#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VSTM4	196740	broad.mit.edu	37	10	50255031	50255031	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr10:50255031C>T	ENST00000332853.4	-	7	857	c.834G>A	c.(832-834)acG>acA	p.T278T		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T278T(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						TACTTACCAGCGTGACTTTTC	0.453																																					p.T278T												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G834A	10						.						342.0	306.0	318.0					10																	50255031		2203	4300	6503	49925037	SO:0001819	synonymous_variant	196740	exon7			BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.834G>A	10.37:g.50255031C>T			49925037	NM_001031746	B4DNI6|Q96MX7	Silent	SNP	ENST00000332853.4	37	CCDS31198.1																																																																																				0.453	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984	
RTKN2	219790	broad.mit.edu	37	10	63958074	63958074	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr10:63958074C>G	ENST00000373789.3	-	12	1519	c.1423G>C	c.(1423-1425)Gat>Cat	p.D475H	RTKN2_ENST00000395265.1_Missense_Mutation_p.D496H|RTKN2_ENST00000315289.2_Missense_Mutation_p.D277H	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	475					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)		p.D475H(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					TGGTTACCATCAAAGAGTGTG	0.408																																					p.D475H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1423C	10						.						122.0	123.0	123.0					10																	63958074		2203	4300	6503	63628080	SO:0001583	missense	219790	exon12			BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.1423G>C	10.37:g.63958074C>G	ENSP00000362894:p.Asp475His		63628080	NM_145307	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	37	CCDS7263.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329703	0.60743	.	.	ENSG00000182010	ENST00000315289;ENST00000395265;ENST00000373789	T;T;T	0.54675	0.56;1.19;1.19	5.49	4.57	0.56435	.	0.098904	0.64402	D	0.000002	T	0.67841	0.2936	L	0.52573	1.65	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.87578	0.99;0.998	T	0.71724	-0.4506	10	0.87932	D	0	-1.411	16.2428	0.82424	0.0:0.867:0.133:0.0	.	277;475	Q5SVY4;Q8IZC4	.;RTKN2_HUMAN	H	277;496;475	ENSP00000325379:D277H;ENSP00000378682:D496H;ENSP00000362894:D475H	ENSP00000325379:D277H	D	-	1	0	RTKN2	63628080	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.341000	0.65964	1.314000	0.45095	0.655000	0.94253	GAT		0.408	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	NM_145307	
KAT6B	23522	broad.mit.edu	37	10	76780500	76780500	+	Silent	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr10:76780500G>A	ENST00000287239.4	+	14	3279	c.2790G>A	c.(2788-2790)gcG>gcA	p.A930A	KAT6B_ENST00000372714.1_Silent_p.A638A|KAT6B_ENST00000372725.1_Silent_p.A638A|KAT6B_ENST00000372724.1_Silent_p.A638A|KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372711.1_Silent_p.A747A|RP11-77G23.2_ENST00000413431.1_RNA|RP11-77G23.5_ENST00000436608.1_RNA	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	930	Catalytic.|Interaction with BRPF1.|MYST-type HAT.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.A930A(1)									TTAGCAGAGCGACGGGCATGT	0.562																																					p.A930A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G2790A	10						.						115.0	93.0	100.0					10																	76780500		2203	4300	6503	76450506	SO:0001819	synonymous_variant	23522	exon14			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.2790G>A	10.37:g.76780500G>A			76450506	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	37	CCDS7345.1																																																																																				0.562	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
ITIH5	80760	broad.mit.edu	37	10	7679318	7679318	+	Silent	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr10:7679318G>A	ENST00000256861.6	-	5	603	c.525C>T	c.(523-525)agC>agT	p.S175S	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397146.2_Silent_p.S175S|ITIH5_ENST00000397145.2_Silent_p.S175S	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	175					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.S175S(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GGGGCCGCACGCTGATGCTGT	0.607																																					p.S175S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C525T	10						.						57.0	59.0	59.0					10																	7679318		2203	4300	6503	7719324	SO:0001819	synonymous_variant	80760	exon5					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.525C>T	10.37:g.7679318G>A			7719324	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	ENST00000256861.6	37																																																																																					0.607	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
DUSP13	51207	broad.mit.edu	37	10	76855528	76855528	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr10:76855528G>C	ENST00000472493.2	-	3	277	c.199C>G	c.(199-201)Ctg>Gtg	p.L67V	DUSP13_ENST00000607009.1_5'Flank|DUSP13_ENST00000605915.1_Missense_Mutation_p.L89V|DUSP13_ENST00000607131.1_Missense_Mutation_p.L160V|DUSP13_ENST00000372700.3_Missense_Mutation_p.L117V|DUSP13_ENST00000478873.2_Missense_Mutation_p.L203V|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000491677.2_Missense_Mutation_p.L196V|DUSP13_ENST00000464872.1_Missense_Mutation_p.L67V	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	67					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.L67V(1)|p.L196V(1)		large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					AGCTGGATCAGCTTGCTCTTG	0.562																																					p.L67V	NSCLC(174;1655 2059 12324 40663 42963)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C199G	10						.						146.0	132.0	137.0					10																	76855528		2203	4300	6503	76525534	SO:0001583	missense	51207	exon3			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000472493.2:c.199C>G	10.37:g.76855528G>C	ENSP00000444580:p.Leu67Val		76525534	NM_016364	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	ENST00000472493.2	37	CCDS7346.1	.	.	.	.	.	.	.	.	.	.	g	14.17	2.455404	0.43634	.	.	ENSG00000079393	ENST00000308475;ENST00000472493;ENST00000491677;ENST00000372698;ENST00000464872;ENST00000372700	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	5.01	2.15	0.27550	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.067584	0.64402	D	0.000009	T	0.80924	0.4717	M	0.88570	2.965	0.09310	N	0.999999	D;D;D	0.76494	0.96;0.969;0.999	P;P;D	0.81914	0.862;0.898;0.995	T	0.70908	-0.4744	10	0.87932	D	0	-5.4556	7.5239	0.27643	0.1439:0.0:0.7209:0.1352	.	117;196;67	Q9UII6-4;F2Z2C4;Q9UII6	.;.;DUS13_HUMAN	V	67;67;196;160;67;117	ENSP00000311051:L67V;ENSP00000444580:L67V;ENSP00000436312:L196V;ENSP00000434041:L67V;ENSP00000361785:L117V	ENSP00000311051:L67V	L	-	1	2	DUSP13	76525534	0.999000	0.42202	0.032000	0.17829	0.485000	0.33311	3.028000	0.49705	0.167000	0.19631	-0.121000	0.15023	CTG		0.562	DUSP13-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048786.3		
