987	ENSP00000379946:T987N	ENSP00000379946:T987N	T	+	2	0	GLTSCR1	52890033	0.031000	0.19500	0.790000	0.31976	0.020000	0.10135	1.131000	0.31406	0.111000	0.17947	0.313000	0.20887	ACC		0.726	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
TPRX1	284355	broad.mit.edu	37	19	48305873	48305873	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:48305873G>T	ENST00000322175.3	-	2	550	c.395C>A	c.(394-396)cCa>cAa	p.P132Q	TPRX1_ENST00000543508.1_Missense_Mutation_p.P132Q|TPRX1_ENST00000535759.1_Missense_Mutation_p.P229Q	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	132	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P132Q(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gattggggctgggatcgggct	0.652																																					p.P132Q	Esophageal Squamous(123;175 2281 3051 32395)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C395A	19						.						19.0	17.0	18.0					19																	48305873		2078	4084	6162	52997685	SO:0001583	missense	284355	exon2				CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.395C>A	19.37:g.48305873G>T	ENSP00000323455:p.Pro132Gln		52997685	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	g	0.306	-0.970557	0.02232	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.59364	0.27;0.27;0.27	0.383	-0.766	0.11020	.	.	.	.	.	T	0.31327	0.0793	N	0.19112	0.55	0.09310	N	1	B	0.30361	0.277	B	0.20955	0.032	T	0.09400	-1.0676	8	0.42905	T	0.14	.	.	.	.	.	132	Q8N7U7	TPRX1_HUMAN	Q	132;229;132	ENSP00000323455:P132Q;ENSP00000438832:P229Q;ENSP00000438712:P132Q	ENSP00000323455:P132Q	P	-	2	0	TPRX1	52997685	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.540000	0.06106	-1.947000	0.01034	-2.005000	0.00442	CCA		0.652	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
ZNF528	84436	broad.mit.edu	37	19	52919663	52919663	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:52919663C>T	ENST00000360465.3	+	7	1984	c.1558C>T	c.(1558-1560)Cct>Tct	p.P520S	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P520S(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AGGAGAAAAGCCTTACAAATG	0.388																																					p.P520S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1558T	19						.						58.0	56.0	57.0					19																	52919663		2203	4300	6503	57611475	SO:0001583	missense	84436	exon7			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1558C>T	19.37:g.52919663C>T	ENSP00000353652:p.Pro520Ser		57611475	NM_032423	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	37	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	C	10.07	1.248455	0.22880	.	.	ENSG00000167555	ENST00000360465	T	0.28454	1.61	1.83	1.83	0.25207	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38692	0.1050	L	0.60455	1.87	0.23906	N	0.996502	D	0.54047	0.964	P	0.50659	0.647	T	0.19647	-1.0299	9	0.66056	D	0.02	.	10.6285	0.45521	0.0:1.0:0.0:0.0	.	520	Q3MIS6	ZN528_HUMAN	S	520	ENSP00000353652:P520S	ENSP00000353652:P520S	P	+	1	0	ZNF528	57611475	0.720000	0.27996	0.389000	0.26208	0.041000	0.13682	3.121000	0.50438	0.986000	0.38683	0.557000	0.71058	CCT		0.388	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
LILRB5	10990	broad.mit.edu	37	19	54758749	54758749	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:54758749C>A	ENST00000316219.5	-	6	1211	c.1104G>T	c.(1102-1104)aaG>aaT	p.K368N	LILRB5_ENST00000450632.1_Missense_Mutation_p.K359N|LILRB5_ENST00000345866.6_Missense_Mutation_p.K268N|LILRB5_ENST00000449561.2_Missense_Mutation_p.K368N	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	368	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.K359N(1)|p.K368N(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGTACTTTGACTTTAGACACA	0.532																																					p.K368N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1104T	19						.						85.0	81.0	83.0					19																	54758749		2203	4300	6503	59450561	SO:0001583	missense	10990	exon6			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1104G>T	19.37:g.54758749C>A	ENSP00000320390:p.Lys368Asn		59450561	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	37	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.601172	0.28534	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.02916	4.11;4.11;4.11;4.11	3.08	-5.73	0.02398	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.716310	0.01649	N	0.024453	T	0.04363	0.0120	L	0.31526	0.94	0.09310	N	1	B;P;P;B;B	0.50443	0.1;0.888;0.935;0.01;0.033	B;P;P;B;B	0.53954	0.06;0.698;0.738;0.015;0.026	T	0.29792	-1.0000	10	0.87932	D	0	.	2.2052	0.03934	0.1853:0.4592:0.1554:0.2002	.	359;259;268;368;368	C9JMK7;Q8NF80;O75023-2;O75023-3;O75023	.;.;.;.;LIRB5_HUMAN	N	368;359;368;268	ENSP00000320390:K368N;ENSP00000414225:K359N;ENSP00000406478:K368N;ENSP00000263430:K268N	ENSP00000320390:K368N	K	-	3	2	LILRB5	59450561	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.210000	0.00273	-1.341000	0.02225	-0.510000	0.04470	AAG		0.532	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
EPN1	29924	broad.mit.edu	37	19	56204103	56204103	+	Missense_Mutation	SNP	C	C	T	rs370785243		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:56204103C>T	ENST00000270460.6	+	8	1429	c.1118C>T	c.(1117-1119)cCg>cTg	p.P373L	EPN1_ENST00000411543.2_Missense_Mutation_p.P459L|AC010525.4_ENST00000585559.1_RNA|EPN1_ENST00000085079.7_Missense_Mutation_p.P348L	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	373	8 X 3 AA repeats of [ED]-P-W.|Ala/Gly/Pro-rich.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.P459L(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		ACACCGGCCCCGGCCTTCTCA	0.662																																					p.P373L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1118T	19						.	C	LEU/PRO,LEU/PRO,LEU/PRO	0,3824		0,0,1912	12.0	15.0	14.0		1376,1118,1043	2.2	0.1	19		14	1,8225		0,1,4112	no	missense,missense,missense	EPN1	NM_001130071.1,NM_001130072.1,NM_013333.3	98,98,98	0,1,6024	TT,TC,CC		0.0122,0.0,0.0083	probably-damaging,probably-damaging,probably-damaging	459/663,373/577,348/551	56204103	1,12049	1912	4113	6025	60895915	SO:0001583	missense	29924	exon8			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.1118C>T	19.37:g.56204103C>T	ENSP00000270460:p.Pro373Leu		60895915	NM_001130072	Q86ST3|Q9HA18	Missense_Mutation	SNP	ENST00000270460.6	37	CCDS46199.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320881	0.23994	0.0	1.22E-4	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.15952	2.45;2.4;2.38	3.3	2.22	0.28083	.	0.259012	0.31784	N	0.007065	T	0.13884	0.0336	L	0.48642	1.525	0.37982	D	0.933632	B;P;B;D	0.54047	0.249;0.876;0.249;0.964	B;B;B;B	0.40825	0.019;0.124;0.019;0.341	T	0.17899	-1.0354	10	0.25106	T	0.35	-17.6055	10.8229	0.46614	0.1914:0.8086:0.0:0.0	.	334;459;373;348	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	L	373;348;334;459	ENSP00000270460:P373L;ENSP00000085079:P348L;ENSP00000406209:P459L	ENSP00000085079:P348L	P	+	2	0	EPN1	60895915	0.157000	0.22836	0.121000	0.21740	0.002000	0.02628	3.220000	0.51207	0.710000	0.31997	-0.521000	0.04368	CCG		0.662	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453610.1	NM_013333	
ZNF582	147948	broad.mit.edu	37	19	56896345	56896345	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:56896345T>G	ENST00000301310.4	-	5	599	c.441A>C	c.(439-441)gaA>gaC	p.E147D	ZNF582_ENST00000586929.1_Missense_Mutation_p.E147D|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E147D(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TGGGCATTTCTTCATGTCTGA	0.368																																					p.E147D	Ovarian(183;1887 2032 4349 30507 51343)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A441C	19						.						150.0	148.0	149.0					19																	56896345		2203	4300	6503	61588157	SO:0001583	missense	147948	exon5			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.441A>C	19.37:g.56896345T>G	ENSP00000301310:p.Glu147Asp		61588157	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	ENST00000301310.4	37	CCDS33121.1	.	.	.	.	.	.	.	.	.	.	T	13.59	2.281391	0.40394	.	.	ENSG00000018869	ENST00000301310	T	0.06142	3.34	4.23	3.21	0.36854	.	0.218000	0.23298	N	0.049714	T	0.07548	0.0190	L	0.48642	1.525	0.09310	N	1	P;P	0.47409	0.895;0.895	P;P	0.44518	0.452;0.452	T	0.19582	-1.0301	10	0.54805	T	0.06	.	6.7391	0.23424	0.0:0.106:0.0:0.894	.	147;178	Q96NG8;B4DQZ9	ZN582_HUMAN;.	D	147	ENSP00000301310:E147D	ENSP00000301310:E147D	E	-	3	2	ZNF582	61588157	0.724000	0.28038	0.007000	0.13788	0.254000	0.26022	0.054000	0.14205	0.941000	0.37499	0.482000	0.46254	GAA		0.368	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
MUC16	94025	broad.mit.edu	37	19	9082718	9082718	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:9082718T>A	ENST00000397910.4	-	1	9300	c.9097A>T	c.(9097-9099)Agc>Tgc	p.S3033C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3034	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S3033C(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGATAGGCTTATGGGAGAG	0.493																																					p.S3033C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A9097T	19						.						111.0	110.0	111.0					19																	9082718		2033	4196	6229	8943718	SO:0001583	missense	94025	exon1			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.9097A>T	19.37:g.9082718T>A	ENSP00000381008:p.Ser3033Cys		8943718	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	2.649	-0.282421	0.05642	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.541	0.541	0.17168	.	.	.	.	.	T	0.04182	0.0116	N	0.08118	0	.	.	.	D	0.67145	0.996	D	0.65773	0.938	T	0.45659	-0.9246	7	0.87932	D	0	.	.	.	.	.	3033	B5ME49	.	C	3033	ENSP00000381008:S3033C	ENSP00000381008:S3033C	S	-	1	0	MUC16	8943718	0.002000	0.14202	0.116000	0.21606	0.082000	0.17680	0.084000	0.14891	0.441000	0.26529	0.260000	0.18958	AGC		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF266	10781	broad.mit.edu	37	19	9524696	9524696	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:9524696C>A	ENST00000592904.1	-	5	2981	c.905G>T	c.(904-906)gGg>gTg	p.G302V	ZNF266_ENST00000361151.1_Missense_Mutation_p.G302V|ZNF266_ENST00000361451.2_Missense_Mutation_p.G302V|ZNF266_ENST00000588221.1_Missense_Mutation_p.G302V|ZNF266_ENST00000592292.1_Missense_Mutation_p.G302V|ZNF266_ENST00000590306.1_Missense_Mutation_p.G302V|ZNF266_ENST00000588933.1_Missense_Mutation_p.G302V			Q14584	ZN266_HUMAN	zinc finger protein 266	302					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G302V(1)		NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						GAAGGCTATCCCACATTCCTT	0.378																																					p.G302V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G905T	19						.						110.0	108.0	109.0					19																	9524696		2203	4300	6503	9385696	SO:0001583	missense	10781	exon11			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.905G>T	19.37:g.9524696C>A	ENSP00000466714:p.Gly302Val		9385696	NM_006631	A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	ENST00000592904.1	37	CCDS12213.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322015	0.60634	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	T;T	0.07567	3.18;3.18	2.53	2.53	0.30540	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36248	0.0960	H	0.94503	3.545	0.46564	D	0.999101	D	0.89917	1.0	D	0.87578	0.998	T	0.50074	-0.8870	9	0.72032	D	0.01	.	11.1769	0.48606	0.0:1.0:0.0:0.0	.	302	Q14584	ZN266_HUMAN	V	302	ENSP00000354680:G302V;ENSP00000355047:G302V	ENSP00000355047:G302V	G	-	2	0	ZNF266	9385696	0.026000	0.19158	0.506000	0.27664	0.244000	0.25665	0.208000	0.17415	1.727000	0.51537	0.555000	0.69702	GGG		0.378	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449033.1		
ZIM3	114026	broad.mit.edu	37	19	57646504	57646504	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr19:57646504A>G	ENST00000269834.1	-	5	1586	c.1201T>C	c.(1201-1203)Ttt>Ctt	p.F401L	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	401					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F401L(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GACTTCTGAAAGAAGGCTTTT	0.378																																					p.F401L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1201C	19						.						142.0	145.0	144.0					19																	57646504		2203	4300	6503	62338316	SO:0001583	missense	114026	exon5			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.1201T>C	19.37:g.57646504A>G	ENSP00000269834:p.Phe401Leu		62338316	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	37	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	A	0.088	-1.171461	0.01660	.	.	ENSG00000141946	ENST00000269834	T	0.32023	1.47	2.71	-5.43	0.02632	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09468	0.0233	N	0.03029	-0.43	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20874	-1.0262	9	0.62326	D	0.03	.	0.8516	0.01173	0.3547:0.1318:0.1194:0.3941	.	401	Q96PE6	ZIM3_HUMAN	L	401	ENSP00000269834:F401L	ENSP00000269834:F401L	F	-	1	0	ZIM3	62338316	0.000000	0.05858	0.004000	0.12327	0.090000	0.18270	-6.358000	0.00069	-1.173000	0.02758	-0.696000	0.03686	TTT		0.378	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
VPS13B	157680	broad.mit.edu	37	8	100520063	100520063	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:100520063T>G	ENST00000358544.2	+	28	4334	c.4223T>G	c.(4222-4224)cTg>cGg	p.L1408R	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Intron	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1408					protein transport (GO:0015031)			p.L1408R(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACTGACAAGCTGAACAGACGC	0.458																																					p.L1408R	Colon(161;2205 2542 7338 31318)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T4223G	8						.						205.0	174.0	184.0					8																	100520063		2203	4300	6503	100589239	SO:0001583	missense	157680	exon28			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4223T>G	8.37:g.100520063T>G	ENSP00000351346:p.Leu1408Arg		100589239	NM_017890	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	T	18.08	3.542809	0.65198	.	.	ENSG00000132549	ENST00000358544	T	0.54675	0.56	5.64	5.64	0.86602	.	0.171967	0.38436	N	0.001683	T	0.65544	0.2701	L	0.39898	1.24	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	T	0.68561	-0.5376	10	0.87932	D	0	.	15.8329	0.78773	0.0:0.0:0.0:1.0	.	1407;1408	Q7Z7G8-6;Q7Z7G8	.;VP13B_HUMAN	R	1408	ENSP00000351346:L1408R	ENSP00000351346:L1408R	L	+	2	0	VPS13B	100589239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.780000	0.85658	2.149000	0.67028	0.482000	0.46254	CTG		0.458	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
DCAF13	25879	broad.mit.edu	37	8	104453843	104453843	+	Missense_Mutation	SNP	G	G	A	rs139907413	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:104453843G>A	ENST00000297579.5	+	10	1980	c.1703G>A	c.(1702-1704)cGa>cAa	p.R568Q		NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	416					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.R568Q(1)		NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						GCTCGTCGACGAAAGTATGTT	0.393																																					p.R568Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1703A	8						.	G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	107.0	108.0		1703	5.4	0.3	8	dbSNP_134	108	3,8597	3.0+/-9.4	0,3,4297	yes	missense	DCAF13	NM_015420.6	43	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	probably-damaging	568/598	104453843	4,13002	2203	4300	6503	104523019	SO:0001583	missense	25879	exon10			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1703G>A	8.37:g.104453843G>A	ENSP00000297579:p.Arg568Gln		104523019	NM_015420	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	ENST00000297579.5	37	CCDS34934.1	.	.	.	.	.	.	.	.	.	.	G	35	5.567540	0.96540	2.27E-4	3.49E-4	ENSG00000164934	ENST00000297579	T	0.77620	-1.11	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.90752	0.7097	M	0.92833	3.35	0.80722	D	1	.	.	.	.	.	.	D	0.92716	0.6187	8	0.72032	D	0.01	-8.2276	17.4002	0.87458	0.0:0.0:1.0:0.0	.	.	.	.	Q	568	ENSP00000297579:R568Q	ENSP00000297579:R568Q	R	+	2	0	DCAF13	104523019	1.000000	0.71417	0.333000	0.25482	0.971000	0.66376	7.239000	0.78182	2.521000	0.84997	0.563000	0.77884	CGA		0.393	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2	NM_015420	
RIMS2	9699	broad.mit.edu	37	8	104709326	104709326	+	Silent	SNP	G	G	A	rs374844910	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:104709326G>A	ENST00000406091.3	+	2	189	c.189G>A	c.(187-189)caG>caA	p.Q63Q		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	94	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.Q99Q(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AACTGCATCAGCAGTTTGAAA	0.368										HNSCC(12;0.0054)			G|||	8	0.00159744	0.0061	0.0	5008	,	,		16531	0.0		0.0	False		,,,				2504	0.0				p.Q63Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G189A	8						.	G		10,3692		0,10,1841	56.0	55.0	55.0		189	3.3	1.0	8		55	0,8192		0,0,4096	no	coding-synonymous	RIMS2	NM_001100117.2		0,10,5937	AA,AG,GG		0.0,0.2701,0.0841		63/1350	104709326	10,11884	1851	4096	5947	104778502	SO:0001819	synonymous_variant	9699	exon2			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.189G>A	8.37:g.104709326G>A			104778502	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	ENST00000406091.3	37	CCDS55269.1																																																																																				0.368	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117	
RSPO2	340419	broad.mit.edu	37	8	108973016	108973016	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:108973016A>G	ENST00000276659.5	-	4	933	c.313T>C	c.(313-315)Ttt>Ctt	p.F105L	RSPO2_ENST00000517781.1_Missense_Mutation_p.F42L|RSPO2_ENST00000517939.1_Missense_Mutation_p.F38L|RSPO2_ENST00000378439.2_Missense_Mutation_p.F42L	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	105					bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)	p.F105L(1)	EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			TCTTTGCTAAAGCAAGAATCA	0.308																																					p.F105L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T313C	8						.						66.0	63.0	64.0					8																	108973016		2203	4300	6503	109042192	SO:0001583	missense	340419	exon4			AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.313T>C	8.37:g.108973016A>G	ENSP00000276659:p.Phe105Leu		109042192	NM_178565	B3KVP0|Q4G0U4|Q8N6X6	Missense_Mutation	SNP	ENST00000276659.5	37	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	A	33	5.275490	0.95459	.	.	ENSG00000147655	ENST00000517939;ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521502;ENST00000521757;ENST00000521956;ENST00000520026	D;D;D;D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	5.86	5.86	0.93980	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.87849	0.6281	L	0.37697	1.125	0.80722	D	1	D;P	0.56035	0.974;0.928	D;P	0.70487	0.969;0.718	D	0.84602	0.0673	10	0.17369	T	0.5	-11.451	16.261	0.82547	1.0:0.0:0.0:0.0	.	105;42	Q6UXX9;Q6UXX9-3	RSPO2_HUMAN;.	L	38;42;42;105;38;38;105;77	ENSP00000428940:F38L;ENSP00000427937:F42L;ENSP00000367698:F42L;ENSP00000276659:F105L;ENSP00000428614:F38L;ENSP00000430485:F38L;ENSP00000430010:F105L;ENSP00000429159:F77L	ENSP00000276659:F105L	F	-	1	0	RSPO2	109042192	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.279000	0.95777	2.246000	0.74042	0.445000	0.29226	TTT		0.308	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565	
LY6K	54742	broad.mit.edu	37	8	143784537	143784537	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:143784537G>A	ENST00000292430.6	+	3	663	c.246G>A	c.(244-246)gcG>gcA	p.A82A	CTD-2292P10.4_ENST00000520572.1_RNA|LY6K_ENST00000519387.1_Intron|LY6K_ENST00000519390.1_3'UTR|LY6K_ENST00000561179.1_Silent_p.A140A|LY6K_ENST00000522591.1_3'UTR			Q17RY6	LY6K_HUMAN	lymphocyte antigen 6 complex, locus K	82	UPAR/Ly6.					anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A140A(1)		NS(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)	10	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					TCATGGTTGCGAAGCAGTGCT	0.498																																					p.A82A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G246A	8						.						62.0	60.0	61.0					8																	143784537		2203	4300	6503	143781539	SO:0001819	synonymous_variant	54742	exon3			AK092545	CCDS6385.1, CCDS6385.2, CCDS59114.1	8q24.3	2009-08-06				ENSG00000160886			24225	protein-coding gene	gene with protein product	"""cancer/testis antigen 97"""	615093				12516096	Standard	NM_017527		Approved	HSJ001348, FLJ35226, CT97	uc011ljv.2	Q17RY6		ENST00000292430.6:c.246G>A	8.37:g.143784537G>A			143781539	NM_017527	G3V116|O15227|Q9BVD7	Silent	SNP	ENST00000292430.6	37	CCDS6385.2																																																																																				0.498	LY6K-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379893.2	NM_017527	
CSMD1	64478	broad.mit.edu	37	8	2808792	2808792	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:2808792A>G	ENST00000520002.1	-	67	10603	c.10048T>C	c.(10048-10050)Tca>Cca	p.S3350P	CSMD1_ENST00000542608.1_Missense_Mutation_p.S3172P|CSMD1_ENST00000602557.1_Missense_Mutation_p.S3350P|CSMD1_ENST00000400186.3_Missense_Mutation_p.S3173P|CSMD1_ENST00000537824.1_Missense_Mutation_p.S3349P|CSMD1_ENST00000602723.1_Missense_Mutation_p.S3173P			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3350						integral component of membrane (GO:0016021)		p.S3349P(1)|p.S3078P(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGACATCTGAAGGAACTGTG	0.418																																					p.F3349S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T10046C	8						.						41.0	40.0	41.0					8																	2808792		1919	4120	6039	2796199	SO:0001583	missense	64478	exon66					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10048T>C	8.37:g.2808792A>G	ENSP00000430733:p.Ser3350Pro		2796199	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.76|12.76	2.035145|2.035145	0.35893|0.35893	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	.|T;T;T;T	.|0.26518	.|1.73;1.85;1.88;1.73	5.29|5.29	4.11|4.11	0.48088|0.48088	.|.	.|0.183579	.|0.37955	.|N	.|0.001865	T|T	0.34077|0.34077	0.0885|0.0885	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|P;B;P	.|0.49961	.|0.93;0.017;0.883	.|B;B;P	.|0.52909	.|0.36;0.01;0.713	T|T	0.02138|0.02138	-1.1207|-1.1207	5|10	.|0.31617	.|T	.|0.26	.|.	12.272|12.272	0.54712|0.54712	0.8577:0.1423:0.0:0.0|0.8577:0.1423:0.0:0.0	.|.	.|3350;3350;3172	.|E5RIG2;Q96PZ7;F5H2I8	.|.;CSMD1_HUMAN;.	S|P	2751|3173;3350;3211;3349;3172	.|ENSP00000383047:S3173P;ENSP00000430733:S3350P;ENSP00000441462:S3349P;ENSP00000446243:S3172P	.|ENSP00000320445:S3211P	F|S	-|-	2|1	0|0	CSMD1|CSMD1	2796199|2796199	0.987000|0.987000	0.35691|0.35691	0.998000|0.998000	0.56505|0.56505	0.253000|0.253000	0.25986|0.25986	3.342000|3.342000	0.52159|0.52159	0.810000|0.810000	0.34279|0.34279	0.523000|0.523000	0.50628|0.50628	TTC|TCA		0.418	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ADAMDEC1	27299	broad.mit.edu	37	8	24256410	24256410	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:24256410A>C	ENST00000256412.4	+	9	1006	c.786A>C	c.(784-786)caA>caC	p.Q262H	ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.Q183H|ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.Q183H|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	262	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.Q262H(1)		NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		TAGATGTTCAAGTGGCCTTGG	0.428																																					p.Q183H	Ovarian(147;687 1849 3699 25981 31337)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A549C	8						.						108.0	105.0	106.0					8																	24256410		2203	4300	6503	24312355	SO:0001583	missense	27299	exon8			Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.786A>C	8.37:g.24256410A>C	ENSP00000256412:p.Gln262His		24312355	NM_001145272	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	37	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.754524	0.00663	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.63417	-0.04;-0.04;-0.04	5.87	-6.32	0.01995	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	1.083810	0.06986	N	0.820787	T	0.25606	0.0623	N	0.04387	-0.21	0.19300	N	0.999977	B	0.02656	0.0	B	0.04013	0.001	T	0.32798	-0.9893	10	0.02654	T	1	-3.6408	2.6709	0.05067	0.2014:0.2128:0.0743:0.5116	.	262	O15204	ADEC1_HUMAN	H	262;183;183	ENSP00000256412:Q262H;ENSP00000442592:Q183H;ENSP00000428993:Q183H	ENSP00000256412:Q262H	Q	+	3	2	ADAMDEC1	24312355	0.023000	0.18921	0.002000	0.10522	0.287000	0.27160	-0.370000	0.07523	-0.741000	0.04797	-2.347000	0.00243	CAA		0.428	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2	NM_014479	
DPYSL2	1808	broad.mit.edu	37	8	26505284	26505284	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:26505284G>A	ENST00000311151.5	+	11	1661	c.1249G>A	c.(1249-1251)Gtt>Att	p.V417I	DPYSL2_ENST00000523027.1_Missense_Mutation_p.V381I|DPYSL2_ENST00000521913.1_Missense_Mutation_p.V381I	NM_001386.5	NP_001377.1	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	417					axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|olfactory bulb development (GO:0021772)|positive regulation of glutamate secretion (GO:0014049)|pyrimidine nucleobase catabolic process (GO:0006208)|regulation of neuron differentiation (GO:0045664)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|synaptic vesicle transport (GO:0048489)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	dihydropyrimidinase activity (GO:0004157)	p.V417I(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(3)|prostate(1)|skin(1)|stomach(1)	20		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		CCCCGACAGCGTTAAAACCAT	0.542																																					p.V417I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1249A	8						.						80.0	73.0	75.0					8																	26505284		2203	4300	6503	26561201	SO:0001583	missense	1808	exon11			D78013	CCDS6051.1, CCDS59096.1	8p22-p21	2011-09-28			ENSG00000092964	ENSG00000092964			3014	protein-coding gene	gene with protein product		602463				8973361	Standard	NM_001197293		Approved	DRP-2, DHPRP2, CRMP2, DRP2	uc003xfa.3	Q16555	OTTHUMG00000099439	ENST00000311151.5:c.1249G>A	8.37:g.26505284G>A	ENSP00000309539:p.Val417Ile		26561201	NM_001386	A8K5H2|B4DR31|D3DSS7|O00424	Missense_Mutation	SNP	ENST00000311151.5	37	CCDS6051.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.152721	0.38021	.	.	ENSG00000092964	ENST00000545637;ENST00000521913;ENST00000311151;ENST00000522745;ENST00000523027	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	5.07	1.16	0.20824	Metal-dependent hydrolase, composite domain (1);	0.333575	0.32416	N	0.006131	T	0.58466	0.2124	N	0.25332	0.735	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.52268	-0.8598	10	0.62326	D	0.03	-9.3468	9.27	0.37666	0.3008:0.0:0.6992:0.0	.	417;473	Q16555;Q59GB4	DPYL2_HUMAN;.	I	56;381;417;417;381	ENSP00000427985:V381I;ENSP00000309539:V417I;ENSP00000428909:V417I;ENSP00000431117:V381I	ENSP00000309539:V417I	V	+	1	0	DPYSL2	26561201	0.853000	0.29707	0.002000	0.10522	0.846000	0.48090	1.555000	0.36277	0.094000	0.17404	0.563000	0.77884	GTT		0.542	DPYSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216904.3	NM_001386	
RNF122	79845	broad.mit.edu	37	8	33406959	33406959	+	Missense_Mutation	SNP	C	C	T	rs115346711		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:33406959C>T	ENST00000256257.1	-	5	723	c.322G>A	c.(322-324)Gtg>Atg	p.V108M		NM_024787.2	NP_079063.2	Q9H9V4	RN122_HUMAN	ring finger protein 122	108						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.V108M(1)		endometrium(2)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)		CACGGGAGCACGCCTAACTCA	0.547													c|||	1	0.000199681	0.0	0.0	5008	,	,		17934	0.0		0.001	False		,,,				2504	0.0				p.V108M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G322A	8						.	C	MET/VAL	0,4406		0,0,2203	135.0	104.0	114.0		322	4.1	0.7	8	dbSNP_132	114	2,8598	2.2+/-6.3	0,2,4298	yes	missense	RNF122	NM_024787.2	21	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	108/156	33406959	2,13004	2203	4300	6503	33526501	SO:0001583	missense	79845	exon5			AK022588	CCDS6091.1	8p12	2013-01-09			ENSG00000133874	ENSG00000133874		"""RING-type (C3HC4) zinc fingers"""	21147	protein-coding gene	gene with protein product							Standard	NM_024787		Approved	FLJ12526	uc003xjo.1	Q9H9V4	OTTHUMG00000163960	ENST00000256257.1:c.322G>A	8.37:g.33406959C>T	ENSP00000256257:p.Val108Met		33526501	NM_024787	Q52LK3	Missense_Mutation	SNP	ENST00000256257.1	37	CCDS6091.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	23.3	4.397100	0.83120	0.0	2.33E-4	ENSG00000133874	ENST00000256257	T	0.46063	0.88	5.96	4.05	0.47172	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.114001	0.64402	N	0.000013	T	0.53850	0.1822	L	0.49455	1.56	0.50632	D	0.999886	D	0.89917	1.0	D	0.77557	0.99	T	0.53408	-0.8443	10	0.87932	D	0	-10.3984	7.6049	0.28097	0.1613:0.7508:0.0:0.0878	.	108	Q9H9V4	RN122_HUMAN	M	108	ENSP00000256257:V108M	ENSP00000256257:V108M	V	-	1	0	RNF122	33526501	0.987000	0.35691	0.666000	0.29783	0.985000	0.73830	2.686000	0.46968	0.727000	0.32360	0.655000	0.94253	GTG		0.547	RNF122-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376562.1	NM_024787	
RB1CC1	9821	broad.mit.edu	37	8	53558276	53558276	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:53558276T>C	ENST00000025008.5	-	16	4496	c.3973A>G	c.(3973-3975)Att>Gtt	p.I1325V	RB1CC1_ENST00000435644.2_Missense_Mutation_p.I1325V|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Missense_Mutation_p.I1325V	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1325					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)		p.I1325V(1)		NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TGTTCCGCAATCAAAGATGTT	0.323																																					p.I1325V	GBM(180;1701 2102 13475 42023 52570)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3973G	8						.						83.0	78.0	80.0					8																	53558276		2203	4300	6503	53720829	SO:0001583	missense	9821	exon16			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3973A>G	8.37:g.53558276T>C	ENSP00000025008:p.Ile1325Val		53720829	NM_001083617	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	T	6.851	0.526210	0.13066	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.15603	2.41;2.41;2.41	5.28	5.28	0.74379	.	0.060586	0.64402	D	0.000004	T	0.13970	0.0338	L	0.34521	1.04	0.46149	D	0.998895	B;B	0.32507	0.373;0.256	B;B	0.31495	0.131;0.062	T	0.09885	-1.0654	10	0.17832	T	0.49	-18.216	15.213	0.73241	0.0:0.0:0.0:1.0	.	1325;1325	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	V	1325	ENSP00000025008:I1325V;ENSP00000396067:I1325V;ENSP00000445960:I1325V	ENSP00000025008:I1325V	I	-	1	0	RB1CC1	53720829	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	6.485000	0.73625	2.002000	0.58637	0.533000	0.62120	ATT		0.323	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
RP1	6101	broad.mit.edu	37	8	55539830	55539830	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:55539830C>G	ENST00000220676.1	+	4	3536	c.3388C>G	c.(3388-3390)Cta>Gta	p.L1130V		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1130					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.L1130V(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TAATCTCCTTCTAGCTTGGCT	0.408																																					p.L1130V	Colon(91;1014 1389 7634 14542 40420)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3388G	8						.						82.0	74.0	76.0					8																	55539830		2203	4300	6503	55702383	SO:0001583	missense	6101	exon4			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3388C>G	8.37:g.55539830C>G	ENSP00000220676:p.Leu1130Val		55702383	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	17.46	3.396353	0.62177	.	.	ENSG00000104237	ENST00000220676	T	0.56611	0.45	5.7	3.58	0.41010	.	0.000000	0.44285	D	0.000466	T	0.69061	0.3069	M	0.68952	2.095	0.32161	N	0.582955	D	0.89917	1.0	D	0.87578	0.998	T	0.77112	-0.2708	10	0.87932	D	0	.	13.5936	0.61975	0.0:0.8536:0.0:0.1464	.	1130	P56715	RP1_HUMAN	V	1130	ENSP00000220676:L1130V	ENSP00000220676:L1130V	L	+	1	2	RP1	55702383	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	0.741000	0.26202	1.403000	0.46800	0.563000	0.77884	CTA		0.408	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
KCNB2	9312	broad.mit.edu	37	8	73848793	73848793	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:73848793C>A	ENST00000523207.1	+	3	1791	c.1203C>A	c.(1201-1203)tgC>tgA	p.C401*		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	401					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.C401*(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GAGGTCTGTGCTGTATTGCTG	0.433																																					p.C401X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C1203A	8						.						94.0	93.0	94.0					8																	73848793		2203	4300	6503	74011347	SO:0001587	stop_gained	9312	exon3			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1203C>A	8.37:g.73848793C>A	ENSP00000430846:p.Cys401*		74011347	NM_004770	Q7Z7D0|Q9BXD3	Nonsense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	40	8.108011	0.98657	.	.	ENSG00000182674	ENST00000523207	.	.	.	5.74	4.87	0.63330	.	0.000000	0.49916	D	0.000129	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1732	0.37096	0.0:0.7831:0.0:0.2169	.	.	.	.	X	401	.	ENSP00000430846:C401X	C	+	3	2	KCNB2	74011347	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.006000	0.29847	1.432000	0.47375	0.655000	0.94253	TGC		0.433	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KCNB2	9312	broad.mit.edu	37	8	73849624	73849624	+	Silent	SNP	C	C	T	rs374713448		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:73849624C>T	ENST00000523207.1	+	3	2622	c.2034C>T	c.(2032-2034)ctC>ctT	p.L678L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	678					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.L678L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CTGTGAACCTCGATGCCAGTG	0.542																																					p.L678L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2034T	8						.	C		1,4405	2.1+/-5.4	0,1,2202	56.0	56.0	56.0		2034	-8.7	0.0	8		56	0,8600		0,0,4300	no	coding-synonymous	KCNB2	NM_004770.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		678/912	73849624	1,13005	2203	4300	6503	74012178	SO:0001819	synonymous_variant	9312	exon3			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2034C>T	8.37:g.73849624C>T			74012178	NM_004770	Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	CCDS6209.1																																																																																				0.542	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
CPNE3	8895	broad.mit.edu	37	8	87570635	87570635	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:87570635G>T	ENST00000521271.1	+	17	1773	c.1611G>T	c.(1609-1611)caG>caT	p.Q537H	CPNE3_ENST00000198765.4_Missense_Mutation_p.Q537H	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	537					lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)	p.Q537H(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						AACAGAAGCAGTGACCACTTC	0.468																																					p.Q537H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1611T	8						.						117.0	108.0	111.0					8																	87570635		2203	4300	6503	87639751	SO:0001583	missense	8895	exon17			AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.1611G>T	8.37:g.87570635G>T	ENSP00000430934:p.Gln537His		87639751	NM_003909	A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	37	CCDS6243.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287236	0.40494	.	.	ENSG00000085719	ENST00000198765;ENST00000521271	T;T	0.05580	3.42;3.42	5.78	-5.28	0.02755	.	2.829760	0.01245	N	0.008732	T	0.03178	0.0093	N	0.08118	0	0.09310	N	0.999999	B	0.14438	0.01	B	0.06405	0.002	T	0.39722	-0.9600	10	0.72032	D	0.01	-19.5667	2.0571	0.03583	0.2118:0.3421:0.276:0.1701	.	537	O75131	CPNE3_HUMAN	H	537	ENSP00000198765:Q537H;ENSP00000430934:Q537H	ENSP00000198765:Q537H	Q	+	3	2	CPNE3	87639751	0.000000	0.05858	0.000000	0.03702	0.296000	0.27459	-0.276000	0.08514	-1.144000	0.02862	0.655000	0.94253	CAG		0.468	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		
SPATC1	375686	broad.mit.edu	37	8	145096221	145096221	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr8:145096221C>T	ENST00000377470.3	+	4	1497	c.1395C>T	c.(1393-1395)cgC>cgT	p.R465R	SPATC1_ENST00000447830.2_Intron	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	465						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.R465R(1)|p.R374R(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCCAGAGCGCGTACGGCTCT	0.627																																					p.R465R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1395T	8						.						76.0	57.0	63.0					8																	145096221		2203	4300	6503	145168209	SO:0001819	synonymous_variant	375686	exon4			BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1395C>T	8.37:g.145096221C>T			145168209	NM_198572	B4DWW9|Q5U5I8|Q7Z6L7	Silent	SNP	ENST00000377470.3	37	CCDS6413.2																																																																																				0.627	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572	
DRAM2	128338	broad.mit.edu	37	1	111668891	111668891	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:111668891T>C	ENST00000286692.4	-	4	774	c.157A>G	c.(157-159)Aaa>Gaa	p.K53E	DRAM2_ENST00000484310.1_5'UTR|DRAM2_ENST00000539140.1_Missense_Mutation_p.K53E			Q6UX65	DRAM2_HUMAN	DNA-damage regulated autophagy modulator 2	53					apoptotic process (GO:0006915)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|microtubule cytoskeleton (GO:0015630)		p.K53E(1)		endometrium(1)|large_intestine(5)|lung(3)	9						AATAAGCATTTTTCTGGAGCT	0.323																																					p.K53E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A157G	1						.						105.0	113.0	110.0					1																	111668891		2203	4296	6499	111470414	SO:0001583	missense	128338	exon4			AY336747	CCDS30801.1	1p13.3	2010-07-08	2009-06-12	2009-06-12	ENSG00000156171	ENSG00000156171			28769	protein-coding gene	gene with protein product		613360	"""transmembrane protein 77"""	TMEM77		12975309	Standard	NM_178454		Approved	MGC54289, PRO180, WWFQ154, RP5-1180E21.1	uc001ead.4	Q6UX65	OTTHUMG00000011911	ENST00000286692.4:c.157A>G	1.37:g.111668891T>C	ENSP00000286692:p.Lys53Glu		111470414	NM_178454	B3SUG9|Q4VWF6|Q86VD3|Q8NBQ4	Missense_Mutation	SNP	ENST00000286692.4	37	CCDS30801.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.647205	0.47258	.	.	ENSG00000156171	ENST00000286692;ENST00000539140	T;T	0.43294	0.95;0.95	5.53	5.53	0.82687	.	0.110120	0.64402	D	0.000007	T	0.22244	0.0536	L	0.43152	1.355	0.31554	N	0.658328	B	0.25390	0.125	B	0.30716	0.119	T	0.14364	-1.0475	10	0.42905	T	0.14	-4.2814	12.0642	0.53578	0.0:0.0:0.0:1.0	.	53	Q6UX65	DRAM2_HUMAN	E	53	ENSP00000286692:K53E;ENSP00000437718:K53E	ENSP00000286692:K53E	K	-	1	0	DRAM2	111470414	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.802000	0.55553	2.105000	0.64084	0.528000	0.53228	AAA		0.323	DRAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032930.3	NM_178454	
DENND2C	163259	broad.mit.edu	37	1	115141935	115141935	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:115141935G>T	ENST00000393274.1	-	16	2868	c.2243C>A	c.(2242-2244)tCt>tAt	p.S748Y	DENND2C_ENST00000393276.3_Missense_Mutation_p.S691Y|DENND2C_ENST00000393277.1_Intron|DENND2C_ENST00000481894.1_5'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	748	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S691Y(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAAGGAGCAAGACAGGATTCC	0.443																																					p.S691Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2072A	1						.						163.0	140.0	148.0					1																	115141935		2203	4300	6503	114943458	SO:0001583	missense	163259	exon13				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2243C>A	1.37:g.115141935G>T	ENSP00000376955:p.Ser748Tyr		114943458	NM_198459	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	ENST00000393274.1	37	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037800	0.93630	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540	T;T	0.14391	2.51;2.51	5.81	5.81	0.92471	DENN (3);	0.251016	0.43747	D	0.000529	T	0.33876	0.0878	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.992;0.987	T	0.05733	-1.0867	10	0.87932	D	0	.	20.1379	0.98040	0.0:0.0:1.0:0.0	.	748;691	Q68D51;Q68D51-3	DEN2C_HUMAN;.	Y	691;748;748	ENSP00000376957:S691Y;ENSP00000376955:S748Y	ENSP00000358553:S748Y	S	-	2	0	DENND2C	114943458	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.337000	0.96545	2.769000	0.95229	0.644000	0.83932	TCT		0.443	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
OTUD7B	56957	broad.mit.edu	37	1	149922060	149922060	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:149922060G>A	ENST00000369135.4	-	8	1204	c.910C>T	c.(910-912)Cat>Tat	p.H304Y		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	304	Catalytic.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.H304Y(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			CTAAGCACATGAGCAAGGACA	0.557																																					p.H304Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C910T	1						.						78.0	80.0	79.0					1																	149922060		2059	4205	6264	148188684	SO:0001583	missense	56957	exon8			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.910C>T	1.37:g.149922060G>A	ENSP00000358131:p.His304Tyr		148188684	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	ENST00000369135.4	37	CCDS41389.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866620	0.91511	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	T;T	0.35421	1.31;1.31	5.03	5.03	0.67393	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61023	-0.7146	9	.	.	.	-1.6017	17.52	0.87784	0.0:0.0:1.0:0.0	.	304	Q6GQQ9	OTU7B_HUMAN	Y	304	ENSP00000358131:H304Y;ENSP00000408231:H304Y	.	H	-	1	0	OTUD7B	148188684	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.263000	0.95617	2.612000	0.88384	0.655000	0.94253	CAT		0.557	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
LCE1F	353137	broad.mit.edu	37	1	152749149	152749149	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:152749149C>T	ENST00000334371.2	+	1	302	c.302C>T	c.(301-303)gCg>gTg	p.A101V		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	101					keratinization (GO:0031424)			p.A101V(1)		kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCCCTCAGCGGGCTCCAGC	0.647																																					p.A101V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C302T	1						.						31.0	35.0	34.0					1																	152749149		2199	4294	6493	151015773	SO:0001583	missense	353137	exon1				CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.302C>T	1.37:g.152749149C>T	ENSP00000334187:p.Ala101Val		151015773	NM_178354		Missense_Mutation	SNP	ENST00000334371.2	37	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.652520	0.29336	.	.	ENSG00000240386	ENST00000334371	T	0.03635	3.86	4.45	2.57	0.30868	.	0.707775	0.11673	N	0.540692	T	0.00906	0.0030	N	0.08118	0	0.20196	N	0.999921	B	0.14438	0.01	B	0.14578	0.011	T	0.49771	-0.8904	10	0.87932	D	0	.	10.7817	0.46382	0.0:0.1987:0.8013:0.0	.	101	Q5T754	LCE1F_HUMAN	V	101	ENSP00000334187:A101V	ENSP00000334187:A101V	A	+	2	0	LCE1F	151015773	0.991000	0.36638	0.998000	0.56505	0.740000	0.42216	2.108000	0.41854	1.200000	0.43188	-0.267000	0.10333	GCG		0.647	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
UBAP2L	9898	broad.mit.edu	37	1	154224075	154224075	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:154224075C>T	ENST00000361546.2	+	13	1652	c.1610C>T	c.(1609-1611)aCc>aTc	p.T537I	AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000428931.1_Missense_Mutation_p.T537I|UBAP2L_ENST00000271877.7_Missense_Mutation_p.T548I|UBAP2L_ENST00000343815.6_Missense_Mutation_p.T537I			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	537					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)	p.T537I(1)|p.T33I(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCACCCCCACCACGAGCGCC	0.507																																					p.T537I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1610T	1						.						96.0	96.0	96.0					1																	154224075		2203	4300	6503	152490699	SO:0001583	missense	9898	exon14			BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1610C>T	1.37:g.154224075C>T	ENSP00000355343:p.Thr537Ile		152490699	NM_014847	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	37	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.606099	0.87157	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.12569	2.68;2.67;2.69;2.67	5.09	5.09	0.68999	.	0.106104	0.64402	D	0.000004	T	0.11495	0.0280	L	0.36672	1.1	0.50039	D	0.999841	P;P;P;P;P	0.43477	0.808;0.782;0.782;0.782;0.675	B;P;B;B;B	0.46172	0.228;0.506;0.404;0.404;0.309	T	0.01583	-1.1319	10	0.62326	D	0.03	-2.6015	18.0834	0.89449	0.0:1.0:0.0:0.0	.	451;548;530;537;537	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	I	537;537;33;33;548;537	ENSP00000345308:T537I;ENSP00000389445:T537I;ENSP00000271877:T548I;ENSP00000355343:T537I	ENSP00000271877:T548I	T	+	2	0	UBAP2L	152490699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.521000	0.67086	2.820000	0.97059	0.650000	0.86243	ACC		0.507	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
YY1AP1	55249	broad.mit.edu	37	1	155629929	155629929	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:155629929G>T	ENST00000295566.4	-	11	1933	c.1910C>A	c.(1909-1911)gCc>gAc	p.A637D	YY1AP1_ENST00000355499.4_Missense_Mutation_p.A591D|YY1AP1_ENST00000359205.5_Missense_Mutation_p.A580D|MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000347088.5_Missense_Mutation_p.A591D|YY1AP1_ENST00000535662.1_Missense_Mutation_p.A437D|YY1AP1_ENST00000368330.2_Missense_Mutation_p.A591D|YY1AP1_ENST00000361831.5_Missense_Mutation_p.A580D|YY1AP1_ENST00000368340.5_Missense_Mutation_p.A709D|YY1AP1_ENST00000368339.5_Missense_Mutation_p.A729D|YY1AP1_ENST00000404643.1_Missense_Mutation_p.A571D|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000407221.1_Missense_Mutation_p.A560D|YY1AP1_ENST00000311573.5_Missense_Mutation_p.A560D	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	637					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.A637D(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CAAGAGGGTGGCGATGGGAAT	0.537																																					p.A591D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1772A	1						.						84.0	76.0	79.0					1																	155629929		2203	4300	6503	153896553	SO:0001583	missense	55249	exon10			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.1910C>A	1.37:g.155629929G>T	ENSP00000295566:p.Ala637Asp		153896553	NM_001198901	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	37	CCDS1115.1	.	.	.	.	.	.	.	.	.	.	g	13.40	2.226173	0.39300	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662	T;T;T;T;T;T;T;T;T;T;T;T	0.24723	1.91;1.91;1.91;1.91;1.91;1.85;1.88;1.91;1.91;1.91;1.84;1.91	2.53	2.53	0.30540	.	0.303789	0.32357	N	0.006215	T	0.06096	0.0158	N	0.08118	0	0.80722	D	1	B;B;B;B;P	0.41848	0.092;0.119;0.275;0.116;0.763	B;B;B;B;B	0.35971	0.11;0.092;0.121;0.135;0.215	T	0.21109	-1.0255	10	0.87932	D	0	.	13.0809	0.59114	0.0:0.0:1.0:0.0	.	729;571;637;591;709	B4DMP2;Q9H869-4;Q9H869;Q9H869-2;Q5VYZ1	.;.;YYAP1_HUMAN;.;.	D	580;591;560;591;580;709;637;591;560;571;729;437	ENSP00000352134:A580D;ENSP00000347686:A591D;ENSP00000311138:A560D;ENSP00000316079:A591D;ENSP00000355298:A580D;ENSP00000357324:A709D;ENSP00000295566:A637D;ENSP00000357314:A591D;ENSP00000385791:A560D;ENSP00000385390:A571D;ENSP00000357323:A729D;ENSP00000437926:A437D	ENSP00000295566:A637D	A	-	2	0	YY1AP1	153896553	1.000000	0.71417	0.998000	0.56505	0.757000	0.42996	4.592000	0.61027	1.419000	0.47118	0.306000	0.20318	GCC		0.537	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
NES	10763	broad.mit.edu	37	1	156640422	156640422	+	Silent	SNP	C	C	T	rs149557132	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:156640422C>T	ENST00000368223.3	-	4	3690	c.3558G>A	c.(3556-3558)gcG>gcA	p.A1186A		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1186	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.A1186A(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGCAGGGAACGCCTCCTCTG	0.637													C|||	4	0.000798722	0.0015	0.0	5008	,	,		15258	0.0		0.002	False		,,,				2504	0.0				p.A1186A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3558A	1						.	C		2,4404	4.2+/-10.8	0,2,2201	77.0	78.0	77.0		3558	-3.4	0.0	1	dbSNP_134	77	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	NES	NM_006617.1		0,7,6496	TT,TC,CC		0.0581,0.0454,0.0538		1186/1622	156640422	7,12999	2203	4300	6503	154907046	SO:0001819	synonymous_variant	10763	exon4			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3558G>A	1.37:g.156640422C>T			154907046	NM_006617	O00552|Q3LIF5|Q5SYZ6	Silent	SNP	ENST00000368223.3	37	CCDS1151.1																																																																																				0.637	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
FCRL3	115352	broad.mit.edu	37	1	157666049	157666049	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:157666049T>C	ENST00000368184.3	-	7	1204	c.913A>G	c.(913-915)Atg>Gtg	p.M305V	FCRL3_ENST00000473231.1_5'UTR|FCRL3_ENST00000368186.5_Missense_Mutation_p.M305V|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	305	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.M305V(1)		autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					ATAAGGACCATATTTTCTCCT	0.517																																					p.M305V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A913G	1						.						127.0	118.0	121.0					1																	157666049		2203	4300	6503	155932673	SO:0001583	missense	115352	exon7			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.913A>G	1.37:g.157666049T>C	ENSP00000357167:p.Met305Val		155932673	NM_052939	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	ENST00000368184.3	37	CCDS1167.1	.	.	.	.	.	.	.	.	.	.	T	5.483	0.274196	0.10403	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.08458	3.09;3.09	5.22	0.972	0.19704	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.808279	0.10423	N	0.676504	T	0.00468	0.0015	N	0.00114	-2.085	0.09310	N	1	B;B;B	0.18013	0.025;0.012;0.02	B;B;B	0.22152	0.012;0.038;0.007	T	0.44251	-0.9340	10	0.22706	T	0.39	.	4.4373	0.11557	0.179:0.0:0.4753:0.3457	.	305;210;305	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	V	305	ENSP00000357169:M305V;ENSP00000357167:M305V	ENSP00000292392:M305V	M	-	1	0	FCRL3	155932673	0.098000	0.21812	0.162000	0.22713	0.428000	0.31595	0.576000	0.23744	0.157000	0.19338	-1.275000	0.01399	ATG		0.517	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051419.2	NM_052939	
OR6K6	128371	broad.mit.edu	37	1	158725622	158725622	+	Silent	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:158725622T>G	ENST00000368144.2	+	1	1113	c.1017T>G	c.(1015-1017)ggT>ggG	p.G339G		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	339						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G339G(1)		endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					AGAGGGCTGGTTGGGCTGGGA	0.413																																					p.G339G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1017G	1						.						72.0	77.0	75.0					1																	158725622		2203	4299	6502	156992246	SO:0001819	synonymous_variant	128371	exon1			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.1017T>G	1.37:g.158725622T>G			156992246	NM_001005184	B9EIM8|Q5VUU9|Q6IFR4	Silent	SNP	ENST00000368144.2	37	CCDS30904.1																																																																																				0.413	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
C1orf226	400793	broad.mit.edu	37	1	162351795	162351795	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:162351795C>G	ENST00000458626.2	+	1	276	c.104C>G	c.(103-105)tCt>tGt	p.S35C	C1orf226_ENST00000426197.2_Missense_Mutation_p.S78C|RP11-565P22.6_ENST00000431696.1_Missense_Mutation_p.S144C	NM_001085375.1	NP_001078844.1	A1L170	CA226_HUMAN	chromosome 1 open reading frame 226	35								p.S78C(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12						CCTCTGGGCTCTGGTGAGCCT	0.627																																					p.S35C												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C104G	1						.						11.0	14.0	13.0					1																	162351795		1790	4006	5796	160618419	SO:0001583	missense	400793	exon1			AI480219, AK023199, AK125122, AL512785, BC127743	CCDS44268.1, CCDS53422.1	1q23.3	2013-10-11			ENSG00000239887	ENSG00000239887			34351	protein-coding gene	gene with protein product						14702039	Standard	NM_001085375		Approved	FLJ13137	uc010pkt.1	A1L170	OTTHUMG00000031376	ENST00000458626.2:c.104C>G	1.37:g.162351795C>G	ENSP00000437071:p.Ser35Cys		160618419	NM_001085375	B4DF31	Missense_Mutation	SNP	ENST00000458626.2	37	CCDS53422.1	.	.	.	.	.	.	.	.	.	.	C	14.56	2.570805	0.45798	.	.	ENSG00000254706;ENSG00000239887;ENSG00000239887;ENSG00000239887	ENST00000431696;ENST00000420220;ENST00000426197;ENST00000458626	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	T	0.45895	0.1365	L	0.27053	0.805	.	.	.	D;D	0.63046	0.992;0.992	P;P	0.55999	0.789;0.789	T	0.52320	-0.8591	7	0.59425	D	0.04	-1.1778	16.3966	0.83607	0.0:1.0:0.0:0.0	.	78;35	A1L170-2;A1L170	.;CA226_HUMAN	C	144;35;78;35	.	ENSP00000398035:S35C	S	+	2	0	C1orf226;RP11-565P22.6	160618419	0.049000	0.20398	0.043000	0.18650	0.206000	0.24218	3.681000	0.54648	2.447000	0.82792	0.655000	0.94253	TCT		0.627	C1orf226-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076793.2	NM_001085375	
CEP350	9857	broad.mit.edu	37	1	179983080	179983080	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:179983080G>C	ENST00000367607.3	+	10	1910	c.1492G>C	c.(1492-1494)Gaa>Caa	p.E498Q		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	498					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E498Q(1)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						ATCTCGGTCTGAAAATAATAT	0.378																																					p.E498Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1492C	1						.						49.0	52.0	51.0					1																	179983080		2203	4300	6503	178249703	SO:0001583	missense	9857	exon10			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.1492G>C	1.37:g.179983080G>C	ENSP00000356579:p.Glu498Gln		178249703	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	37	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996044	0.74703	.	.	ENSG00000135837	ENST00000367607	D	0.90197	-2.63	5.78	5.78	0.91487	.	0.000000	0.49916	D	0.000130	D	0.94361	0.8187	M	0.70595	2.14	0.41659	D	0.989172	D;D	0.60575	0.988;0.988	P;D	0.63192	0.815;0.912	D	0.93787	0.7089	9	.	.	.	.	17.7934	0.88562	0.0:0.0:1.0:0.0	.	498;498	E7EU22;Q5VT06	.;CE350_HUMAN	Q	498	ENSP00000356579:E498Q	.	E	+	1	0	CEP350	178249703	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.564000	0.67359	2.729000	0.93468	0.650000	0.86243	GAA		0.378	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
COLGALT2	23127	broad.mit.edu	37	1	183942876	183942876	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:183942876A>C	ENST00000361927.4	-	4	872	c.501T>G	c.(499-501)gaT>gaG	p.D167E	COLGALT2_ENST00000546159.1_Missense_Mutation_p.D167E	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	167					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.D167E(1)									AATTGTCAACATCTATGAACT	0.413																																					p.D167E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T501G	1						.						99.0	107.0	104.0					1																	183942876		2203	4300	6503	182209499	SO:0001583	missense	23127	exon4			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.501T>G	1.37:g.183942876A>C	ENSP00000354960:p.Asp167Glu		182209499	NM_015101	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	37	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.940209	0.73557	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.79554	-1.28;-1.28	5.23	4.11	0.48088	.	0.000000	0.85682	D	0.000000	D	0.91161	0.7216	M	0.93197	3.39	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.79784	0.972;0.993	D	0.91682	0.5359	10	0.87932	D	0	.	10.8469	0.46748	0.9259:0.0:0.0741:0.0	.	167;167	F5H3T5;Q8IYK4	.;GT252_HUMAN	E	167	ENSP00000439112:D167E;ENSP00000354960:D167E	ENSP00000354960:D167E	D	-	3	2	GLT25D2	182209499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.622000	0.46427	0.836000	0.34901	0.477000	0.44152	GAT		0.413	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
IGSF21	84966	broad.mit.edu	37	1	18692066	18692066	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:18692066G>A	ENST00000251296.1	+	6	1273	c.890G>A	c.(889-891)gGc>gAc	p.G297D		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	297						extracellular region (GO:0005576)		p.G297D(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		AGCAGTGACGGCACTGTGGAA	0.632																																					p.G297D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G890A	1						.						114.0	97.0	103.0					1																	18692066		2203	4300	6503	18564653	SO:0001583	missense	84966	exon6			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.890G>A	1.37:g.18692066G>A	ENSP00000251296:p.Gly297Asp		18564653	NM_032880	Q8NBR8	Missense_Mutation	SNP	ENST00000251296.1	37	CCDS184.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540785	0.85917	.	.	ENSG00000117154	ENST00000251296	T	0.63580	-0.05	4.28	4.28	0.50868	Immunoglobulin-like fold (1);	0.047421	0.85682	D	0.000000	T	0.68540	0.3012	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.68040	-0.5514	10	0.37606	T	0.19	-6.8934	15.7859	0.78304	0.0:0.0:1.0:0.0	.	297	Q96ID5	IGS21_HUMAN	D	297	ENSP00000251296:G297D	ENSP00000251296:G297D	G	+	2	0	IGSF21	18564653	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	8.821000	0.92009	2.383000	0.81215	0.561000	0.74099	GGC		0.632	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
PLA2G2F	64600	broad.mit.edu	37	1	20474891	20474891	+	Silent	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:20474891C>A	ENST00000375102.3	+	5	735	c.633C>A	c.(631-633)ccC>ccA	p.P211P		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	168					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)	p.P211P(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CCGCCCCTCCCTAGAGCCTCT	0.657																																					p.P211P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C633A	1						.						25.0	28.0	27.0					1																	20474891		2203	4300	6503	20347478	SO:0001819	synonymous_variant	64600	exon5			AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.633C>A	1.37:g.20474891C>A			20347478	NM_022819	Q5R385|Q8N217|Q9H506	Silent	SNP	ENST00000375102.3	37	CCDS204.2																																																																																				0.657	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007687.1	NM_022819	
IVNS1ABP	10625	broad.mit.edu	37	1	185269187	185269187	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:185269187C>G	ENST00000367498.3	-	13	2067	c.1445G>C	c.(1444-1446)tGt>tCt	p.C482S	IVNS1ABP_ENST00000459929.1_5'UTR|IVNS1ABP_ENST00000392007.3_Missense_Mutation_p.C264S	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	482					negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)		p.C482S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						AAATACATCACAATTTTTCAG	0.338																																					p.C482S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1445C	1						.						103.0	96.0	99.0					1																	185269187		2203	4300	6503	183535810	SO:0001583	missense	10625	exon13			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.1445G>C	1.37:g.185269187C>G	ENSP00000356468:p.Cys482Ser		183535810	NM_006469	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Missense_Mutation	SNP	ENST00000367498.3	37	CCDS1368.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573392	0.86542	.	.	ENSG00000116679	ENST00000367498;ENST00000392007	T;T	0.78246	-1.16;-1.16	5.61	5.61	0.85477	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.86994	0.6067	L	0.58810	1.83	0.80722	D	1	D;D;D	0.89917	0.985;1.0;0.997	P;D;D	0.87578	0.71;0.998;0.945	D	0.87302	0.2306	10	0.87932	D	0	.	19.5968	0.95544	0.0:1.0:0.0:0.0	.	264;183;482	A8MVR0;Q6MZF3;Q9Y6Y0	.;.;NS1BP_HUMAN	S	482;264	ENSP00000356468:C482S;ENSP00000375864:C264S	ENSP00000356468:C482S	C	-	2	0	IVNS1ABP	183535810	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.420000	0.80191	2.793000	0.96121	0.655000	0.94253	TGT		0.338	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085774.1	NM_006469	
LYPLAL1	127018	broad.mit.edu	37	1	219352564	219352564	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:219352564T>C	ENST00000366928.5	+	2	214	c.167T>C	c.(166-168)aTt>aCt	p.I56T	LYPLAL1_ENST00000483635.1_3'UTR|LYPLAL1_ENST00000366927.3_Missense_Mutation_p.I56T	NM_138794.3	NP_620149	Q5VWZ2	LYPL1_HUMAN	lysophospholipase-like 1	56					negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|protein depalmitoylation (GO:0002084)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	lysophospholipase activity (GO:0004622)	p.I56T(1)		large_intestine(1)|lung(5)	6				GBM - Glioblastoma multiforme(131;0.055)|all cancers(67;0.105)|OV - Ovarian serous cystadenocarcinoma(81;0.116)		CACATAAAAATTATTTATCCA	0.333																																					p.I56T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T167C	1						.						65.0	65.0	65.0					1																	219352564		2203	4297	6500	217419187	SO:0001583	missense	127018	exon2			BC016711	CCDS1522.1, CCDS73032.1	1q41	2008-02-05			ENSG00000143353	ENSG00000143353			20440	protein-coding gene	gene with protein product							Standard	XM_005273046		Approved	Q96AV0	uc001hlq.4	Q5VWZ2	OTTHUMG00000037141	ENST00000366928.5:c.167T>C	1.37:g.219352564T>C	ENSP00000355895:p.Ile56Thr		217419187	NM_138794	A8K677|Q5VWZ3|Q7Z4A3|Q96AV0	Missense_Mutation	SNP	ENST00000366928.5	37	CCDS1522.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.064560	0.76187	.	.	ENSG00000143353	ENST00000366928;ENST00000366927	T;T	0.23147	1.92;1.92	5.68	5.68	0.88126	Phospholipase/carboxylesterase/thioesterase (1);	0.163843	0.52532	D	0.000069	T	0.36744	0.0978	L	0.56280	1.765	0.43021	D	0.994576	P;P	0.46220	0.874;0.818	P;P	0.49301	0.606;0.514	T	0.14980	-1.0453	10	0.72032	D	0.01	.	15.2047	0.73169	0.0:0.0:0.0:1.0	.	56;56	Q5VWZ2-2;Q5VWZ2	.;LYPL1_HUMAN	T	56	ENSP00000355895:I56T;ENSP00000355894:I56T	ENSP00000355894:I56T	I	+	2	0	LYPLAL1	217419187	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.796000	0.62496	2.289000	0.77006	0.482000	0.46254	ATT		0.333	LYPLAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090208.1	NM_138794	
OBSCN	84033	broad.mit.edu	37	1	228504566	228504566	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:228504566C>G	ENST00000422127.1	+	51	13486	c.13442C>G	c.(13441-13443)aCt>aGt	p.T4481S	OBSCN_ENST00000284548.11_Missense_Mutation_p.T4481S|OBSCN_ENST00000366709.4_Missense_Mutation_p.T1600S|OBSCN_ENST00000366707.4_Missense_Mutation_p.T2115S|OBSCN_ENST00000570156.2_Missense_Mutation_p.T5438S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4481	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.T5063S(1)		NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCGACTGGACTGTCACCGCC	0.697																																					p.T4481S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C13442G	1						.						11.0	17.0	15.0					1																	228504566		2147	4230	6377	226571189	SO:0001583	missense	84033	exon51			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13442C>G	1.37:g.228504566C>G	ENSP00000409493:p.Thr4481Ser		226571189	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	c	12.20	1.866836	0.32977	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.75704	-0.96;-0.96;0.14;0.64	5.41	-3.46	0.04767	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.926528	0.09118	N	0.846142	T	0.49372	0.1553	N	0.24115	0.695	0.09310	N	1	B;P	0.34587	0.146;0.458	B;B	0.27796	0.039;0.083	T	0.34900	-0.9810	10	0.16896	T	0.51	.	5.6043	0.17371	0.3919:0.3729:0.0:0.2353	.	4481;4481	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	4481;4481;2115;1600	ENSP00000284548:T4481S;ENSP00000409493:T4481S;ENSP00000355668:T2115S;ENSP00000355670:T1600S	ENSP00000284548:T4481S	T	+	2	0	OBSCN	226571189	0.000000	0.05858	0.010000	0.14722	0.016000	0.09150	-0.445000	0.06845	-0.646000	0.05452	-0.333000	0.08304	ACT		0.697	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PGBD5	79605	broad.mit.edu	37	1	230492810	230492810	+	Missense_Mutation	SNP	G	G	A	rs148878203		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:230492810G>A	ENST00000525115.1	-	2	405	c.382C>T	c.(382-384)Cgc>Tgc	p.R128C	PGBD5_ENST00000391860.1_Missense_Mutation_p.R82C|PGBD5_ENST00000321327.2_Missense_Mutation_p.R227C			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	128						integral component of membrane (GO:0016021)		p.R227C(1)		biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GCGAGGCTGCGGTTGCTGTAG	0.617																																					p.R128C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C382T	1						.	G	CYS/ARG	1,4405		0,1,2202	98.0	80.0	86.0		382	-0.4	0.3	1	dbSNP_134	86	0,8600		0,0,4300	no	missense	PGBD5	NM_024554.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	128/456	230492810	1,13005	2203	4300	6503	228559433	SO:0001583	missense	79605	exon2			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.382C>T	1.37:g.230492810G>A	ENSP00000431404:p.Arg128Cys		228559433	NM_024554	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	37		.	.	.	.	.	.	.	.	.	.	G	18.76	3.691947	0.68271	2.27E-4	0.0	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.17854	2.25;2.25;2.25	6.03	-0.444	0.12245	.	0.230823	0.43110	D	0.000606	T	0.18215	0.0437	N	0.24115	0.695	0.49213	D	0.999763	D	0.71674	0.998	P	0.54815	0.761	T	0.01084	-1.1457	10	0.51188	T	0.08	-24.9672	13.0813	0.59115	0.0:0.0783:0.1567:0.765	.	128	Q8N414	PGBD5_HUMAN	C	82;227;128	ENSP00000375733:R82C;ENSP00000322530:R227C;ENSP00000431404:R128C	ENSP00000322530:R227C	R	-	1	0	PGBD5	228559433	0.790000	0.28787	0.275000	0.24674	0.947000	0.59692	1.055000	0.30467	-0.001000	0.14495	0.655000	0.94253	CGC		0.617	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
ZP4	57829	broad.mit.edu	37	1	238050711	238050711	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:238050711A>T	ENST00000366570.4	-	5	862	c.704T>A	c.(703-705)tTc>tAc	p.F235Y	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	235	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.F235Y(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGGAAACTGGAACAGAACAAA	0.517																																					p.F235Y	NSCLC(166;160 2029 11600 18754 19936)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T704A	1						.						165.0	157.0	159.0					1																	238050711		2203	4300	6503	236117334	SO:0001583	missense	57829	exon5			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.704T>A	1.37:g.238050711A>T	ENSP00000355529:p.Phe235Tyr		236117334	NM_021186	B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446562	0.25987	.	.	ENSG00000116996	ENST00000366570	D	0.83837	-1.77	5.26	4.14	0.48551	Zona pellucida sperm-binding protein (3);	0.121953	0.56097	D	0.000039	D	0.86091	0.5850	L	0.58101	1.795	0.09310	N	0.999997	D	0.60160	0.987	D	0.63381	0.914	T	0.76361	-0.2987	10	0.33940	T	0.23	-27.1514	8.9958	0.36052	0.9117:0.0:0.0883:0.0	.	235	Q12836	ZP4_HUMAN	Y	235	ENSP00000355529:F235Y	ENSP00000355529:F235Y	F	-	2	0	ZP4	236117334	1.000000	0.71417	0.009000	0.14445	0.020000	0.10135	1.312000	0.33574	0.845000	0.35118	0.533000	0.62120	TTC		0.517	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
FMN2	56776	broad.mit.edu	37	1	240371930	240371930	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:240371930G>T	ENST00000319653.9	+	5	4048	c.3818G>T	c.(3817-3819)gGa>gTa	p.G1273V		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1273					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G1416V(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGCTTGTTTGGATTAGGGATG	0.493																																					p.G1273V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3818T	1						.						53.0	53.0	53.0					1																	240371930		2203	4300	6503	238438553	SO:0001583	missense	56776	exon5			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3818G>T	1.37:g.240371930G>T	ENSP00000318884:p.Gly1273Val		238438553	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	37	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	g	11.25	1.582547	0.28180	.	.	ENSG00000155816	ENST00000319653	T	0.28895	1.59	4.6	3.62	0.41486	Actin-binding FH2 (1);Actin-binding FH2/DRF autoregulatory (1);	0.256475	0.25083	U	0.033278	T	0.32585	0.0834	L	0.53249	1.67	0.80722	D	1	P	0.35714	0.517	B	0.43728	0.429	T	0.05920	-1.0856	9	.	.	.	.	8.0504	0.30575	0.0:0.3652:0.4952:0.1396	.	1273	Q9NZ56	FMN2_HUMAN	V	1273	ENSP00000318884:G1273V	.	G	+	2	0	FMN2	238438553	0.953000	0.32496	1.000000	0.80357	0.855000	0.48748	1.677000	0.37576	2.099000	0.63709	0.472000	0.43445	GGA		0.493	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
WDR64	128025	broad.mit.edu	37	1	241912880	241912880	+	Silent	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:241912880G>C	ENST00000366552.2	+	13	1803	c.1596G>C	c.(1594-1596)ggG>ggC	p.G532G	WDR64_ENST00000437684.2_Silent_p.G532G	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	532								p.G252G(1)|p.G532G(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TTGGCAGTGGGCAGGAGATGA	0.498																																					p.G532G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1596C	1						.						126.0	129.0	128.0					1																	241912880		2203	4300	6503	239979503	SO:0001819	synonymous_variant	128025	exon13			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1596G>C	1.37:g.241912880G>C			239979503	NM_144625	B1ANT0|Q7Z573|Q96LY9	Silent	SNP	ENST00000366552.2	37		.	.	.	.	.	.	.	.	.	.	G	10.68	1.418109	0.25552	.	.	ENSG00000162843	ENST00000425826	T	0.36340	1.26	6.06	-1.65	0.08291	.	0.167159	0.42548	D	0.000700	T	0.35248	0.0925	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20472	-1.0274	7	0.87932	D	0	-9.1647	2.3982	0.04394	0.4072:0.1148:0.3605:0.1175	.	.	.	.	A	11	ENSP00000406342:G11A	ENSP00000406342:G11A	G	+	2	0	WDR64	239979503	0.163000	0.22920	0.973000	0.42090	0.992000	0.81027	-1.030000	0.03581	-0.289000	0.09038	0.655000	0.94253	GGC		0.498	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
CLSPN	63967	broad.mit.edu	37	1	36228830	36228830	+	Silent	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:36228830A>G	ENST00000318121.3	-	4	732	c.675T>C	c.(673-675)tcT>tcC	p.S225S	CLSPN_ENST00000251195.5_Silent_p.S225S|CLSPN_ENST00000520551.1_Silent_p.S225S|CLSPN_ENST00000373220.3_Silent_p.S225S	NM_022111.3	NP_071394.2	Q9HAW4	CLSPN_HUMAN	claspin	225					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|mitotic DNA replication checkpoint (GO:0033314)|peptidyl-serine phosphorylation (GO:0018105)	nucleoplasm (GO:0005654)	anaphase-promoting complex binding (GO:0010997)|DNA binding (GO:0003677)	p.S225S(2)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTTCCAATGGAGAGTTATTTT	0.353																																					p.S225S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T675C	1						.						136.0	130.0	132.0					1																	36228830		2203	4299	6502	36001417	SO:0001819	synonymous_variant	63967	exon4			AF297866	CCDS396.1, CCDS53297.1	1p34.3	2010-06-24	2010-06-24		ENSG00000092853	ENSG00000092853			19715	protein-coding gene	gene with protein product		605434	"""claspin homolog (Xenopus laevis)"""			11090622, 12766152	Standard	NM_022111		Approved		uc001bzi.3	Q9HAW4	OTTHUMG00000004168	ENST00000318121.3:c.675T>C	1.37:g.36228830A>G			36001417	NM_001190481	A6NFL4|Q1RMC6|Q2KHM3|Q5VYG0|Q6P6H5|Q8IWI1	Silent	SNP	ENST00000318121.3	37	CCDS396.1																																																																																				0.353	CLSPN-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377857.1	NM_022111	
MAST2	23139	broad.mit.edu	37	1	46500589	46500589	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:46500589C>T	ENST00000361297.2	+	29	4531	c.4248C>T	c.(4246-4248)gcC>gcT	p.A1416A	MAST2_ENST00000372009.2_Silent_p.A1226A	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2									p.A1416A(1)		breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CAGCACTTGCCGCCTCTGAGA	0.607																																					p.A1416A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4248T	1						.						53.0	60.0	57.0					1																	46500589		2028	4189	6217	46273176	SO:0001819	synonymous_variant	23139	exon29			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.4248C>T	1.37:g.46500589C>T			46273176	NM_015112		Silent	SNP	ENST00000361297.2	37	CCDS41326.1																																																																																				0.607	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
PKN2	5586	broad.mit.edu	37	1	89271666	89271666	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:89271666C>T	ENST00000370521.3	+	12	2128	c.1769C>T	c.(1768-1770)tCt>tTt	p.S590F	PKN2_ENST00000370513.5_Missense_Mutation_p.S542F|PKN2_ENST00000544045.1_Missense_Mutation_p.S264F|PKN2_ENST00000316005.7_3'UTR|PKN2_ENST00000370505.3_Missense_Mutation_p.S433F	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	590					apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)	p.S590F(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		ATAGATGAATCTTCTGAATTA	0.388																																					p.S590F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1769T	1						.						67.0	63.0	64.0					1																	89271666		1821	4076	5897	89044254	SO:0001583	missense	5586	exon12			U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.1769C>T	1.37:g.89271666C>T	ENSP00000359552:p.Ser590Phe		89044254	NM_006256	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	CCDS714.1	.	.	.	.	.	.	.	.	.	.	C	14.31	2.497995	0.44455	.	.	ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.72	4.8	0.61643	.	0.155083	0.29924	U	0.010849	T	0.20820	0.0501	L	0.50333	1.59	0.45342	D	0.99833	P;B;B	0.35208	0.49;0.148;0.257	B;B;B	0.29598	0.081;0.104;0.033	T	0.09975	-1.0650	10	0.59425	D	0.04	.	15.1111	0.72359	0.0:0.931:0.0:0.069	.	574;542;590	B4DTP5;E7ESL7;Q16513	.;.;PKN2_HUMAN	F	590;433;542;264	ENSP00000359552:S590F;ENSP00000359536:S433F;ENSP00000359544:S542F;ENSP00000439643:S264F	ENSP00000359536:S433F	S	+	2	0	PKN2	89044254	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.385000	0.59613	2.689000	0.91719	0.591000	0.81541	TCT		0.388	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256	
WDR77	79084	broad.mit.edu	37	1	111991767	111991767	+	Frame_Shift_Del	DEL	G	G	-			TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:111991767delG	ENST00000235090.5	-	1	231	c.25delC	c.(25-27)ctafs	p.L9fs	ATP5F1_ENST00000483994.1_5'Flank|WDR77_ENST00000497278.1_5'Flank|WDR77_ENST00000411751.2_Frame_Shift_Del_p.L9fs|Y_RNA_ENST00000363020.1_RNA|ATP5F1_ENST00000369722.3_5'UTR	NM_024102.2	NP_077007.1	Q9BQA1	MEP50_HUMAN	WD repeat domain 77	9					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA metabolic process (GO:0016070)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|methylosome (GO:0034709)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.L9fs*1(1)		NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGGGGCACTAGGGGGGGTGGG	0.672																																					p.L9X												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.25delC	1						.						5.0	6.0	6.0					1																	111991767		1724	3675	5399	111793290	SO:0001589	frameshift_variant	79084	exon1			BC016946	CCDS835.1	1p13.2	2013-01-09		2005-08-09	ENSG00000116455	ENSG00000116455		"""WD repeat domain containing"""	29652	protein-coding gene	gene with protein product		611734				11756452, 8619474	Standard	NM_024102		Approved	MEP50	uc001ebb.3	Q9BQA1	OTTHUMG00000011748	ENST00000235090.5:c.25delC	1.37:g.111991767delG	ENSP00000235090:p.Leu9fs		111793290	NM_024102	B3KMW6|B4DP38|Q3LID2|Q53FU2|Q6JZZ5|Q96GK4|Q9BWY3	Frame_Shift_Del	DEL	ENST00000235090.5	37	CCDS835.1																																																																																				0.672	WDR77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032465.1	NM_024102	