WAPAL	23063	broad.mit.edu	37	10	88260181	88260181	+	Missense_Mutation	SNP	T	T	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr10:88260181T>G	ENST00000298767.5	-	3	1291	c.819A>C	c.(817-819)gaA>gaC	p.E273D		NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	273	Mediates interaction with the cohesin complex.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)		p.E273D(1)		breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						CATTCAGATTTTCCAATCGAT	0.368																																					p.E273D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A819C	10						.						86.0	81.0	83.0					10																	88260181		2203	4300	6503	88250161	SO:0001583	missense	23063	exon3			AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.819A>C	10.37:g.88260181T>G	ENSP00000298767:p.Glu273Asp		88250161	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.518492	0.27211	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076	T	0.46451	0.87	5.77	4.64	0.57946	.	0.271361	0.34802	N	0.003679	T	0.29093	0.0723	L	0.33485	1.01	0.80722	D	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.002;0.002;0.004	T	0.14200	-1.0481	10	0.72032	D	0.01	.	4.8532	0.13547	0.1378:0.1451:0.0:0.7171	.	273;273;316	B2RTX8;Q7Z5K2;Q7Z5K2-2	.;WAPL_HUMAN;.	D	358;273;358	ENSP00000298767:E273D	ENSP00000298767:E273D	E	-	3	2	WAPAL	88250161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.579000	0.36536	1.015000	0.39444	0.528000	0.53228	GAA		0.368	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
MUC6	4588	broad.mit.edu	37	11	1027447	1027447	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:1027447C>T	ENST00000421673.2	-	17	2102	c.2052G>A	c.(2050-2052)ctG>ctA	p.L684L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	684					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)	p.L684L(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CACGGTCCGACAGCGACAGGC	0.652																																					p.L684L												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G2052A	11						.						75.0	85.0	82.0					11																	1027447		2166	4241	6407	1017447	SO:0001819	synonymous_variant	4588	exon17			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2052G>A	11.37:g.1027447C>T			1017447	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																				0.652	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
LDHC	3948	broad.mit.edu	37	11	18467844	18467844	+	Silent	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:18467844T>C	ENST00000541669.1	+	7	909	c.798T>C	c.(796-798)aaT>aaC	p.N266N	LDHC_ENST00000546146.1_Intron|LDHC_ENST00000544105.1_Intron|LDHC_ENST00000535809.1_Intron|LDHC_ENST00000536880.1_Silent_p.N252N|LDHC_ENST00000537486.1_Intron|LDHC_ENST00000280704.4_Silent_p.N266N			P07864	LDHC_HUMAN	lactate dehydrogenase C	266					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)	p.N266N(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TTTTGAAAAATCTTAGGAGAG	0.368																																					p.N266N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T798C	11						.						162.0	160.0	161.0					11																	18467844		2199	4293	6492	18424420	SO:0001819	synonymous_variant	3948	exon7			AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.798T>C	11.37:g.18467844T>C			18424420	NM_002301	D3DQY4|Q6GSG8|Q7Z7J4	Silent	SNP	ENST00000541669.1	37	CCDS7840.1																																																																																				0.368	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395892.1	NM_017448	
MTA2	9219	broad.mit.edu	37	11	62365507	62365507	+	Missense_Mutation	SNP	C	C	T	rs370573471		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:62365507C>T	ENST00000278823.2	-	6	868	c.479G>A	c.(478-480)cGc>cAc	p.R160H	MTA2_ENST00000524902.1_5'UTR|MTA2_ENST00000527204.1_5'UTR	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	160	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.R160H(1)		endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						CTCTACTAGGCGATCTGGGAT	0.473																																					p.R160H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G479A	11						.	C	HIS/ARG	0,4404		0,0,2202	156.0	152.0	153.0		479	5.7	1.0	11		153	1,8597	1.2+/-3.3	0,1,4298	no	missense	MTA2	NM_004739.3	29	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign	160/669	62365507	1,13001	2202	4299	6501	62122083	SO:0001583	missense	9219	exon6			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.479G>A	11.37:g.62365507C>T	ENSP00000278823:p.Arg160His		62122083	NM_004739	Q68DB1|Q9UQB5	Missense_Mutation	SNP	ENST00000278823.2	37	CCDS8022.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135814	0.37728	0.0	1.16E-4	ENSG00000149480	ENST00000278823	T	0.29397	1.57	5.73	5.73	0.89815	ELM2 domain (2);	0.169262	0.52532	D	0.000072	T	0.12944	0.0314	N	0.08118	0	0.80722	D	1	P	0.47350	0.894	B	0.34138	0.176	T	0.08066	-1.0740	10	0.26408	T	0.33	-11.2739	10.772	0.46327	0.0:0.9144:0.0:0.0856	.	160	O94776	MTA2_HUMAN	H	160	ENSP00000278823:R160H	ENSP00000278823:R160H	R	-	2	0	MTA2	62122083	0.557000	0.26546	0.998000	0.56505	0.980000	0.70556	1.051000	0.30417	2.722000	0.93159	0.655000	0.94253	CGC		0.473	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
GANAB	23193	broad.mit.edu	37	11	62406479	62406479	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:62406479A>G	ENST00000356638.3	-	4	372	c.356T>C	c.(355-357)tTg>tCg	p.L119S	GANAB_ENST00000346178.4_Missense_Mutation_p.L119S|GANAB_ENST00000534422.1_5'UTR|GANAB_ENST00000534779.1_Intron|GANAB_ENST00000540933.1_Missense_Mutation_p.L22S	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	119					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)	p.L119S(1)		central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	ATCAGCCACCAAAACATCTGG	0.488																																					p.L119S	Melanoma(23;1005 1074 15747 18937)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T356C	11						.						53.0	53.0	53.0					11																	62406479		2202	4299	6501	62163055	SO:0001583	missense	23193	exon4			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.356T>C	11.37:g.62406479A>G	ENSP00000349053:p.Leu119Ser		62163055	NM_198335	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	37	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	A	18.62	3.662692	0.67700	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000540933	D;D;D	0.86164	-2.08;-2.08;-2.08	4.65	4.65	0.58169	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.64402	D	0.000002	D	0.93485	0.7921	M	0.87827	2.91	0.58432	D	0.999995	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.991	D	0.94281	0.7520	10	0.87932	D	0	-13.1044	12.0726	0.53626	1.0:0.0:0.0:0.0	.	119;119	Q14697;Q14697-2	GANAB_HUMAN;.	S	119;119;22	ENSP00000340466:L119S;ENSP00000349053:L119S;ENSP00000442962:L22S	ENSP00000340466:L119S	L	-	2	0	GANAB	62163055	1.000000	0.71417	0.998000	0.56505	0.732000	0.41865	7.861000	0.87004	1.973000	0.57446	0.374000	0.22700	TTG		0.488	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