OR2L13	284521	broad.mit.edu	37	1	248262801	248262801	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr1:248262801T>C	ENST00000358120.2	+	2	269	c.124T>C	c.(124-126)Tcg>Ccg	p.S42P	OR2L13_ENST00000366478.2_Missense_Mutation_p.S42P			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S42P(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			GGTGGGTAACTCGGCCATGAT	0.468																																					p.S42P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T124C	1						.						212.0	202.0	205.0					1																	248262801		2203	4300	6503	246329424	SO:0001583	missense	284521	exon3			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.124T>C	1.37:g.248262801T>C	ENSP00000350836:p.Ser42Pro		246329424	NM_175911	Q5VUR5	Missense_Mutation	SNP	ENST00000358120.2	37	CCDS1637.1	.	.	.	.	.	.	.	.	.	.	T	11.64	1.700205	0.30142	.	.	ENSG00000196071	ENST00000366478;ENST00000358120	T;T	0.00446	7.39;7.39	4.07	0.26	0.15588	GPCR, rhodopsin-like superfamily (1);	0.222293	0.22983	N	0.053292	T	0.00300	0.0009	L	0.55990	1.75	0.09310	N	1	P	0.42123	0.771	B	0.36504	0.226	T	0.50491	-0.8822	10	0.38643	T	0.18	.	4.7748	0.13173	0.0:0.2509:0.288:0.4611	.	42	Q8N349	OR2LD_HUMAN	P	42	ENSP00000355434:S42P;ENSP00000350836:S42P	ENSP00000350836:S42P	S	+	1	0	OR2L13	246329424	0.000000	0.05858	0.023000	0.16930	0.013000	0.08279	-2.743000	0.00797	0.137000	0.18759	-0.263000	0.10527	TCG		0.468	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097342.1	NM_175911	
DCHS1	8642	broad.mit.edu	37	11	6643472	6643472	+	Silent	SNP	A	A	C			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:6643472A>C	ENST00000299441.3	-	21	9846	c.9435T>G	c.(9433-9435)ggT>ggG	p.G3145G	TPP1_ENST00000534644.1_5'Flank|RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000533371.1_5'Flank|TPP1_ENST00000528657.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000299427.6_5'Flank	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3145					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G3145G(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGTCAGCGCACCTGCCACAC	0.647																																					p.G3145G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T9435G	11						.						14.0	15.0	15.0					11																	6643472		2189	4275	6464	6600048	SO:0001819	synonymous_variant	8642	exon21			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9435T>G	11.37:g.6643472A>C			6600048	NM_003737	O15098	Silent	SNP	ENST00000299441.3	37	CCDS7771.1																																																																																				0.647	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
BTBD10	84280	broad.mit.edu	37	11	13410492	13410492	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:13410492G>C	ENST00000278174.5	-	9	1559	c.1314C>G	c.(1312-1314)gaC>gaG	p.D438E	BTBD10_ENST00000528120.1_Missense_Mutation_p.D390E|BTBD10_ENST00000530907.1_Missense_Mutation_p.D446E	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	438	Interaction with AKT family members. {ECO:0000250|UniProtKB:Q80X66}.					nucleus (GO:0005634)		p.D438E(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		CTACCAGCTGGTCCTGGGGAA	0.498																																					p.D438E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1314G	11						.						137.0	121.0	126.0					11																	13410492		2200	4294	6494	13367068	SO:0001583	missense	84280	exon9			AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.1314C>G	11.37:g.13410492G>C	ENSP00000278174:p.Asp438Glu		13367068	NM_032320	B7Z228|Q86WG1	Missense_Mutation	SNP	ENST00000278174.5	37	CCDS7811.1	.	.	.	.	.	.	.	.	.	.	G	16.80	3.223663	0.58668	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120	D;D;D	0.82433	-1.61;-1.61;-1.61	5.03	2.01	0.26516	.	0.000000	0.85682	D	0.000000	T	0.78679	0.4321	L	0.29908	0.895	0.58432	D	0.99999	D;D;D	0.58970	0.984;0.984;0.984	P;P;P	0.54238	0.746;0.679;0.679	T	0.72606	-0.4242	10	0.23302	T	0.38	.	9.8146	0.40844	0.238:0.0:0.762:0.0	.	446;438;438	B7Z228;D3DQW7;Q9BSF8	.;.;BTBDA_HUMAN	E	438;446;390	ENSP00000278174:D438E;ENSP00000431186:D446E;ENSP00000435257:D390E	ENSP00000278174:D438E	D	-	3	2	BTBD10	13367068	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	3.334000	0.52097	0.662000	0.31006	0.555000	0.69702	GAC		0.498	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386200.1	NM_032320	
CAT	847	broad.mit.edu	37	11	34489852	34489852	+	Silent	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:34489852G>C	ENST00000241052.4	+	11	1433	c.1344G>C	c.(1342-1344)gtG>gtC	p.V448V		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	448					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.V448V(1)		breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	CATTCTATGTGAACGTGCTGA	0.443																																					p.V448V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1344C	11						.						130.0	130.0	130.0					11																	34489852		2202	4298	6500	34446428	SO:0001819	synonymous_variant	847	exon11			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1344G>C	11.37:g.34489852G>C			34446428	NM_001752	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Silent	SNP	ENST00000241052.4	37	CCDS7891.1																																																																																				0.443	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103197.2	NM_001752	
OR8K1	390157	broad.mit.edu	37	11	56113842	56113842	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:56113842T>G	ENST00000279783.2	+	1	422	c.328T>G	c.(328-330)Ttt>Gtt	p.F110V		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F110V(1)		large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					GCTAGCATTCTTTGAGATTTT	0.408										HNSCC(65;0.19)																											p.F110V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T328G	11						.						180.0	181.0	181.0					11																	56113842		2201	4296	6497	55870418	SO:0001583	missense	390157	exon1			AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.328T>G	11.37:g.56113842T>G	ENSP00000279783:p.Phe110Val		55870418	NM_001002907	B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	ENST00000279783.2	37	CCDS31528.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.092695	0.36952	.	.	ENSG00000150261	ENST00000279783	T	0.00377	7.69	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000079	T	0.00328	0.0010	M	0.63428	1.95	0.09310	N	1	P	0.45474	0.859	B	0.37833	0.259	T	0.52155	-0.8613	10	0.72032	D	0.01	-22.2381	9.2	0.37251	0.0:0.1335:0.0:0.8665	.	110	Q8NGG5	OR8K1_HUMAN	V	110	ENSP00000279783:F110V	ENSP00000279783:F110V	F	+	1	0	OR8K1	55870418	0.756000	0.28383	0.630000	0.29268	0.991000	0.79684	1.479000	0.35453	1.862000	0.54008	0.448000	0.29417	TTT		0.408	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907	
CCDC86	79080	broad.mit.edu	37	11	60615429	60615429	+	Missense_Mutation	SNP	G	G	A	rs376975583		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:60615429G>A	ENST00000227520.5	+	2	845	c.791G>A	c.(790-792)cGc>cAc	p.R264H	CCDC86_ENST00000545580.1_Missense_Mutation_p.R8H|RP11-804A23.4_ENST00000538705.1_RNA	NM_024098.3	NP_077003.1	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	264					viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R264H(1)		endometrium(1)|large_intestine(2)|liver(2)|lung(2)|urinary_tract(3)	10						AAGCCCCTGCGCACATCGTGG	0.617																																					p.R264H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G791A	11						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	104.0	106.0		791	1.3	1.0	11		106	0,8598		0,0,4299	no	missense	CCDC86	NM_024098.3	29	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign	264/361	60615429	1,13003	2203	4299	6502	60372005	SO:0001583	missense	79080	exon2			AK025974	CCDS7993.1	11q12.2	2006-03-16			ENSG00000110104	ENSG00000110104			28359	protein-coding gene	gene with protein product		611293					Standard	NM_024098		Approved	MGC2574	uc001nqa.2	Q9H6F5	OTTHUMG00000167706	ENST00000227520.5:c.791G>A	11.37:g.60615429G>A	ENSP00000227520:p.Arg264His		60372005	NM_024098	B4DY99	Missense_Mutation	SNP	ENST00000227520.5	37	CCDS7993.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.801352	0.31869	2.27E-4	0.0	ENSG00000110104	ENST00000227520;ENST00000545580	T	0.50548	0.74	5.3	1.33	0.21861	.	0.203884	0.42548	N	0.000682	T	0.37461	0.1004	L	0.52206	1.635	0.38152	D	0.938767	B	0.10296	0.003	B	0.06405	0.002	T	0.21690	-1.0238	10	0.40728	T	0.16	-5.176	8.4444	0.32833	0.3236:0.0:0.6764:0.0	.	264	Q9H6F5	CCD86_HUMAN	H	264;8	ENSP00000227520:R264H	ENSP00000227520:R264H	R	+	2	0	CCDC86	60372005	0.648000	0.27313	0.983000	0.44433	0.747000	0.42532	0.419000	0.21247	0.243000	0.21327	-0.948000	0.02665	CGC		0.617	CCDC86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395743.1	NM_024098	
SYT7	9066	broad.mit.edu	37	11	61290608	61290608	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:61290608G>A	ENST00000263846.4	-	8	1373	c.1046C>T	c.(1045-1047)aCg>aTg	p.T349M	SYT7_ENST00000539008.1_Missense_Mutation_p.T632M|SYT7_ENST00000540677.1_Missense_Mutation_p.T424M|SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000542670.1_Missense_Mutation_p.T557M|SYT7_ENST00000542836.1_Missense_Mutation_p.T393M|SYT7_ENST00000535826.1_Missense_Mutation_p.T468M	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	349	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)	p.T349M(2)		kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GATGATGGTCGTCTCCCTCAG	0.567																																					p.T349M												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1046T	11						.						290.0	226.0	248.0					11																	61290608		2202	4299	6501	61047184	SO:0001583	missense	9066	exon8			AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.1046C>T	11.37:g.61290608G>A	ENSP00000263846:p.Thr349Met		61047184	NM_004200	F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126586	0.77549	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826	T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	4.64	4.64	0.57946	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	T	0.75989	0.3925	L	0.28608	0.87	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.67725	0.921;0.953	T	0.77213	-0.2670	10	0.48119	T	0.1	.	18.1087	0.89528	0.0:0.0:1.0:0.0	.	424;349	F5GZU9;O43581	.;SYT7_HUMAN	M	349;424;632;393;557;468	ENSP00000263846:T349M;ENSP00000444201:T424M;ENSP00000439694:T632M;ENSP00000444568:T393M;ENSP00000444019:T557M;ENSP00000437720:T468M	ENSP00000263846:T349M	T	-	2	0	SYT7	61047184	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	4.829000	0.62737	2.583000	0.87209	0.561000	0.74099	ACG		0.567	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
ALG8	79053	broad.mit.edu	37	11	77815451	77815451	+	Silent	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:77815451C>G	ENST00000299626.5	-	11	1298	c.1227G>C	c.(1225-1227)ctG>ctC	p.L409L	ALG8_ENST00000532552.2_5'UTR|ALG8_ENST00000376156.3_Silent_p.L409L	NM_024079.4	NP_076984.2	Q9BVK2	ALG8_HUMAN	ALG8, alpha-1,3-glucosyltransferase	409					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)	p.L409L(1)		NS(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	30	all_cancers(14;3.62e-19)|all_epithelial(13;1.27e-21)|Breast(9;8.51e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;9.66e-25)			CTGTTGTGGTCAGAATCAGAA	0.358																																					p.L409L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1227C	11						.						70.0	71.0	70.0					11																	77815451		2200	4292	6492	77493099	SO:0001819	synonymous_variant	79053	exon11			AJ224875	CCDS8258.1, CCDS41692.1	11q14.1	2013-03-01	2013-03-01		ENSG00000159063	ENSG00000159063	2.4.1.265		23161	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Glc(1)Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	608103	"""asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""				Standard	XM_005274247		Approved	MGC2840	uc001oza.1	Q9BVK2	OTTHUMG00000166594	ENST00000299626.5:c.1227G>C	11.37:g.77815451C>G			77493099	NM_001007027	A6NDW6|O60860	Silent	SNP	ENST00000299626.5	37	CCDS8258.1	.	.	.	.	.	.	.	.	.	.	C	8.594	0.885232	0.17540	.	.	ENSG00000159063	ENST00000530608;ENST00000532306	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.3337	18.8103	0.92056	0.0:1.0:0.0:0.0	.	.	.	.	S	111;196	.	.	X	-	2	2	ALG8	77493099	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.842000	0.39250	2.507000	0.84556	0.655000	0.94253	TGA		0.358	ALG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390637.1	NM_024079	
ME3	10873	broad.mit.edu	37	11	86158137	86158137	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:86158137G>A	ENST00000393324.3	-	11	1603	c.1350C>T	c.(1348-1350)tgC>tgT	p.C450C	ME3_ENST00000543262.1_Silent_p.C450C|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000359636.2_Silent_p.C450C	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	450					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)	p.C450C(1)		endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				TCTCAGCCGTGCACTCGGCCT	0.582																																					p.C450C												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1350T	11						.						68.0	60.0	63.0					11																	86158137		2202	4299	6501	85835785	SO:0001819	synonymous_variant	10873	exon12			X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.1350C>T	11.37:g.86158137G>A			85835785	NM_001161586	B7Z6V0|Q8TBJ0	Silent	SNP	ENST00000393324.3	37	CCDS8277.1																																																																																				0.582	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
FAT3	120114	broad.mit.edu	37	11	92086535	92086535	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:92086535C>T	ENST00000298047.6	+	1	1274	c.1257C>T	c.(1255-1257)taC>taT	p.Y419Y	FAT3_ENST00000409404.2_Silent_p.Y419Y|FAT3_ENST00000541502.1_Silent_p.Y419Y|FAT3_ENST00000525166.1_Silent_p.Y269Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Y419Y(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATGCAGTGTACTTTAAAATTA	0.423										TCGA Ovarian(4;0.039)																											p.Y419Y												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1257T	11						.						65.0	61.0	62.0					11																	92086535		1855	4092	5947	91726183	SO:0001819	synonymous_variant	120114	exon1			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1257C>T	11.37:g.92086535C>T			91726183	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																					0.423	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
OR6M1	390261	broad.mit.edu	37	11	123676334	123676334	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr11:123676334T>C	ENST00000309154.2	-	1	761	c.724A>G	c.(724-726)Atc>Gtc	p.I242V		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I242V(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		ACAACAGTGATGTGAGAAGCA	0.502																																					p.I242V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A724G	11						.						100.0	85.0	90.0					11																	123676334		2202	4299	6501	123181544	SO:0001583	missense	390261	exon1			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.724A>G	11.37:g.123676334T>C	ENSP00000311038:p.Ile242Val		123181544	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	ENST00000309154.2	37	CCDS31696.1	.	.	.	.	.	.	.	.	.	.	T	7.959	0.746509	0.15710	.	.	ENSG00000196099	ENST00000309154	T	0.37058	1.22	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33691	U	0.004659	T	0.22781	0.0550	N	0.21240	0.645	0.25205	N	0.990022	B	0.32968	0.392	B	0.33960	0.173	T	0.15321	-1.0441	10	0.62326	D	0.03	.	6.7148	0.23296	0.0:0.0:0.2428:0.7572	.	242	Q8NGM8	OR6M1_HUMAN	V	242	ENSP00000311038:I242V	ENSP00000311038:I242V	I	-	1	0	OR6M1	123181544	0.224000	0.23674	0.146000	0.22360	0.212000	0.24457	0.053000	0.14184	1.432000	0.47375	0.533000	0.62120	ATC		0.502	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
HACE1	57531	broad.mit.edu	37	6	105244595	105244595	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:105244595A>G	ENST00000262903.4	-	9	1027	c.751T>C	c.(751-753)Tat>Cat	p.Y251H	HACE1_ENST00000369125.2_Missense_Mutation_p.Y251H	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	251					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)	p.Y251H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CTCGGGTGATATTGAATTAAT	0.328																																					p.Y251H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T751C	6						.						76.0	76.0	76.0					6																	105244595		2202	4298	6500	105351288	SO:0001583	missense	57531	exon9			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.751T>C	6.37:g.105244595A>G	ENSP00000262903:p.Tyr251His		105351288	NM_020771	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	ENST00000262903.4	37	CCDS5050.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.386488	0.25031	.	.	ENSG00000085382	ENST00000262903;ENST00000369125;ENST00000519645	T;T;T	0.62232	0.04;0.04;0.04	5.4	3.05	0.35203	Ankyrin repeat-containing domain (2);	0.183555	0.49305	N	0.000150	T	0.15392	0.0371	N	0.04508	-0.205	0.40010	D	0.975272	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08994	-1.0695	10	0.14252	T	0.57	.	7.4126	0.27025	0.6925:0.0:0.3075:0.0	.	251;251	E9PGP0;Q8IYU2	.;HACE1_HUMAN	H	251;251;207	ENSP00000262903:Y251H;ENSP00000358121:Y251H;ENSP00000429765:Y207H	ENSP00000262903:Y251H	Y	-	1	0	HACE1	105351288	1.000000	0.71417	0.999000	0.59377	0.935000	0.57460	5.436000	0.66538	0.890000	0.36211	0.477000	0.44152	TAT		0.328	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041643.2	XM_045095	
TJAP1	93643	broad.mit.edu	37	6	43469402	43469402	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:43469402C>G	ENST00000372445.5	+	6	643	c.267C>G	c.(265-267)gaC>gaG	p.D89E	TJAP1_ENST00000436109.2_Missense_Mutation_p.D89E|TJAP1_ENST00000372452.1_Missense_Mutation_p.D89E|TJAP1_ENST00000483640.1_3'UTR|TJAP1_ENST00000438588.2_Missense_Mutation_p.D89E|TJAP1_ENST00000259751.1_Missense_Mutation_p.D89E|TJAP1_ENST00000372449.1_Missense_Mutation_p.D89E|TJAP1_ENST00000372444.2_Missense_Mutation_p.D89E	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	89					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)		p.D89E(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			AGGAGCTGGACAAATTTAAGG	0.582																																					p.D89E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C267G	6						.						28.0	29.0	28.0					6																	43469402		2203	4300	6503	43577380	SO:0001583	missense	93643	exon6			AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.267C>G	6.37:g.43469402C>G	ENSP00000361522:p.Asp89Glu		43577380	NM_001146016	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.08|13.08	2.130078|2.130078	0.37630|0.37630	.|.	.|.	ENSG00000137221|ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000442878;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588|ENST00000454762	T;T;T;T;T;T;T;T|.	0.78246|.	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16|.	4.91|4.91	3.11|3.11	0.35812|0.35812	.|.	0.062472|.	0.64402|.	D|.	0.000008|.	T|T	0.05960|0.05960	0.0155|0.0155	N|N	0.11560|0.11560	0.145|0.145	0.30291|0.30291	N|N	0.790397|0.790397	B;D;B|.	0.67145|.	0.006;0.996;0.197|.	B;D;B|.	0.77557|.	0.022;0.99;0.134|.	T|T	0.27468|0.27468	-1.0073|-1.0073	10|5	0.06494|.	T|.	0.89|.	-15.9062|-15.9062	2.4402|2.4402	0.04492|0.04492	0.1346:0.4898:0.2067:0.169|0.1346:0.4898:0.2067:0.169	.|.	89;89;89|.	E2QRK7;Q5JTD0;Q5JTD0-2|.	.;TJAP1_HUMAN;.|.	E|E	89|47	ENSP00000361521:D89E;ENSP00000361522:D89E;ENSP00000407080:D89E;ENSP00000390981:D89E;ENSP00000259751:D89E;ENSP00000361530:D89E;ENSP00000361527:D89E;ENSP00000408769:D89E|.	ENSP00000259751:D89E|.	D|Q	+|+	3|1	2|0	TJAP1|TJAP1	43577380|43577380	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.825000|0.825000	0.46686|0.46686	0.894000|0.894000	0.28350|0.28350	1.081000|1.081000	0.41110|0.41110	0.298000|0.298000	0.19748|0.19748	GAC|CAA		0.582	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040629.1	NM_080604	
DOPEY1	23033	broad.mit.edu	37	6	83863236	83863236	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:83863236G>C	ENST00000349129.2	+	31	6396	c.6136G>C	c.(6136-6138)Gct>Cct	p.A2046P	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.A2037P|DOPEY1_ENST00000237163.5_Missense_Mutation_p.A1976P	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2046					protein transport (GO:0015031)			p.A2046P(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ATAGGTTTTGGCTCATCTTTT	0.343																																					p.A2046P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G6136C	6						.						175.0	162.0	167.0					6																	83863236		2203	4297	6500	83919955	SO:0001583	missense	23033	exon31			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6136G>C	6.37:g.83863236G>C	ENSP00000195654:p.Ala2046Pro		83919955	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546830	0.86022	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.28069	1.63;1.7	5.17	5.17	0.71159	.	0.153691	0.64402	D	0.000019	T	0.51227	0.1662	M	0.73430	2.235	0.80722	D	1	D;D;P	0.76494	0.999;0.999;0.934	D;D;P	0.79784	0.993;0.991;0.621	T	0.53690	-0.8403	10	0.66056	D	0.02	.	18.8557	0.92251	0.0:0.0:1.0:0.0	.	1937;2037;2046	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	P	2046;1976;1976	ENSP00000195654:A2046P;ENSP00000237163:A1976P	ENSP00000237163:A1976P	A	+	1	0	DOPEY1	83919955	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	7.412000	0.80091	2.688000	0.91661	0.650000	0.86243	GCT		0.343	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
CGA	1081	broad.mit.edu	37	6	87796017	87796017	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:87796017T>G	ENST00000369582.2	-	3	324	c.224A>C	c.(223-225)aAg>aCg	p.K75T	RN7SKP209_ENST00000516888.1_RNA	NM_000735.3	NP_000726.1	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	75					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|cellular response to hormone stimulus (GO:0032870)|developmental growth (GO:0048589)|follicle-stimulating hormone secretion (GO:0046884)|gonad development (GO:0008406)|luteinizing hormone secretion (GO:0032275)|negative regulation of organ growth (GO:0046621)|peptide hormone processing (GO:0016486)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.K75T(1)		NS(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(1)	15		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		GGTGACGTTCTTTTGGACCAA	0.483																																					p.K75T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A224C	6						.						197.0	193.0	194.0					6																	87796017		2203	4300	6503	87852736	SO:0001583	missense	1081	exon3			V00518	CCDS5007.1, CCDS75492.1	6q14-q21	2013-02-26			ENSG00000135346	ENSG00000135346		"""Endogenous ligands"""	1885	protein-coding gene	gene with protein product	"""follicle-stimulating hormone alpha subunit"", ""chorionic gonadotropin, alpha polypeptide"", ""luteinizing hormone alpha chain"", ""lutropin alpha chain"", ""thyroid-stimulating hormone alpha chain"", ""glycoprotein hormones alpha chain"""	118850				6286817	Standard	NM_000735		Approved	HCG, GPHa, GPHA1, FSHA, LHA, TSHA	uc021zci.1	P01215	OTTHUMG00000015161	ENST00000369582.2:c.224A>C	6.37:g.87796017T>G	ENSP00000358595:p.Lys75Thr		87852736	NM_000735		Missense_Mutation	SNP	ENST00000369582.2	37	CCDS5007.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.043093	0.55003	.	.	ENSG00000135346	ENST00000369582	.	.	.	5.62	5.62	0.85841	.	0.042815	0.85682	D	0.000000	T	0.73814	0.3635	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78130	-0.2324	9	0.87932	D	0	0.3063	15.8151	0.78595	0.0:0.0:0.0:1.0	.	75	P01215	GLHA_HUMAN	T	75	.	ENSP00000358595:K75T	K	-	2	0	CGA	87852736	1.000000	0.71417	0.606000	0.28943	0.001000	0.01503	7.404000	0.79996	2.136000	0.66102	0.477000	0.44152	AAG		0.483	CGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041425.1	NM_000735	
CASP8AP2	9994	broad.mit.edu	37	6	90581012	90581012	+	RNA	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:90581012G>C	ENST00000551025.1	+	0	7234									caspase 8 associated protein 2									p.D1933H(1)		NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		CCTCAGAAATGATGACCGGGA	0.353																																					p.D1933H	Colon(187;1656 2025 17045 31481 39901)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5797C	6						.						72.0	69.0	70.0					6																	90581012		1800	4069	5869	90637733			9994	exon9			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90581012G>C			90637733	NM_001137667		Missense_Mutation	SNP	ENST00000551025.1	37																																																																																					0.353	CASP8AP2-202	KNOWN	basic	processed_transcript	processed_transcript		NM_001137667	
EPHA7	2045	broad.mit.edu	37	6	94068039	94068039	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:94068039G>T	ENST00000369303.4	-	4	1107	c.923C>A	c.(922-924)tCc>tAc	p.S308Y		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	308	Cys-rich.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.S308Y(1)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTCACATCTGGAGGAGCCTTC	0.463																																					p.S308Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C923A	6						.						114.0	105.0	108.0					6																	94068039		2203	4300	6503	94124760	SO:0001583	missense	2045	exon4			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.923C>A	6.37:g.94068039G>T	ENSP00000358309:p.Ser308Tyr		94124760	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.240205	0.58995	.	.	ENSG00000135333	ENST00000369303	T	0.29397	1.57	5.62	5.62	0.85841	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.371469	0.28431	N	0.015377	T	0.22244	0.0536	L	0.52126	1.63	0.80722	D	1	B;B;B	0.29909	0.078;0.261;0.086	B;B;B	0.28011	0.027;0.071;0.085	T	0.04664	-1.0935	10	0.66056	D	0.02	.	19.6472	0.95784	0.0:0.0:1.0:0.0	.	308;308;308	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	Y	308	ENSP00000358309:S308Y	ENSP00000358309:S308Y	S	-	2	0	EPHA7	94124760	1.000000	0.71417	0.987000	0.45799	0.991000	0.79684	7.324000	0.79115	2.652000	0.90054	0.655000	0.94253	TCC		0.463	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
HECA	51696	broad.mit.edu	37	6	139487480	139487482	+	In_Frame_Del	DEL	GAC	GAC	-	rs142291743	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01							Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:139487480_139487482delGAC	ENST00000367658.2	+	2	616_618	c.331_333delGAC	c.(331-333)gacdel	p.D112del	RP1-225E12.2_ENST00000586229.1_RNA|RP1-225E12.2_ENST00000415194.2_RNA|RP1-225E12.2_ENST00000588638.1_RNA|RP1-225E12.2_ENST00000589192.1_RNA|RP1-225E12.2_ENST00000588529.1_RNA|RP1-225E12.2_ENST00000590679.1_RNA|RP1-225E12.2_ENST00000587577.1_RNA|RP1-225E12.3_ENST00000585874.1_RNA|RP1-225E12.2_ENST00000586266.1_RNA	NM_016217.2	NP_057301.1	Q9UBI9	HDC_HUMAN	headcase homolog (Drosophila)	112					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.D111delD(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(68;0.000252)|OV - Ovarian serous cystadenocarcinoma(155;0.000387)		CCTGGAGAAGGACGACTACCAGA	0.567																																					p.111_111del												.	.	1	Deletion - In frame(1)	large_intestine(1)	c.331_333del	6						.																																			139529175	SO:0001651	inframe_deletion	51696	exon2			AB033492	CCDS5194.1	6q23-q24	2010-11-25			ENSG00000112406	ENSG00000112406			21041	protein-coding gene	gene with protein product		607977				11696983, 19643820	Standard	NM_016217		Approved	HDCL, hHDC, HDC, dJ225E12.1	uc003qin.3	Q9UBI9	OTTHUMG00000015686	ENST00000367658.2:c.331_333delGAC	6.37:g.139487483_139487485delGAC	ENSP00000356630:p.Asp112del		139529173	NM_016217		In_Frame_Del	DEL	ENST00000367658.2	37	CCDS5194.1																																																																																				0.567	HECA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042456.1	NM_016217	
PDE10A	10846	broad.mit.edu	37	6	165863797	165863797	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr6:165863797T>A	ENST00000366882.1	-	5	403	c.249A>T	c.(247-249)gaA>gaT	p.E83D	PDE10A_ENST00000539869.2_Missense_Mutation_p.E93D|PDE10A_ENST00000354448.4_Missense_Mutation_p.E83D			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	83					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)	p.E83D(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CCAACCGTTGTTCTATATAGC	0.328																																					p.E83D	Esophageal Squamous(22;308 615 5753 12038 40624)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A249T	6						.						169.0	154.0	159.0					6																	165863797		2203	4300	6503	165783787	SO:0001583	missense	10846	exon5			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.249A>T	6.37:g.165863797T>A	ENSP00000355847:p.Glu83Asp		165783787	NM_006661	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	T	14.12	2.440470	0.43326	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.71341	-0.56;-0.56	4.7	-1.3	0.09259	.	0.099622	0.64402	D	0.000002	T	0.61664	0.2365	L	0.44542	1.39	0.41880	D	0.990315	D;P	0.58970	0.984;0.537	D;B	0.68192	0.956;0.134	T	0.62058	-0.6934	10	0.16896	T	0.51	.	12.3919	0.55362	0.0:0.6521:0.0:0.3479	.	93;83	Q9ULW9;Q9Y233	.;PDE10_HUMAN	D	83;111;93;83;82	ENSP00000355847:E83D;ENSP00000346435:E83D	ENSP00000341187:E93D	E	-	3	2	PDE10A	165783787	0.987000	0.35691	0.986000	0.45419	0.947000	0.59692	0.218000	0.17622	-0.406000	0.07588	-0.468000	0.05107	GAA		0.328	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		
ELAC2	60528	broad.mit.edu	37	17	12909266	12909266	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:12909266G>A	ENST00000338034.4	-	9	1008	c.769C>T	c.(769-771)Ctc>Ttc	p.L257F	ELAC2_ENST00000426905.3_Missense_Mutation_p.L217F|ELAC2_ENST00000395962.2_Missense_Mutation_p.L238F|ELAC2_ENST00000609345.1_5'UTR	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	257					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L257F(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						TTTGCTTTGAGCACCAAGAAG	0.443																																					p.L217F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C649T	17						.						137.0	128.0	131.0					17																	12909266		2203	4300	6503	12849991	SO:0001583	missense	60528	exon8			AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.769C>T	17.37:g.12909266G>A	ENSP00000337445:p.Leu257Phe		12849991	NM_001165962	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	ENST00000338034.4	37	CCDS11164.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.511|8.511	0.866476|0.866476	0.17250|0.17250	.|.	.|.	ENSG00000006744|ENSG00000006744	ENST00000446899|ENST00000426905;ENST00000338034;ENST00000395962	.|T;T;T	.|0.55234	.|0.53;0.53;0.53	4.43|4.43	3.46|3.46	0.39613|0.39613	.|.	.|0.266144	.|0.35555	.|N	.|0.003130	T|T	0.63827|0.63827	0.2544|0.2544	M|M	0.72118|0.72118	2.19|2.19	0.40864|0.40864	D|D	0.983859|0.983859	.|D;D;D;P;D;D	.|0.65815	.|0.981;0.97;0.995;0.94;0.991;0.981	.|P;P;P;P;P;P	.|0.60068	.|0.779;0.608;0.868;0.454;0.779;0.606	T|T	0.66312|0.66312	-0.5955|-0.5955	5|10	.|0.56958	.|D	.|0.05	-27.5499|-27.5499	8.654|8.654	0.34051|0.34051	0.1053:0.0:0.8947:0.0|0.1053:0.0:0.8947:0.0	.|.	.|217;240;238;80;257;17	.|B4DPL9;E9PGJ0;G5E9D5;E7ES68;Q9BQ52;B3KSU9	.|.;.;.;.;RNZ2_HUMAN;.	V|F	33|217;257;238	.|ENSP00000405223:L217F;ENSP00000337445:L257F;ENSP00000379291:L238F	.|ENSP00000337445:L257F	A|L	-|-	2|1	0|0	ELAC2|ELAC2	12849991|12849991	0.817000|0.817000	0.29147|0.29147	0.983000|0.983000	0.44433|0.44433	0.540000|0.540000	0.34992|0.34992	1.353000|1.353000	0.34045|0.34045	1.213000|1.213000	0.43380|0.43380	-0.244000|-0.244000	0.11960|0.11960	GCT|CTC		0.443	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
HS3ST3A1	9955	broad.mit.edu	37	17	13504318	13504318	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:13504318G>A	ENST00000284110.1	-	1	926	c.129C>T	c.(127-129)gcC>gcT	p.A43A		NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	43					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)	p.A43A(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGCAGCGCTCGGCCAGGCAGT	0.716																																					p.A43A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C129T	17						.						28.0	25.0	26.0					17																	13504318		2181	4289	6470	13445043	SO:0001819	synonymous_variant	9955	exon1			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.129C>T	17.37:g.13504318G>A			13445043	NM_006042	A8K7N2	Silent	SNP	ENST00000284110.1	37	CCDS11165.1																																																																																				0.716	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129952.1	NM_006042	
ANKFY1	51479	broad.mit.edu	37	17	4098323	4098323	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:4098323G>C	ENST00000341657.4	-	10	1357	c.1322C>G	c.(1321-1323)gCc>gGc	p.A441G	ANKFY1_ENST00000574367.1_Missense_Mutation_p.A441G|Y_RNA_ENST00000384660.1_RNA|ANKFY1_ENST00000570535.1_Missense_Mutation_p.A483G|ANKFY1_ENST00000433651.1_Missense_Mutation_p.A441G	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	441					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)	p.A441G(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GATGAGTCTGGCTGCAAAGCT	0.587																																					p.A441G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1322G	17						.						51.0	54.0	53.0					17																	4098323		2108	4251	6359	4045072	SO:0001583	missense	51479	exon10			AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.1322C>G	17.37:g.4098323G>C	ENSP00000343362:p.Ala441Gly		4045072	NM_020740	A8KA65|Q5RKV4|Q9ULG5	Missense_Mutation	SNP	ENST00000341657.4	37		.	.	.	.	.	.	.	.	.	.	G	29.1	4.977256	0.92982	.	.	ENSG00000185722	ENST00000341657;ENST00000535427;ENST00000433651	T;T	0.53206	0.63;0.69	5.58	5.58	0.84498	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.60843	0.2300	L	0.39020	1.185	0.80722	D	1	D;P;B;B;B	0.71674	0.998;0.867;0.41;0.204;0.342	D;P;B;B;B	0.80764	0.994;0.658;0.226;0.156;0.142	T	0.58440	-0.7636	10	0.44086	T	0.13	-15.9981	18.5599	0.91096	0.0:0.0:1.0:0.0	.	382;441;441;441;483	F5H754;Q9P2R3-3;Q9P2R3;Q9P2R3-2;Q9P2R3-4	.;.;ANFY1_HUMAN;.;.	G	441;382;441	ENSP00000343362:A441G;ENSP00000416005:A441G	ENSP00000343362:A441G	A	-	2	0	ANKFY1	4045072	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.771000	0.98977	2.644000	0.89710	0.655000	0.94253	GCC		0.587	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
ZNF287	57336	broad.mit.edu	37	17	16456605	16456605	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:16456605A>G	ENST00000395824.1	-	6	1468	c.851T>C	c.(850-852)tTc>tCc	p.F284S	ZNF287_ENST00000395825.3_Missense_Mutation_p.F284S			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	277					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.F277S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		AATTTTCCAGAAGCCACCTTT	0.363																																					p.F284S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T851C	17						.						128.0	134.0	132.0					17																	16456605		2202	4299	6501	16397330	SO:0001583	missense	57336	exon6			AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.851T>C	17.37:g.16456605A>G	ENSP00000379168:p.Phe284Ser		16397330	NM_020653	Q6IAG1	Missense_Mutation	SNP	ENST00000395824.1	37	CCDS11179.2	.	.	.	.	.	.	.	.	.	.	A	1.926	-0.447206	0.04572	.	.	ENSG00000141040	ENST00000395825;ENST00000395824	T;T	0.05025	3.51;3.51	4.35	1.99	0.26369	.	0.128788	0.36409	N	0.002615	T	0.03305	0.0096	N	0.14661	0.345	0.09310	N	1	B	0.22604	0.072	B	0.23574	0.047	T	0.44952	-0.9294	10	0.21540	T	0.41	.	5.4067	0.16326	0.4702:0.3572:0.0:0.1726	.	277	Q9HBT7	ZN287_HUMAN	S	284	ENSP00000379169:F284S;ENSP00000379168:F284S	ENSP00000379168:F284S	F	-	2	0	ZNF287	16397330	0.001000	0.12720	0.019000	0.16419	0.085000	0.17905	0.207000	0.17395	0.387000	0.25024	0.477000	0.44152	TTC		0.363	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130504.1		
CSH2	1443	broad.mit.edu	37	17	61950623	61950623	+	Silent	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:61950623G>T	ENST00000392886.2	-	2	238	c.87C>A	c.(85-87)acC>acA	p.T29T	CSH2_ENST00000345366.7_Silent_p.T29T|CSH2_ENST00000336844.5_Silent_p.T29T|CSH2_ENST00000560142.1_Intron	NM_020991.3	NP_066271.1	P0DML3	CSH2_HUMAN	chorionic somatomammotropin hormone 2	29						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.T29T(2)		endometrium(2)|large_intestine(1)|lung(3)	6						ATAACGGAACGGTTTGGACGG	0.597																																					p.T29T												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C87A	17						.						105.0	103.0	104.0					17																	61950623		2203	4300	6503	59304355	SO:0001819	synonymous_variant	1443	exon2			V00573	CCDS11646.1, CCDS42368.1, CCDS42369.1	17q22-q24	2012-10-02							2441	protein-coding gene	gene with protein product	"""placental lactogen"", ""chorionic somatomammotropin B"""	118820				593368, 6208192	Standard	NM_020991		Approved	hCS-B, CSB, CS-2	uc002jch.3	P0DML3		ENST00000392886.2:c.87C>A	17.37:g.61950623G>T			59304355	NM_022645	P01243|Q0VDB1|Q14407	Silent	SNP	ENST00000392886.2	37	CCDS42369.1																																																																																				0.597	CSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417657.1	NM_020991	
RGS9	8787	broad.mit.edu	37	17	63221156	63221156	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:63221156G>A	ENST00000262406.9	+	18	1511	c.1444G>A	c.(1444-1446)Gtg>Atg	p.V482M	RGS9_ENST00000443584.3_Missense_Mutation_p.V479M|RGS9_ENST00000449996.3_Missense_Mutation_p.V479M	NM_003835.3	NP_003826.2	O75916	RGS9_HUMAN	regulator of G-protein signaling 9	482					dopamine receptor signaling pathway (GO:0007212)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to estrogen (GO:0043627)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)	p.V482M(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(8)|liver(2)|lung(12)|ovary(2)|prostate(3)|skin(3)	41						CCATCTGACCGTGTACACCGG	0.657																																					p.V482M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1444A	17						.						104.0	121.0	115.0					17																	63221156		2061	4205	6266	60651618	SO:0001583	missense	8787	exon18			AF071476	CCDS42373.1, CCDS45764.1	17q24	2008-07-18	2007-08-14			ENSG00000108370		"""Regulators of G-protein signaling"""	10004	protein-coding gene	gene with protein product	"""regulator of G protein signalling 9"", ""regulator of G protein signalling 9L"", ""regulator of G-protein signaling 9L"""	604067	"""regulator of G-protein signalling 9"""			9765512	Standard	NM_003835		Approved	PERRS, RGS9L, MGC26458, MGC111763	uc002jfe.3	O75916		ENST00000262406.9:c.1444G>A	17.37:g.63221156G>A	ENSP00000262406:p.Val482Met		60651618	NM_003835	A8K3C0|O75573|Q696R2|Q8TD64|Q8TD65|Q9HC32|Q9HC33	Missense_Mutation	SNP	ENST00000262406.9	37	CCDS42373.1	.	.	.	.	.	.	.	.	.	.	G	11.32	1.605289	0.28623	.	.	ENSG00000108370	ENST00000262406;ENST00000449996	T;T	0.38560	1.15;1.13	4.56	4.56	0.56223	.	0.228808	0.39407	N	0.001367	T	0.49440	0.1557	L	0.27053	0.805	0.39183	D	0.962824	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74348	0.962;0.962;0.983	T	0.54649	-0.8262	10	0.66056	D	0.02	.	12.756	0.57335	0.0845:0.0:0.9155:0.0	.	482;482;479	A8K1G1;O75916;O75916-5	.;RGS9_HUMAN;.	M	482;479	ENSP00000262406:V482M;ENSP00000396329:V479M	ENSP00000262406:V482M	V	+	1	0	RGS9	60651618	1.000000	0.71417	0.975000	0.42487	0.421000	0.31385	6.572000	0.74005	2.450000	0.82876	0.561000	0.74099	GTG		0.657	RGS9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445885.1	NM_003835	
TMEM104	54868	broad.mit.edu	37	17	72773474	72773474	+	Missense_Mutation	SNP	C	C	T	rs147087919	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:72773474C>T	ENST00000335464.5	+	2	167	c.5C>T	c.(4-6)gCg>gTg	p.A2V	NAT9_ENST00000357814.3_5'Flank|NAT9_ENST00000580216.1_5'Flank|NAT9_ENST00000580301.1_5'Flank|NAT9_ENST00000580632.1_5'Flank|NAT9_ENST00000581136.1_5'Flank|TMEM104_ENST00000582773.1_Missense_Mutation_p.A2V|NAT9_ENST00000583757.1_5'Flank|NAT9_ENST00000578822.1_5'Flank|NAT9_ENST00000582870.1_5'Flank|NAT9_ENST00000582524.1_5'Flank|TMEM104_ENST00000582330.1_Missense_Mutation_p.A2V|NAT9_ENST00000583476.1_5'Flank|TMEM104_ENST00000417024.2_Missense_Mutation_p.A2V	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	2						integral component of membrane (GO:0016021)		p.A2V(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					TTGGAAATGGCGGGTGAAATT	0.498																																					p.A2V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5T	17						.						72.0	71.0	71.0					17																	72773474		2203	4300	6503	70285069	SO:0001583	missense	54868	exon2			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.5C>T	17.37:g.72773474C>T	ENSP00000334849:p.Ala2Val		70285069	NM_017728	Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	ENST00000335464.5	37	CCDS32723.1	.	.	.	.	.	.	.	.	.	.	C	34	5.365410	0.95900	.	.	ENSG00000109066	ENST00000335464;ENST00000417024	T;T	0.56776	1.15;0.44	4.81	4.81	0.61882	.	0.049194	0.85682	D	0.000000	T	0.71962	0.3402	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;P	0.77004	0.989;0.977;0.783	T	0.75875	-0.3163	10	0.72032	D	0.01	-36.5763	15.7722	0.78180	0.0:1.0:0.0:0.0	.	2;2;2	B4DKL7;Q8NE00-2;Q8NE00	.;.;TM104_HUMAN	V	2	ENSP00000334849:A2V;ENSP00000397676:A2V	ENSP00000334849:A2V	A	+	2	0	TMEM104	70285069	0.999000	0.42202	0.952000	0.39060	0.978000	0.69477	4.584000	0.60971	2.392000	0.81423	0.561000	0.74099	GCG		0.498	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444442.1	NM_017728	
SGSH	6448	broad.mit.edu	37	17	78185900	78185900	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:78185900G>C	ENST00000326317.6	-	7	1005	c.919C>G	c.(919-921)Caa>Gaa	p.Q307E	SGSH_ENST00000572208.1_5'Flank|SGSH_ENST00000534910.1_Missense_Mutation_p.Q104E|SGSH_ENST00000570923.1_3'UTR	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	307			Q -> P (in MPS3A). {ECO:0000269|PubMed:15902564}.		carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)	p.Q307E(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TCGCTGACTTGGCCCCAGCGT	0.617																																					p.Q307E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C919G	17						.						74.0	61.0	65.0					17																	78185900		2203	4300	6503	75800495	SO:0001583	missense	6448	exon7			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.919C>G	17.37:g.78185900G>C	ENSP00000314606:p.Gln307Glu		75800495	NM_000199	A8K5E2	Missense_Mutation	SNP	ENST00000326317.6	37	CCDS11770.1	.	.	.	.	.	.	.	.	.	.	G	4.927	0.172160	0.09391	.	.	ENSG00000181523	ENST00000326317;ENST00000534910	D;D	0.98531	-4.98;-4.98	4.62	4.62	0.57501	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.192486	0.45126	D	0.000381	D	0.93808	0.8020	N	0.13140	0.3	0.45541	D	0.998499	B	0.06786	0.001	B	0.15484	0.013	D	0.90487	0.4464	10	0.02654	T	1	-26.7145	17.0355	0.86474	0.0:0.0:1.0:0.0	.	307	P51688	SPHM_HUMAN	E	307;104	ENSP00000314606:Q307E;ENSP00000437778:Q104E	ENSP00000314606:Q307E	Q	-	1	0	SGSH	75800495	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.084000	0.57650	2.115000	0.64714	0.557000	0.71058	CAA		0.617	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437695.1	NM_000199	
SGSH	6448	broad.mit.edu	37	17	78195518	78195518	+	5'Flank	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr17:78195518C>A	ENST00000326317.6	-	0	0				SGSH_ENST00000572208.1_5'Flank|SLC26A11_ENST00000571602.1_3'UTR|SLC26A11_ENST00000361193.3_Silent_p.V53V|SGSH_ENST00000534910.1_5'Flank|SLC26A11_ENST00000546047.2_Silent_p.V53V|SLC26A11_ENST00000572725.1_Silent_p.V53V|SLC26A11_ENST00000411502.3_Silent_p.V53V|SGSH_ENST00000570923.1_5'Flank	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase						carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)	p.V53V(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGGATTTCGTCGCCGGCCTCT	0.677																																					p.V53V												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C159A	17						.						31.0	33.0	32.0					17																	78195518		2203	4300	6503	75810113	SO:0001631	upstream_gene_variant	284129	exon2			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688			17.37:g.78195518C>A	Exception_encountered		75810113	NM_001166349	A8K5E2	Silent	SNP	ENST00000326317.6	37	CCDS11770.1																																																																																				0.677	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437695.1	NM_000199	
HUNK	30811	broad.mit.edu	37	21	33331199	33331199	+	Missense_Mutation	SNP	C	C	T	rs576162040		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr21:33331199C>T	ENST00000270112.2	+	5	1151	c.791C>T	c.(790-792)aCg>aTg	p.T264M		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.T264M(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CTGCCTTTCACGGTGGAGCCT	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		19682	0.001		0.0	False		,,,				2504	0.0				p.T264M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C791T	21						.						152.0	136.0	141.0					21																	33331199		2203	4300	6503	32253070	SO:0001583	missense	30811	exon5			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.791C>T	21.37:g.33331199C>T	ENSP00000270112:p.Thr264Met		32253070	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607871	0.87258	.	.	ENSG00000142149	ENST00000270112	T	0.65916	-0.18	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	L	0.45422	1.42	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.76753	-0.2843	10	0.87932	D	0	-10.7685	18.2097	0.89866	0.0:1.0:0.0:0.0	.	264	P57058	HUNK_HUMAN	M	264	ENSP00000270112:T264M	ENSP00000270112:T264M	T	+	2	0	HUNK	32253070	1.000000	0.71417	0.951000	0.38953	0.937000	0.57800	7.104000	0.77024	2.525000	0.85131	0.655000	0.94253	ACG		0.537	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
ACSM2A	123876	broad.mit.edu	37	16	20497974	20497974	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:20497974A>G	ENST00000573854.1	+	14	1822	c.1708A>G	c.(1708-1710)Atg>Gtg	p.M570V	ACSM2A_ENST00000396104.2_Missense_Mutation_p.M570V|ACSM2A_ENST00000536134.1_Missense_Mutation_p.M342V|AC137056.1_ENST00000593357.1_5'Flank|ACSM2A_ENST00000219054.6_Missense_Mutation_p.M570V|ACSM2A_ENST00000575690.1_Missense_Mutation_p.M570V|ACSM2A_ENST00000417235.2_Missense_Mutation_p.M491V	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	570					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)	p.M570V(1)		breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGAGTGGAAGATGTCCGGAAA	0.468																																					p.M570V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1708G	16						.						200.0	190.0	193.0					16																	20497974		2203	4300	6503	20405475	SO:0001583	missense	123876	exon15			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1708A>G	16.37:g.20497974A>G	ENSP00000459451:p.Met570Val		20405475	NM_001010845	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	37	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	A	3.951	-0.012173	0.07727	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.43294	0.95;0.98;1.51;0.98	2.88	2.88	0.33553	.	2.011570	0.03264	U	0.183740	T	0.27933	0.0688	N	0.08118	0	0.38813	D	0.95546	B	0.06786	0.001	B	0.04013	0.001	T	0.15896	-1.0421	10	0.51188	T	0.08	-0.5111	9.1914	0.37202	1.0:0.0:0.0:0.0	.	570	Q08AH3	ACS2A_HUMAN	V	491;570;342;570	ENSP00000392169:M491V;ENSP00000219054:M570V;ENSP00000445082:M342V;ENSP00000379411:M570V	ENSP00000219054:M570V	M	+	1	0	ACSM2A	20405475	0.997000	0.39634	0.428000	0.26697	0.039000	0.13416	3.339000	0.52135	1.565000	0.49641	0.254000	0.18369	ATG		0.468	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
HS3ST2	9956	broad.mit.edu	37	16	22826314	22826314	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:22826314G>T	ENST00000261374.3	+	1	817	c.383G>T	c.(382-384)cGg>cTg	p.R128L		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	128					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)	p.R128L(1)		breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		GGGGGCACCCGGGCCGTGCTG	0.652																																					p.R128L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G383T	16						.						13.0	16.0	15.0					16																	22826314		2181	4278	6459	22733815	SO:0001583	missense	9956	exon1			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.383G>T	16.37:g.22826314G>T	ENSP00000261374:p.Arg128Leu		22733815	NM_006043	Q52LZ1	Missense_Mutation	SNP	ENST00000261374.3	37	CCDS10606.1	.	.	.	.	.	.	.	.	.	.	G	32	5.118617	0.94385	.	.	ENSG00000122254	ENST00000261374;ENST00000540146	T	0.44881	0.91	5.02	5.02	0.67125	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	T	0.74504	0.3725	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83033	-0.0161	10	0.87932	D	0	.	16.9118	0.86142	0.0:0.0:1.0:0.0	.	128	Q9Y278	HS3S2_HUMAN	L	128;136	ENSP00000261374:R128L	ENSP00000261374:R128L	R	+	2	0	HS3ST2	22733815	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.240000	0.95396	2.315000	0.78130	0.655000	0.94253	CGG		0.652	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211598.1	NM_006043	
SRCAP	10847	broad.mit.edu	37	16	30748499	30748499	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:30748499C>T	ENST00000262518.4	+	34	7523	c.7138C>T	c.(7138-7140)Cgg>Tgg	p.R2380W	SRCAP_ENST00000395059.2_Missense_Mutation_p.R2318W|SRCAP_ENST00000344771.4_Missense_Mutation_p.R2222W	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2380					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.R2380W(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGGCACCCACCGGCGCAGTAA	0.652																																					p.R2380W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C7138T	16						.						39.0	43.0	42.0					16																	30748499		2197	4300	6497	30656000	SO:0001583	missense	10847	exon34			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7138C>T	16.37:g.30748499C>T	ENSP00000262518:p.Arg2380Trp		30656000	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697016	0.48202	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.93366	-3.13;-3.19;-3.21	4.8	4.8	0.61643	.	0.000000	0.42682	D	0.000670	D	0.92450	0.7603	N	0.08118	0	0.33581	D	0.599891	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.981	D	0.95121	0.8246	10	0.72032	D	0.01	-1.144	16.865	0.86027	0.0:1.0:0.0:0.0	.	2318;2380	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	W	2380;2318;2222	ENSP00000262518:R2380W;ENSP00000378499:R2318W;ENSP00000343042:R2222W	ENSP00000262518:R2380W	R	+	1	2	SRCAP	30656000	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.762000	0.47597	2.513000	0.84729	0.558000	0.71614	CGG		0.652	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CCDC113	29070	broad.mit.edu	37	16	58312466	58312466	+	Silent	SNP	C	C	T	rs571059899	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:58312466C>T	ENST00000219299.4	+	8	1051	c.972C>T	c.(970-972)taC>taT	p.Y324Y	CCDC113_ENST00000443128.2_Silent_p.Y270Y	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	324						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)		p.Y324Y(1)		large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						TGATGACTTACGTCCGGGAGA	0.582													C|||	2	0.000399361	0.0	0.0	5008	,	,		16439	0.002		0.0	False		,,,				2504	0.0				p.Y270Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C810T	16						.						61.0	62.0	62.0					16																	58312466		2198	4300	6498	56869967	SO:0001819	synonymous_variant	29070	exon7			AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.972C>T	16.37:g.58312466C>T			56869967	NM_001142302	B2RAQ7|B4DR20|Q9NZX2	Silent	SNP	ENST00000219299.4	37	CCDS10795.1																																																																																				0.582	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257387.2	NM_014157	
PRSS54	221191	broad.mit.edu	37	16	58325032	58325032	+	Missense_Mutation	SNP	C	C	T	rs367701903		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:58325032C>T	ENST00000219301.4	-	4	488	c.94G>A	c.(94-96)Gtc>Atc	p.V32I	PRSS54_ENST00000567164.1_Missense_Mutation_p.V32I|PRSS54_ENST00000543437.1_Intron	NM_001080492.1	NP_001073961.1	Q6PEW0	PRS54_HUMAN	protease, serine, 54	32						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.V32I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GCTTTCTGGACGCCACAACCT	0.617																																					p.V32I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G94A	16						.	C	ILE/VAL	0,4396		0,0,2198	54.0	46.0	49.0		94	0.8	1.0	16		49	1,8599	1.2+/-3.3	0,1,4299	no	missense	PRSS54	NM_001080492.1	29	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	benign	32/396	58325032	1,12995	2198	4300	6498	56882533	SO:0001583	missense	221191	exon4			AK058068	CCDS32463.1	16q21	2010-05-07			ENSG00000103023	ENSG00000103023		"""Serine peptidases / Serine peptidases"""	26336	protein-coding gene	gene with protein product	"""cancer/testis antigen 67"""					17521433	Standard	NM_001080492		Approved	FLJ25339, KLKBL4, CT67	uc002enf.3	Q6PEW0		ENST00000219301.4:c.94G>A	16.37:g.58325032C>T	ENSP00000219301:p.Val32Ile		56882533	NM_001080492	Q96LN9|Q9NT77	Missense_Mutation	SNP	ENST00000219301.4	37	CCDS32463.1	.	.	.	.	.	.	.	.	.	.	C	0.946	-0.707839	0.03230	0.0	1.16E-4	ENSG00000103023	ENST00000219301	D	0.88975	-2.45	5.85	0.827	0.18835	Peptidase cysteine/serine, trypsin-like (1);	0.224009	0.30244	N	0.010078	T	0.62853	0.2462	N	0.03050	-0.425	0.21020	N	0.999801	B	0.17852	0.024	B	0.09377	0.004	T	0.55667	-0.8105	10	0.02654	T	1	-15.9758	1.2558	0.01991	0.1453:0.1673:0.151:0.5364	.	32	Q6PEW0	PRS54_HUMAN	I	32	ENSP00000219301:V32I	ENSP00000219301:V32I	V	-	1	0	PRSS54	56882533	0.983000	0.35010	1.000000	0.80357	0.034000	0.12701	-0.151000	0.10175	0.129000	0.18514	-0.302000	0.09304	GTC		0.617	PRSS54-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422556.1	NM_001080492	
CTCF	10664	broad.mit.edu	37	16	67644806	67644806	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:67644806C>G	ENST00000264010.4	+	3	515	c.71C>G	c.(70-72)aCt>aGt	p.T24S	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	24					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.T24S(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GAGAGAAAGACTTACCAGAGA	0.522																																					p.T24S	Colon(175;1200 1966 6945 23069 27405)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C71G	16						.						51.0	57.0	55.0					16																	67644806		2198	4300	6498	66202307	SO:0001583	missense	10664	exon3			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.71C>G	16.37:g.67644806C>G	ENSP00000264010:p.Thr24Ser		66202307	NM_006565	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	37	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569346	0.86439	.	.	ENSG00000102974	ENST00000264010	T	0.11712	2.75	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	T	0.09949	0.0244	N	0.24115	0.695	0.80722	D	1	B	0.29378	0.243	B	0.24541	0.054	T	0.13953	-1.0490	10	0.87932	D	0	-2.5955	18.8924	0.92410	0.0:1.0:0.0:0.0	.	24	P49711	CTCF_HUMAN	S	24	ENSP00000264010:T24S	ENSP00000264010:T24S	T	+	2	0	CTCF	66202307	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.646000	0.61411	2.696000	0.92011	0.655000	0.94253	ACT		0.522	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
CMTR2	55783	broad.mit.edu	37	16	71319233	71319233	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:71319233C>G	ENST00000338099.5	-	3	927	c.591G>C	c.(589-591)ttG>ttC	p.L197F	CMTR2_ENST00000434935.2_Missense_Mutation_p.L197F			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	197	Adrift-type SAM-dependent 2'-O-MTase. {ECO:0000255|PROSITE-ProRule:PRU00946}.				7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)	p.L197F(1)									ACCACCAGTGCAAGGTATTTG	0.428																																					p.L197F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G591C	16						.						125.0	115.0	118.0					16																	71319233		2198	4300	6498	69876734	SO:0001583	missense	55783	exon3			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.591G>C	16.37:g.71319233C>G	ENSP00000337512:p.Leu197Phe		69876734	NM_018348	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	ENST00000338099.5	37	CCDS10898.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428687	0.43122	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.37411	1.2;1.2	5.49	2.37	0.29283	Ribosomal RNA methyltransferase RrmJ/FtsJ (1);	0.154190	0.44483	D	0.000450	T	0.53449	0.1797	M	0.70903	2.155	0.58432	D	0.99999	D	0.89917	1.0	D	0.91635	0.999	T	0.47911	-0.9080	10	0.46703	T	0.11	-16.2939	8.5142	0.33235	0.0:0.5822:0.0:0.4178	.	197	Q8IYT2	FTSJ1_HUMAN	F	197	ENSP00000337512:L197F;ENSP00000411148:L197F	ENSP00000337512:L197F	L	-	3	2	FTSJD1	69876734	1.000000	0.71417	0.365000	0.25901	0.992000	0.81027	0.920000	0.28705	0.326000	0.23384	0.556000	0.70494	TTG		0.428	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348	
ZNF23	7571	broad.mit.edu	37	16	71483092	71483092	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:71483092G>C	ENST00000393539.2	-	6	1649	c.836C>G	c.(835-837)cCc>cGc	p.P279R	ZNF23_ENST00000357254.4_Missense_Mutation_p.P279R|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000428724.2_Missense_Mutation_p.P221R|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000564528.1_Missense_Mutation_p.P221R|ZNF23_ENST00000417828.1_Missense_Mutation_p.P279R	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P279R(1)		NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		GCACTGATAGGGCTTCTCTCC	0.468																																					p.P279R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C836G	16						.						98.0	95.0	96.0					16																	71483092		2198	4300	6498	70040593	SO:0001583	missense	7571	exon6			X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.836C>G	16.37:g.71483092G>C	ENSP00000377171:p.Pro279Arg		70040593	NM_145911	Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	ENST00000393539.2	37	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308714	0.60305	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742;ENST00000358700	T;T;T;T;T	0.34667	1.64;1.64;1.64;1.64;1.35	3.7	3.7	0.42460	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40908	D	0.000984	T	0.58595	0.2133	M	0.75447	2.3	0.53005	D	0.999969	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.962	T	0.63708	-0.6576	10	0.66056	D	0.02	-16.353	13.7712	0.63026	0.0:0.0:1.0:0.0	.	279;279	B3KR55;P17027	.;ZNF23_HUMAN	R	279;279;279;221;221;79	ENSP00000377171:P279R;ENSP00000349796:P279R;ENSP00000395712:P279R;ENSP00000387673:P221R;ENSP00000351535:P79R	ENSP00000349796:P279R	P	-	2	0	ZNF23	70040593	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.571000	0.82399	2.371000	0.80710	0.561000	0.74099	CCC		0.468	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911	
FBXO31	79791	broad.mit.edu	37	16	87369863	87369863	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:87369863C>T	ENST00000311635.7	-	6	752	c.740G>A	c.(739-741)cGg>cAg	p.R247Q	RP11-178L8.4_ENST00000568879.1_5'Flank	NM_001282683.1|NM_024735.3	NP_001269612.1|NP_079011.3	Q5XUX0	FBX31_HUMAN	F-box protein 31	247					cellular response to DNA damage stimulus (GO:0006974)|cyclin catabolic process (GO:0008054)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)	p.R247Q(1)|p.R75Q(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0272)		CAGCCACGTCCGAAACTCCTT	0.547																																					p.R247Q												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G740A	16						.						141.0	110.0	120.0					16																	87369863		2198	4300	6498	85927364	SO:0001583	missense	79791	exon6			BC002985	CCDS32501.1, CCDS73922.1	16q24	2008-12-18	2004-05-27			ENSG00000103264		"""F-boxes /  ""other"""""	16510	protein-coding gene	gene with protein product		609102	"""F-box only protein 31"""				Standard	NM_024735		Approved	FBX14, FBXO14, Fbx31, MGC15419	uc002fjw.3	Q5XUX0		ENST00000311635.7:c.740G>A	16.37:g.87369863C>T	ENSP00000310841:p.Arg247Gln		85927364	NM_024735	Q5K680|Q8WYV1|Q96D73|Q9UFV4	Missense_Mutation	SNP	ENST00000311635.7	37	CCDS32501.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418788	0.83559	.	.	ENSG00000103264	ENST00000311635	T	0.69306	-0.39	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.70002	0.3174	N	0.17082	0.46	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	T	0.72354	-0.4319	10	0.38643	T	0.18	-16.1671	17.4779	0.87666	0.0:1.0:0.0:0.0	.	247;139	Q5XUX0;Q5XUX0-2	FBX31_HUMAN;.	Q	247	ENSP00000310841:R247Q	ENSP00000310841:R247Q	R	-	2	0	FBXO31	85927364	1.000000	0.71417	0.998000	0.56505	0.823000	0.46562	7.565000	0.82337	2.208000	0.71279	0.561000	0.74099	CGG		0.547	FBXO31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430799.2	NM_024735	
TUBB3	10381	broad.mit.edu	37	16	90002152	90002152	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr16:90002152G>T	ENST00000315491.7	+	4	1416	c.1293G>T	c.(1291-1293)gaG>gaT	p.E431D	TUBB3_ENST00000554444.1_Missense_Mutation_p.E359D|TUBB3_ENST00000304984.5_Missense_Mutation_p.E359D|TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000556922.1_Missense_Mutation_p.E778D	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	431					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.E431D(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	CCACGGCCGAGGAAGAGGGCG	0.652																																					p.E431D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1293T	16						.						77.0	73.0	74.0					16																	90002152		2198	4300	6498	88529653	SO:0001583	missense	10381	exon4			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.1293G>T	16.37:g.90002152G>T	ENSP00000320295:p.Glu431Asp		88529653	NM_006086	A8K854|Q9BTZ0|Q9BW10	Missense_Mutation	SNP	ENST00000315491.7	37	CCDS10988.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.075822	0.36662	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000198211;ENSG00000198211	ENST00000556922;ENST00000555399;ENST00000304984;ENST00000554444;ENST00000315491	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	4.66	4.66	0.58398	.	0.000000	0.56097	D	0.000022	T	0.51958	0.1705	N	0.03304	-0.355	0.47009	D	0.999287	B;B	0.15141	0.0;0.012	B;B	0.11329	0.0;0.006	T	0.49960	-0.8883	9	.	.	.	.	16.6871	0.85311	0.0:0.0:1.0:0.0	.	431;431	Q13509;B2RBD5	TBB3_HUMAN;.	D	778;431;359;359;431	ENSP00000451560:E778D;ENSP00000302777:E359D;ENSP00000451617:E359D;ENSP00000320295:E431D	.	E	+	3	2	RP11-566K11.2;TUBB3	88529653	0.999000	0.42202	1.000000	0.80357	0.937000	0.57800	0.386000	0.20702	2.313000	0.78055	0.561000	0.74099	GAG		0.652	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272874.1	NM_006086	
ZNF521	25925	broad.mit.edu	37	18	22805162	22805162	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr18:22805162C>T	ENST00000361524.3	-	4	2868	c.2720G>A	c.(2719-2721)cGa>cAa	p.R907Q	ZNF521_ENST00000584787.1_Missense_Mutation_p.R687Q|ZNF521_ENST00000538137.2_Missense_Mutation_p.R907Q|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	907					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.R907Q(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GTTGTGGTCTCGGAGCTGGTG	0.498			T	PAX5	ALL																																p.R907Q			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2720A	18						.						119.0	114.0	116.0					18																	22805162		2203	4300	6503	21059160	SO:0001583	missense	25925	exon4			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2720G>A	18.37:g.22805162C>T	ENSP00000354794:p.Arg907Gln		21059160	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532333	0.45073	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.09630	2.96;2.98	6.07	6.07	0.98685	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	M	0.81239	2.535	0.40226	D	0.977796	D	0.89917	1.0	D	0.70716	0.97	T	0.03077	-1.1075	10	0.20046	T	0.44	-18.5157	20.6439	0.99570	0.0:1.0:0.0:0.0	.	907	Q96K83	ZN521_HUMAN	Q	907;941;907	ENSP00000354794:R907Q;ENSP00000382352:R907Q	ENSP00000354794:R907Q	R	-	2	0	ZNF521	21059160	1.000000	0.71417	0.444000	0.26895	0.976000	0.68499	7.487000	0.81328	2.884000	0.98904	0.655000	0.94253	CGA		0.498	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
L3MBTL4	91133	broad.mit.edu	37	18	6263993	6263993	+	Missense_Mutation	SNP	A	A	C			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr18:6263993A>C	ENST00000284898.6	-	5	372	c.172T>G	c.(172-174)Ttg>Gtg	p.L58V	L3MBTL4_ENST00000400105.2_Missense_Mutation_p.L58V|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.L58V|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.L58V	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	58					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.L58V(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TGTTCTTTCAAGTACCACTCC	0.438																																					p.L58V	Esophageal Squamous(41;748 902 17366 28959 43175)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T172G	18						.						88.0	90.0	90.0					18																	6263993		2203	4300	6503	6253993	SO:0001583	missense	91133	exon5			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.172T>G	18.37:g.6263993A>C	ENSP00000284898:p.Leu58Val		6253993	NM_173464	A8MTL8|Q8IXS3	Missense_Mutation	SNP	ENST00000284898.6	37	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	A	10.71	1.428191	0.25726	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.04	-7.54	0.01332	.	0.000000	0.49305	D	0.000147	D	0.93288	0.7861	M	0.69185	2.1	0.47037	D	0.999297	D	0.89917	1.0	D	0.91635	0.999	D	0.92556	0.6054	10	0.87932	D	0	.	13.0768	0.59091	0.6629:0.0:0.3371:0.0	.	58	Q8NA19	LMBL4_HUMAN	V	58	ENSP00000382976:L58V;ENSP00000318543:L58V;ENSP00000284898:L58V;ENSP00000382975:L58V	ENSP00000284898:L58V	L	-	1	2	L3MBTL4	6253993	0.014000	0.17966	0.305000	0.25099	0.976000	0.68499	-0.754000	0.04787	-1.294000	0.02360	-0.256000	0.11100	TTG		0.438	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	
CCDC178	374864	broad.mit.edu	37	18	30806811	30806811	+	Silent	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr18:30806811T>C	ENST00000383096.3	-	16	1784	c.1602A>G	c.(1600-1602)gaA>gaG	p.E534E	CCDC178_ENST00000583930.1_Silent_p.E534E|CCDC178_ENST00000402325.1_Silent_p.E534E|CCDC178_ENST00000300227.8_Silent_p.E534E|CCDC178_ENST00000406524.2_Silent_p.E534E|CCDC178_ENST00000579947.1_Silent_p.E534E|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000403303.1_Silent_p.E534E			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	534								p.E534E(2)									TCAGGAATTCTTCTCTACCCT	0.284																																					p.E534E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.A1602G	18						.						68.0	69.0	69.0					18																	30806811		2203	4300	6503	29060809	SO:0001819	synonymous_variant	374864	exon16			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.1602A>G	18.37:g.30806811T>C			29060809	NM_198995	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	ENST00000383096.3	37	CCDS42424.1																																																																																				0.284	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
FBXO15	201456	broad.mit.edu	37	18	71740902	71740902	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr18:71740902A>G	ENST00000419743.2	-	10	1406	c.1327T>C	c.(1327-1329)Tcc>Ccc	p.S443P	FBXO15_ENST00000580806.1_5'UTR|FBXO15_ENST00000269500.5_Missense_Mutation_p.S367P	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	443						SCF ubiquitin ligase complex (GO:0019005)		p.S367P(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		CACACCGGGGAACTGAAACAC	0.478																																					p.S367P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1099C	18						.						183.0	171.0	175.0					18																	71740902		2203	4300	6503	69891882	SO:0001583	missense	201456	exon10			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.1327T>C	18.37:g.71740902A>G	ENSP00000393154:p.Ser443Pro		69891882	NM_152676	B3KST3	Missense_Mutation	SNP	ENST00000419743.2	37	CCDS45884.1	.	.	.	.	.	.	.	.	.	.	a	19.20	3.781400	0.70222	.	.	ENSG00000141665	ENST00000269500;ENST00000419743	T;T	0.44881	0.91;0.91	5.9	4.73	0.59995	.	0.159438	0.52532	D	0.000063	T	0.60843	0.2300	M	0.69823	2.125	0.30247	N	0.794404	D;D	0.76494	0.999;0.998	D;D	0.66196	0.942;0.915	T	0.65434	-0.6169	10	0.87932	D	0	-21.7078	12.6173	0.56584	0.5687:0.4313:0.0:0.0	.	443;367	B3KST3;Q8NCQ5	.;FBX15_HUMAN	P	367;443	ENSP00000269500:S367P;ENSP00000393154:S443P	ENSP00000269500:S367P	S	-	1	0	FBXO15	69891882	1.000000	0.71417	0.996000	0.52242	0.888000	0.51559	2.264000	0.43302	1.043000	0.40175	0.529000	0.55759	TCC		0.478	FBXO15-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000444223.1	NM_152676	
CBLB	868	broad.mit.edu	37	3	105421116	105421116	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:105421116C>T	ENST00000264122.4	-	12	2102	c.1781G>A	c.(1780-1782)tGc>tAc	p.C594Y	CBLB_ENST00000403724.1_Missense_Mutation_p.C594Y|CBLB_ENST00000405772.1_Missense_Mutation_p.C594Y|CBLB_ENST00000394027.3_Missense_Mutation_p.C616Y	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	594	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C594Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						ATCCCGAGGGCACCATGCTTC	0.522			Mis S		AML																																p.C594Y	GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1781A	3						.						116.0	105.0	109.0					3																	105421116		2203	4300	6503	106903806	SO:0001583	missense	868	exon12			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1781G>A	3.37:g.105421116C>T	ENSP00000264122:p.Cys594Tyr		106903806	NM_170662	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	ENST00000264122.4	37	CCDS2948.1	.	.	.	.	.	.	.	.	.	.	C	6.273	0.418552	0.11870	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.83837	-1.75;-1.73;-1.76;-1.77	5.67	5.67	0.87782	.	0.188780	0.64402	D	0.000020	T	0.77226	0.4099	L	0.36672	1.1	0.80722	D	1	B;B;B	0.22983	0.019;0.078;0.047	B;B;B	0.21917	0.017;0.037;0.015	T	0.71009	-0.4716	9	.	.	.	-11.2839	17.9312	0.88998	0.0:1.0:0.0:0.0	.	616;594;594	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	Y	594;616;594;594	ENSP00000264122:C594Y;ENSP00000377595:C616Y;ENSP00000384816:C594Y;ENSP00000384938:C594Y	.	C	-	2	0	CBLB	106903806	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.037000	0.70956	2.663000	0.90544	0.536000	0.68110	TGC		0.522	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319417.2	NM_170662	
TMEM43	79188	broad.mit.edu	37	3	14176378	14176378	+	Missense_Mutation	SNP	C	C	G	rs533275736		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:14176378C>G	ENST00000306077.4	+	8	946	c.692C>G	c.(691-693)cCc>cGc	p.P231R	RP11-434D12.1_ENST00000608606.1_5'Flank	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	231					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.P231R(1)		breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						AGCGAAAATCCCAAGTATCCA	0.547																																					p.P231R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C692G	3						.						86.0	86.0	86.0					3																	14176378		2203	4300	6503	14151379	SO:0001583	missense	79188	exon8			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.692C>G	3.37:g.14176378C>G	ENSP00000303992:p.Pro231Arg		14151379	NM_024334	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	ENST00000306077.4	37	CCDS2618.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240438	0.79912	.	.	ENSG00000170876	ENST00000306077	T	0.37235	1.21	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.54663	0.1872	L	0.48362	1.52	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.87578	0.998;0.905	T	0.50634	-0.8805	10	0.42905	T	0.14	-31.7777	18.0052	0.89207	0.0:1.0:0.0:0.0	.	161;231	Q8TEP9;Q9BTV4	.;TMM43_HUMAN	R	231	ENSP00000303992:P231R	ENSP00000303992:P231R	P	+	2	0	TMEM43	14151379	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	6.389000	0.73199	2.491000	0.84063	0.491000	0.48974	CCC		0.547	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252030.2	NM_024334	
TF	7018	broad.mit.edu	37	3	133496021	133496021	+	Silent	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:133496021A>G	ENST00000402696.3	+	16	2486	c.2001A>G	c.(1999-2001)gaA>gaG	p.E667E	TF_ENST00000264998.3_Silent_p.E540E	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	667	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.E667E(1)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	ACACATATGAAAAATACTTAG	0.448																																					p.E667E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A2001G	3						.						78.0	74.0	76.0					3																	133496021		2203	4300	6503	134978711	SO:0001819	synonymous_variant	7018	exon16				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.2001A>G	3.37:g.133496021A>G			134978711	NM_001063	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Silent	SNP	ENST00000402696.3	37	CCDS3080.1																																																																																				0.448	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317775.1	NM_001063	
NCEH1	57552	broad.mit.edu	37	3	172363473	172363473	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:172363473T>C	ENST00000475381.1	-	3	610	c.377A>G	c.(376-378)tAt>tGt	p.Y126C	NCEH1_ENST00000273512.3_Missense_Mutation_p.Y158C|NCEH1_ENST00000538775.1_Missense_Mutation_p.Y166C|NCEH1_ENST00000543711.1_5'UTR			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	126					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)	p.Y158C(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						CTCATCATAATACCTGATTTC	0.323																																					p.Y166C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A497G	3						.						132.0	142.0	139.0					3																	172363473		2203	4297	6500	173846167	SO:0001583	missense	57552	exon3			AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.377A>G	3.37:g.172363473T>C	ENSP00000418571:p.Tyr126Cys		173846167	NM_001146276	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	ENST00000475381.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.77|14.77	2.634963|2.634963	0.47049|0.47049	.|.	.|.	ENSG00000144959|ENSG00000144959	ENST00000424772|ENST00000475381;ENST00000538775;ENST00000273512	.|T;T;T	.|0.05025	.|3.65;3.51;3.66	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Alpha/beta hydrolase fold-3 (1);	.|0.273474	.|0.36338	.|N	.|0.002653	T|T	0.06325|0.06325	0.0163|0.0163	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D;P	.|0.56287	.|0.975;0.897	.|P;P	.|0.47102	.|0.525;0.537	T|T	0.38478|0.38478	-0.9659|-0.9659	6|10	0.24483|0.40728	T|T	0.36|0.16	-7.42|-7.42	7.0155|7.0155	0.24885|0.24885	0.1533:0.0:0.14:0.7067|0.1533:0.0:0.14:0.7067	.|.	.|166;126	.|F5H7K4;Q6PIU2	.|.;NCEH1_HUMAN	V|C	157|126;166;158	.|ENSP00000418571:Y126C;ENSP00000442464:Y166C;ENSP00000273512:Y158C	ENSP00000402196:I82V|ENSP00000273512:Y158C	I|Y	-|-	1|2	0|0	NCEH1|NCEH1	173846167|173846167	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.971000|0.971000	0.66376|0.66376	2.594000|2.594000	0.46189|0.46189	1.959000|1.959000	0.56917|0.56917	0.402000|0.402000	0.26972|0.26972	ATT|TAT		0.323	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000346367.3	NM_020792	