CTSC	1075	broad.mit.edu	37	11	88033724	88033724	+	Missense_Mutation	SNP	T	T	C	rs370851747		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:88033724T>C	ENST00000227266.5	-	5	845	c.731A>G	c.(730-732)aAt>aGt	p.N244S		NM_001814.4	NP_001805	P53634	CATC_HUMAN	cathepsin C	244					aging (GO:0007568)|immune response (GO:0006955)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of proteolysis involved in cellular protein catabolic process (GO:1903052)|proteolysis (GO:0006508)|response to organic substance (GO:0010033)|T cell mediated cytotoxicity (GO:0001913)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	chaperone binding (GO:0051087)|chloride ion binding (GO:0031404)|cysteine-type peptidase activity (GO:0008234)|peptidase activator activity involved in apoptotic process (GO:0016505)|phosphatase binding (GO:0019902)|serine-type endopeptidase activity (GO:0004252)	p.N244S(1)		large_intestine(7)|lung(8)|ovary(2)|prostate(3)|skin(2)	22		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ACTGACAAAATTGATACCATG	0.373																																					p.N244S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A731G	11						.	T	SER/ASN	1,4401	2.1+/-5.4	0,1,2200	112.0	110.0	110.0		731	5.1	1.0	11		110	1,8597	1.2+/-3.3	0,1,4298	no	missense	CTSC	NM_001814.4	46	0,2,6498	CC,CT,TT		0.0116,0.0227,0.0154	possibly-damaging	244/464	88033724	2,12998	2201	4299	6500	87673372	SO:0001583	missense	1075	exon5			AK223038	CCDS8282.1, CCDS31654.1, CCDS44693.1	11q14.2	2014-09-17			ENSG00000109861	ENSG00000109861	3.4.14.1	"""Cathepsins"""	2528	protein-coding gene	gene with protein product	"""dipeptidyl peptidase 1"""	602365		PLS, PALS		7649281, 9092576	Standard	NM_148170		Approved	DPP1	uc001pck.4	P53634	OTTHUMG00000167290	ENST00000227266.5:c.731A>G	11.37:g.88033724T>C	ENSP00000227266:p.Asn244Ser		87673372	NM_001814	A8K7V2|B5MDD5|Q2HIY8|Q53G93|Q71E75|Q71E76|Q7M4N9|Q7Z3G7|Q7Z5U7|Q8WY99|Q8WYA7|Q8WYA8	Missense_Mutation	SNP	ENST00000227266.5	37	CCDS8282.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.249532|4.249532	0.80024|0.80024	2.27E-4|2.27E-4	1.16E-4|1.16E-4	ENSG00000109861|ENSG00000109861	ENST00000527018|ENST00000393302;ENST00000227266	.|D	.|0.84146	.|-1.81	5.11|5.11	5.11|5.11	0.69529|0.69529	.|Peptidase C1A, papain C-terminal (2);	.|0.088668	.|0.85682	.|D	.|0.000000	T|T	0.80884|0.80884	0.4709|0.4709	L|L	0.38649|0.38649	1.16|1.16	0.80722|0.80722	D|D	1|1	.|P;P	.|0.42203	.|0.773;0.697	.|B;B	.|0.42653	.|0.394;0.165	T|T	0.79674|0.79674	-0.1705|-0.1705	5|9	.|.	.|.	.|.	.|.	14.916|14.916	0.70798|0.70798	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|227;244	.|B4DJQ8;P53634	.|.;CATC_HUMAN	V|S	201|227;244	.|ENSP00000227266:N244S	.|.	I|N	-|-	1|2	0|0	CTSC|CTSC	87673372|87673372	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.954000|0.954000	0.61252|0.61252	5.888000|5.888000	0.69758|0.69758	1.932000|1.932000	0.55993|0.55993	0.528000|0.528000	0.53228|0.53228	ATT|AAT		0.373	CTSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394019.2	NM_001814	
CNTN5	53942	broad.mit.edu	37	11	99941279	99941279	+	Missense_Mutation	SNP	C	C	A	rs201464362		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:99941279C>A	ENST00000524871.1	+	11	1576	c.1286C>A	c.(1285-1287)cCc>cAc	p.P429H	CNTN5_ENST00000279463.3_Missense_Mutation_p.P429H|CNTN5_ENST00000528682.1_Missense_Mutation_p.P429H|CNTN5_ENST00000527185.1_Missense_Mutation_p.P429H|CNTN5_ENST00000418526.2_Missense_Mutation_p.P355H	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	429	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.P429H(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AATGGAGTACCCCTCTCACCT	0.453																																					p.P355H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1064A	11						.						87.0	86.0	86.0					11																	99941279		1907	4104	6011	99446489	SO:0001583	missense	53942	exon10			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1286C>A	11.37:g.99941279C>A	ENSP00000435637:p.Pro429His		99446489	NM_175566	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.667206	0.47677	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	6.07	6.07	0.98685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.047372	0.85682	D	0.000000	D	0.82351	0.5018	M	0.71036	2.16	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.993;0.996	T	0.82384	-0.0484	10	0.72032	D	0.01	.	19.632	0.95713	0.0:1.0:0.0:0.0	.	429;355;429	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	H	429;429;429;355;429	ENSP00000433575:P429H;ENSP00000436185:P429H;ENSP00000435637:P429H;ENSP00000393229:P355H;ENSP00000279463:P429H	ENSP00000279463:P429H	P	+	2	0	CNTN5	99446489	1.000000	0.71417	0.017000	0.16124	0.004000	0.04260	6.019000	0.70818	2.890000	0.99128	0.650000	0.86243	CCC		0.453	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
PDGFD	80310	broad.mit.edu	37	11	103797793	103797793	+	Silent	SNP	C	C	T	rs564284731		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr11:103797793C>T	ENST00000393158.2	-	6	1013	c.834G>A	c.(832-834)tcG>tcA	p.S278S	PDGFD_ENST00000302251.5_Silent_p.S272S			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	278					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)		p.S278S(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		TTATATTGACCGAGTAATTCC	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		20266	0.001		0.0	False		,,,				2504	0.0				p.S272S												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G816A	11						.						181.0	155.0	164.0					11																	103797793		2202	4299	6501	103303003	SO:0001819	synonymous_variant	80310	exon6			AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.834G>A	11.37:g.103797793C>T			103303003	NM_033135	A8K9T6|Q9BWV5	Silent	SNP	ENST00000393158.2	37	CCDS41703.1																																																																																				0.473	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
CCDC184	387856	broad.mit.edu	37	12	48578409	48578410	+	Frame_Shift_Ins	INS	-	-	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:48578409_48578410insG	ENST00000316554.3	+	1	1044_1045	c.504_505insG	c.(505-507)gggfs	p.G169fs		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		169						cytoplasm (GO:0005737)		p.D171fs*>25(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						CTGGTCTCCTTGGGGGGGACGG	0.658																																					p.L168fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.504_505insG	12						.																																			46864677	SO:0001589	frameshift_variant	387856	exon1																														ENST00000316554.3:c.511dupG	12.37:g.48578416_48578416dupG	ENSP00000320849:p.Gly169fs		46864676	NM_001013635	Q96MK5|Q96N39	Frame_Shift_Ins	INS	ENST00000316554.3	37	CCDS31785.1																																																																																				0.658	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406514.1		