CCDC71	64925	broad.mit.edu	37	3	49200714	49200714	+	Missense_Mutation	SNP	G	G	A	rs538826878|rs373036352	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:49200714G>A	ENST00000321895.6	-	2	1034	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	310								p.R310W(2)		endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		gccttgGCCCGGGCCTTAGCA	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19237	0.0		0.0	False		,,,				2504	0.0				p.R310W												.	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C928T	3						.	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	47.0	51.0		928	0.8	0.0	3		51	0,8600		0,0,4300	no	missense	CCDC71	NM_022903.3	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	310/468	49200714	1,13005	2203	4300	6503	49175718	SO:0001583	missense	64925	exon2			AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.928C>T	3.37:g.49200714G>A	ENSP00000319006:p.Arg310Trp		49175718	NM_022903	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	37	CCDS2790.1	.	.	.	.	.	.	.	.	.	.	G	2.398	-0.338307	0.05243	2.27E-4	0.0	ENSG00000177352	ENST00000321895	T	0.37058	1.22	3.95	0.819	0.18785	.	0.506412	0.17017	N	0.190244	T	0.30916	0.0780	L	0.51422	1.61	0.09310	N	1	D	0.54772	0.968	B	0.43783	0.431	T	0.17137	-1.0379	10	0.72032	D	0.01	-19.6975	7.2435	0.26109	0.0:0.1389:0.2836:0.5774	.	310	Q8IV32	CCD71_HUMAN	W	310	ENSP00000319006:R310W	ENSP00000319006:R310W	R	-	1	2	CCDC71	49175718	0.000000	0.05858	0.002000	0.10522	0.038000	0.13279	0.092000	0.15066	0.145000	0.18977	0.313000	0.20887	CGG		0.612	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
TLR9	54106	broad.mit.edu	37	3	52257592	52257592	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:52257592C>T	ENST00000360658.2	-	2	1373	c.740G>A	c.(739-741)cGt>cAt	p.R247H	TLR9_ENST00000597542.1_Missense_Mutation_p.R271H|TLR9_ENST00000494383.1_Silent_p.A400A	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	247					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)	p.R247H(1)		endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	ATCGAGCACACGCAGGGCGGT	0.627																																					p.R247H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G740A	3						.						38.0	29.0	32.0					3																	52257592		2203	4300	6503	52232632	SO:0001583	missense	54106	exon2			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.740G>A	3.37:g.52257592C>T	ENSP00000353874:p.Arg247His		52232632	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239741	0.39598	.	.	ENSG00000239732	ENST00000360658	T	0.61158	0.13	5.38	0.394	0.16299	.	0.255193	0.19851	N	0.104633	T	0.59985	0.2234	M	0.65498	2.005	0.19300	N	0.999977	D;D	0.65815	0.986;0.995	P;P	0.55667	0.781;0.781	T	0.50775	-0.8788	10	0.52906	T	0.07	.	3.8964	0.09141	0.1626:0.4266:0.0:0.4109	.	344;247	B4E0A1;Q9NR96	.;TLR9_HUMAN	H	247	ENSP00000353874:R247H	ENSP00000353874:R247H	R	-	2	0	TLR9	52232632	0.000000	0.05858	0.065000	0.19835	0.113000	0.19764	0.241000	0.18065	0.239000	0.21243	0.655000	0.94253	CGT		0.627	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
SHQ1	55164	broad.mit.edu	37	3	72842105	72842105	+	Silent	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:72842105G>C	ENST00000325599.8	-	10	1282	c.1143C>G	c.(1141-1143)ctC>ctG	p.L381L	SHQ1_ENST00000463369.1_Silent_p.L353L|SHQ1_ENST00000468371.1_5'UTR	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	381					negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.L381L(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CTGAGATGTAGAGATCATTCA	0.323																																					p.L381L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1143G	3						.						84.0	82.0	83.0					3																	72842105		2203	4299	6502	72924795	SO:0001819	synonymous_variant	55164	exon10			BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.1143C>G	3.37:g.72842105G>C			72924795	NM_018130	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Silent	SNP	ENST00000325599.8	37	CCDS33788.1																																																																																				0.323	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130	
ZDHHC19	131540	broad.mit.edu	37	3	195936249	195936249	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr3:195936249C>A	ENST00000296326.3	-	3	485	c.406G>T	c.(406-408)Gag>Tag	p.E136*	ZDHHC19_ENST00000488508.1_5'UTR	NM_001039617.1	NP_001034706.1	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC-type containing 19	136						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.E136*(1)		breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(7)|ovary(3)	14	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		GCACTCACCTCCACACAGATG	0.642																																					p.E136X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G406T	3						.						38.0	46.0	43.0					3																	195936249		2056	4189	6245	197420646	SO:0001587	stop_gained	131540	exon3			BC022078	CCDS43190.1	3q29	2008-05-02			ENSG00000163958	ENSG00000163958		"""Zinc fingers, DHHC-type"""	20713	protein-coding gene	gene with protein product							Standard	XR_246038		Approved	MGC33345	uc003fwc.3	Q8WVZ1	OTTHUMG00000133642	ENST00000296326.3:c.406G>T	3.37:g.195936249C>A	ENSP00000296326:p.Glu136*		197420646	NM_001039617	A8MSY6|B3KVI1	Nonsense_Mutation	SNP	ENST00000296326.3	37	CCDS43190.1	.	.	.	.	.	.	.	.	.	.	C	37	6.262302	0.97421	.	.	ENSG00000163958	ENST00000296326	.	.	.	5.81	5.81	0.92471	.	0.000000	0.53938	D	0.000050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-35.6208	15.5735	0.76356	0.0:1.0:0.0:0.0	.	.	.	.	X	136	.	ENSP00000296326:E136X	E	-	1	0	ZDHHC19	197420646	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	5.673000	0.68109	2.751000	0.94390	0.555000	0.69702	GAG		0.642	ZDHHC19-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341533.1	NM_144637	
TAS2R8	50836	broad.mit.edu	37	12	10959213	10959213	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:10959213T>G	ENST00000240615.2	-	1	679	c.367A>C	c.(367-369)Aag>Cag	p.K123Q		NM_023918.1	NP_076407.1	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	123					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.K123Q(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						ATTTTCCACTTCAGCCAGAGA	0.418																																					p.K123Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A367C	12						.						78.0	75.0	76.0					12																	10959213		2203	4300	6503	10850480	SO:0001583	missense	50836	exon1			AF227134	CCDS8632.1	12p13	2012-08-22			ENSG00000121314	ENSG00000121314		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14915	protein-coding gene	gene with protein product		604794				10761934, 10766242	Standard	NM_023918		Approved	T2R8, TRB5	uc010shh.2	Q9NYW2	OTTHUMG00000168506	ENST00000240615.2:c.367A>C	12.37:g.10959213T>G	ENSP00000240615:p.Lys123Gln		10850480	NM_023918	Q4KN29|Q645Y2	Missense_Mutation	SNP	ENST00000240615.2	37	CCDS8632.1	.	.	.	.	.	.	.	.	.	.	T	14.29	2.491878	0.44352	.	.	ENSG00000121314	ENST00000240615	T	0.01505	4.82	5.1	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.200108	0.29212	U	0.012815	T	0.12008	0.0292	M	0.90977	3.165	0.24839	N	0.992474	D	0.89917	1.0	D	0.87578	0.998	T	0.06391	-1.0829	10	0.87932	D	0	.	8.9116	0.35557	0.0:0.0904:0.0:0.9096	.	123	Q9NYW2	TA2R8_HUMAN	Q	123	ENSP00000240615:K123Q	ENSP00000240615:K123Q	K	-	1	0	TAS2R8	10850480	0.965000	0.33210	0.746000	0.31095	0.187000	0.23431	2.626000	0.46460	0.786000	0.33708	0.455000	0.32223	AAG		0.418	TAS2R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399932.1		
HECTD4	283450	broad.mit.edu	37	12	112617047	112617047	+	Silent	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:112617047G>C	ENST00000430131.2	-	62	11021	c.9876C>G	c.(9874-9876)ggC>ggG	p.G3292G	HECTD4_ENST00000550722.1_Silent_p.G3568G|HECTD4_ENST00000377560.5_Silent_p.G3542G			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3292					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.G3542G(1)|p.G3292G(1)									GGAGGAGGTTGCCTGGGGTCT	0.577																																					p.G3542G												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C10626G	12						.						85.0	92.0	90.0					12																	112617047		2003	4166	6169	111101430	SO:0001819	synonymous_variant	283450	exon62			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9876C>G	12.37:g.112617047G>C			111101430	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																					0.577	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
NOS1	4842	broad.mit.edu	37	12	117728150	117728150	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:117728150C>T	ENST00000338101.4	-	3	938	c.934G>A	c.(934-936)Gag>Aag	p.E312K	NOS1_ENST00000317775.6_Missense_Mutation_p.E312K|NOS1_ENST00000344089.3_Silent_p.G330G			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)	p.E312K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ACCTCAGTCTCCCAGTTCTTG	0.542																																					p.E312K	Esophageal Squamous(162;1748 2599 51982 52956)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G934A	12						.						55.0	58.0	57.0					12																	117728150		2059	4208	6267	116212533	SO:0001583	missense	4842	exon4				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.934G>A	12.37:g.117728150C>T	ENSP00000337459:p.Glu312Lys		116212533	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	C	16.91	3.251908	0.59212	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.42131	0.98;0.98	5.13	5.13	0.70059	Nitric oxide synthase, oxygenase domain (1);	0.053609	0.85682	D	0.000000	T	0.51024	0.1650	M	0.67625	2.065	0.80722	D	1	D	0.55800	0.973	P	0.50378	0.639	T	0.43798	-0.9369	10	0.13108	T	0.6	-32.9204	18.7669	0.91876	0.0:1.0:0.0:0.0	.	312	P29475	NOS1_HUMAN	K	312	ENSP00000320758:E312K;ENSP00000337459:E312K	ENSP00000320758:E312K	E	-	1	0	NOS1	116212533	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.382000	0.79729	2.680000	0.91292	0.467000	0.42956	GAG		0.542	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
CACNA1C	775	broad.mit.edu	37	12	2705069	2705069	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:2705069A>G	ENST00000347598.4	+	20	2693	c.2693A>G	c.(2692-2694)aAt>aGt	p.N898S	CACNA1C_ENST00000344100.3_Missense_Mutation_p.N898S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.N898S|CACNA1C_ENST00000480911.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399634.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.N898S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000406454.3_Missense_Mutation_p.N898S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399591.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399595.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399606.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000335762.5_Missense_Mutation_p.N923S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399603.1_Missense_Mutation_p.N898S|CACNA1C_ENST00000399638.1_Missense_Mutation_p.N898S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	898					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.N928S(1)|p.N433S(1)|p.N898S(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGCATTGTCAATGACACGATC	0.567																																					p.N898S												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A2693G	12						.						125.0	126.0	125.0					12																	2705069		2101	4222	6323	2575330	SO:0001583	missense	775	exon20			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.2693A>G	12.37:g.2705069A>G	ENSP00000266376:p.Asn898Ser		2575330	NM_001129842	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	37	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.306732	0.81247	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96334	-3.92;-3.92;-3.91;-3.91;-3.9;-3.93;-3.93;-3.83;-3.86;-3.92;-3.85;-3.86;-3.92;-3.95;-3.82;-3.76;-3.98;-3.93;-3.94;-3.94;-3.85;-3.94;-3.98	4.93	4.93	0.64822	.	0.045287	0.85682	D	0.000000	D	0.97545	0.9196	M	0.65498	2.005	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.996;0.999;0.987;0.982;0.993;0.999;0.99;0.967;0.996;0.982;0.999;0.998;0.564;0.998;0.997;0.997;0.99;0.997;0.999;0.969;0.99;0.999;0.999;0.999;0.974;0.999	D;D;P;D;D;D;D;D;D;D;D;D;B;D;D;D;D;D;D;P;D;D;D;D;D;D	0.81914	0.99;0.994;0.858;0.952;0.99;0.994;0.96;0.969;0.937;0.918;0.994;0.987;0.406;0.995;0.97;0.989;0.979;0.938;0.994;0.845;0.979;0.994;0.994;0.991;0.969;0.99	D	0.98338	1.0537	10	0.87932	D	0	.	14.7299	0.69374	1.0:0.0:0.0:0.0	.	898;895;898;898;898;898;898;898;898;898;898;898;869;898;898;898;898;898;898;898;898;898;898;898;898;898	Q13936-14;Q13936-35;Q13936;E9PDI6;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	923;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;898;739	ENSP00000336982:N923S;ENSP00000382563:N898S;ENSP00000437936:N898S;ENSP00000382552:N898S;ENSP00000382547:N898S;ENSP00000382506:N898S;ENSP00000382530:N898S;ENSP00000382546:N898S;ENSP00000382500:N898S;ENSP00000382549:N898S;ENSP00000266376:N898S;ENSP00000382515:N898S;ENSP00000382510:N898S;ENSP00000341092:N898S;ENSP00000382537:N898S;ENSP00000329877:N898S;ENSP00000382557:N898S;ENSP00000385724:N898S;ENSP00000382512:N898S;ENSP00000382542:N898S;ENSP00000382526:N898S;ENSP00000385896:N898S;ENSP00000382504:N898S	ENSP00000323129:N739S	N	+	2	0	CACNA1C	2575330	1.000000	0.71417	0.987000	0.45799	0.738000	0.42128	9.053000	0.93860	2.074000	0.62210	0.455000	0.32223	AAT		0.567	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
VWF	7450	broad.mit.edu	37	12	6128449	6128449	+	Missense_Mutation	SNP	G	G	A	rs61750074		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:6128449G>A	ENST00000261405.5	-	28	4389	c.4135C>T	c.(4135-4137)Cgc>Tgc	p.R1379C		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1379	VWFA 1; binding site for platelet glycoprotein Ib. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.R1379C(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AGGGTGATGCGGGAGGCTTCA	0.577																																					p.R1379C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4135T	12	GRCh37	CM011508	VWF	M	rs61750074	.						48.0	49.0	49.0					12																	6128449		2203	4300	6503	5998710	SO:0001583	missense	7450	exon28				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.4135C>T	12.37:g.6128449G>A	ENSP00000261405:p.Arg1379Cys		5998710	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	16.34	3.094678	0.56075	.	.	ENSG00000110799	ENST00000261405	D	0.84370	-1.84	4.98	4.98	0.66077	von Willebrand factor, type A (3);	0.328267	0.22298	N	0.061915	D	0.94571	0.8251	H	0.96970	3.915	0.49299	D	0.999777	D	0.89917	1.0	D	0.85130	0.997	D	0.95356	0.8451	10	0.72032	D	0.01	.	12.1622	0.54110	0.0:0.0:0.7174:0.2826	rs61750074	1379	P04275	VWF_HUMAN	C	1379	ENSP00000261405:R1379C	ENSP00000261405:R1379C	R	-	1	0	VWF	5998710	1.000000	0.71417	0.560000	0.28344	0.736000	0.42039	4.514000	0.60482	2.605000	0.88082	0.555000	0.69702	CGC		0.577	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
CLEC2B	9976	broad.mit.edu	37	12	10015151	10015151	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:10015151T>C	ENST00000228438.2	-	2	953	c.20A>G	c.(19-21)aAg>aGg	p.K7R		NM_005127.2	NP_005118.2	Q92478	CLC2B_HUMAN	C-type lectin domain family 2, member B	7						integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)	p.K7R(1)		endometrium(1)|large_intestine(3)|lung(1)	5						TATAAAACACTTTTTATGTTT	0.289																																					p.K7R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A20G	12						.						23.0	25.0	24.0					12																	10015151		2179	4264	6443	9906418	SO:0001583	missense	9976	exon2			X96719	CCDS8605.1	12p13-p12	2005-02-09	2005-02-09	2005-02-09		ENSG00000110852		"""C-type lectin domain containing"""	2053	protein-coding gene	gene with protein product		603242	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 2 (activation-induced)"""	CLECSF2		9038101	Standard	NM_005127		Approved	AICL, HP10085	uc001qwn.3	Q92478		ENST00000228438.2:c.20A>G	12.37:g.10015151T>C	ENSP00000228438:p.Lys7Arg		9906418	NM_005127	B2R9U1|Q8IZE9|Q9BS74|Q9UQB4	Missense_Mutation	SNP	ENST00000228438.2	37	CCDS8605.1	.	.	.	.	.	.	.	.	.	.	T	1.746	-0.490426	0.04322	.	.	ENSG00000110852	ENST00000228438	T	0.02050	4.48	1.39	-2.78	0.05859	.	.	.	.	.	T	0.01320	0.0043	L	0.36672	1.1	0.09310	N	1	P	0.37233	0.588	B	0.24541	0.054	T	0.46484	-0.9188	9	0.18276	T	0.48	.	2.6243	0.04925	0.49:0.0:0.218:0.2919	.	7	Q92478	CLC2B_HUMAN	R	7	ENSP00000228438:K7R	ENSP00000228438:K7R	K	-	2	0	CLEC2B	9906418	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-2.918000	0.00695	-1.242000	0.02523	0.402000	0.26972	AAG		0.289	CLEC2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399881.1	NM_005127	
ERP27	121506	broad.mit.edu	37	12	15067698	15067698	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:15067698C>G	ENST00000266397.2	-	7	1366	c.793G>C	c.(793-795)Gaa>Caa	p.E265Q	ERP27_ENST00000544881.1_5'Flank|ERP27_ENST00000540097.1_Missense_Mutation_p.E164Q	NM_152321.2	NP_689534.1	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27	265						endoplasmic reticulum (GO:0005783)		p.E265Q(1)		breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(3)|prostate(2)|skin(1)	19						GTCTTTCCTTCTGATTCACGA	0.348																																					p.E265Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G793C	12						.						183.0	157.0	165.0					12																	15067698		2203	4300	6503	14958965	SO:0001583	missense	121506	exon7			AK056677	CCDS8670.1, CCDS73450.1	12p12.3	2011-10-19	2009-02-23	2007-03-26	ENSG00000139055	ENSG00000139055		"""Protein disulfide isomerases"""	26495	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 8"""	610642	"""chromosome 12 open reading frame 46"", ""endoplasmic reticulum protein 27 kDa"""	C12orf46		12975309, 16940051	Standard	XM_005253303		Approved	FLJ32115, ERp27, PDIA8	uc001rco.3	Q96DN0	OTTHUMG00000168741	ENST00000266397.2:c.793G>C	12.37:g.15067698C>G	ENSP00000266397:p.Glu265Gln		14958965	NM_152321		Missense_Mutation	SNP	ENST00000266397.2	37	CCDS8670.1	.	.	.	.	.	.	.	.	.	.	C	8.146	0.786238	0.16189	.	.	ENSG00000139055	ENST00000266397;ENST00000540097	T;T	0.53640	1.51;0.61	4.54	3.65	0.41850	Thioredoxin-like fold (1);	0.116253	0.56097	D	0.000024	T	0.40839	0.1133	L	0.55481	1.735	0.37780	D	0.926996	B	0.14438	0.01	B	0.18263	0.021	T	0.43556	-0.9384	10	0.45353	T	0.12	-0.1396	8.7204	0.34436	0.0:0.8988:0.0:0.1012	.	265	Q96DN0	ERP27_HUMAN	Q	265;164	ENSP00000266397:E265Q;ENSP00000440573:E164Q	ENSP00000266397:E265Q	E	-	1	0	ERP27	14958965	0.988000	0.35896	0.931000	0.37212	0.087000	0.18053	1.535000	0.36061	1.521000	0.48983	0.655000	0.94253	GAA		0.348	ERP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400868.1	NM_152321	
LRMP	4033	broad.mit.edu	37	12	25232638	25232638	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:25232638A>T	ENST00000354454.3	+	8	1014	c.185A>T	c.(184-186)aAc>aTc	p.N62I	LRMP_ENST00000547044.1_Missense_Mutation_p.N62I|LRMP_ENST00000548766.1_Missense_Mutation_p.N62I	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	118					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.N62I(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					CTTGACAGAAACTCGCTCTGT	0.378																																					p.N62I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A185T	12						.						110.0	109.0	109.0					12																	25232638		2203	4300	6503	25123905	SO:0001583	missense	4033	exon8				CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.185A>T	12.37:g.25232638A>T	ENSP00000346442:p.Asn62Ile		25123905	NM_006152	A0AVM2|B4E077|Q8N301	Missense_Mutation	SNP	ENST00000354454.3	37	CCDS8701.1	.	.	.	.	.	.	.	.	.	.	A	7.040	0.562318	0.13498	.	.	ENSG00000118308	ENST00000550945;ENST00000557489;ENST00000354454;ENST00000536173;ENST00000548766;ENST00000554942;ENST00000547044	T;T;T;T;T;T;T	0.15256	2.44;2.44;2.44;2.44;2.44;2.44;2.44	4.55	3.4	0.38934	.	0.258068	0.28724	N	0.014342	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	B	0.28082	0.2	B	0.32864	0.154	T	0.21075	-1.0256	10	0.62326	D	0.03	-13.5205	5.5966	0.17331	0.8612:0.0:0.1388:0.0	.	118	Q12912	LRMP_HUMAN	I	62;62;62;9;62;62;62	ENSP00000448534:N62I;ENSP00000452116:N62I;ENSP00000346442:N62I;ENSP00000444056:N9I;ENSP00000446496:N62I;ENSP00000450634:N62I;ENSP00000450246:N62I	ENSP00000346442:N62I	N	+	2	0	LRMP	25123905	0.008000	0.16893	0.037000	0.18230	0.002000	0.02628	1.148000	0.31614	0.877000	0.35895	0.491000	0.48974	AAC		0.378	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152	
GXYLT1	283464	broad.mit.edu	37	12	42523599	42523599	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:42523599A>T	ENST00000398675.3	-	2	508	c.276T>A	c.(274-276)gaT>gaA	p.D92E	GXYLT1_ENST00000280876.6_Intron	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	92					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)	p.D92E(1)		kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						TTCCACAAACATCAGAGGGCA	0.373																																					p.D92E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T276A	12						.						112.0	102.0	105.0					12																	42523599		1856	4098	5954	40809866	SO:0001583	missense	283464	exon2			BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.276T>A	12.37:g.42523599A>T	ENSP00000381666:p.Asp92Glu		40809866	NM_173601	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	37	CCDS41772.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.721613	0.48728	.	.	ENSG00000151233	ENST00000398675	.	.	.	5.41	5.41	0.78517	.	2.040290	0.02632	N	0.104471	T	0.54919	0.1888	N	0.24115	0.695	0.80722	D	1	B	0.21071	0.051	B	0.15052	0.012	T	0.01935	-1.1244	9	0.17832	T	0.49	-8.4982	15.7333	0.77822	1.0:0.0:0.0:0.0	.	92	Q4G148	GXLT1_HUMAN	E	92	.	ENSP00000381666:D92E	D	-	3	2	GXYLT1	40809866	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.218000	0.72224	2.186000	0.69663	0.482000	0.46254	GAT		0.373	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403778.1	XM_290597	
KRT73	319101	broad.mit.edu	37	12	53012010	53012010	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:53012010G>A	ENST00000305748.3	-	1	333	c.299C>T	c.(298-300)cCg>cTg	p.P100L	RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	100	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.P100L(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		ACCCCCGGGCGGGCACAACGA	0.637																																					p.P100L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C299T	12						.						110.0	117.0	115.0					12																	53012010		2203	4300	6503	51298277	SO:0001583	missense	319101	exon1			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.299C>T	12.37:g.53012010G>A	ENSP00000307014:p.Pro100Leu		51298277	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	37	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	G	4.896	0.166513	0.09339	.	.	ENSG00000186049	ENST00000305748	D	0.91351	-2.83	4.64	1.38	0.22167	.	0.617506	0.14424	N	0.320475	D	0.88228	0.6380	M	0.72576	2.205	0.09310	N	1	B	0.26147	0.143	B	0.21546	0.035	T	0.80077	-0.1533	10	0.72032	D	0.01	.	9.5273	0.39171	0.3028:0.0:0.6972:0.0	.	100	Q86Y46	K2C73_HUMAN	L	100	ENSP00000307014:P100L	ENSP00000307014:P100L	P	-	2	0	KRT73	51298277	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.638000	0.05452	0.135000	0.18707	0.655000	0.94253	CCG		0.637	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
LRRC43	254050	broad.mit.edu	37	12	122670781	122670781	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr12:122670781G>A	ENST00000339777.4	+	3	484	c.456G>A	c.(454-456)gaG>gaA	p.E152E	LRRC43_ENST00000425921.1_5'UTR	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	152								p.E152E(1)		NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		TAAAGCTGGAGGAGTTGGTAC	0.562																																					p.E152E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G456A	12						.						58.0	59.0	59.0					12																	122670781		1913	4120	6033	121236734	SO:0001819	synonymous_variant	254050	exon3			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.456G>A	12.37:g.122670781G>A			121236734	NM_001098519	Q6ZVT9	Silent	SNP	ENST00000339777.4	37	CCDS45001.1																																																																																				0.562	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
HDC	3067	broad.mit.edu	37	15	50555518	50555518	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr15:50555518G>A	ENST00000267845.3	-	2	520	c.118C>T	c.(118-120)Cga>Tga	p.R40*	HDC_ENST00000543581.1_Nonsense_Mutation_p.R40*	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0	Ala/Gly-rich.				respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.R40*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		AGCTGGGCTCGCAGGTAGCCA	0.572																																					p.R40X	GBM(95;1627 1936 6910 9570)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C118T	15						.						112.0	102.0	106.0					15																	50555518		2196	4295	6491	48342810	SO:0001587	stop_gained	3067	exon2				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.118C>T	15.37:g.50555518G>A	ENSP00000267845:p.Arg40*		48342810	NM_002112		Nonsense_Mutation	SNP	ENST00000267845.3	37	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	G	37	6.480361	0.97603	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	.	.	.	6.05	2.85	0.33270	.	0.341439	0.28921	N	0.013710	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6665	10.7951	0.46455	0.072:0.0:0.6337:0.2943	.	.	.	.	X	40	.	ENSP00000267845:R40X	R	-	1	2	HDC	48342810	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.957000	0.40392	0.877000	0.35895	0.650000	0.86243	CGA		0.572	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
NPTN	27020	broad.mit.edu	37	15	73884391	73884391	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr15:73884391G>A	ENST00000345330.4	-	3	724	c.527C>T	c.(526-528)tCt>tTt	p.S176F	NPTN_ENST00000542234.1_Intron|NPTN_ENST00000564551.1_5'UTR|NPTN_ENST00000545878.1_Missense_Mutation_p.S176F|NPTN_ENST00000287226.8_Missense_Mutation_p.S176F|NPTN_ENST00000563691.1_Missense_Mutation_p.S176F|NPTN_ENST00000351217.6_Missense_Mutation_p.S60F|NPTN_ENST00000562924.1_Missense_Mutation_p.S60F	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	176	Ig-like 2.				homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)	p.S176F(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						AAGGGTGTGAGAGCTGGAGGT	0.507																																					p.S60F	Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C179T	15						.						214.0	177.0	190.0					15																	73884391		2198	4297	6495	71671444	SO:0001583	missense	27020	exon2			AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.527C>T	15.37:g.73884391G>A	ENSP00000290401:p.Ser176Phe		71671444	NM_001161364	B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Missense_Mutation	SNP	ENST00000345330.4	37	CCDS10249.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647527	0.67358	.	.	ENSG00000156642	ENST00000345330;ENST00000351217;ENST00000545878;ENST00000287226	T;T;T;T	0.14516	2.5;2.5;2.5;2.5	6.07	5.15	0.70609	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.373692	0.33290	N	0.005063	T	0.19287	0.0463	L	0.50333	1.59	0.32220	N	0.575427	D;P;D;P	0.56035	0.967;0.93;0.974;0.947	B;P;P;P	0.50314	0.434;0.532;0.57;0.637	T	0.06391	-1.0829	10	0.54805	T	0.06	.	9.6878	0.40109	0.0698:0.0:0.7888:0.1414	.	176;60;176;60	Q9Y639-5;B2RAL7;Q9Y639;Q9Y639-3	.;.;NPTN_HUMAN;.	F	176;60;176;176	ENSP00000290401:S176F;ENSP00000342958:S60F;ENSP00000444548:S176F;ENSP00000287226:S176F	ENSP00000287226:S176F	S	-	2	0	NPTN	71671444	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.668000	0.61568	2.884000	0.98904	0.655000	0.94253	TCT		0.507	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268980.1	NM_012428	
ACSBG1	23205	broad.mit.edu	37	15	78475123	78475123	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr15:78475123C>G	ENST00000258873.4	-	6	873	c.668G>C	c.(667-669)tGg>tCg	p.W223S	ACSBG1_ENST00000541759.1_5'UTR|ACSBG1_ENST00000560817.1_5'UTR	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	223					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)	p.W223S(1)|p.W223*(1)		endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CAACTGTTTCCAGATCTGCAT	0.463																																					p.W219S												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|liver(1)	c.G656C	15						.						101.0	93.0	96.0					15																	78475123		2196	4293	6489	76262178	SO:0001583	missense	23205	exon6			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.668G>C	15.37:g.78475123C>G	ENSP00000258873:p.Trp223Ser		76262178	NM_001199377	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	ENST00000258873.4	37	CCDS10298.1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.454380	0.26161	.	.	ENSG00000103740	ENST00000258873	T	0.09817	2.94	5.49	5.49	0.81192	AMP-dependent synthetase/ligase (1);	0.149009	0.48286	D	0.000196	T	0.09686	0.0238	L	0.36672	1.1	0.80722	D	1	B;B	0.26708	0.157;0.017	B;B	0.29663	0.105;0.065	T	0.23833	-1.0177	10	0.17832	T	0.49	-19.4471	11.7867	0.52047	0.0:0.9207:0.0:0.0793	.	219;223	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	S	223	ENSP00000258873:W223S	ENSP00000258873:W223S	W	-	2	0	ACSBG1	76262178	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	3.540000	0.53611	2.565000	0.86533	0.655000	0.94253	TGG		0.463	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289802.2	NM_015162	
SH3GL3	6457	broad.mit.edu	37	15	84237364	84237364	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr15:84237364G>A	ENST00000427482.2	+	4	577	c.271G>A	c.(271-273)Ggc>Agc	p.G91S	SH3GL3_ENST00000324537.5_Missense_Mutation_p.G99S|SH3GL3_ENST00000434347.1_Missense_Mutation_p.G99S|SH3GL3_ENST00000535412.1_Missense_Mutation_p.G91S	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	91	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)	p.G99S(2)		central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						GCAGACGGAAGGCTTGCTGGG	0.517																																					p.G91S												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G271A	15						.						84.0	85.0	85.0					15																	84237364		2203	4300	6503	82028368	SO:0001583	missense	6457	exon4			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.271G>A	15.37:g.84237364G>A	ENSP00000391372:p.Gly91Ser		82028368	NM_003027	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	37	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365073	0.82463	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.86	3.95	0.45737	BAR (3);	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	M	0.79805	2.47	0.80722	D	1	D;P;P	0.89917	1.0;0.75;0.874	D;P;P	0.71870	0.975;0.77;0.742	T	0.79662	-0.1710	10	0.52906	T	0.07	-40.6955	12.7223	0.57149	0.0803:0.0:0.9197:0.0	.	91;91;99	Q8IVP1;Q99963;Q99963-3	.;SH3G3_HUMAN;.	S	91;91;99;99	ENSP00000391372:G91S;ENSP00000439239:G91S;ENSP00000320092:G99S;ENSP00000397871:G99S	ENSP00000320092:G99S	G	+	1	0	SH3GL3	82028368	1.000000	0.71417	0.975000	0.42487	0.969000	0.65631	7.431000	0.80335	1.171000	0.42768	0.544000	0.68410	GGC		0.517	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027	
MESP2	145873	broad.mit.edu	37	15	90321388	90321388	+	Silent	SNP	C	C	T	rs370227491		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr15:90321388C>T	ENST00000341735.3	+	2	1017	c.1017C>T	c.(1015-1017)ccC>ccT	p.P339P	MESP2_ENST00000560219.1_Silent_p.P41P|MESP2_ENST00000558723.1_3'UTR	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	339					mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P339P(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			CTCAGACCCCCGGGAGGTGCT	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16737	0.0		0.0	False		,,,				2504	0.0				p.P339P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1017T	15						.	C		2,3872		0,2,1935	30.0	34.0	33.0		1017	-0.3	0.0	15		33	0,8292		0,0,4146	no	coding-synonymous	MESP2	NM_001039958.1		0,2,6081	TT,TC,CC		0.0,0.0516,0.0164		339/398	90321388	2,12164	1937	4146	6083	88122392	SO:0001819	synonymous_variant	145873	exon2				CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.1017C>T	15.37:g.90321388C>T			88122392	NM_001039958	Q7RTU2	Silent	SNP	ENST00000341735.3	37	CCDS42078.1																																																																																				0.647	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416421.1	XM_085261	
CERS3	204219	broad.mit.edu	37	15	100996237	100996237	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr15:100996237G>A	ENST00000394113.1	-	13	1550	c.860C>T	c.(859-861)aCg>aTg	p.T287M	CERS3_ENST00000560944.1_Intron|CERS3_ENST00000284382.4_Missense_Mutation_p.T287M|CERS3_ENST00000538112.2_Missense_Mutation_p.T287M			Q8IU89	CERS3_HUMAN	ceramide synthase 3	287	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)	p.T287M(1)									CAAGATCAGCGTGCAATATAA	0.368																																					p.T287M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C860T	15						.						82.0	76.0	78.0					15																	100996237		2203	4300	6503	98813760	SO:0001583	missense	204219	exon12				CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568	ENST00000394113.1:c.860C>T	15.37:g.100996237G>A	ENSP00000377672:p.Thr287Met		98813760	NM_178842	Q8NE64|Q8NEN6	Missense_Mutation	SNP	ENST00000394113.1	37	CCDS10384.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.667684	0.47677	.	.	ENSG00000154227	ENST00000284382;ENST00000394113;ENST00000538112	D;D	0.85258	-1.96;-1.96	5.66	5.66	0.87406	TRAM/LAG1/CLN8 homology domain (3);	0.223476	0.45126	D	0.000389	D	0.93713	0.7991	M	0.91920	3.255	0.58432	D	0.999997	D	0.89917	1.0	D	0.75484	0.986	D	0.94651	0.7839	10	0.87932	D	0	-16.0042	15.244	0.73493	0.0:0.0:1.0:0.0	.	287	Q8IU89	CERS3_HUMAN	M	287;298;287	ENSP00000284382:T287M;ENSP00000437640:T287M	ENSP00000284382:T287M	T	-	2	0	CERS3	98813760	1.000000	0.71417	0.945000	0.38365	0.076000	0.17211	5.442000	0.66575	2.669000	0.90835	0.655000	0.94253	ACG		0.368	CERS3-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313594.4	NM_178842	
ANK2	287	broad.mit.edu	37	4	114275608	114275608	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:114275608C>T	ENST00000357077.4	+	38	5887	c.5834C>T	c.(5833-5835)aCg>aTg	p.T1945M	ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Missense_Mutation_p.T1912M|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1945	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.T1945M(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCCGGAAGAACGGACAAGCAC	0.532																																					p.T1945M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5834T	4						.						74.0	72.0	72.0					4																	114275608		2203	4300	6503	114495057	SO:0001583	missense	287	exon38			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5834C>T	4.37:g.114275608C>T	ENSP00000349588:p.Thr1945Met		114495057	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	3.918	-0.018766	0.07681	.	.	ENSG00000145362	ENST00000357077;ENST00000264366	T;T	0.68025	-0.28;-0.3	5.65	0.422	0.16457	.	1.106060	0.06968	N	0.817639	T	0.51466	0.1676	L	0.28115	0.83	0.19300	N	0.99998	B;B	0.13145	0.007;0.004	B;B	0.11329	0.004;0.006	T	0.32508	-0.9904	9	.	.	.	.	9.1321	0.36852	0.0:0.6133:0.0:0.3867	.	1912;1945	Q01484;Q01484-4	ANK2_HUMAN;.	M	1945;1912	ENSP00000349588:T1945M;ENSP00000264366:T1912M	.	T	+	2	0	ANK2	114495057	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-0.458000	0.06737	0.077000	0.16863	-0.794000	0.03295	ACG		0.532	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ZNF330	27309	broad.mit.edu	37	4	142155045	142155045	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:142155045A>G	ENST00000262990.4	+	10	1093	c.865A>G	c.(865-867)Aag>Gag	p.K289E	ZNF330_ENST00000421169.2_Missense_Mutation_p.K229E	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	289						chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)	p.K289E(1)		kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					tgaagGCAGAAAGGATTCAGA	0.418																																					p.K289E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A865G	4						.						136.0	140.0	138.0					4																	142155045		2203	4300	6503	142374495	SO:0001583	missense	27309	exon10			AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.865A>G	4.37:g.142155045A>G	ENSP00000262990:p.Lys289Glu		142374495	NM_014487	B2RDA3	Missense_Mutation	SNP	ENST00000262990.4	37	CCDS3754.1	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124855	0.56613	.	.	ENSG00000109445	ENST00000262990;ENST00000421169	T;T	0.29655	1.56;1.56	6.17	4.98	0.66077	.	0.144293	0.64402	D	0.000007	T	0.11410	0.0278	N	0.00926	-1.1	0.51767	D	0.99993	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.13575	-1.0504	10	0.32370	T	0.25	-22.0031	12.6751	0.56889	0.935:0.0:0.065:0.0	.	229;289	E9PDK6;Q9Y3S2	.;ZN330_HUMAN	E	289;229	ENSP00000262990:K289E;ENSP00000397397:K229E	ENSP00000262990:K289E	K	+	1	0	ZNF330	142374495	1.000000	0.71417	0.993000	0.49108	0.956000	0.61745	4.197000	0.58413	2.371000	0.80710	0.533000	0.62120	AAG		0.418	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257271.2	NM_014487	
PPP2R2C	5522	broad.mit.edu	37	4	6331012	6331012	+	Silent	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:6331012T>C	ENST00000382599.4	-	8	1245	c.1029A>G	c.(1027-1029)gaA>gaG	p.E343E	PPP2R2C_ENST00000506140.1_Silent_p.E336E|PPP2R2C_ENST00000507294.1_Silent_p.E336E|PPP2R2C_ENST00000335585.5_Silent_p.E343E|PPP2R2C_ENST00000515571.1_Silent_p.E326E			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	343					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.E343E(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						TCCAGGCACATTCAAACTTGT	0.582																																					p.E343E												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1029G	4						.						175.0	140.0	152.0					4																	6331012		2203	4300	6503	6381913	SO:0001819	synonymous_variant	5522	exon8			AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.1029A>G	4.37:g.6331012T>C			6381913	NM_020416	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Silent	SNP	ENST00000382599.4	37																																																																																					0.582	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
DRD5	1816	broad.mit.edu	37	4	9783956	9783956	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:9783956C>T	ENST00000304374.2	+	1	699	c.303C>T	c.(301-303)gcC>gcT	p.A101A		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	101					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.A101A(1)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	AGGCAGTCGCCGAGGTGGCCG	0.617																																					p.A101A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C303T	4						.						51.0	48.0	49.0					4																	9783956		2203	4300	6503	9393054	SO:0001819	synonymous_variant	1816	exon1			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.303C>T	4.37:g.9783956C>T			9393054	NM_000798	B2R9S3|Q8NEQ8	Silent	SNP	ENST00000304374.2	37	CCDS3405.1																																																																																				0.617	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
LPHN3	23284	broad.mit.edu	37	4	62849252	62849252	+	Missense_Mutation	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:62849252A>G	ENST00000514591.1	+	18	3292	c.2963A>G	c.(2962-2964)tAt>tGt	p.Y988C	LPHN3_ENST00000508946.1_Missense_Mutation_p.Y988C|LPHN3_ENST00000545650.1_Missense_Mutation_p.Y988C|LPHN3_ENST00000507625.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000514996.1_Missense_Mutation_p.Y988C|LPHN3_ENST00000508693.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000511324.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000506746.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000507164.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000506700.1_Missense_Mutation_p.Y988C|LPHN3_ENST00000509896.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000506720.1_Missense_Mutation_p.Y1056C|LPHN3_ENST00000514157.1_Missense_Mutation_p.Y988C|LPHN3_ENST00000504896.1_Missense_Mutation_p.Y988C|LPHN3_ENST00000512091.2_Missense_Mutation_p.Y988C			Q9HAR2	LPHN3_HUMAN	latrophilin 3	975					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)	p.Y988C(1)		breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CTGGTCGGCTATGGGATGCCT	0.423																																					p.Y988C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2963G	4						.						210.0	207.0	208.0					4																	62849252		1932	4153	6085	62531847	SO:0001583	missense	23284	exon16			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2963A>G	4.37:g.62849252A>G	ENSP00000422533:p.Tyr988Cys		62531847	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.311740	0.81358	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.59	5.72	5.72	0.89469	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.82070	0.4957	H	0.97186	3.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.88321	0.2962	10	0.87932	D	0	.	16.0129	0.80417	1.0:0.0:0.0:0.0	.	988;975;988	E9PE04;Q9HAR2;Q9HAR2-2	.;LPHN3_HUMAN;.	C	988;988;1056;1056;988;988;975;988;1056;1056;1056;988;988;988;1056;1056;988	ENSP00000423388:Y988C;ENSP00000422533:Y988C;ENSP00000423787:Y1056C;ENSP00000425033:Y1056C;ENSP00000424120:Y988C;ENSP00000439831:Y988C;ENSP00000421476:Y1056C;ENSP00000424030:Y1056C;ENSP00000421372:Y1056C;ENSP00000425201:Y988C;ENSP00000423434:Y988C;ENSP00000421627:Y988C;ENSP00000420931:Y1056C;ENSP00000425884:Y1056C;ENSP00000424258:Y988C	ENSP00000280009:Y988C	Y	+	2	0	LPHN3	62531847	1.000000	0.71417	0.941000	0.38009	0.981000	0.71138	9.339000	0.96797	2.184000	0.69523	0.482000	0.46254	TAT		0.423	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
UNC5C	8633	broad.mit.edu	37	4	96124004	96124004	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:96124004G>T	ENST00000453304.1	-	12	2362	c.2014C>A	c.(2014-2016)Cat>Aat	p.H672N		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	672					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)	p.H672N(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GTGGTGGAATGTCCTACCAGG	0.597																																					p.H672N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2014A	4						.						132.0	126.0	128.0					4																	96124004		2203	4300	6503	96343027	SO:0001583	missense	8633	exon12			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2014C>A	4.37:g.96124004G>T	ENSP00000406022:p.His672Asn		96343027	NM_003728	Q8IUT0	Missense_Mutation	SNP	ENST00000453304.1	37	CCDS3643.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589641	0.46214	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796	T;T	0.55588	0.85;0.51	5.47	5.47	0.80525	.	0.114104	0.64402	D	0.000011	T	0.47581	0.1453	L	0.34521	1.04	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.12156	0.007;0.0	T	0.41378	-0.9512	10	0.87932	D	0	.	19.6995	0.96047	0.0:0.0:1.0:0.0	.	672;672	A8K385;O95185	.;UNC5C_HUMAN	N	672;631;691	ENSP00000406022:H672N;ENSP00000426924:H691N	ENSP00000328673:H631N	H	-	1	0	UNC5C	96343027	1.000000	0.71417	0.193000	0.23327	0.778000	0.44026	7.823000	0.86660	2.744000	0.94065	0.561000	0.74099	CAT		0.597	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253607.1	NM_003728	
CENPU	79682	broad.mit.edu	37	4	185623590	185623590	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr4:185623590C>A	ENST00000281453.5	-	9	873	c.803G>T	c.(802-804)aGa>aTa	p.R268I	MLF1IP_ENST00000506535.1_5'UTR|MLF1IP_ENST00000541971.1_Missense_Mutation_p.R268I	NM_024629.3	NP_078905.2												p.R268I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		AGATTCTATTCTTTGTCTGTA	0.328																																					p.R268I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G803T	4						.						85.0	88.0	87.0					4																	185623590		2203	4300	6503	185860584	SO:0001583	missense	79682	exon9																														ENST00000281453.5:c.803G>T	4.37:g.185623590C>A	ENSP00000281453:p.Arg268Ile		185860584	NM_024629		Missense_Mutation	SNP	ENST00000281453.5	37	CCDS3838.1	.	.	.	.	.	.	.	.	.	.	C	9.568	1.120287	0.20877	.	.	ENSG00000151725	ENST00000281453;ENST00000541665;ENST00000541971	T;T	0.24723	1.84;1.84	4.5	1.53	0.23141	.	0.858078	0.10389	N	0.680610	T	0.26085	0.0636	L	0.34521	1.04	0.21527	N	0.999658	P;P	0.48998	0.918;0.918	P;P	0.52267	0.694;0.694	T	0.12656	-1.0539	10	0.45353	T	0.12	-24.6861	4.938	0.13950	0.0:0.3942:0.0:0.6058	.	268;268	Q09GN1;Q71F23	.;CENPU_HUMAN	I	268	ENSP00000281453:R268I;ENSP00000445862:R268I	ENSP00000281453:R268I	R	-	2	0	MLF1IP	185860584	0.167000	0.22975	0.110000	0.21437	0.027000	0.11550	0.261000	0.18442	0.299000	0.22661	0.557000	0.71058	AGA		0.328	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360841.2		
SLC6A14	11254	broad.mit.edu	37	X	115584286	115584286	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:115584286G>A	ENST00000371900.4	+	9	1352	c.1264G>A	c.(1264-1266)Gat>Aat	p.D422N		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	422					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.D422N(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TTTGGGTCTCGATTCTCAGTT	0.378																																					p.D422N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1264A	X						.						164.0	139.0	148.0					X																	115584286		2203	4300	6503	115498314	SO:0001583	missense	11254	exon9			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1264G>A	X.37:g.115584286G>A	ENSP00000360967:p.Asp422Asn		115498314	NM_007231	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	32	5.182937	0.94885	.	.	ENSG00000087916	ENST00000371900	T	0.75367	-0.93	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.86083	0.5848	M	0.82132	2.575	0.51233	D	0.999916	D	0.89917	1.0	D	0.66351	0.943	D	0.87734	0.2581	10	0.72032	D	0.01	.	16.2172	0.82238	0.0:0.0:1.0:0.0	.	422	Q9UN76	S6A14_HUMAN	N	422	ENSP00000360967:D422N	ENSP00000360967:D422N	D	+	1	0	SLC6A14	115498314	1.000000	0.71417	0.947000	0.38551	0.964000	0.63967	9.444000	0.97578	2.433000	0.82419	0.591000	0.81541	GAT		0.378	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
DCAF12L2	340578	broad.mit.edu	37	X	125298991	125298991	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:125298991C>A	ENST00000360028.2	-	1	943	c.917G>T	c.(916-918)tGc>tTc	p.C306F	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.C306F			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	306								p.C306F(1)		NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						ATTCTCTCGGCAGTAGGGCAG	0.607																																					p.C306F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G917T	X						.						100.0	103.0	102.0					X																	125298991		2203	4300	6503	125126672	SO:0001583	missense	340578	exon1			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.917G>T	X.37:g.125298991C>A	ENSP00000353128:p.Cys306Phe		125126672	NM_001013628	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	C	9.547	1.114827	0.20795	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.62498	0.02;0.02	4.71	2.68	0.31781	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.408519	0.18317	N	0.144933	T	0.40791	0.1131	L	0.31664	0.95	0.39443	D	0.967278	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	10	0.07644	T	0.81	.	5.8276	0.18562	0.2435:0.5578:0.1987:0.0	.	306	Q5VW00	DC122_HUMAN	F	306	ENSP00000441489:C306F;ENSP00000353128:C306F	ENSP00000353128:C306F	C	-	2	0	DCAF12L2	125126672	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	2.965000	0.49200	1.003000	0.39130	0.544000	0.68410	TGC		0.607	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
ZNF280C	55609	broad.mit.edu	37	X	129364600	129364600	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:129364600G>C	ENST00000370978.4	-	9	1026	c.873C>G	c.(871-873)atC>atG	p.I291M		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I291M(1)		endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						TGACTAACATGATCAACTTTC	0.368																																					p.I291M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C873G	X						.						165.0	153.0	157.0					X																	129364600		2203	4300	6503	129192281	SO:0001583	missense	55609	exon9			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.873C>G	X.37:g.129364600G>C	ENSP00000360017:p.Ile291Met		129192281	NM_017666	A8K2V8|Q9NXR3	Missense_Mutation	SNP	ENST00000370978.4	37	CCDS14622.1	.	.	.	.	.	.	.	.	.	.	g	13.25	2.182559	0.38511	.	.	ENSG00000056277	ENST00000066465;ENST00000370978;ENST00000447817	T;T	0.08807	3.97;3.05	3.4	0.411	0.16392	.	.	.	.	.	T	0.24890	0.0604	M	0.80746	2.51	0.26757	N	0.970087	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.05354	-1.0890	9	0.52906	T	0.07	.	6.33	0.21264	0.5629:0.0:0.4371:0.0	.	291;291	Q9UJJ2;Q8ND82	.;Z280C_HUMAN	M	291	ENSP00000360017:I291M;ENSP00000408521:I291M	ENSP00000066465:I291M	I	-	3	3	ZNF280C	129192281	0.998000	0.40836	0.995000	0.50966	0.688000	0.40055	0.397000	0.20883	-0.151000	0.11176	0.458000	0.33432	ATC		0.368	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058251.1	NM_017666	
MAGEB18	286514	broad.mit.edu	37	X	26157245	26157245	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:26157245G>T	ENST00000325250.1	+	2	330	c.143G>T	c.(142-144)aGa>aTa	p.R48I		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	48						cytoplasm (GO:0005737)		p.R48I(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						TTTGGTGACAGACCCCAGAAT	0.562																																					p.R48I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G143T	X						.						51.0	45.0	47.0					X																	26157245		2202	4300	6502	26067166	SO:0001583	missense	286514	exon2			AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.143G>T	X.37:g.26157245G>T	ENSP00000314543:p.Arg48Ile		26067166	NM_173699		Missense_Mutation	SNP	ENST00000325250.1	37	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	G	8.124	0.781586	0.16120	.	.	ENSG00000176774	ENST00000325250	T	0.04049	3.72	3.78	-5.13	0.02884	Melanoma associated antigen, MAGE, N-terminal (1);	2.685990	0.01163	N	0.006694	T	0.04815	0.0130	L	0.51422	1.61	0.09310	N	1	B	0.10296	0.003	B	0.16722	0.016	T	0.36986	-0.9725	10	0.33940	T	0.23	.	0.2163	0.00162	0.283:0.2734:0.1934:0.2502	.	48	Q96M61	MAGBI_HUMAN	I	48	ENSP00000314543:R48I	ENSP00000314543:R48I	R	+	2	0	MAGEB18	26067166	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.838000	0.04372	-1.534000	0.01743	0.600000	0.82982	AGA		0.562	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699	
DMD	1756	broad.mit.edu	37	X	32381009	32381009	+	Silent	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:32381009A>G	ENST00000357033.4	-	37	5427	c.5221T>C	c.(5221-5223)Ttg>Ctg	p.L1741L	DMD_ENST00000378677.2_Silent_p.L1737L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1741	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.L1737L(1)|p.L400L(1)|p.L1736L(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTGCCATCAAGTTTGCTGCT	0.463																																					p.L400L												.	.	3	Substitution - coding silent(3)	large_intestine(3)	c.T1198C	X						.						202.0	154.0	170.0					X																	32381009		2202	4300	6502	32290930	SO:0001819	synonymous_variant	1756	exon9			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5221T>C	X.37:g.32381009A>G			32290930	NM_004011	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1																																																																																				0.463	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
USP9X	8239	broad.mit.edu	37	X	41007672	41007672	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:41007672G>A	ENST00000324545.8	+	12	2103	c.1470G>A	c.(1468-1470)ctG>ctA	p.L490L	USP9X_ENST00000378308.2_Silent_p.L490L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	490					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.L483L(1)		NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TACTTGAGCTGATACGTCGTC	0.403																																					p.L490L	Ovarian(172;1807 2695 35459 49286)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1470A	X						.						194.0	169.0	177.0					X																	41007672		2203	4300	6503	40892616	SO:0001819	synonymous_variant	8239	exon12			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1470G>A	X.37:g.41007672G>A			40892616	NM_001039590	O75550|Q8WWT3|Q8WX12	Silent	SNP	ENST00000324545.8	37	CCDS43930.1																																																																																				0.403	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
PAGE5	90737	broad.mit.edu	37	X	55247041	55247041	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:55247041G>A	ENST00000289619.5	+	1	254	c.9G>A	c.(7-9)gcG>gcA	p.A3A	PAGE5_ENST00000374952.1_Intron|PAGE5_ENST00000374955.3_Intron	NM_130467.3	NP_569734.2	Q96GU1	PAGE5_HUMAN	P antigen family, member 5 (prostate associated)	3								p.A3A(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						TGATGCAGGCGCCATGGGCCG	0.667																																					p.A3A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G9A	X						.						33.0	24.0	27.0					X																	55247041		2202	4298	6500	55263766	SO:0001819	synonymous_variant	90737	exon1			AJ344352	CCDS14368.1, CCDS35306.1	Xp11.22	2009-08-18			ENSG00000158639	ENSG00000158639			29992	protein-coding gene	gene with protein product	"""cancer/testis antigen family 16, member 1"", ""cancer/testis antigen family 16, member 2"""					11920606, 11992404	Standard	XM_006724613		Approved	PAGE-5, CT16.1, CT16.2	uc004duk.3	Q96GU1	OTTHUMG00000021650	ENST00000289619.5:c.9G>A	X.37:g.55247041G>A			55263766	NM_130467	Q2NL97|Q5JUL0|Q8WWL9	Silent	SNP	ENST00000289619.5	37	CCDS14368.1																																																																																				0.667	PAGE5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056861.1	NM_130467	
SLC7A3	84889	broad.mit.edu	37	X	70148454	70148454	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:70148454C>G	ENST00000374299.3	-	4	703	c.559G>C	c.(559-561)Gcc>Ccc	p.A187P	SLC7A3_ENST00000298085.4_Missense_Mutation_p.A187P			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	187					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)	p.A187P(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	GTAACCAGGGCCGACTCACTA	0.522																																					p.A187P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G559C	X						.						44.0	38.0	40.0					X																	70148454		2203	4300	6503	70065179	SO:0001583	missense	84889	exon4			AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.559G>C	X.37:g.70148454C>G	ENSP00000363417:p.Ala187Pro		70065179	NM_032803	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	CCDS14404.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.397094	0.62177	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.91407	-2.84;-2.84	5.21	4.35	0.52113	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.92545	0.7632	M	0.90369	3.11	0.58432	D	0.999999	B	0.19445	0.036	B	0.30316	0.114	D	0.90920	0.4782	10	0.62326	D	0.03	.	13.4069	0.60919	0.1578:0.8422:0.0:0.0	.	187	Q8WY07	CTR3_HUMAN	P	187	ENSP00000363417:A187P;ENSP00000298085:A187P	ENSP00000298085:A187P	A	-	1	0	SLC7A3	70065179	1.000000	0.71417	0.837000	0.33122	0.981000	0.71138	5.786000	0.69006	1.175000	0.42826	0.436000	0.28706	GCC		0.522	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057080.1	NM_032803	
P2RY10	27334	broad.mit.edu	37	X	78216666	78216666	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:78216666T>A	ENST00000171757.2	+	4	929	c.649T>A	c.(649-651)Tgt>Agt	p.C217S	P2RY10_ENST00000544091.1_Missense_Mutation_p.C217S	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)	p.C217S(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						CATCGCATGGTGTACCTGGAA	0.478																																					p.C217S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T649A	X						.						153.0	118.0	130.0					X																	78216666		2203	4300	6503	78103322	SO:0001583	missense	27334	exon2			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.649T>A	X.37:g.78216666T>A	ENSP00000171757:p.Cys217Ser		78103322	NM_198333	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	ENST00000171757.2	37	CCDS14442.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.948726	0.53186	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.35048	1.33;1.33	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.052083	0.85682	D	0.000000	T	0.49695	0.1572	L	0.60455	1.87	0.51767	D	0.999931	P	0.52061	0.95	P	0.58266	0.836	T	0.46569	-0.9182	10	0.41790	T	0.15	.	12.3133	0.54940	0.0:0.0:0.0:1.0	.	217	O00398	P2Y10_HUMAN	S	217	ENSP00000443138:C217S;ENSP00000171757:C217S	ENSP00000171757:C217S	C	+	1	0	P2RY10	78103322	0.999000	0.42202	1.000000	0.80357	0.897000	0.52465	2.342000	0.43992	1.788000	0.52465	0.438000	0.28831	TGT		0.478	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057323.1		
PCDH11X	27328	broad.mit.edu	37	X	91873510	91873510	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:91873510C>G	ENST00000373094.1	+	7	4460	c.3615C>G	c.(3613-3615)atC>atG	p.I1205M	PCDH11X_ENST00000361655.2_Missense_Mutation_p.I1187M|PCDH11X_ENST00000373097.1_Missense_Mutation_p.I1195M|PCDH11X_ENST00000406881.1_Missense_Mutation_p.I1197M|PCDH11X_ENST00000373088.1_Missense_Mutation_p.I1168M|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000298274.8_Missense_Mutation_p.I1168M	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1205					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1205M(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CACAGACCATCGCATTGTGCC	0.597																																					p.I1205M	NSCLC(38;925 1092 2571 38200 45895)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3615G	X						.						205.0	155.0	172.0					X																	91873510		2203	4300	6503	91760166	SO:0001583	missense	27328	exon7			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3615C>G	X.37:g.91873510C>G	ENSP00000362186:p.Ile1205Met		91760166	NM_032968	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	5.553	0.286912	0.10513	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.54071	0.61;0.62;0.59;0.6;0.62;0.59	3.93	-7.85	0.01192	.	.	.	.	.	T	0.42337	0.1198	N	0.24115	0.695	0.09310	N	1	D;D;D;D;P	0.55172	0.97;0.97;0.97;0.97;0.949	P;P;P;P;P	0.51550	0.601;0.673;0.673;0.673;0.473	T	0.60541	-0.7243	9	0.52906	T	0.07	.	10.5534	0.45103	0.1071:0.169:0.0:0.7239	.	1168;1187;1197;1195;1205	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	M	1205;1195;1168;1187;1197;1205;1168	ENSP00000362186:I1205M;ENSP00000362189:I1195M;ENSP00000362180:I1168M;ENSP00000355105:I1187M;ENSP00000384758:I1197M;ENSP00000298274:I1168M	ENSP00000298274:I1168M	I	+	3	3	PCDH11X	91760166	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.751000	0.01821	-2.856000	0.00329	-0.537000	0.04273	ATC		0.597	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
GPR112	139378	broad.mit.edu	37	X	135427196	135427196	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chrX:135427196G>C	ENST00000394143.1	+	6	1622	c.1331G>C	c.(1330-1332)gGa>gCa	p.G444A	GPR112_ENST00000370652.1_Missense_Mutation_p.G444A|GPR112_ENST00000287534.4_Missense_Mutation_p.G381A|GPR112_ENST00000394141.1_Missense_Mutation_p.G239A|GPR112_ENST00000412101.1_Missense_Mutation_p.G239A	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	444					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G444A(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACAGCTGCCGGAACTGTACCT	0.478																																					p.G444A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1331C	X						.						80.0	73.0	75.0					X																	135427196		2203	4299	6502	135254862	SO:0001583	missense	139378	exon6			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1331G>C	X.37:g.135427196G>C	ENSP00000377699:p.Gly444Ala		135254862	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	0.315	-0.965197	0.02249	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.31510	1.53;1.53;1.49;1.62;1.49	3.57	0.481	0.16809	.	.	.	.	.	T	0.16385	0.0394	N	0.19112	0.55	0.09310	N	1	B;B;B	0.23591	0.03;0.008;0.088	B;B;B	0.21917	0.037;0.023;0.037	T	0.28933	-1.0028	9	0.25751	T	0.34	.	5.0833	0.14668	0.2356:0.0:0.5995:0.1649	.	381;239;444	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	A	444;444;239;381;239	ENSP00000377699:G444A;ENSP00000359686:G444A;ENSP00000416526:G239A;ENSP00000287534:G381A;ENSP00000377697:G239A	ENSP00000287534:G381A	G	+	2	0	GPR112	135254862	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.117000	0.15583	-0.496000	0.06650	-1.687000	0.00730	GGA		0.478	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
NTSR2	23620	broad.mit.edu	37	2	11798794	11798794	+	Silent	SNP	G	G	A	rs143067546	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:11798794G>A	ENST00000306928.5	-	4	1078	c.1044C>T	c.(1042-1044)taC>taT	p.Y348Y		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	348					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)	p.Y348Y(1)		breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	CTGAGCTGACGTAGAAAAGTG	0.532																																					p.Y348Y												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1044T	2						.	G		6,4400	11.4+/-27.6	0,6,2197	108.0	106.0	107.0		1044	-3.5	0.0	2	dbSNP_134	107	0,8600		0,0,4300	yes	coding-synonymous	NTSR2	NM_012344.3		0,6,6497	AA,AG,GG		0.0,0.1362,0.0461		348/411	11798794	6,13000	2203	4300	6503	11716245	SO:0001819	synonymous_variant	23620	exon4			Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.1044C>T	2.37:g.11798794G>A			11716245	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Silent	SNP	ENST00000306928.5	37	CCDS1681.1																																																																																				0.532	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
RANBP2	5903	broad.mit.edu	37	2	109384117	109384117	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:109384117G>T	ENST00000283195.6	+	20	7248	c.7122G>T	c.(7120-7122)agG>agT	p.R2374S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2374	RanBD1 3. {ECO:0000255|PROSITE- ProRule:PRU00164}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.R2374S(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TGATGAGAAGGGACCAAGTAT	0.358																																					p.R2374S												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G7122T	2						.						62.0	74.0	70.0					2																	109384117		2061	3946	6007	108750549	SO:0001583	missense	5903	exon20			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.7122G>T	2.37:g.109384117G>T	ENSP00000283195:p.Arg2374Ser		108750549	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255960	0.39896	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.47869	0.83	5.47	-0.536	0.11876	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.67757	0.2927	M	0.79011	2.435	0.30436	N	0.776655	D	0.89917	1.0	D	0.97110	1.0	T	0.69939	-0.5009	9	0.87932	D	0	-26.7645	15.1017	0.72284	0.0967:0.0:0.9033:0.0	.	2374	P49792	RBP2_HUMAN	S	1398;2374	ENSP00000283195:R2374S	ENSP00000283195:R2374S	R	+	3	2	RANBP2	108750549	0.999000	0.42202	0.991000	0.47740	0.898000	0.52572	0.587000	0.23909	-0.324000	0.08589	-0.786000	0.03341	AGG		0.358	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
POTEE	445582	broad.mit.edu	37	2	131976219	131976219	+	Missense_Mutation	SNP	G	G	A	rs530766889		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:131976219G>A	ENST00000356920.5	+	1	338	c.244G>A	c.(244-246)Gct>Act	p.A82T	PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.A82T|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	82					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.A82T(2)									CAACGTGGGCGCTTCTGGAGA	0.602													g|||	1	0.000199681	0.0	0.0	5008	,	,		14720	0.0		0.0	False		,,,				2504	0.001				p.A82T												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G244A	2						.						81.0	83.0	82.0					2																	131976219		2201	4293	6494	131692689	SO:0001583	missense	445582	exon1			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.244G>A	2.37:g.131976219G>A	ENSP00000439189:p.Ala82Thr		131692689	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	0.008	-1.900130	0.00517	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.75367	-0.93;1.78	0.619	0.619	0.17630	.	.	.	.	.	T	0.32071	0.0817	N	0.01576	-0.805	0.09310	N	1	P	0.52463	0.953	B	0.32149	0.141	T	0.44922	-0.9296	8	0.02654	T	1	.	.	.	.	.	82	Q6S8J3	POTEE_HUMAN	T	82	ENSP00000439189:A82T;ENSP00000443049:A82T	ENSP00000439189:A82T	A	+	1	0	AC131180.1	131692689	0.000000	0.05858	0.002000	0.10522	0.062000	0.15995	-1.322000	0.02695	0.595000	0.29777	0.162000	0.16502	GCT		0.602	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
CCNT2	905	broad.mit.edu	37	2	135676566	135676566	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:135676566G>A	ENST00000264157.5	+	1	172	c.142G>A	c.(142-144)Gga>Aga	p.G48R	CCNT2_ENST00000295238.6_Missense_Mutation_p.G48R|AC016725.4_ENST00000428857.1_RNA|CCNT2_ENST00000537343.1_5'UTR|AC016725.4_ENST00000392929.2_RNA|AC016725.4_ENST00000537615.1_RNA|AC016725.4_ENST00000413962.1_RNA	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	48					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.G48R(1)		endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		CCAGGAGATGGGACAGCGTCT	0.667																																					p.G48R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G142A	2						.						52.0	55.0	54.0					2																	135676566		2203	4300	6503	135393036	SO:0001583	missense	905	exon1			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.142G>A	2.37:g.135676566G>A	ENSP00000264157:p.Gly48Arg		135393036	NM_058241	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	.	.	.	.	.	.	.	.	.	.	G	32	5.156953	0.94686	.	.	ENSG00000082258	ENST00000295238;ENST00000264157	T;T	0.51574	0.7;0.7	5.25	4.36	0.52297	Cyclin, N-terminal (1);Cyclin-like (3);	0.099937	0.64402	D	0.000002	T	0.75162	0.3812	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82649	-0.0353	10	0.87932	D	0	.	14.719	0.69291	0.0:0.0:0.8541:0.1459	.	48;48	O60583;O60583-2	CCNT2_HUMAN;.	R	48	ENSP00000295238:G48R;ENSP00000264157:G48R	ENSP00000264157:G48R	G	+	1	0	CCNT2	135393036	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.378000	0.79679	1.550000	0.49438	0.585000	0.79938	GGA		0.667	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241	
SCN3A	6328	broad.mit.edu	37	2	165986780	165986780	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:165986780G>A	ENST00000360093.3	-	17	3083	c.2592C>T	c.(2590-2592)tcC>tcT	p.S864S	SCN3A_ENST00000283254.7_Silent_p.S864S|SCN3A_ENST00000409101.3_Silent_p.S815S	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	864					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.S864S(1)		NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTGTGGGCCAGGATTTTGCCA	0.363																																					p.S864S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2592T	2						.						70.0	73.0	72.0					2																	165986780		2203	4300	6503	165695026	SO:0001819	synonymous_variant	6328	exon17			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2592C>T	2.37:g.165986780G>A			165695026	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	37																																																																																					0.363	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
TTN	7273	broad.mit.edu	37	2	179451304	179451304	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:179451304C>G	ENST00000591111.1	-	258	59625	c.59401G>C	c.(59401-59403)Gcg>Ccg	p.A19801P	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A12569P|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A18874P|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A12502P|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A12377P|TTN_ENST00000589042.1_Missense_Mutation_p.A21442P|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19801	Fibronectin type-III 43. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A18872P(1)|p.A12377P(1)|p.A12569P(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTGGCCGCTACTCTAAAT	0.438																																					p.X12376Y												.	.	3	Substitution - Missense(3)	large_intestine(3)	c.G37128C	2						.						104.0	106.0	105.0					2																	179451304		1997	4185	6182	179159550	SO:0001583	missense	7273	exon136			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59401G>C	2.37:g.179451304C>G	ENSP00000465570:p.Ala19801Pro		179159550	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	21.9	4.221116	0.79464	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58940	0.3;0.3;0.3;0.3	6.07	6.07	0.98685	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79563	0.4467	M	0.85299	2.745	0.44373	D	0.997275	D;D;D;D	0.62365	0.991;0.991;0.991;0.991	P;P;P;D	0.64776	0.84;0.84;0.84;0.929	T	0.81026	-0.1119	9	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	12377;12502;12569;19801	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	18874;12377;12569;12502;12375	ENSP00000343764:A18874P;ENSP00000434586:A12377P;ENSP00000340554:A12569P;ENSP00000352154:A12502P	ENSP00000340554:A12569P	A	-	1	0	TTN	179159550	0.948000	0.32251	0.244000	0.24202	0.972000	0.66771	7.440000	0.80464	2.884000	0.98904	0.655000	0.94253	GCG		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179616598	179616598	+	Intron	SNP	A	A	C			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:179616598A>C	ENST00000591111.1	-	45	10585				TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.L3510R			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L3510R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAAATGTAAGTTTCTGGGT	0.378																																					p.L3510R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T10529G	2						.						92.0	102.0	99.0					2																	179616598		2203	4300	6503	179324843	SO:0001627	intron_variant	7273	exon46			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+1252T>G	2.37:g.179616598A>C			179324843	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	16.74	3.206171	0.58343	.	.	ENSG00000155657	ENST00000360870;ENST00000446208	T	0.50548	0.74	5.86	5.86	0.93980	.	.	.	.	.	T	0.76314	0.3970	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82481	-0.0436	9	0.72032	D	0.01	.	15.9094	0.79461	1.0:0.0:0.0:0.0	.	3510	Q8WZ42-6	.	R	3510;115	ENSP00000354117:L3510R	ENSP00000354117:L3510R	L	-	2	0	TTN	179324843	1.000000	0.71417	0.980000	0.43619	0.942000	0.58702	9.277000	0.95755	2.241000	0.73720	0.533000	0.62120	CTT		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NEUROD1	4760	broad.mit.edu	37	2	182543516	182543516	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:182543516G>A	ENST00000295108.3	-	2	529	c.72C>T	c.(70-72)gaC>gaT	p.D24D	NEUROD1_ENST00000496876.1_Intron|CERKL_ENST00000479558.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	24					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.D24D(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TGAGACACTCGTCTGTCCAGC	0.562																																					p.D24D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C72T	2						.						91.0	75.0	81.0					2																	182543516		2203	4300	6503	182251761	SO:0001819	synonymous_variant	4760	exon2			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.72C>T	2.37:g.182543516G>A			182251761	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Silent	SNP	ENST00000295108.3	37	CCDS2283.1																																																																																				0.562	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
NCKAP1	10787	broad.mit.edu	37	2	183866720	183866720	+	Silent	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:183866720A>T	ENST00000361354.4	-	6	936	c.564T>A	c.(562-564)ccT>ccA	p.P188P	NCKAP1_ENST00000360982.2_Silent_p.P194P	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	188					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)	p.P194P(1)		breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCTTCTTTAAAGGGTTTTCAT	0.388																																					p.P188P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T564A	2						.						161.0	153.0	156.0					2																	183866720		2203	4300	6503	183574965	SO:0001819	synonymous_variant	10787	exon6			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.564T>A	2.37:g.183866720A>T			183574965	NM_013436	O60329|Q53QN5|Q53S94|Q53Y35	Silent	SNP	ENST00000361354.4	37	CCDS2287.1																																																																																				0.388	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255867.2	NM_205842	
MARS2	92935	broad.mit.edu	37	2	198571812	198571812	+	Silent	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:198571812A>G	ENST00000282276.6	+	1	1726	c.1683A>G	c.(1681-1683)ccA>ccG	p.P561P	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	561					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.P561P(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	ATGGACATCCATGCCCTTTTG	0.547																																					p.P561P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1683G	2						.						124.0	125.0	125.0					2																	198571812		2203	4300	6503	198280057	SO:0001819	synonymous_variant	92935	exon1			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1683A>G	2.37:g.198571812A>G			198280057	NM_138395	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	ENST00000282276.6	37	CCDS33358.1																																																																																				0.547	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395	
MPP4	58538	broad.mit.edu	37	2	202546225	202546225	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:202546225C>A	ENST00000409474.3	-	9	933	c.726G>T	c.(724-726)caG>caT	p.Q242H	MPP4_ENST00000428900.2_Missense_Mutation_p.Q242H|MPP4_ENST00000396886.3_Missense_Mutation_p.Q198H|MPP4_ENST00000409143.1_Missense_Mutation_p.Q215H|MPP4_ENST00000447335.2_Missense_Mutation_p.Q242H|MPP4_ENST00000359962.5_Missense_Mutation_p.Q242H|MPP4_ENST00000315506.7_Missense_Mutation_p.Q242H	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	242	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)		p.Q242H(1)		kidney(1)|lung(11)	12						TTACCATCTGCTGGCTATTCA	0.423																																					p.Q242H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G726T	2						.						101.0	93.0	96.0					2																	202546225		1941	4141	6082	202254470	SO:0001583	missense	58538	exon9			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.726G>T	2.37:g.202546225C>A	ENSP00000387278:p.Gln242His		202254470	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	ENST00000409474.3	37	CCDS46491.1	.	.	.	.	.	.	.	.	.	.	C	9.351	1.065481	0.20067	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;D;T;T;T;T	0.82433	3.45;-1.61;3.45;3.43;3.46;3.44	5.55	4.67	0.58626	Src homology-3 domain (2);	0.209202	0.43747	D	0.000529	T	0.76076	0.3937	L	0.45581	1.43	0.53688	D	0.999974	B;B;B;B;B;B;B;B;B;B	0.14012	0.002;0.001;0.001;0.001;0.002;0.001;0.004;0.009;0.001;0.002	B;B;B;B;B;B;B;B;B;B	0.20384	0.015;0.006;0.007;0.007;0.015;0.003;0.008;0.029;0.005;0.008	T	0.71520	-0.4568	10	0.45353	T	0.12	.	7.5358	0.27710	0.0:0.7061:0.1374:0.1565	.	215;198;242;242;242;242;198;255;242;198	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;F8WC25;F8WBH8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;.;.;MPP4_HUMAN;.	H	242;242;198;242;198;171;242;215;242	ENSP00000387278:Q242H;ENSP00000319363:Q242H;ENSP00000353047:Q242H;ENSP00000416781:Q242H;ENSP00000387293:Q215H;ENSP00000406160:Q242H	ENSP00000319363:Q242H	Q	-	3	2	MPP4	202254470	0.999000	0.42202	0.984000	0.44739	0.317000	0.28152	0.633000	0.24598	1.474000	0.48178	0.561000	0.74099	CAG		0.423	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