CELA1	1990	broad.mit.edu	37	12	51740413	51740414	+	Frame_Shift_Ins	INS	-	-	C	rs573952082|rs386762976|rs377599213|rs370927847	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	-	-	-	-	-	-	Unknown	Wildtype	None	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:51740413_51740414insC	ENST00000293636.1	-	1	49_50	c.9_10insG	c.(7-12)gtccttfs	p.L4fs		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	4					exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						TTACCATAAAGGACCAGCATGT	0.515													?|-|C|unsure	1840	0.367412	0.2988	0.451	5008	,	,		13831	0.5546		0.3211	False		,,,				2504	0.2556				p.L4fs												.	.	0			c.10_11insG	12						.																																			50026681	SO:0001589	frameshift_variant	1990	exon1				CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.9_10insG	12.37:g.51740413_51740414insC	ENSP00000293636:p.Leu4fs		50026680	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Frame_Shift_Ins	INS	ENST00000293636.1	37	CCDS8812.1																																																																																				0.515	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
CAND1	55832	broad.mit.edu	37	12	67699277	67699277	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:67699277A>C	ENST00000545606.1	+	10	2266	c.1829A>C	c.(1828-1830)aAt>aCt	p.N610T		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	610					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)		p.N610T(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		GACTTGCCTAATACACTTCAG	0.393																																					p.N610T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1829C	12						.						125.0	125.0	125.0					12																	67699277		2203	4300	6503	65985544	SO:0001583	missense	55832	exon10				CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1829A>C	12.37:g.67699277A>C	ENSP00000442318:p.Asn610Thr		65985544	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	0.086	-1.175729	0.01646	.	.	ENSG00000111530	ENST00000545606;ENST00000299218	T	0.41400	1.0	5.73	3.4	0.38934	Armadillo-like helical (1);Armadillo-type fold (1);	0.128574	0.64402	D	0.000001	T	0.12518	0.0304	N	0.01188	-0.97	0.38914	D	0.957582	B	0.02656	0.0	B	0.01281	0.0	T	0.06516	-1.0822	9	.	.	.	-25.3333	4.5664	0.12189	0.545:0.0:0.455:0.0	.	610	Q86VP6	CAND1_HUMAN	T	610	ENSP00000442318:N610T	.	N	+	2	0	CAND1	65985544	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.336000	0.59304	1.007000	0.39238	0.528000	0.53228	AAT		0.393	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
TRHDE	29953	broad.mit.edu	37	12	72667306	72667306	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:72667306C>T	ENST00000261180.4	+	1	844	c.748C>T	c.(748-750)Cgc>Tgc	p.R250C	TRHDE-AS1_ENST00000550334.1_RNA|TRHDE-AS1_ENST00000426250.3_RNA|TRHDE-AS1_ENST00000435350.1_RNA	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	250					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R250C(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GGGCTTCTTCCGCAGCTCCTA	0.617																																					p.R250C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C748T	12						.						46.0	50.0	48.0					12																	72667306		2193	4276	6469	70953573	SO:0001583	missense	29953	exon1			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.748C>T	12.37:g.72667306C>T	ENSP00000261180:p.Arg250Cys		70953573	NM_013381	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	CCDS9004.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.06|13.06	2.122929|2.122929	0.37436|0.37436	.|.	.|.	ENSG00000072657|ENSG00000072657	ENST00000547300|ENST00000261180	.|T	.|0.05382	.|3.45	5.53|5.53	4.63|4.63	0.57726|0.57726	.|Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	.|0.056019	.|0.64402	.|D	.|0.000002	T|T	0.32556|0.32556	0.0833|0.0833	M|M	0.91972|0.91972	3.26|3.26	0.58432|0.58432	D|D	0.999999|0.999999	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.41378|0.41378	-0.9512|-0.9512	5|10	.|0.87932	.|D	.|0	.|.	14.6467|14.6467	0.68767|0.68767	0.1469:0.853:0.0:0.0|0.1469:0.853:0.0:0.0	.|.	.|250	.|Q9UKU6	.|TRHDE_HUMAN	L|C	15|250	.|ENSP00000261180:R250C	.|ENSP00000261180:R250C	P|R	+|+	2|1	0|0	TRHDE|TRHDE	70953573|70953573	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.097000|0.097000	0.18754|0.18754	4.312000|4.312000	0.59154|0.59154	1.308000|1.308000	0.44962|0.44962	-0.241000|-0.241000	0.12123|0.12123	CCG|CGC		0.617	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
LUM	4060	broad.mit.edu	37	12	91502249	91502249	+	Silent	SNP	G	G	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:91502249G>T	ENST00000266718.4	-	2	962	c.508C>A	c.(508-510)Cgg>Agg	p.R170R	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	170					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.R170R(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						TCTTTCAGCCGATTGTGCTGG	0.443																																					p.R170R												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C508A	12						.						98.0	100.0	99.0					12																	91502249		2203	4300	6503	90026380	SO:0001819	synonymous_variant	4060	exon2			BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.508C>A	12.37:g.91502249G>T			90026380	NM_002345	B2R6R5|Q96QM7	Silent	SNP	ENST00000266718.4	37	CCDS9038.1																																																																																				0.443	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345	
LINC00477	144360	broad.mit.edu	37	12	24736850	24736850	+	lincRNA	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:24736850G>A	ENST00000483544.1	-	0	252					NR_029451.2		Q96M19	CL067_HUMAN	long intergenic non-protein coding RNA 477							integral component of membrane (GO:0016021)		p.S68S(1)									TGGAGGCTCCGGAATACATCC	0.547																																					.												.	.	1	Substitution - coding silent(1)	large_intestine(1)	.	12						.						41.0	45.0	44.0					12																	24736850		2203	4300	6503	24628117			144360	.			AK057456		12p12.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000197503	ENSG00000197503		"""Long non-coding RNAs"""	26557	non-coding RNA	RNA, long non-coding	"""family with sequence similarity 191, member B"""		"""chromosome 12 open reading frame 67"""	C12orf67		14702039	Standard	NR_029451		Approved	FLJ32894, FAM191B	uc001rgb.1	Q96M19	OTTHUMG00000159485		12.37:g.24736850G>A			24628117	.		Silent	SNP	ENST00000483544.1	37																																																																																					0.547	LINC00477-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000355725.1	NM_144667	