CARF	79800	broad.mit.edu	37	2	203836412	203836412	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:203836412T>A	ENST00000402905.3	+	11	1603	c.1282T>A	c.(1282-1284)Tta>Ata	p.L428I	CARF_ENST00000438828.2_Missense_Mutation_p.L428I|CARF_ENST00000545253.1_Missense_Mutation_p.L340I|WDR12_ENST00000477723.1_Intron|CARF_ENST00000545262.1_Missense_Mutation_p.L352I|CARF_ENST00000320443.8_Missense_Mutation_p.L428I|CARF_ENST00000428585.1_Missense_Mutation_p.L352I|CARF_ENST00000414439.1_Missense_Mutation_p.L326I	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	428					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L428I(1)									GATTCAAGAATTAGTATCACA	0.368																																					p.L428I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1282A	2						.						92.0	86.0	88.0					2																	203836412		1906	4118	6024	203544657	SO:0001583	missense	79800	exon11			AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.1282T>A	2.37:g.203836412T>A	ENSP00000384006:p.Leu428Ile		203544657	NM_001104586	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	ENST00000402905.3	37	CCDS42801.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.105158	0.77096	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	4.96	-0.378	0.12497	.	0.000000	0.56097	D	0.000024	T	0.68723	0.3032	M	0.71581	2.175	0.36290	D	0.856379	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.79108	0.987;0.986;0.992	T	0.71196	-0.4664	9	0.52906	T	0.07	-9.5962	9.3062	0.37876	0.0:0.4905:0.0:0.5095	.	340;352;428	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	I	428;326;352;340;352;428;428	.	ENSP00000316224:L428I	L	+	1	2	ALS2CR8	203544657	0.981000	0.34729	0.996000	0.52242	0.994000	0.84299	0.931000	0.28871	0.012000	0.14892	0.374000	0.22700	TTA		0.368	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
WNT6	7475	broad.mit.edu	37	2	219735804	219735804	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:219735804C>T	ENST00000233948.3	+	2	353	c.136C>T	c.(136-138)Cgg>Tgg	p.R46W	WNT6_ENST00000486233.1_Intron	NM_006522.3	NP_006513.1	Q9Y6F9	WNT6_HUMAN	wingless-type MMTV integration site family, member 6	46					axis specification (GO:0009798)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|epithelial-mesenchymal cell signaling (GO:0060684)|nephron tubule formation (GO:0072079)|neuron differentiation (GO:0030182)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of gene expression (GO:0010628)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription, DNA-templated (GO:0045893)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.R46W(1)		large_intestine(1)|ovary(2)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.53e-07)|all cancers(144;9.3e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAAGGCACGGCGGCTGGCCGG	0.652																																					p.R46W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C136T	2						.						57.0	68.0	64.0					2																	219735804		2202	4299	6501	219444048	SO:0001583	missense	7475	exon2			AF079522	CCDS2425.1	2q35	2008-05-23			ENSG00000115596	ENSG00000115596		"""Wingless-type MMTV integration sites"""	12785	protein-coding gene	gene with protein product		604663				10343101, 11350055	Standard	NM_006522		Approved		uc002vjc.1	Q9Y6F9	OTTHUMG00000133082	ENST00000233948.3:c.136C>T	2.37:g.219735804C>T	ENSP00000233948:p.Arg46Trp		219444048	NM_006522	Q9H1J6|Q9H238	Missense_Mutation	SNP	ENST00000233948.3	37	CCDS2425.1	.	.	.	.	.	.	.	.	.	.	c	17.35	3.367545	0.61513	.	.	ENSG00000115596	ENST00000233948	T	0.76578	-1.03	5.17	2.17	0.27698	.	0.359822	0.28016	N	0.016926	D	0.82393	0.5027	L	0.45051	1.395	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.80890	-0.1180	10	0.56958	D	0.05	.	13.3694	0.60705	0.4444:0.5555:0.0:0.0	.	46	Q9Y6F9	WNT6_HUMAN	W	46	ENSP00000233948:R46W	ENSP00000233948:R46W	R	+	1	2	WNT6	219444048	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	1.510000	0.35790	0.108000	0.17862	0.586000	0.80456	CGG		0.652	WNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256727.2	NM_006522	
RHBDD1	84236	broad.mit.edu	37	2	227779017	227779017	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:227779017G>A	ENST00000341329.3	+	6	1048	c.806G>A	c.(805-807)aGt>aAt	p.S269N	RHBDD1_ENST00000493526.1_3'UTR|RHBDD1_ENST00000409053.1_Missense_Mutation_p.S103N|RHBDD1_ENST00000392062.2_Missense_Mutation_p.S269N	NM_032276.3	NP_115652.2	Q8TEB9	RHBL4_HUMAN	rhomboid domain containing 1	269	Ubiquitin-binding domain (UBD). {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to unfolded protein (GO:0034620)|cellular response to UV (GO:0034644)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|membrane protein intracellular domain proteolysis (GO:0031293)|membrane protein proteolysis (GO:0033619)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein processing (GO:0010954)|positive regulation of secretion (GO:0051047)|post-translational protein modification (GO:0043687)|spermatid differentiation (GO:0048515)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of endoplasmic reticulum membrane (GO:0030176)|mitochondrion (GO:0005739)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.S269N(1)		breast(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)		GCAGGACTGAGTGAAGAAGAA	0.488																																					p.S269N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G806A	2						.						109.0	107.0	108.0					2																	227779017		2203	4300	6503	227487261	SO:0001583	missense	84236	exon8			AK074258	CCDS2464.1	2q36.3	2012-07-09			ENSG00000144468	ENSG00000144468			23081	protein-coding gene	gene with protein product						12838346	Standard	NM_032276		Approved	DKFZp547E052	uc002voi.3	Q8TEB9	OTTHUMG00000133178	ENST00000341329.3:c.806G>A	2.37:g.227779017G>A	ENSP00000344779:p.Ser269Asn		227487261	NM_001167608	Q495B9|Q53S43|Q5EBM8|Q6P5V8|Q8IV60|Q9H057	Missense_Mutation	SNP	ENST00000341329.3	37	CCDS2464.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020319	0.54576	.	.	ENSG00000144468	ENST00000341329;ENST00000392062;ENST00000409053	T;T	0.50277	0.75;0.75	6.06	5.15	0.70609	.	0.233125	0.52532	D	0.000078	T	0.65460	0.2693	M	0.71581	2.175	0.34667	D	0.723251	D;B	0.76494	0.999;0.166	D;B	0.71656	0.974;0.029	T	0.71626	-0.4536	10	0.39692	T	0.17	-23.2314	14.1894	0.65628	0.0:0.1622:0.8378:0.0	.	60;269	Q8TEB9-2;Q8TEB9	.;RHBD1_HUMAN	N	269;269;103	ENSP00000344779:S269N;ENSP00000375914:S269N	ENSP00000344779:S269N	S	+	2	0	RHBDD1	227487261	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.771000	0.47670	2.880000	0.98712	0.650000	0.86243	AGT		0.488	RHBDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256885.2		
CAD	790	broad.mit.edu	37	2	27458139	27458139	+	Silent	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:27458139G>A	ENST00000403525.1	+	23	3768	c.3624G>A	c.(3622-3624)ttG>ttA	p.L1208L	CAD_ENST00000264705.4_Silent_p.L1271L			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.L1271L(1)		NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTCCCGCTTGGCGGGTGCTG	0.612																																					p.L1271L												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3813A	2						.						69.0	64.0	65.0					2																	27458139		2203	4300	6503	27311643	SO:0001819	synonymous_variant	790	exon24			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.3624G>A	2.37:g.27458139G>A			27311643	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000403525.1	37																																																																																					0.612	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
PLB1	151056	broad.mit.edu	37	2	28826833	28826833	+	Splice_Site	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:28826833C>A	ENST00000327757.5	+	40	2819	c.2775C>A	c.(2773-2775)agC>agA	p.S925R	PLB1_ENST00000422425.2_Splice_Site_p.S914R|PLB1_ENST00000541605.1_Intron	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	925	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)	p.S925R(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					CTTTGTGCAGCGTTTTGTGTA	0.622																																					p.S914R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2742A	2						.						82.0	73.0	76.0					2																	28826833		2203	4300	6503	28680337	SO:0001630	splice_region_variant	151056	exon39				CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2775-1C>A	2.37:g.28826833C>A			28680337	NM_001170585	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	37	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.23|12.23	1.875854|1.875854	0.33162|0.33162	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000404858|ENST00000327757;ENST00000422425	.|T;T	.|0.11712	.|2.75;2.77	5.43|5.43	-0.655|-0.655	0.11439|0.11439	.|Esterase, SGNH hydrolase-type (1);Lipase, GDSL (1);	.|0.302937	.|0.33732	.|N	.|0.004613	T|T	0.12050|0.12050	0.0293|0.0293	N|N	0.12569|0.12569	0.235|0.235	0.50313|0.50313	D|D	0.99986|0.99986	.|D;D	.|0.89917	.|0.996;1.0	.|D;D	.|0.78314	.|0.95;0.991	T|T	0.07966|0.07966	-1.0745|-1.0745	5|9	.|.	.|.	.|.	.|.	8.9404|8.9404	0.35727|0.35727	0.0:0.5059:0.0:0.4941|0.0:0.5059:0.0:0.4941	.|.	.|914;925	.|Q6P1J6-3;Q6P1J6	.|.;PLB1_HUMAN	E|R	913|925;914	.|ENSP00000330442:S925R;ENSP00000416440:S914R	.|.	A|S	+|+	2|3	0|2	PLB1|PLB1	28680337|28680337	0.003000|0.003000	0.15002|0.15002	0.014000|0.014000	0.15608|0.15608	0.344000|0.344000	0.29017|0.29017	-0.508000|-0.508000	0.06344|0.06344	-0.361000|-0.361000	0.08125|0.08125	-0.254000|-0.254000	0.11334|0.11334	GCG|AGC		0.622	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		Missense_Mutation
SOCS5	9655	broad.mit.edu	37	2	46987240	46987240	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:46987240G>C	ENST00000306503.5	+	2	1743	c.1571G>C	c.(1570-1572)aGa>aCa	p.R524T	SOCS5_ENST00000394861.2_Missense_Mutation_p.R524T	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	524					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)	p.R524T(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CAAAAAGTTAGAGTTCGCTGG	0.428																																					p.R524T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1571C	2						.						45.0	45.0	45.0					2																	46987240		2203	4300	6503	46840744	SO:0001583	missense	9655	exon2			AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1571G>C	2.37:g.46987240G>C	ENSP00000305133:p.Arg524Thr		46840744	NM_144949	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	37	CCDS1830.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203934	0.58234	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.50277	0.75;0.75	5.43	5.43	0.79202	.	0.105219	0.64402	D	0.000004	T	0.70378	0.3217	M	0.76838	2.35	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.73186	-0.4062	10	0.87932	D	0	-12.6804	19.0206	0.92912	0.0:0.0:1.0:0.0	.	524	O75159	SOCS5_HUMAN	T	524	ENSP00000305133:R524T;ENSP00000378330:R524T	ENSP00000305133:R524T	R	+	2	0	SOCS5	46840744	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.615000	0.98356	2.824000	0.97209	0.655000	0.94253	AGA		0.428	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2		
USP34	9736	broad.mit.edu	37	2	61484423	61484423	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:61484423C>A	ENST00000398571.2	-	45	5983	c.5907G>T	c.(5905-5907)caG>caT	p.Q1969H		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1969	USP.				positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.Q1969H(1)		autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TATTCAGAGGCTGCTTATCCA	0.368																																					p.Q1969H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5907T	2						.						106.0	101.0	103.0					2																	61484423		1821	4084	5905	61337927	SO:0001583	missense	9736	exon45			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5907G>T	2.37:g.61484423C>A	ENSP00000381577:p.Gln1969His		61337927	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	C	18.50	3.636972	0.67130	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.30182	1.54;1.54	5.96	2.74	0.32292	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);Armadillo-type fold (1);	0.054693	0.85682	N	0.000000	T	0.47097	0.1427	M	0.62209	1.925	0.51482	D	0.999924	D	0.57257	0.979	D	0.76575	0.988	T	0.41822	-0.9487	10	0.87932	D	0	.	7.3393	0.26627	0.1268:0.6665:0.0:0.2067	.	1969	Q70CQ2	UBP34_HUMAN	H	1817;1817;1969;247	ENSP00000381577:Q1969H;ENSP00000410559:Q247H	ENSP00000263989:Q1817H	Q	-	3	2	USP34	61337927	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.669000	0.37492	0.830000	0.34757	0.650000	0.86243	CAG		0.368	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
VAX2	25806	broad.mit.edu	37	2	71160241	71160241	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:71160241C>T	ENST00000234392.2	+	3	812	c.780C>T	c.(778-780)gcC>gcT	p.A260A	ATP6V1B1_ENST00000234396.4_5'Flank|ATP6V1B1_ENST00000412314.1_5'Flank|snoU13_ENST00000459218.1_RNA	NM_012476.2	NP_036608.1	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	260					axonogenesis (GO:0007409)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic eye morphogenesis (GO:0048048)|forebrain development (GO:0030900)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A260A(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	7						ATCTGCCTGCCGGCTACGAAC	0.642																																					p.A260A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C780T	2						.						21.0	23.0	23.0					2																	71160241		2203	4300	6503	71013749	SO:0001819	synonymous_variant	25806	exon3			Y17791	CCDS1911.1	2p13.3	2011-06-20			ENSG00000116035	ENSG00000116035		"""Homeoboxes / ANTP class : NKL subclass"""	12661	protein-coding gene	gene with protein product		604295				10485894	Standard	NM_012476		Approved	DRES93	uc002shh.3	Q9UIW0	OTTHUMG00000129714	ENST00000234392.2:c.780C>T	2.37:g.71160241C>T			71013749	NM_012476	Q53Y33	Silent	SNP	ENST00000234392.2	37	CCDS1911.1																																																																																				0.642	VAX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251923.1		
EXOC6B	23233	broad.mit.edu	37	2	72606983	72606983	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:72606983G>A	ENST00000272427.6	-	19	2127	c.1997C>T	c.(1996-1998)aCa>aTa	p.T666I		NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	666					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)		p.T203I(1)		breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						CATACACGCTGTCTGGGCCAC	0.388																																					p.T666I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1997T	2						.						71.0	68.0	69.0					2																	72606983		1990	4166	6156	72460491	SO:0001583	missense	23233	exon19			AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1997C>T	2.37:g.72606983G>A	ENSP00000272427:p.Thr666Ile		72460491	NM_015189	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571946	0.86542	.	.	ENSG00000144036	ENST00000272427	T	0.28895	1.59	4.73	4.73	0.59995	.	.	.	.	.	T	0.57932	0.2087	M	0.84433	2.695	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.58008	-0.7712	9	0.21540	T	0.41	.	16.4984	0.84251	0.0:0.0:1.0:0.0	.	666	Q9Y2D4	EXC6B_HUMAN	I	666	ENSP00000272427:T666I	ENSP00000272427:T666I	T	-	2	0	EXOC6B	72460491	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.614000	0.98353	2.449000	0.82847	0.558000	0.71614	ACA		0.388	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
POLR1A	25885	broad.mit.edu	37	2	86254602	86254602	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:86254602C>T	ENST00000263857.6	-	34	5485	c.5107G>A	c.(5107-5109)Ggg>Agg	p.G1703R	POLR1A_ENST00000409681.1_Missense_Mutation_p.G1642R			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1703					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.G1703R(1)|p.G1703W(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						ACGACCTTCCCGACCACAAGG	0.577																																					p.G1703R												.	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G5107A	2						.						84.0	90.0	88.0					2																	86254602		2081	4208	6289	86108113	SO:0001583	missense	25885	exon34			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.5107G>A	2.37:g.86254602C>T	ENSP00000263857:p.Gly1703Arg		86108113	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	37	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471108	0.84533	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	D;D	0.90676	-2.71;-2.71	5.18	4.29	0.51040	.	0.000000	0.85682	D	0.000000	D	0.96306	0.8795	H	0.94222	3.51	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.96920	0.9673	10	0.87932	D	0	-28.0669	13.0751	0.59083	0.0:0.921:0.0:0.079	.	1703	O95602	RPA1_HUMAN	R	1703;1642	ENSP00000263857:G1703R;ENSP00000386300:G1642R	ENSP00000263857:G1703R	G	-	1	0	POLR1A	86108113	1.000000	0.71417	0.846000	0.33378	0.850000	0.48378	5.228000	0.65310	2.399000	0.81585	0.655000	0.94253	GGG		0.577	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
KANSL3	55683	broad.mit.edu	37	2	97268017	97268017	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:97268017G>A	ENST00000431828.1	-	19	2394	c.2318C>T	c.(2317-2319)aCc>aTc	p.T773I	KANSL3_ENST00000599854.1_Missense_Mutation_p.T686I|KANSL3_ENST00000441706.2_Intron|KANSL3_ENST00000440133.1_Missense_Mutation_p.T593I|KANSL3_ENST00000487070.1_Intron			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	799					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.T773I(1)									AATGGTGCTGGTGCCCGTGGT	0.617																																					p.T773I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2318T	2						.						37.0	40.0	39.0					2																	97268017		2086	4219	6305	96631744	SO:0001583	missense	55683	exon19			BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.2318C>T	2.37:g.97268017G>A	ENSP00000396749:p.Thr773Ile		96631744	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	ENST00000431828.1	37	CCDS46361.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310086	0.60414	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000440133;ENST00000444759	T;T	0.54866	0.55;0.62	5.81	5.81	0.92471	.	0.203319	0.51477	N	0.000087	T	0.45276	0.1334	L	0.27053	0.805	0.80722	D	1	B;P;B;B;B	0.39216	0.232;0.664;0.126;0.13;0.343	B;B;B;B;B	0.39419	0.034;0.299;0.074;0.075;0.074	T	0.44205	-0.9343	10	0.51188	T	0.08	.	17.5664	0.87921	0.0:0.0:1.0:0.0	.	567;799;773;684;659	B4E1W4;Q9P2N6;Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;K1310_HUMAN;.;.;.	I	686;659;773;593;567	ENSP00000396749:T773I;ENSP00000406207:T593I	ENSP00000346144:T686I	T	-	2	0	KIAA1310	96631744	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.319000	0.72871	2.738000	0.93877	0.655000	0.94253	ACC		0.617	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
COL6A3	1293	broad.mit.edu	37	2	238249316	238249316	+	Missense_Mutation	SNP	G	G	A	rs115595706	byFrequency	TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr2:238249316G>A	ENST00000295550.4	-	38	8695	c.8243C>T	c.(8242-8244)cCg>cTg	p.P2748L	COL6A3_ENST00000346358.4_Missense_Mutation_p.P2548L|COL6A3_ENST00000409809.1_Missense_Mutation_p.P2542L|COL6A3_ENST00000472056.1_Missense_Mutation_p.P2141L|COL6A3_ENST00000347401.3_Missense_Mutation_p.P2547L|COL6A3_ENST00000353578.4_Missense_Mutation_p.P2542L	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2748	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.P2748L(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CTGCTGCTCCGGCACCTCGCC	0.547													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		21749	0.0		0.0	False		,,,				2504	0.0				p.P2141L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C6422T	2						.						80.0	79.0	80.0					2																	238249316		2203	4300	6503	237914055	SO:0001583	missense	1293	exon35			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8243C>T	2.37:g.238249316G>A	ENSP00000295550:p.Pro2748Leu		237914055	NM_057166	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	8.002	0.755630	0.15846	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.44	-10.9	0.00192	von Willebrand factor, type A (3);	1.166690	0.06424	N	0.722924	T	0.77837	0.4190	L	0.36672	1.1	0.09310	N	1	B;B;D	0.62365	0.016;0.013;0.991	B;B;P	0.53760	0.01;0.006;0.734	T	0.78945	-0.2004	10	0.41790	T	0.15	.	9.562	0.39376	0.0:0.271:0.458:0.271	.	2141;2542;2748	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	L	2748;2547;2542;2141;2542;2548	ENSP00000295550:P2748L;ENSP00000315609:P2547L;ENSP00000315873:P2542L;ENSP00000418285:P2141L;ENSP00000386844:P2542L;ENSP00000295546:P2548L	ENSP00000295550:P2748L	P	-	2	0	COL6A3	237914055	0.000000	0.05858	0.000000	0.03702	0.475000	0.33008	-0.711000	0.05019	-2.866000	0.00325	-1.799000	0.00621	CCG		0.547	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
GKAP1	80318	broad.mit.edu	37	9	86403589	86403589	+	Missense_Mutation	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr9:86403589G>T	ENST00000376371.2	-	5	765	c.365C>A	c.(364-366)aCa>aAa	p.T122K	GKAP1_ENST00000376365.3_Missense_Mutation_p.T122K	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1	122					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)		p.T122K(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						CATTTCAGATGTCAGCTACAA	0.299																																					p.T122K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C365A	9						.						119.0	120.0	120.0					9																	86403589		2201	4292	6493	85593409	SO:0001583	missense	80318	exon5			BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.365C>A	9.37:g.86403589G>T	ENSP00000365550:p.Thr122Lys		85593409	NM_025211	Q96LI0|Q9BYI1|Q9BYI2|Q9H225	Missense_Mutation	SNP	ENST00000376371.2	37	CCDS35049.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495548	0.85069	.	.	ENSG00000165113	ENST00000376371;ENST00000376365	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.77082	0.4078	M	0.76838	2.35	0.80722	D	1	P;D	0.58970	0.775;0.984	B;P	0.56700	0.436;0.804	T	0.79820	-0.1642	9	0.72032	D	0.01	-14.7711	19.1566	0.93514	0.0:0.0:1.0:0.0	.	122;122	Q5VSY0-2;Q5VSY0	.;GKAP1_HUMAN	K	122	.	ENSP00000365544:T122K	T	-	2	0	GKAP1	85593409	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.725000	0.74752	2.700000	0.92200	0.585000	0.79938	ACA		0.299	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052839.2	NM_025211	
SSNA1	8636	broad.mit.edu	37	9	140083672	140083672	+	Missense_Mutation	SNP	C	C	A			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr9:140083672C>A	ENST00000322310.5	+	2	287	c.207C>A	c.(205-207)aaC>aaA	p.N69K	SSNA1_ENST00000459860.1_3'UTR|ANAPC2_ENST00000323927.2_5'Flank	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1	69					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.N69K(1)		breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		CCTCTCGCAACGAGTTCGACC	0.642																																					p.N69K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C207A	9						.						54.0	42.0	46.0					9																	140083672		2203	4299	6502	139203493	SO:0001583	missense	8636	exon2			Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.207C>A	9.37:g.140083672C>A	ENSP00000313752:p.Asn69Lys		139203493	NM_003731	Q5VSG0|Q6FG70|Q9BVW8	Missense_Mutation	SNP	ENST00000322310.5	37	CCDS7034.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600636	0.28534	.	.	ENSG00000176101	ENST00000322310	D	0.82711	-1.64	4.07	2.16	0.27623	.	0.192916	0.45361	D	0.000379	T	0.80082	0.4558	M	0.84683	2.71	0.35541	D	0.803026	B	0.20164	0.042	B	0.15484	0.013	T	0.73382	-0.4000	10	0.12103	T	0.63	-28.6855	8.7668	0.34708	0.0:0.7902:0.0:0.2098	.	69	O43805	SSNA1_HUMAN	K	69	ENSP00000313752:N69K	ENSP00000313752:N69K	N	+	3	2	SSNA1	139203493	0.652000	0.27349	1.000000	0.80357	0.995000	0.86356	0.080000	0.14802	0.827000	0.34685	0.561000	0.74099	AAC		0.642	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055311.1	NM_003731	
PROSER1	80209	broad.mit.edu	37	13	39587547	39587547	+	Silent	SNP	A	A	G			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:39587547A>G	ENST00000352251.3	-	11	2675	c.1842T>C	c.(1840-1842)ccT>ccC	p.P614P	PROSER1_ENST00000350125.3_Silent_p.P592P|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	614	Ser-rich.							p.P614P(1)									CCGAGGGAGTAGGACTTGTGG	0.502																																					p.P592P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1776C	13						.						155.0	164.0	161.0					13																	39587547		2203	4300	6503	38485547	SO:0001819	synonymous_variant	80209	exon10			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1842T>C	13.37:g.39587547A>G			38485547	NM_170719	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Silent	SNP	ENST00000352251.3	37	CCDS9368.2																																																																																				0.502	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
COG6	57511	broad.mit.edu	37	13	40297544	40297544	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:40297544C>G	ENST00000455146.3	+	16	1709	c.1659C>G	c.(1657-1659)atC>atG	p.I553M	COG6_ENST00000416691.1_Missense_Mutation_p.I553M	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	553					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.I553M(1)		NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TGAGTTACATCTATAACACTG	0.358																																					p.I553M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1659G	13						.						107.0	98.0	102.0					13																	40297544		2203	4300	6503	39195544	SO:0001583	missense	57511	exon16			AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.1659C>G	13.37:g.40297544C>G	ENSP00000397441:p.Ile553Met		39195544	NM_001145079	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	ENST00000455146.3	37	CCDS9370.1	.	.	.	.	.	.	.	.	.	.	C	8.653	0.898622	0.17686	.	.	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000455146	T;T	0.56444	0.46;0.46	5.66	3.95	0.45737	.	0.044756	0.85682	D	0.000000	T	0.46210	0.1381	M	0.61703	1.905	0.80722	D	1	P;B	0.38280	0.625;0.425	B;B	0.37508	0.252;0.192	T	0.39354	-0.9618	10	0.45353	T	0.12	-12.1367	6.1824	0.20478	0.1327:0.6519:0.0:0.2154	.	574;553	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	M	553;584;553	ENSP00000403733:I553M;ENSP00000397441:I553M	ENSP00000255468:I584M	I	+	3	3	COG6	39195544	1.000000	0.71417	0.998000	0.56505	0.186000	0.23388	1.037000	0.30241	0.755000	0.32990	-0.157000	0.13467	ATC		0.358	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3		
DIAPH3	81624	broad.mit.edu	37	13	60584789	60584789	+	Silent	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:60584789T>C	ENST00000400324.4	-	8	1006	c.786A>G	c.(784-786)agA>agG	p.R262R	DIAPH3_ENST00000465066.1_5'UTR|DIAPH3-AS1_ENST00000435636.1_RNA|DIAPH3_ENST00000377908.2_Silent_p.R251R|DIAPH3_ENST00000400330.1_Silent_p.R262R|DIAPH3_ENST00000400319.1_Silent_p.R192R|DIAPH3-AS1_ENST00000432995.1_RNA|DIAPH3_ENST00000267215.4_Silent_p.R262R|DIAPH3_ENST00000400320.1_Silent_p.R216R|DIAPH3-AS1_ENST00000422052.1_RNA	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	262	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R262R(1)		cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CACTCATAATTCTTTCCAAGC	0.353																																					p.R262R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A786G	13						.						46.0	48.0	48.0					13																	60584789		1820	4079	5899	59482790	SO:0001819	synonymous_variant	81624	exon8			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.786A>G	13.37:g.60584789T>C			59482790	NM_001042517	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Silent	SNP	ENST00000400324.4	37	CCDS41898.1																																																																																				0.353	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045166.3	NM_001042517	
PCDH9	5101	broad.mit.edu	37	13	66878816	66878816	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:66878816T>C	ENST00000377865.2	-	4	3819	c.3685A>G	c.(3685-3687)Act>Gct	p.T1229A	PCDH9_ENST00000456367.1_Missense_Mutation_p.T1195A|PCDH9_ENST00000544246.1_Missense_Mutation_p.T1229A|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.T1195A			Q9HC56	PCDH9_HUMAN	protocadherin 9	1229					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T1229A(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GGACTCTCAGTAGCACCTCCT	0.428																																					p.T1195A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A3583G	13						.						114.0	109.0	110.0					13																	66878816		2203	4300	6503	65776817	SO:0001583	missense	5101	exon4			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3685A>G	13.37:g.66878816T>C	ENSP00000367096:p.Thr1229Ala		65776817	NM_020403	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	T	10.68	1.419100	0.25552	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.51817	0.76;0.76;0.69;0.69	6.05	2.52	0.30459	.	0.631198	0.14265	N	0.330555	T	0.22975	0.0555	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.19353	-1.0308	10	0.19590	T	0.45	.	5.9808	0.19405	0.0:0.4852:0.0:0.5148	.	1187;1195;1229	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	A	1229;1229;1195;1195	ENSP00000442186:T1229A;ENSP00000367096:T1229A;ENSP00000401699:T1195A;ENSP00000332060:T1195A	ENSP00000332060:T1195A	T	-	1	0	PCDH9	65776817	0.147000	0.22687	0.132000	0.22025	0.965000	0.64279	1.604000	0.36804	0.543000	0.28864	0.528000	0.53228	ACT		0.428	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
TBC1D4	9882	broad.mit.edu	37	13	75873657	75873657	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:75873657G>C	ENST00000377636.3	-	17	3311	c.2965C>G	c.(2965-2967)Ctg>Gtg	p.L989V	TBC1D4_ENST00000431480.2_Missense_Mutation_p.L981V|TBC1D4_ENST00000425511.1_Missense_Mutation_p.L153V|TBC1D4_ENST00000478591.1_5'UTR|TBC1D4_ENST00000377625.2_Missense_Mutation_p.L926V	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	989	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)	p.L989V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		AACAGTGACAGCTGTCCTGGC	0.463																																					p.L989V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2965G	13						.						53.0	55.0	54.0					13																	75873657		1893	4126	6019	74771658	SO:0001583	missense	9882	exon17			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.2965C>G	13.37:g.75873657G>C	ENSP00000366863:p.Leu989Val		74771658	NM_014832	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	ENST00000377636.3	37	CCDS41901.1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812391	0.70912	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	5.45	4.59	0.56863	Rab-GAP/TBC domain (4);	0.259655	0.26311	N	0.025109	T	0.20455	0.0492	L	0.35414	1.06	0.53005	D	0.99996	B;P;D;D	0.63046	0.376;0.682;0.974;0.992	B;P;P;D	0.81914	0.276;0.74;0.902;0.995	T	0.00341	-1.1804	10	0.59425	D	0.04	-14.8351	10.7376	0.46135	0.1465:0.0:0.8535:0.0	.	153;926;981;989	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	V	989;981;926;153	ENSP00000366863:L989V;ENSP00000395986:L981V;ENSP00000366852:L926V;ENSP00000390654:L153V	ENSP00000366852:L926V	L	-	1	2	TBC1D4	74771658	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.778000	0.47726	2.539000	0.85634	0.591000	0.81541	CTG		0.463	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045283.1	NM_014832	
SLITRK5	26050	broad.mit.edu	37	13	88330382	88330382	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:88330382A>T	ENST00000325089.6	+	2	2958	c.2739A>T	c.(2737-2739)gaA>gaT	p.E913D	SLITRK5_ENST00000400028.3_Missense_Mutation_p.E672D	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	913					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.E913D(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GGCTACGGGAACCGGTGCTCT	0.572																																					p.E913D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2739T	13						.						78.0	86.0	83.0					13																	88330382		2203	4300	6503	87128383	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2739A>T	13.37:g.88330382A>T	ENSP00000366283:p.Glu913Asp		87128383	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531706	0.64972	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.64085	-0.08;0.26	5.77	5.77	0.91146	.	0.057952	0.64402	D	0.000003	T	0.62563	0.2438	L	0.59436	1.845	0.47862	D	0.99953	P;P	0.49185	0.852;0.92	B;P	0.45071	0.213;0.468	T	0.63941	-0.6523	9	.	.	.	-10.0643	14.0545	0.64759	1.0:0.0:0.0:0.0	.	672;913	B4DSH5;O94991	.;SLIK5_HUMAN	D	913;672	ENSP00000366283:E913D;ENSP00000442244:E672D	.	E	+	3	2	SLITRK5	87128383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.095000	0.50235	2.200000	0.70718	0.459000	0.35465	GAA		0.572	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
DOCK9	23348	broad.mit.edu	37	13	99515280	99515280	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:99515280G>A	ENST00000376460.1	-	32	3652	c.3572C>T	c.(3571-3573)gCg>gTg	p.A1191V	DOCK9_ENST00000448493.2_Missense_Mutation_p.A1203V|DOCK9_ENST00000461998.1_5'UTR|DOCK9_ENST00000339416.2_Missense_Mutation_p.A1192V|DOCK9_ENST00000442173.1_Missense_Mutation_p.A1191V	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1192					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1192V(1)|p.A1203V(1)		breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TACCATGCCCGCGTTCACAGG	0.547																																					p.A1191V												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C3572T	13						.						52.0	50.0	50.0					13																	99515280		2033	4191	6224	98313281	SO:0001583	missense	23348	exon32			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.3572C>T	13.37:g.99515280G>A	ENSP00000365643:p.Ala1191Val		98313281	NM_001130050	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	G	9.635	1.137461	0.21123	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000400220;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.26	4.26	0.50523	.	0.352684	0.34025	N	0.004334	T	0.15262	0.0368	N	0.14661	0.345	0.21915	N	0.999471	B;B;B;B;B;B	0.20459	0.008;0.001;0.014;0.001;0.0;0.045	B;B;B;B;B;B	0.14023	0.002;0.0;0.004;0.001;0.001;0.01	T	0.13926	-1.0491	10	0.31617	T	0.26	.	12.8979	0.58109	0.0:0.0:1.0:0.0	.	1192;1191;1192;1191;1191;1192	A6H8Z6;E9PFM9;A8MWZ5;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;.;DOCK9_HUMAN	V	1191;1192;1192;1192;1191;122;1192;1203;1191	ENSP00000365643:A1191V;ENSP00000341086:A1192V;ENSP00000401958:A1203V;ENSP00000406883:A1191V	ENSP00000341086:A1192V	A	-	2	0	DOCK9	98313281	.	.	0.875000	0.34327	0.002000	0.02628	.	.	2.293000	0.77203	0.555000	0.69702	GCG		0.547	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
GPR18	2841	broad.mit.edu	37	13	99908103	99908103	+	Missense_Mutation	SNP	A	A	T			TCGA-AG-A026-01	TCGA-AG-A026-01	A	A					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr13:99908103A>T	ENST00000340807.3	-	3	580	c.24T>A	c.(22-24)gaT>gaA	p.D8E	UBAC2_ENST00000403766.3_Intron|GPR18_ENST00000397473.2_Missense_Mutation_p.D8E|UBAC2_ENST00000376440.2_Intron|GPR18_ENST00000397470.2_Missense_Mutation_p.D8E			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	8					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D8E(1)		endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	GGACAGGTTGATCTTGATTGT	0.328																																					p.D8E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T24A	13						.						136.0	133.0	134.0					13																	99908103		2203	4300	6503	98706104	SO:0001583	missense	2841	exon3			L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.24T>A	13.37:g.99908103A>T	ENSP00000343428:p.Asp8Glu		98706104	NM_005292	Q6GTM3|Q96HI6|Q9H2L2	Missense_Mutation	SNP	ENST00000340807.3	37	CCDS9491.1	.	.	.	.	.	.	.	.	.	.	A	8.601	0.886845	0.17540	.	.	ENSG00000125245	ENST00000397473;ENST00000397470;ENST00000340807;ENST00000416594	T;T;T;T	0.63255	-0.03;-0.03;-0.03;1.38	5.47	0.867	0.19085	.	0.665170	0.14456	N	0.318474	T	0.35828	0.0945	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.18147	-1.0346	9	.	.	.	0.0	8.5782	0.33612	0.612:0.0:0.388:0.0	.	8	Q14330	GPR18_HUMAN	E	8	ENSP00000380613:D8E;ENSP00000380610:D8E;ENSP00000343428:D8E;ENSP00000401611:D8E	.	D	-	3	2	GPR18	98706104	0.085000	0.21516	0.006000	0.13384	0.521000	0.34408	1.170000	0.31883	-0.065000	0.13021	0.460000	0.39030	GAT		0.328	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1		
ACTR1A	10121	broad.mit.edu	37	10	104243990	104243990	+	Missense_Mutation	SNP	C	C	T	rs368237331		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:104243990C>T	ENST00000369905.4	-	6	647	c.584G>A	c.(583-585)cGc>cAc	p.R195H	RP11-18I14.11_ENST00000608017.1_RNA|ACTR1A_ENST00000545684.1_Missense_Mutation_p.R121H|ACTR1A_ENST00000487599.1_Missense_Mutation_p.R195H|ACTR1A_ENST00000446605.2_Missense_Mutation_p.R148H|ACTR1A_ENST00000470322.1_5'Flank	NM_005736.3	NP_005727.1	P61163	ACTZ_HUMAN	ARP1 actin-related protein 1 homolog A, centractin alpha (yeast)	195					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|microtubule associated complex (GO:0005875)	ATP binding (GO:0005524)	p.R195H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	13		Colorectal(252;0.122)		Epithelial(162;5.34e-09)|all cancers(201;1.43e-07)|BRCA - Breast invasive adenocarcinoma(275;0.222)		CAGGTAGAGGCGCAGGAAGCG	0.577																																					p.R195H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G584A	10						.	C	HIS/ARG	0,4406		0,0,2203	97.0	90.0	92.0		584	5.7	1.0	10		92	1,8599	1.2+/-3.3	0,1,4299	no	missense	ACTR1A	NM_005736.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	195/377	104243990	1,13005	2203	4300	6503	104233980	SO:0001583	missense	10121	exon6			X82206	CCDS7536.1	10q24	2008-07-08	2001-11-28		ENSG00000138107	ENSG00000138107			167	protein-coding gene	gene with protein product		605143	"""ARP1 (actin-related protein 1, yeast) homolog A (centractin alpha)"""			1528266	Standard	NM_005736		Approved	ARP1	uc001kvv.3	P61163	OTTHUMG00000018956	ENST00000369905.4:c.584G>A	10.37:g.104243990C>T	ENSP00000358921:p.Arg195His		104233980	NM_005736	B2R6B0|P42024	Missense_Mutation	SNP	ENST00000369905.4	37	CCDS7536.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605157	0.66445	0.0	1.16E-4	ENSG00000138107	ENST00000369905;ENST00000545684;ENST00000446605	T;T;T	0.08282	3.11;3.11;3.11	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.14743	0.0356	M	0.64170	1.965	0.80722	D	1	B	0.15719	0.014	B	0.18263	0.021	T	0.02184	-1.1199	10	0.87932	D	0	.	19.7891	0.96450	0.0:1.0:0.0:0.0	.	195	P61163	ACTZ_HUMAN	H	195;121;148	ENSP00000358921:R195H;ENSP00000438890:R121H;ENSP00000406028:R148H	ENSP00000358921:R195H	R	-	2	0	ACTR1A	104233980	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.738000	0.62073	2.692000	0.91855	0.561000	0.74099	CGC		0.577	ACTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050053.1		