CELA1	1990	broad.mit.edu	37	12	51740415	51740416	+	Frame_Shift_Del	DEL	AC	AC	-	rs370927847|rs386762976|rs61761206|rs55827519|rs148235680	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	AC	AC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:51740415_51740416delAC	ENST00000293636.1	-	1	47_48	c.7_8delGT	c.(7-9)gtcfs	p.V3fs		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	3					exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.V3fs*21(1)		NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						ACCATAAAGGACCAGCATGTTG	0.515														1840	0.367412	0.2988	0.451	5008	,	,		16016	0.5546		0.3211	False		,,,				2504	0.2556				p.3_3del												.	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.7_8del	12						.																																			50026683	SO:0001589	frameshift_variant	1990	exon1				CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.7_8delGT	12.37:g.51740415_51740416delAC	ENSP00000293636:p.Val3fs		50026682	NM_001971	Q5MLF0|Q6DJT0|Q6ISM6	Frame_Shift_Del	DEL	ENST00000293636.1	37	CCDS8812.1																																																																																				0.515	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394901.1	NM_001971	
FGD6	55785	broad.mit.edu	37	12	95485483	95485483	+	Splice_Site	SNP	C	C	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr12:95485483C>A	ENST00000343958.4	-	17	4073	c.3850G>T	c.(3850-3852)Gat>Tat	p.D1284Y	FGD6_ENST00000546711.1_Splice_Site_p.D1284Y	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1284					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)	p.D1284Y(1)		breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TATATATTACCTAATTTCTGC	0.348																																					p.D1284Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3850T	12						.						89.0	82.0	84.0					12																	95485483		2203	4296	6499	94009614	SO:0001630	splice_region_variant	55785	exon17			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3850+1G>T	12.37:g.95485483C>A			94009614	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.4|23.4	4.415599|4.415599	0.83449|0.83449	.|.	.|.	ENSG00000180263|ENSG00000180263	ENST00000343958;ENST00000546711|ENST00000548069	T;T|.	0.41065|.	2.74;1.01|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.000000|.	0.50627|.	D|.	0.000107|.	T|.	0.65852|.	0.2731|.	L|L	0.36672|0.36672	1.1|1.1	0.49051|0.49051	D|D	0.999743|0.999743	D;D|.	0.71674|.	0.997;0.998|.	D;D|.	0.66979|.	0.946;0.948|.	T|.	0.60301|.	-0.7290|.	9|.	.|.	.|.	.|.	-11.3819|-11.3819	19.5451|19.5451	0.95291|0.95291	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1284;1284|.	Q6ZV73-2;Q6ZV73|.	.;FGD6_HUMAN|.	Y|Y	1284|27	ENSP00000344446:D1284Y;ENSP00000450342:D1284Y|.	.|.	D|X	-|-	1|3	0|2	FGD6|FGD6	94009614|94009614	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.036000|5.036000	0.64164|0.64164	2.685000|2.685000	0.91497|0.91497	0.561000|0.561000	0.74099|0.74099	GAT|TAG		0.348	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	Missense_Mutation
ATP12A	479	broad.mit.edu	37	13	25276176	25276176	+	Missense_Mutation	SNP	G	G	A	rs34864304|rs370861260		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr13:25276176G>A	ENST00000381946.3	+	14	2152	c.1985G>A	c.(1984-1986)cGc>cAc	p.R662H	ATP12A_ENST00000218548.6_Missense_Mutation_p.R668H|RNY1P7_ENST00000384743.1_RNA			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	662					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.R662H(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		ATTGCACATCGCCTCAACATT	0.463																																					p.R668H	Pancreas(156;1582 1935 18898 22665 26498)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2003A	13						.	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	199.0	161.0	174.0		2003,1985	5.4	1.0	13		174	0,8600		0,0,4300	no	missense,missense	ATP12A	NM_001185085.1,NM_001676.5	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	668/1046,662/1040	25276176	1,13005	2203	4300	6503	24174176	SO:0001583	missense	479	exon14			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1985G>A	13.37:g.25276176G>A	ENSP00000371372:p.Arg662His		24174176	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876217	0.72180	2.27E-4	0.0	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.99014	-5.33;-5.33	5.4	5.4	0.78164	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.000000	0.64402	D	0.000002	D	0.98767	0.9585	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.67900	0.954;0.946	D	0.99880	1.1111	10	0.87932	D	0	.	17.0213	0.86434	0.0:0.0:1.0:0.0	.	668;662	P54707-2;P54707	.;AT12A_HUMAN	H	668;662	ENSP00000218548:R668H;ENSP00000371372:R662H	ENSP00000218548:R668H	R	+	2	0	ATP12A	24174176	1.000000	0.71417	0.997000	0.53966	0.184000	0.23303	9.695000	0.98691	2.692000	0.91855	0.467000	0.42956	CGC		0.463	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
FREM2	341640	broad.mit.edu	37	13	39425838	39425838	+	Missense_Mutation	SNP	T	T	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr13:39425838T>G	ENST00000280481.7	+	11	6974	c.6758T>G	c.(6757-6759)tTt>tGt	p.F2253C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2253	Calx-beta 5.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F2253C(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GTTATTAAATTTGGAGAAACC	0.383																																					p.F2253C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T6758G	13						.						43.0	44.0	43.0					13																	39425838		2203	4300	6503	38323838	SO:0001583	missense	341640	exon11			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6758T>G	13.37:g.39425838T>G	ENSP00000280481:p.Phe2253Cys		38323838	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.817293	0.70912	.	.	ENSG00000150893	ENST00000280481	T	0.48836	0.8	5.62	4.44	0.53790	Na-Ca exchanger/integrin-beta4 (2);	0.116043	0.64402	D	0.000013	T	0.75635	0.3876	H	0.95079	3.62	0.58432	D	0.999999	D;D	0.76494	0.998;0.999	D;D	0.74674	0.957;0.984	T	0.81241	-0.1022	10	0.87932	D	0	.	11.4377	0.50078	0.0:0.0705:0.0:0.9295	.	2253;2253	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	C	2253	ENSP00000280481:F2253C	ENSP00000280481:F2253C	F	+	2	0	FREM2	38323838	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.988000	0.88194	0.971000	0.38288	-0.256000	0.11100	TTT		0.383	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
SLITRK5	26050	broad.mit.edu	37	13	88328679	88328679	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr13:88328679T>C	ENST00000325089.6	+	2	1255	c.1036T>C	c.(1036-1038)Tct>Cct	p.S346P	SLITRK5_ENST00000400028.3_Missense_Mutation_p.S105P	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	346					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.S346P(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GCGCCCCACCTCTCGGCAGCC	0.592																																					p.S346P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T1036C	13						.						61.0	64.0	63.0					13																	88328679		2203	4299	6502	87126680	SO:0001583	missense	26050	exon2			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.1036T>C	13.37:g.88328679T>C	ENSP00000366283:p.Ser346Pro		87126680	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	37	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	T	8.795	0.931523	0.18131	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.58506	0.33;0.68	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.44477	0.1295	N	0.25332	0.735	0.58432	D	0.999995	B;B	0.18863	0.031;0.002	B;B	0.17722	0.019;0.011	T	0.33189	-0.9878	9	.	.	.	-9.5821	14.2004	0.65699	0.0:0.0:0.0:1.0	.	105;346	B4DSH5;O94991	.;SLIK5_HUMAN	P	346;105	ENSP00000366283:S346P;ENSP00000442244:S105P	.	S	+	1	0	SLITRK5	87126680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.716000	0.54904	2.237000	0.73441	0.459000	0.35465	TCT		0.592	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
MYH6	4624	broad.mit.edu	37	14	23871680	23871680	+	Silent	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr14:23871680G>A	ENST00000356287.3	-	11	1163	c.1134C>T	c.(1132-1134)ggC>ggT	p.G378G	MYH6_ENST00000405093.3_Silent_p.G378G			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	378	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)	p.G378G(1)		breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CACCTTCGGTGCCGTCTGGCT	0.627																																					p.G378G												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1134T	14						.						76.0	73.0	74.0					14																	23871680		2203	4300	6503	22941520	SO:0001819	synonymous_variant	4624	exon12			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1134C>T	14.37:g.23871680G>A			22941520	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	37	CCDS9600.1																																																																																				0.627	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
KIAA0586	9786	broad.mit.edu	37	14	58979293	58979293	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr14:58979293A>T	ENST00000556134.1	+	30	4606	c.4332A>T	c.(4330-4332)caA>caT	p.Q1444H	KIAA0586_ENST00000354386.6_Missense_Mutation_p.Q1512H|KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000423743.3_Missense_Mutation_p.Q1415H|KIAA0586_ENST00000261244.5_Missense_Mutation_p.Q1383H	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	1444					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)		p.Q1512H(1)|p.Q1383H(1)|p.S1384fs*5(1)		endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AACCATCACAAAGTTACCTAC	0.284																																					p.Q1383H												.	.	3	Substitution - Missense(2)|Deletion - Frameshift(1)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)	c.A4149T	14						.						71.0	64.0	66.0					14																	58979293		1822	4075	5897	58049046	SO:0001583	missense	9786	exon28			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.4332A>T	14.37:g.58979293A>T	ENSP00000452351:p.Gln1444His		58049046	NM_014749	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	37	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	A	5.028	0.190945	0.09547	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000555397	T;T;T;T	0.57752	0.38;0.42;0.42;0.41	5.12	3.99	0.46301	.	0.343157	0.25166	N	0.032627	T	0.57519	0.2059	.	.	.	0.19945	N	0.999941	P;P;P;P;P	0.52061	0.911;0.95;0.696;0.95;0.95	P;P;B;P;P	0.57620	0.76;0.824;0.357;0.824;0.824	T	0.46359	-0.9197	9	0.31617	T	0.26	.	7.4242	0.27090	0.9039:0.0:0.0961:0.0	.	1319;1512;1383;1444;1415	B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;K0586_HUMAN;.	H	1512;1444;1415;1383;141	ENSP00000346359:Q1512H;ENSP00000452351:Q1444H;ENSP00000399427:Q1415H;ENSP00000261244:Q1383H	ENSP00000261244:Q1383H	Q	+	3	2	KIAA0586	58049046	0.963000	0.33076	0.440000	0.26846	0.007000	0.05969	1.711000	0.37930	0.986000	0.38683	-0.326000	0.08463	CAA		0.284	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
GPHN	10243	broad.mit.edu	37	14	67576891	67576891	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr14:67576891G>A	ENST00000315266.5	+	13	2350	c.1229G>A	c.(1228-1230)cGg>cAg	p.R410Q	GPHN_ENST00000543237.1_Missense_Mutation_p.R456Q|GPHN_ENST00000478722.1_Missense_Mutation_p.R443Q|GPHN_ENST00000305960.9_Missense_Mutation_p.R379Q|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	410	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)	p.R443Q(1)		large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		CAAGTCATGCGGGTTACAACA	0.453			T	MLL	AL																																p.R410Q			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1229A	14						.						196.0	167.0	177.0					14																	67576891		2203	4300	6503	66646644	SO:0001583	missense	10243	exon13			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.1229G>A	14.37:g.67576891G>A	ENSP00000312771:p.Arg410Gln		66646644	NM_001024218	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.	.	.	.	.	.	.	.	.	.	G	36	5.858075	0.97036	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.	.	.	5.6	5.6	0.85130	MoeA, N-terminal and linker domain (2);	0.000000	0.85682	D	0.000000	D	0.83746	0.5321	M	0.83384	2.64	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.70935	0.971;0.94;0.948;0.924	D	0.85667	0.1292	9	0.87932	D	0	-4.9782	19.6229	0.95667	0.0:0.0:1.0:0.0	.	379;456;410;443	F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.;.;GEPH_HUMAN;.	Q	410;443;456;379	.	ENSP00000303019:R379Q	R	+	2	0	GPHN	66646644	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.835000	0.99442	2.628000	0.89032	0.655000	0.94253	CGG		0.453	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
SERPINA3	12	broad.mit.edu	37	14	95080920	95080920	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr14:95080920G>A	ENST00000467132.1	+	2	1290	c.142G>A	c.(142-144)Gga>Aga	p.G48R	RP11-986E7.7_ENST00000553947.1_3'UTR|SERPINA3_ENST00000393080.4_Missense_Mutation_p.G48R|SERPINA3_ENST00000393078.3_Missense_Mutation_p.G48R			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	48					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.G48R(1)|p.G48*(1)		NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		CGTGGACCTCGGATTAGCCTC	0.567																																					p.G48R												.	.	2	Substitution - Nonsense(1)|Substitution - Missense(1)	large_intestine(1)|lung(1)	c.G142A	14						.						121.0	116.0	118.0					14																	95080920		2203	4300	6503	94150673	SO:0001583	missense	12	exon2			K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.142G>A	14.37:g.95080920G>A	ENSP00000450540:p.Gly48Arg		94150673	NM_001085	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	37	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	G	8.298	0.819187	0.16607	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132;ENST00000380354	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.03	-4.71	0.03279	Serpin domain (1);	2.568120	0.01625	N	0.023256	T	0.70474	0.3228	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.08055	0.001;0.003	T	0.58228	-0.7673	10	0.48119	T	0.1	.	1.6027	0.02678	0.4367:0.2299:0.2216:0.1118	.	48;73	P01011;G3V5I3	AACT_HUMAN;.	R	73;48;48;48;48;48	ENSP00000452367:G73R;ENSP00000376793:G48R;ENSP00000376795:G48R;ENSP00000450540:G48R	ENSP00000369712:G48R	G	+	1	0	SERPINA3	94150673	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.525000	0.02231	-0.632000	0.05553	-1.669000	0.00746	GGA		0.567	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085	