DHTKD1	55526	broad.mit.edu	37	10	12131190	12131190	+	Missense_Mutation	SNP	G	G	A	rs17849603		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:12131190G>A	ENST00000263035.4	+	5	985	c.923G>A	c.(922-924)cGc>cAc	p.R308H	DHTKD1_ENST00000465617.1_Intron	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	308			R -> L (in dbSNP:rs17849603). {ECO:0000269|PubMed:15489334}.		cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)	p.R308H(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			CAGCAGTCTCGCCAAGACGGC	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17379	0.001		0.0	False		,,,				2504	0.0				p.R308H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G923A	10						.	G	HIS/ARG	0,4406		0,0,2203	63.0	60.0	61.0		923	3.2	0.0	10	dbSNP_123	61	1,8597	1.2+/-3.3	0,1,4298	no	missense	DHTKD1	NM_018706.5	29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	308/920	12131190	1,13003	2203	4299	6502	12171196	SO:0001583	missense	55526	exon5			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.923G>A	10.37:g.12131190G>A	ENSP00000263035:p.Arg308His		12171196	NM_018706	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	10.53	1.376683	0.24857	0.0	1.16E-4	ENSG00000181192	ENST00000263035;ENST00000437298;ENST00000415935	T;T;D	0.90732	2.49;2.49;-2.72	5.43	3.19	0.36642	Dehydrogenase, E1 component (1);	0.417546	0.25032	N	0.033677	D	0.86176	0.5870	L	0.38953	1.18	0.09310	N	1	P	0.44734	0.842	P	0.47645	0.553	T	0.76828	-0.2815	10	0.36615	T	0.2	-10.0499	5.9275	0.19120	0.178:0.0:0.5744:0.2475	.	308	Q96HY7	DHTK1_HUMAN	H	308;243;6	ENSP00000263035:R308H;ENSP00000388163:R243H;ENSP00000400625:R6H	ENSP00000263035:R308H	R	+	2	0	DHTKD1	12171196	0.012000	0.17670	0.020000	0.16555	0.024000	0.10985	1.915000	0.39976	1.259000	0.44117	0.563000	0.77884	CGC		0.607	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
ATRNL1	26033	broad.mit.edu	37	10	117061475	117061475	+	Nonsense_Mutation	SNP	C	C	T	rs555650933		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:117061475C>T	ENST00000355044.3	+	17	2866	c.2740C>T	c.(2740-2742)Cga>Tga	p.R914*	ATRNL1_ENST00000303745.7_5'Flank|ATRNL1_ENST00000423111.2_Nonsense_Mutation_p.R11*	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	914	PSI 4.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.R914*(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CAGTACGAAACGATGTGTTGA	0.453																																					p.R914X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C2740T	10						.						292.0	214.0	241.0					10																	117061475		2203	4300	6503	117051465	SO:0001587	stop_gained	26033	exon17			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2740C>T	10.37:g.117061475C>T	ENSP00000347152:p.Arg914*		117051465	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Nonsense_Mutation	SNP	ENST00000355044.3	37	CCDS7592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	7.247262|7.247262	0.98161|0.98161	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	.|.	.|.	.|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.76506	.|0.3997	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74630	.|-0.3601	.|4	0.02654|.	T|.	1|.	-5.4211|-5.4211	19.7031|19.7031	0.96063|0.96063	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|M	914;11|43	.|.	ENSP00000347152:R914X|.	R|T	+|+	1|2	2|0	ATRNL1|ATRNL1	117051465|117051465	1.000000|1.000000	0.71417|0.71417	0.142000|0.142000	0.22268|0.22268	0.861000|0.861000	0.49209|0.49209	7.730000|7.730000	0.84881|0.84881	2.664000|2.664000	0.90586|0.90586	0.591000|0.591000	0.81541|0.81541	CGA|ACG		0.453	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
DOCK1	1793	broad.mit.edu	37	10	128824642	128824642	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:128824642C>T	ENST00000280333.6	+	16	1624	c.1515C>T	c.(1513-1515)aaC>aaT	p.N505N	RP11-223P11.3_ENST00000594614.1_RNA|RP11-223P11.3_ENST00000432554.2_RNA|RP11-223P11.3_ENST00000594559.1_RNA|RP11-223P11.3_ENST00000599979.1_RNA|RP11-223P11.3_ENST00000595456.1_RNA|RP11-223P11.2_ENST00000420941.2_RNA|RP11-223P11.3_ENST00000601826.1_RNA|RP11-223P11.3_ENST00000608350.1_RNA|RP11-223P11.3_ENST00000601242.1_RNA	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	505	DHR-1.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.N505N(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AGGACGTTAACCGCAGTCACC	0.458																																					p.N505N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1515T	10						.						74.0	74.0	74.0					10																	128824642		1955	4144	6099	128714632	SO:0001819	synonymous_variant	1793	exon16			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.1515C>T	10.37:g.128824642C>T			128714632	NM_001380	A9Z1Z5	Silent	SNP	ENST00000280333.6	37																																																																																					0.458	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
KLF6	1316	broad.mit.edu	37	10	3824117	3824117	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:3824117C>T	ENST00000497571.1	-	2	652	c.392G>A	c.(391-393)gGc>gAc	p.G131D	KLF6_ENST00000469435.1_Missense_Mutation_p.G131D|KLF6_ENST00000542957.1_Missense_Mutation_p.G131D|KLF6_ENST00000173785.4_5'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	131					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G131D(1)		breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		CAAAACTTCGCCAATGGGGTC	0.542											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G131D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G392A	10						.						95.0	99.0	98.0					10																	3824117		2203	4300	6503	3814117	SO:0001583	missense	1316	exon2			U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.392G>A	10.37:g.3824117C>T	ENSP00000419923:p.Gly131Asp	614	3814117	NM_001160125	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	ENST00000497571.1	37	CCDS7060.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172016	0.38315	.	.	ENSG00000067082	ENST00000497571;ENST00000542957;ENST00000469435	T;T;T	0.52983	3.35;0.64;0.87	4.99	4.99	0.66335	.	0.549231	0.21711	N	0.070267	T	0.49575	0.1565	M	0.62723	1.935	0.27205	N	0.960058	B;B;P;P	0.49783	0.29;0.076;0.928;0.79	B;B;B;B	0.44085	0.17;0.246;0.44;0.343	T	0.49771	-0.8904	10	0.23302	T	0.38	.	17.2727	0.87106	0.0:1.0:0.0:0.0	.	131;131;131;131	D3GC14;F5H3M5;Q99612-2;Q99612	.;.;.;KLF6_HUMAN	D	131	ENSP00000419923:G131D;ENSP00000445301:G131D;ENSP00000419079:G131D	ENSP00000419079:G131D	G	-	2	0	KLF6	3814117	0.923000	0.31300	0.650000	0.29550	0.169000	0.22640	4.858000	0.62947	2.309000	0.77851	0.561000	0.74099	GGC		0.542	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		
NEBL	10529	broad.mit.edu	37	10	21074816	21074816	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:21074816C>T	ENST00000377122.4	-	28	3301	c.2905G>A	c.(2905-2907)Gat>Aat	p.D969N	NEBL_ENST00000417816.2_Missense_Mutation_p.D225N|NEBL_ENST00000377159.4_Missense_Mutation_p.D191N	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	969	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)	p.D969N(1)		NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						TCGTCTTCATCCTGGGCACTG	0.498																																					p.D969N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2905A	10						.						134.0	113.0	120.0					10																	21074816		2203	4300	6503	21114822	SO:0001583	missense	10529	exon28			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.2905G>A	10.37:g.21074816C>T	ENSP00000366326:p.Asp969Asn		21114822	NM_006393	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000377122.4	37	CCDS7134.1	.	.	.	.	.	.	.	.	.	.	C	35	5.496545	0.96355	.	.	ENSG00000078114	ENST00000377122;ENST00000417816;ENST00000377159	T;T;T	0.52526	0.66;0.66;0.66	5.84	5.84	0.93424	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.71796	0.3382	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.97110	0.995;1.0	T	0.71293	-0.4636	9	0.51188	T	0.08	.	20.1379	0.98040	0.0:1.0:0.0:0.0	.	225;969	Q70I54;O76041	.;NEBL_HUMAN	N	969;225;191	ENSP00000366326:D969N;ENSP00000393896:D225N;ENSP00000366364:D191N	ENSP00000366326:D969N	D	-	1	0	NEBL	21114822	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.803000	0.85983	2.779000	0.95612	0.655000	0.94253	GAT		0.498	NEBL-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047113.1	NM_006393	
BMS1	9790	broad.mit.edu	37	10	43325738	43325738	+	Missense_Mutation	SNP	T	T	G			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:43325738T>G	ENST00000374518.5	+	22	3549	c.3486T>G	c.(3484-3486)aaT>aaG	p.N1162K	RNU6-885P_ENST00000516607.1_RNA	NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	1162					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)	p.N1162K(1)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AACATTTTAATTCACTGCACA	0.413																																					p.N1162K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3486G	10						.						60.0	64.0	63.0					10																	43325738		2203	4298	6501	42645744	SO:0001583	missense	9790	exon22			BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.3486T>G	10.37:g.43325738T>G	ENSP00000363642:p.Asn1162Lys		42645744	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	37	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.665222	0.47677	.	.	ENSG00000165733	ENST00000374518	T	0.23552	1.9	4.78	1.03	0.20045	.	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	M	0.71920	2.185	0.41412	D	0.987744	D	0.69078	0.997	D	0.75484	0.986	T	0.15321	-1.0441	10	0.33141	T	0.24	.	9.4841	0.38919	0.0:0.3756:0.0:0.6244	.	1162	Q14692	BMS1_HUMAN	K	1162	ENSP00000363642:N1162K	ENSP00000363642:N1162K	N	+	3	2	BMS1	42645744	0.994000	0.37717	0.998000	0.56505	0.985000	0.73830	0.312000	0.19397	-0.008000	0.14320	0.254000	0.18369	AAT		0.413	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
KIF20B	9585	broad.mit.edu	37	10	91498179	91498179	+	Missense_Mutation	SNP	T	T	C			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:91498179T>C	ENST00000371728.3	+	20	3646	c.3581T>C	c.(3580-3582)aTc>aCc	p.I1194T	KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Missense_Mutation_p.I1194T|KIF20B_ENST00000416354.1_Missense_Mutation_p.I1224T|KIF20B_ENST00000260753.4_Missense_Mutation_p.I1154T	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1194					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)	p.I1154T(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GAATCTATCATCTTAAAGCTA	0.313																																					p.I1154T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3461C	10						.						52.0	57.0	55.0					10																	91498179		2203	4296	6499	91488159	SO:0001583	missense	9585	exon20			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3581T>C	10.37:g.91498179T>C	ENSP00000360793:p.Ile1194Thr		91488159	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	T	9.276	1.046894	0.19748	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.72835	-0.61;-0.63;-0.69;-0.62	5.82	5.82	0.92795	.	0.000000	0.51477	D	0.000094	T	0.65037	0.2653	L	0.52364	1.645	0.31004	N	0.71997	P;P	0.40970	0.615;0.734	B;B	0.39503	0.158;0.301	T	0.73607	-0.3929	10	0.72032	D	0.01	-9.9549	10.5104	0.44857	0.0:0.0721:0.0:0.9279	.	1194;1154	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	T	1154;1224;1194;1194	ENSP00000260753:I1154T;ENSP00000411545:I1224T;ENSP00000377830:I1194T;ENSP00000360793:I1194T	ENSP00000260753:I1154T	I	+	2	0	KIF20B	91488159	1.000000	0.71417	0.747000	0.31113	0.126000	0.20510	3.285000	0.51716	2.222000	0.72286	0.383000	0.25322	ATC		0.313	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
KIF11	3832	broad.mit.edu	37	10	94368853	94368853	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:94368853C>T	ENST00000260731.3	+	5	554	c.464C>T	c.(463-465)tCa>tTa	p.S155L		NM_004523.3	NP_004514.2	P52732	KIF11_HUMAN	kinesin family member 11	155	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|chromosome segregation (GO:0007059)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|spindle assembly involved in mitosis (GO:0090307)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)	p.S155L(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACTGAATTTTCAGTCAAAGTG	0.348																																					p.S155L	Colon(47;212 1003 2764 4062 8431)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C464T	10						.						80.0	81.0	81.0					10																	94368853		2203	4300	6503	94358833	SO:0001583	missense	3832	exon5			X85137	CCDS7422.1	10q24.1	2008-03-03	2003-01-09	2003-01-10	ENSG00000138160	ENSG00000138160		"""Kinesins"""	6388	protein-coding gene	gene with protein product		148760	"""kinesin-like 1"""	KNSL1		1505978, 8548803	Standard	NM_004523		Approved	Eg5, HKSP, TRIP5	uc001kic.3	P52732	OTTHUMG00000018761	ENST00000260731.3:c.464C>T	10.37:g.94368853C>T	ENSP00000260731:p.Ser155Leu		94358833	NM_004523	A0AV49|B2RMV3|Q15716|Q5VWX0	Missense_Mutation	SNP	ENST00000260731.3	37	CCDS7422.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.893988	0.91889	.	.	ENSG00000138160	ENST00000260731	T	0.64618	-0.11	5.54	5.54	0.83059	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	T	0.73001	0.3531	L	0.41079	1.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67110	-0.5753	10	0.29301	T	0.29	.	19.6745	0.95926	0.0:1.0:0.0:0.0	.	155	P52732	KIF11_HUMAN	L	155	ENSP00000260731:S155L	ENSP00000260731:S155L	S	+	2	0	KIF11	94358833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.872000	0.69636	2.880000	0.98712	0.650000	0.86243	TCA		0.348	KIF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049401.1	NM_004523	
GOLGA7B	401647	broad.mit.edu	37	10	99623796	99623796	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:99623796C>T	ENST00000370602.1	+	3	313	c.248C>T	c.(247-249)aCg>aTg	p.T83M		NM_001010917.2	NP_001010917.1	Q2TAP0	GOG7B_HUMAN	golgin A7 family, member B	83				T -> M (in Ref. 2; AAI10811). {ECO:0000305}.		Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.T83M(1)		endometrium(1)|large_intestine(3)|prostate(1)	5						GCCTGCGCCACGGCCTACTTC	0.607																																					p.T83M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C248T	10						.						49.0	51.0	51.0					10																	99623796		2203	4300	6503	99613786	SO:0001583	missense	401647	exon3			BC008047	CCDS31265.1	10q24.2	2011-10-25	2010-02-12	2008-10-03	ENSG00000155265	ENSG00000155265			31668	protein-coding gene	gene with protein product		614189	"""chromosome 10 open reading frame 133"", ""chromosome 10 open reading frame 132"", ""golgi autoantigen, golgin subfamily a, 7B"""	C10orf133, C10orf132			Standard	NM_001010917		Approved	bA459F3.4, bA451M19.3	uc001kos.3	Q2TAP0	OTTHUMG00000018869	ENST00000370602.1:c.248C>T	10.37:g.99623796C>T	ENSP00000359634:p.Thr83Met		99613786	NM_001010917	Q5T4F5	Missense_Mutation	SNP	ENST00000370602.1	37	CCDS31265.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598387	0.66332	.	.	ENSG00000155265	ENST00000370602	.	.	.	5.31	5.31	0.75309	Golgin subfamily A member 7/ERF4 (1);	0.000000	0.85682	D	0.000000	D	0.84465	0.5478	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.86566	0.1844	9	0.72032	D	0.01	-30.2452	17.9131	0.88940	0.0:1.0:0.0:0.0	.	83	Q2TAP0	GOG7B_HUMAN	M	83	.	ENSP00000359634:T83M	T	+	2	0	GOLGA7B	99613786	1.000000	0.71417	0.956000	0.39512	0.010000	0.07245	7.651000	0.83577	2.779000	0.95612	0.655000	0.94253	ACG		0.607	GOLGA7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049752.1	NM_001010917	
FAM196A	642938	broad.mit.edu	37	10	128973764	128973764	+	Missense_Mutation	SNP	G	G	A	rs150869481		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr10:128973764G>A	ENST00000522781.1	-	4	1451	c.896C>T	c.(895-897)gCg>gTg	p.A299V	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Missense_Mutation_p.A299V	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	299								p.A299V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TTCCGAGGGCGCCTGGAGCCC	0.677													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15789	0.0		0.0	False		,,,				2504	0.0				p.A299V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C896T	10						.	G	VAL/ALA,	0,4406		0,0,2203	30.0	33.0	32.0		896,	-3.3	0.0	10	dbSNP_134	32	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	DOCK1,FAM196A	NM_001039762.2,NM_001380.3	64,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,	299/480,	128973764	1,13005	2203	4300	6503	128863754	SO:0001583	missense	642938	exon4				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.896C>T	10.37:g.128973764G>A	ENSP00000429763:p.Ala299Val		128863754	NM_001039762	B2RNT4|B7ZME7	Missense_Mutation	SNP	ENST00000522781.1	37	CCDS31312.1	.	.	.	.	.	.	.	.	.	.	G	7.165	0.586482	0.13749	0.0	1.16E-4	ENSG00000188916	ENST00000522781;ENST00000424811	T;T	0.44881	0.91;0.91	4.69	-3.33	0.04958	.	0.528179	0.21148	N	0.079380	T	0.27027	0.0662	L	0.35723	1.085	0.09310	N	1	B;B	0.18310	0.027;0.015	B;B	0.12837	0.008;0.007	T	0.16158	-1.0412	10	0.46703	T	0.11	.	9.3448	0.38102	0.1361:0.4551:0.4089:0.0	.	299;299	B7ZME7;Q6ZSG2	.;F196A_HUMAN	V	299	ENSP00000429763:A299V;ENSP00000428730:A299V	ENSP00000428730:A299V	A	-	2	0	FAM196A	128863754	0.192000	0.23301	0.014000	0.15608	0.025000	0.11179	0.594000	0.24014	-0.470000	0.06901	-0.214000	0.12660	GCG		0.677	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
APC	324	broad.mit.edu	37	5	112175101	112175101	+	Nonsense_Mutation	SNP	T	T	A	rs587783033		TCGA-AG-A026-01	TCGA-AG-A026-01	T	T					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:112175101T>A	ENST00000457016.1	+	16	4190	c.3810T>A	c.(3808-3810)tgT>tgA	p.C1270*	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Nonsense_Mutation_p.C1270*|APC_ENST00000508376.2_Nonsense_Mutation_p.C1270*			P25054	APC_HUMAN	adenomatous polyposis coli	1270	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S1272fs*16(1)|p.K1192fs*3(1)|p.?(1)|p.C1270*(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CTCCAATATGTTTTTCAAGAT	0.373		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.C1252X	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	.	4	Deletion - Frameshift(2)|Substitution - Nonsense(1)|Unknown(1)	large_intestine(2)|soft_tissue(1)|skin(1)	c.T3756A	5	GRCh37	CM000125|CX995213	APC	M|X		.						54.0	56.0	55.0					5																	112175101		2202	4300	6502	112203000	SO:0001587	stop_gained	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3810T>A	5.37:g.112175101T>A	ENSP00000413133:p.Cys1270*		112203000	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Nonsense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	T	39	7.338126	0.98221	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	.	.	.	6.03	3.66	0.41972	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.4828	9.2249	0.37400	0.0:0.1981:0.0:0.8019	.	.	.	.	X	1270	.	.	C	+	3	2	APC	112203000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.618000	0.24373	1.094000	0.41399	0.533000	0.62120	TGT		0.373	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
LVRN	206338	broad.mit.edu	37	5	115298564	115298564	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:115298564C>T	ENST00000357872.4	+	1	374	c.250C>T	c.(250-252)Ccg>Tcg	p.P84S	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		84						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.P84S(1)									GACGACCACCCCGAGCAACTG	0.692																																					p.P84S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C250T	5						.						27.0	31.0	30.0					5																	115298564		2190	4286	6476	115326463	SO:0001583	missense	206338	exon1																														ENST00000357872.4:c.250C>T	5.37:g.115298564C>T	ENSP00000350541:p.Pro84Ser		115326463	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	37	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	C	8.798	0.932182	0.18131	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.01252	5.1	3.5	-0.411	0.12370	.	3.638010	0.00792	N	0.001348	T	0.01189	0.0039	N	0.14661	0.345	0.09310	N	0.999991	B	0.12013	0.005	B	0.08055	0.003	T	0.46610	-0.9179	10	0.33141	T	0.24	.	4.0863	0.09948	0.0:0.37:0.4186:0.2114	.	84	Q6Q4G3	AMPQ_HUMAN	S	84	ENSP00000350541:P84S	ENSP00000350541:P84S	P	+	1	0	AC010282.1	115326463	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-0.232000	0.09811	-0.951000	0.02657	CCG		0.692	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
PCDHA12	56137	broad.mit.edu	37	5	140256370	140256370	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:140256370C>T	ENST00000398631.2	+	1	1313	c.1313C>T	c.(1312-1314)aCg>aTg	p.T438M	PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	438	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T438M(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTGGGCCACGGCTAGAGTG	0.662																																					p.T438M	Pancreas(113;759 1672 13322 24104 50104)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1313T	5						.						125.0	130.0	128.0					5																	140256370		2203	4299	6502	140236554	SO:0001583	missense	56137	exon1			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1313C>T	5.37:g.140256370C>T	ENSP00000381628:p.Thr438Met		140236554	NM_031864	O75278|Q2M1N8	Missense_Mutation	SNP	ENST00000398631.2	37	CCDS47285.1	.	.	.	.	.	.	.	.	.	.	C	9.981	1.228015	0.22542	.	.	ENSG00000251664	ENST00000398631	T	0.01854	4.6	4.92	4.92	0.64577	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.11965	0.0291	M	0.83953	2.67	0.09310	N	1	D;D	0.69078	0.997;0.997	P;D	0.66847	0.784;0.947	T	0.05649	-1.0872	9	0.66056	D	0.02	.	10.2762	0.43512	0.0:0.7861:0.1376:0.0763	.	438;438	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	M	438	ENSP00000381628:T438M	ENSP00000381628:T438M	T	+	2	0	PCDHA12	140236554	0.000000	0.05858	0.177000	0.23020	0.022000	0.10575	-0.074000	0.11450	2.452000	0.82932	0.650000	0.86243	ACG		0.662	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PCDHGA2	56113	broad.mit.edu	37	5	140720096	140720096	+	Missense_Mutation	SNP	T	T	A			TCGA-AG-A026-01	TCGA-AG-A026-01	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:140720096T>A	ENST00000394576.2	+	1	1558	c.1558T>A	c.(1558-1560)Ttt>Att	p.F520I	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	520	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F520I(1)		breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTGCGCTCCTTTGATTATGA	0.507																																					p.F520I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1558A	5						.						126.0	129.0	128.0					5																	140720096		2203	4300	6503	140700280	SO:0001583	missense	56113	exon1			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1558T>A	5.37:g.140720096T>A	ENSP00000378077:p.Phe520Ile		140700280	NM_032009	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	ENST00000394576.2	37	CCDS47289.1	.	.	.	.	.	.	.	.	.	.	.	16.59	3.164492	0.57476	.	.	ENSG00000081853	ENST00000394576	T	0.47528	0.84	5.21	5.21	0.72293	Cadherin (5);Cadherin-like (1);	0.000000	0.42294	U	0.000724	T	0.70020	0.3176	M	0.80616	2.505	0.38477	D	0.94762	D;D	0.89917	1.0;1.0	D;D	0.80764	0.99;0.994	T	0.77286	-0.2644	10	0.87932	D	0	.	15.0453	0.71822	0.0:0.0:0.0:1.0	.	520;520	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	I	520	ENSP00000378077:F520I	ENSP00000378077:F520I	F	+	1	0	PCDHGA2	140700280	0.966000	0.33281	0.997000	0.53966	0.018000	0.09664	1.689000	0.37700	2.094000	0.63399	0.482000	0.46254	TTT		0.507	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374738.1	NM_018915	
PCDHGB3	56102	broad.mit.edu	37	5	140779318	140779318	+	Intron	SNP	G	G	A	rs564705346		TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:140779318G>A	ENST00000576222.1	+	1	2546				PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCGCAAACGTGAGCCTGCG	0.672													.|||	1	0.000199681	0.0	0.0014	5008	,	,		17891	0.0		0.0	False		,,,				2504	0.0				p.V542M												.	.	0			c.G1624A	5						.						26.0	33.0	31.0					5																	140779318		2046	4196	6242	140759502	SO:0001627	intron_variant	56101	exon1			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26942G>A	5.37:g.140779318G>A			140759502	NM_032099	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																				0.672	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
MYO10	4651	broad.mit.edu	37	5	16703107	16703107	+	Missense_Mutation	SNP	C	C	G			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:16703107C>G	ENST00000513610.1	-	23	2891	c.2437G>C	c.(2437-2439)Gca>Cca	p.A813P	MYO10_ENST00000515803.1_Missense_Mutation_p.A152P|MYO10_ENST00000512061.1_5'Flank|MYO10_ENST00000427430.2_Missense_Mutation_p.A170P|MYO10_ENST00000274203.9_Missense_Mutation_p.A170P|MYO10_ENST00000505695.1_Missense_Mutation_p.A152P	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	813	IQ 3. {ECO:0000255|PROSITE- ProRule:PRU00116}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)	p.A813P(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						cttttctCTGCCAGCAATTGT	0.443																																					p.A813P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2437C	5						.						55.0	50.0	51.0					5																	16703107		1768	3894	5662	16756107	SO:0001583	missense	4651	exon23			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2437G>C	5.37:g.16703107C>G	ENSP00000421280:p.Ala813Pro		16756107	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	ENST00000513610.1	37	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946406	0.73672	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430;ENST00000513882	D;D;D;D;D;D	0.87887	-1.52;-1.52;-1.52;-1.52;-1.52;-2.31	5.61	5.61	0.85477	.	.	.	.	.	T	0.76083	0.3938	N	0.08118	0	0.45979	D	0.998797	B;P	0.37955	0.145;0.612	B;B	0.31547	0.093;0.132	T	0.79169	-0.1914	9	0.52906	T	0.07	.	19.2661	0.93985	0.0:1.0:0.0:0.0	.	454;813	Q69YP8;Q9HD67	.;MYO10_HUMAN	P	813;152;170;152;170;824	ENSP00000421280:A813P;ENSP00000425051:A152P;ENSP00000274203:A170P;ENSP00000421170:A152P;ENSP00000391106:A170P;ENSP00000421309:A824P	ENSP00000274203:A170P	A	-	1	0	MYO10	16756107	1.000000	0.71417	0.992000	0.48379	0.753000	0.42808	7.487000	0.81328	2.643000	0.89663	0.557000	0.71058	GCA		0.443	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
PCDHGC4	56098	broad.mit.edu	37	5	140865911	140865911	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:140865911G>A	ENST00000306593.1	+	1	1171	c.1171G>A	c.(1171-1173)Gac>Aac	p.D391N	PCDHGB4_ENST00000519479.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGC5_ENST00000252087.1_5'Flank|PCDHGA11_ENST00000398587.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	391	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D391N(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCATTCCTGACCACTTGCC	0.547																																					p.D391N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1171A	5						.						120.0	97.0	104.0					5																	140865911		2203	4300	6503	140846095	SO:0001583	missense	56098	exon1			AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.1171G>A	5.37:g.140865911G>A	ENSP00000306918:p.Asp391Asn		140846095	NM_032406	Q495T2|Q9Y5C3	Missense_Mutation	SNP	ENST00000306593.1	37	CCDS4262.1	.	.	.	.	.	.	.	.	.	.	G	8.505	0.865206	0.17250	.	.	ENSG00000242419	ENST00000306593	T	0.02863	4.13	5.01	4.13	0.48395	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02688	0.0081	N	0.16790	0.44	0.09310	N	1	B;B	0.28880	0.226;0.022	B;B	0.29598	0.104;0.09	T	0.48269	-0.9050	9	0.22109	T	0.4	.	14.8606	0.70379	0.0:0.2709:0.7291:0.0	.	391;391	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	N	391	ENSP00000306918:D391N	ENSP00000306918:D391N	D	+	1	0	PCDHGC4	140846095	0.000000	0.05858	0.988000	0.46212	0.724000	0.41520	0.276000	0.18716	1.308000	0.44962	0.563000	0.77884	GAC		0.547	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
MSX2	4488	broad.mit.edu	37	5	174151701	174151701	+	Silent	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:174151701C>T	ENST00000239243.6	+	1	166	c.39C>T	c.(37-39)ccC>ccT	p.P13P	MSX2_ENST00000507785.1_Silent_p.P13P	NM_002449.4	NP_002440.2	P35548	MSX2_HUMAN	msh homeobox 2	13					activation of meiosis (GO:0090427)|anagen (GO:0042640)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone trabecula formation (GO:0060346)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|chondrocyte development (GO:0002063)|cranial suture morphogenesis (GO:0060363)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|enamel mineralization (GO:0070166)|endochondral bone growth (GO:0003416)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|frontal suture morphogenesis (GO:0060364)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of catagen (GO:0051795)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|positive regulation of osteoblast differentiation (GO:0045669)|signal transduction involved in regulation of gene expression (GO:0023019)|wound healing, spreading of epidermal cells (GO:0035313)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)	p.P13P(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGTTTTCGCCCGACGAGGAGG	0.706																																					p.P13P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C39T	5						.						6.0	8.0	7.0					5																	174151701		2139	4216	6355	174084307	SO:0001819	synonymous_variant	4488	exon1			D26145	CCDS4392.1	5q35.2	2011-06-20	2006-11-21		ENSG00000120149	ENSG00000120149		"""Homeoboxes / ANTP class : NKL subclass"""	7392	protein-coding gene	gene with protein product	"""craniosynostosis, type 2"""	123101	"""msh (Drosophila) homeo box homolog 2"", ""parietal foramina 1"", ""msh homeobox homolog 2 (Drosophila)"""	PFM1		8668339, 8786091	Standard	XM_006714868		Approved	CRS2, FPP, HOX8, MSH, PFM	uc003mcy.3	P35548	OTTHUMG00000130556	ENST00000239243.6:c.39C>T	5.37:g.174151701C>T			174084307	NM_002449	D3DQN1|Q53XM4|Q9UD60	Silent	SNP	ENST00000239243.6	37	CCDS4392.1																																																																																				0.706	MSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252981.3		
PLEKHG4B	153478	broad.mit.edu	37	5	182162	182162	+	Silent	SNP	C	C	T	rs115843378		TCGA-AG-A026-01	TCGA-AG-A026-01	C	C					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:182162C>T	ENST00000283426.6	+	18	3590	c.3540C>T	c.(3538-3540)caC>caT	p.H1180H		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	1180	Ser-rich.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H1180H(1)		endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CCTCTGACCACGCCGCCCCCT	0.617													c|||	1	0.000199681	0.0008	0.0	5008	,	,		20192	0.0		0.0	False		,,,				2504	0.0				p.H1180H												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3540T	5						.						111.0	101.0	104.0					5																	182162		2203	4300	6503	235162	SO:0001819	synonymous_variant	153478	exon18			BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.3540C>T	5.37:g.182162C>T			235162	NM_052909		Silent	SNP	ENST00000283426.6	37	CCDS34124.1																																																																																				0.617	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
SDHA	6389	broad.mit.edu	37	5	228421	228421	+	Missense_Mutation	SNP	G	G	C			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:228421G>C	ENST00000264932.6	+	6	858	c.743G>C	c.(742-744)aGa>aCa	p.R248T	SDHA_ENST00000504309.1_Missense_Mutation_p.R248T|SDHA_ENST00000510361.1_Missense_Mutation_p.R200T	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	248					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)	p.R248T(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CATCGCATAAGAGCAAAGAAC	0.383									Familial Paragangliomas																												p.R248T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G743C	5						.						102.0	93.0	96.0					5																	228421		2203	4300	6503	281421	SO:0001583	missense	6389	exon6	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.743G>C	5.37:g.228421G>C	ENSP00000264932:p.Arg248Thr		281421	NM_004168	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	g	20.7	4.037619	0.75617	.	.	ENSG00000073578	ENST00000264932;ENST00000504309;ENST00000510361	T;T;T	0.65178	-0.14;-0.14;-0.14	5.23	5.23	0.72850	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.66645	0.2810	M	0.79343	2.45	0.80722	D	1	B;B;B;B;B	0.33919	0.02;0.267;0.432;0.285;0.285	B;B;B;B;B	0.35312	0.056;0.123;0.086;0.2;0.2	T	0.71695	-0.4515	10	0.87932	D	0	.	16.7213	0.85410	0.0:0.0:1.0:0.0	.	200;248;248;248;254	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	T	248;248;200	ENSP00000264932:R248T;ENSP00000426514:R248T;ENSP00000427703:R200T	ENSP00000264932:R248T	R	+	2	0	SDHA	281421	1.000000	0.71417	0.939000	0.37840	0.996000	0.88848	7.518000	0.81795	2.633000	0.89246	0.644000	0.83932	AGA		0.383	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206599.1	NM_004168	
ADAMTS16	170690	broad.mit.edu	37	5	5146494	5146494	+	Missense_Mutation	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:5146494G>A	ENST00000274181.7	+	3	565	c.427G>A	c.(427-429)Gac>Aac	p.D143N	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.D143N|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	143					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D143N(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ACCGCCAGAGGACTTCTGTTT	0.527																																					p.D143N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G427A	5						.						119.0	115.0	117.0					5																	5146494		1909	4137	6046	5199494	SO:0001583	missense	170690	exon3			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.427G>A	5.37:g.5146494G>A	ENSP00000274181:p.Asp143Asn		5199494	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005791	0.35415	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	T;T	0.06218	3.33;3.33	5.74	4.85	0.62838	Peptidase M12B, propeptide (1);	0.120606	0.52532	D	0.000066	T	0.14356	0.0347	L	0.53780	1.695	0.46749	D	0.99918	D;B;B	0.54601	0.967;0.397;0.452	P;B;B	0.54759	0.76;0.363;0.395	T	0.12785	-1.0534	10	0.18276	T	0.48	.	15.7901	0.78350	0.0:0.1369:0.8631:0.0	.	143;143;143	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	N	143	ENSP00000274181:D143N;ENSP00000421631:D143N	ENSP00000274181:D143N	D	+	1	0	ADAMTS16	5199494	1.000000	0.71417	0.380000	0.26093	0.054000	0.15201	4.651000	0.61447	1.507000	0.48752	0.563000	0.77884	GAC		0.527	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
CDH18	1016	broad.mit.edu	37	5	19571825	19571825	+	Silent	SNP	G	G	T			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:19571825G>T	ENST00000507958.1	-	10	2106	c.1116C>A	c.(1114-1116)atC>atA	p.I372I	CDH18_ENST00000274170.4_Silent_p.I372I|CDH18_ENST00000506372.1_Silent_p.I372I|CDH18_ENST00000502796.1_Silent_p.I372I|CDH18_ENST00000511273.1_Silent_p.I372I|CDH18_ENST00000382275.1_Silent_p.I372I			Q13634	CAD18_HUMAN	cadherin 18, type 2	372	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I372I(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCCCAACAATGATCTTCAGCA	0.408																																					p.I372I												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C1116A	5						.						149.0	126.0	134.0					5																	19571825		2203	4300	6503	19607582	SO:0001819	synonymous_variant	1016	exon8			U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1116C>A	5.37:g.19571825G>T			19607582	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Silent	SNP	ENST00000507958.1	37	CCDS3889.1																																																																																				0.408	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
ZFR	51663	broad.mit.edu	37	5	32395272	32395272	+	Missense_Mutation	SNP	C	C	T			TCGA-AG-A026-01	TCGA-AG-A026-01	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Unspecified	454			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:32395272C>T	ENST00000265069.8	-	11	2074	c.1972G>A	c.(1972-1974)Gaa>Aaa	p.E658K	MIR579_ENST00000385221.1_RNA	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	658					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E658K(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TACCTCATTTCCATTCTCCAA	0.403																																					p.E658K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1972A	5						.						233.0	213.0	220.0					5																	32395272		2203	4300	6503	32431029	SO:0001583	missense	51663	exon11			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.1972G>A	5.37:g.32395272C>T	ENSP00000265069:p.Glu658Lys		32431029	NM_016107	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	ENST00000265069.8	37	CCDS34139.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930514	0.92389	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.09723	2.95	5.96	5.96	0.96718	.	0.087235	0.85682	D	0.000000	T	0.37517	0.1006	M	0.78456	2.415	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.02417	-1.1162	10	0.59425	D	0.04	.	20.4008	0.98991	0.0:1.0:0.0:0.0	.	658	Q96KR1	ZFR_HUMAN	K	658;636	ENSP00000265069:E658K	ENSP00000265069:E658K	E	-	1	0	ZFR	32431029	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.625000	0.83145	2.826000	0.97356	0.655000	0.94253	GAA		0.403	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366586.1		
GFPT2	9945	broad.mit.edu	37	5	179762829	179762829	+	Splice_Site	SNP	G	G	A			TCGA-AG-A026-01	TCGA-AG-A026-01	G	G					Unknown	Unknown	Somatic	Phase_I	Unspecified	none			Illumina	TCGA-AG-A026-01	TCGA-AG-A026-01	g.chr5:179762829G>A	ENST00000253778.8	-	4	508	c.339C>T	c.(337-339)aaC>aaT	p.N113N		NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	113	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)	p.N113N(1)		breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	GCCACATACCGTTGCCTTTGT	0.627																																					p.N113N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C339T	5						.						107.0	125.0	119.0					5																	179762829		2108	4228	6336	179695435	SO:0001630	splice_region_variant	9945	exon4			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.340+1C>T	5.37:g.179762829G>A			179695435	NM_005110	Q53XM2|Q9BWS4	Silent	SNP	ENST00000253778.8	37	CCDS43411.1																																																																																				0.627	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373444.4	NM_005110	Silent