CCPG1	9236	broad.mit.edu	37	15	55677834	55677835	+	Nonsense_Mutation	DNP	GC	GC	AG			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	GC	GC					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr15:55677834_55677835GC>AG	ENST00000310958.6	-	3	436_437	c.138_139GC>CT	c.(136-141)gaGCaa>gaCTaa	p.46_47EQ>D*	CCPG1_ENST00000442196.3_Nonsense_Mutation_p.46_47EQ>D*|CCPG1_ENST00000425574.3_Nonsense_Mutation_p.46_47EQ>D*|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000569205.1_Nonsense_Mutation_p.46_47EQ>D*	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	46	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)		p.E46>?(1)		autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		AGCTCCTCTTGCTCTAAAGATG	0.381																																					.												.	.	1	Complex(1)	large_intestine(1)	c.138_139CT	15						.																																			53465127	SO:0001587	stop_gained	9236	exon3			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.138_139delinsAG	15.37:g.55677834_55677835delinsAG	ENSP00000311656:p.E46_Q47delinsD*		53465126	NM_004748	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Nonsense_Mutation	DNP	ENST00000310958.6	37	CCDS42039.1																																																																																				0.381	CCPG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419850.1	NM_004748	
DIS3L	115752	broad.mit.edu	37	15	66610832	66610832	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr15:66610832T>A	ENST00000319212.4	+	8	1090	c.1040T>A	c.(1039-1041)gTg>gAg	p.V347E	DIS3L_ENST00000319194.5_Missense_Mutation_p.V264E|DIS3L_ENST00000441424.2_Intron|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	347					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)	p.V264E(1)|p.V347E(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GATTATGTGGTGACATTTCCG	0.438																																					p.V347E												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1040A	15						.						128.0	126.0	126.0					15																	66610832		2201	4299	6500	64397886	SO:0001583	missense	115752	exon8				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1040T>A	15.37:g.66610832T>A	ENSP00000321711:p.Val347Glu		64397886	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	ENST00000319212.4	37	CCDS45286.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.214733	0.58452	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.30182	1.54;1.54	4.28	3.14	0.36123	.	0.963263	0.08564	N	0.927153	T	0.27349	0.0671	N	0.24115	0.695	0.80722	D	1	P;P	0.46952	0.846;0.887	B;P	0.47528	0.372;0.549	T	0.02829	-1.1105	10	0.62326	D	0.03	-32.9815	6.8159	0.23831	0.0:0.1857:0.0:0.8143	.	347;347	Q8TF46;Q8TF46-3	DI3L1_HUMAN;.	E	264;347	ENSP00000321583:V264E;ENSP00000321711:V347E	ENSP00000321583:V264E	V	+	2	0	DIS3L	64397886	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.761000	0.55242	0.778000	0.33520	0.482000	0.46254	GTG		0.438	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
MAP2K1	5604	broad.mit.edu	37	15	66727483	66727483	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr15:66727483G>A	ENST00000307102.5	+	2	730	c.199G>A	c.(199-201)Gac>Aac	p.D67N		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	67					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.D67N(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	GAAGGATGACGACTTTGAGAA	0.547																																					p.D67N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	15	GRCh37	CM076269	MAP2K1	M		.						188.0	174.0	179.0					15																	66727483		2201	4299	6500	64514537	SO:0001583	missense	5604	exon2			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.199G>A	15.37:g.66727483G>A	ENSP00000302486:p.Asp67Asn		64514537	NM_002755		Missense_Mutation	SNP	ENST00000307102.5	37	CCDS10216.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.691697|5.691697	0.96793|0.96793	.|.	.|.	ENSG00000169032|ENSG00000169032	ENST00000307102|ENST00000425818	D|.	0.93859|.	-3.3|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Protein kinase-like domain (1);|.	0.091006|.	0.85682|.	D|.	0.000000|.	T|T	0.76133|0.76133	0.3945|0.3945	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.993|.	D;P|.	0.64687|.	0.928;0.638|.	T|T	0.76211|0.76211	-0.3042|-0.3042	10|5	0.72032|.	D|.	0.01|.	-32.7633|-32.7633	17.8302|17.8302	0.88680|0.88680	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	45;67|.	B4DFY5;Q02750|.	.;MP2K1_HUMAN|.	N|Q	67|6	ENSP00000302486:D67N|.	ENSP00000302486:D67N|.	D|R	+|+	1|2	0|0	MAP2K1|MAP2K1	64514537|64514537	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.983000|0.983000	0.72400|0.72400	9.723000|9.723000	0.98772|0.98772	2.443000|2.443000	0.82685|0.82685	0.591000|0.591000	0.81541|0.81541	GAC|CGA		0.547	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
CORO2B	10391	broad.mit.edu	37	15	68937682	68937682	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr15:68937682G>A	ENST00000566799.1	+	2	228	c.199G>A	c.(199-201)Gtc>Atc	p.V67I	CORO2B_ENST00000540068.1_Missense_Mutation_p.V62I|CORO2B_ENST00000261861.5_Missense_Mutation_p.V62I|CORO2B_ENST00000543950.1_Missense_Mutation_p.V62I			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	67					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)	p.V67I(1)		kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CTCCTTCCTCGTCATCCCCCT	0.622																																					p.V67I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G199A	15						.						62.0	57.0	59.0					15																	68937682		2200	4298	6498	66724736	SO:0001583	missense	10391	exon2			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.199G>A	15.37:g.68937682G>A	ENSP00000454783:p.Val67Ile		66724736	NM_006091	A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	ENST00000566799.1	37	CCDS10229.2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821232	0.90873	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.06849	3.25;3.25	4.62	4.62	0.57501	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Domain of unknown function DUF1899 (1);	0.116389	0.64402	D	0.000020	T	0.31765	0.0807	M	0.80847	2.515	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.12915	-1.0529	10	0.87932	D	0	-18.6992	16.3948	0.83586	0.0:0.0:1.0:0.0	.	67	Q9UQ03	COR2B_HUMAN	I	67;62;62	ENSP00000446250:V62I;ENSP00000443819:V62I	ENSP00000261861:V67I	V	+	1	0	CORO2B	66724736	1.000000	0.71417	0.991000	0.47740	0.960000	0.62799	7.665000	0.83852	2.267000	0.75376	0.555000	0.69702	GTC		0.622	CORO2B-203	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006091	
C16orf58	64755	broad.mit.edu	37	16	31503352	31503352	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr16:31503352C>A	ENST00000327237.2	-	12	1326	c.1287G>T	c.(1285-1287)atG>atT	p.M429I	C16orf58_ENST00000567994.1_Missense_Mutation_p.M384I|C16orf58_ENST00000570164.1_Missense_Mutation_p.M427I			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	429						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.M429I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						TTGGGAACAGCATGTCCAACA	0.592																																					p.M429I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1287T	16						.						95.0	78.0	84.0					16																	31503352		2197	4300	6497	31410853	SO:0001583	missense	64755	exon12			AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.1287G>T	16.37:g.31503352C>A	ENSP00000317579:p.Met429Ile		31410853	NM_022744	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Missense_Mutation	SNP	ENST00000327237.2	37	CCDS10715.1	.	.	.	.	.	.	.	.	.	.	C	8.459	0.854932	0.17106	.	.	ENSG00000140688	ENST00000327237;ENST00000452223	T	0.41400	1.0	5.18	3.16	0.36331	.	1.141620	0.06163	N	0.676271	T	0.25121	0.0610	N	0.08118	0	0.53688	D	0.999976	B;B	0.15930	0.015;0.006	B;B	0.06405	0.001;0.002	T	0.11299	-1.0593	10	0.45353	T	0.12	1.7473	7.4895	0.27454	0.0:0.7958:0.0:0.2042	.	429;167	Q96GQ5;Q96GQ5-2	CP058_HUMAN;.	I	429;383	ENSP00000317579:M429I	ENSP00000317579:M429I	M	-	3	0	C16orf58	31410853	0.936000	0.31750	0.924000	0.36721	0.151000	0.21798	0.804000	0.27098	1.390000	0.46547	0.655000	0.94253	ATG		0.592	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744	
IRX5	10265	broad.mit.edu	37	16	54967571	54967571	+	Missense_Mutation	SNP	C	C	T	rs568146590	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr16:54967571C>T	ENST00000394636.4	+	3	1575	c.1238C>T	c.(1237-1239)aCg>aTg	p.T413M	IRX5_ENST00000560154.1_Missense_Mutation_p.T193M|IRX5_ENST00000558597.1_Missense_Mutation_p.T347M|CTD-3032H12.2_ENST00000560487.1_lincRNA|IRX5_ENST00000320990.5_Missense_Mutation_p.T412M			P78411	IRX5_HUMAN	iroquois homeobox 5	413					embryonic cranial skeleton morphogenesis (GO:0048701)|gonad development (GO:0008406)|neuron maturation (GO:0042551)|regulation of heart rate (GO:0002027)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|vitamin D binding (GO:0005499)	p.T413M(1)		kidney(3)|large_intestine(6)|lung(4)|prostate(1)	14						CCCGGCTACACGAACTATGGC	0.657																																					p.T413M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1238T	16						.						25.0	31.0	29.0					16																	54967571		2196	4291	6487	53525072	SO:0001583	missense	10265	exon3			U90309	CCDS10751.1, CCDS58462.1	16q12.2	2011-06-20	2007-07-13		ENSG00000176842	ENSG00000176842		"""Homeoboxes / TALE class"""	14361	protein-coding gene	gene with protein product		606195					Standard	NM_005853		Approved	IRX-2a	uc002ehv.3	P78411	OTTHUMG00000133201	ENST00000394636.4:c.1238C>T	16.37:g.54967571C>T	ENSP00000378132:p.Thr413Met		53525072	NM_005853	H0YMS7|P78416|Q7Z2E1	Missense_Mutation	SNP	ENST00000394636.4	37	CCDS10751.1	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121274	0.56613	.	.	ENSG00000176842	ENST00000394636;ENST00000320990	T;T	0.52295	0.67;0.67	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.63212	0.2492	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	T	0.67507	-0.5653	10	0.87932	D	0	-17.8814	17.4716	0.87647	0.0:1.0:0.0:0.0	.	413	P78411	IRX5_HUMAN	M	413;412	ENSP00000378132:T413M;ENSP00000316250:T412M	ENSP00000316250:T412M	T	+	2	0	IRX5	53525072	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.207000	0.77899	2.340000	0.79590	0.650000	0.86243	ACG		0.657	IRX5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256911.2		
SLC7A6OS	84138	broad.mit.edu	37	16	68344733	68344733	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr16:68344733C>T	ENST00000263997.6	-	1	115	c.97G>A	c.(97-99)Gac>Aac	p.D33N	PRMT7_ENST00000348497.4_5'Flank|PRMT7_ENST00000441236.1_5'Flank|PRMT7_ENST00000339507.5_5'Flank|snoU13_ENST00000458872.1_RNA|PRMT7_ENST00000449359.3_5'Flank	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand	33					hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.D33N(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		TCGACCGCGTCGCTCCGGAGG	0.627																																					p.D33N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G97A	16						.						49.0	42.0	44.0					16																	68344733		2198	4300	6498	66902234	SO:0001583	missense	84138	exon1				CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558	ENST00000263997.6:c.97G>A	16.37:g.68344733C>T	ENSP00000263997:p.Asp33Asn		66902234	NM_032178	Q8TCZ3|Q9H8R8	Missense_Mutation	SNP	ENST00000263997.6	37	CCDS10865.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.913654	0.52439	.	.	ENSG00000103061	ENST00000263997	T	0.18174	2.23	5.47	-6.67	0.01783	.	0.695406	0.15373	N	0.265752	T	0.06325	0.0163	N	0.11427	0.14	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.15809	-1.0424	10	0.39692	T	0.17	-6.5304	7.0736	0.25191	0.0:0.3235:0.2042:0.4723	.	33	Q96CW6	S7A6O_HUMAN	N	33	ENSP00000263997:D33N	ENSP00000263997:D33N	D	-	1	0	SLC7A6OS	66902234	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	0.261000	0.18442	-1.815000	0.01222	-0.145000	0.13849	GAC		0.627	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268894.3	NM_032178	
C17orf97	400566	broad.mit.edu	37	17	263652	263652	+	Missense_Mutation	SNP	G	G	A	rs111543298	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr17:263652G>A	ENST00000360127.6	+	2	1034	c.1018G>A	c.(1018-1020)Gag>Aag	p.E340K	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	370	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.							p.E340K(2)		breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						CCCCGACCCCGAGGCCCTCAA	0.697																																					p.E340K												.	.	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)	c.G1018A	17						.																																			263998	SO:0001583	missense	400566	exon3			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1018G>A	17.37:g.263652G>A	ENSP00000353245:p.Glu340Lys		263998	NM_001013672	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	ENST00000360127.6	37	CCDS32519.2	.	.	.	.	.	.	.	.	.	.	G	0.019	-1.456157	0.01071	.	.	ENSG00000187624	ENST00000360127	T	0.30448	1.53	2.05	-4.1	0.03940	.	.	.	.	.	T	0.10637	0.0260	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16660	-1.0395	9	0.20046	T	0.44	.	1.1152	0.01713	0.4009:0.1974:0.266:0.1357	.	340	Q6ZQX7-4	.	K	340	ENSP00000353245:E340K	ENSP00000353245:E340K	E	+	1	0	C17orf97	263998	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.847000	0.00351	-2.613000	0.00444	-1.026000	0.02426	GAG		0.697	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
PPM1D	8493	broad.mit.edu	37	17	58740438	58740438	+	Missense_Mutation	SNP	A	A	G	rs200334649	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr17:58740438A>G	ENST00000305921.3	+	6	1575	c.1343A>G	c.(1342-1344)aAt>aGt	p.N448S	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	448					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.N448S(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TTCTCAGAGAATTTTTTAGAG	0.443											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	A|||	2	0.000399361	0.0	0.0	5008	,	,		18300	0.002		0.0	False		,,,				2504	0.0				p.N448S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1343G	17						.						99.0	99.0	99.0					17																	58740438		2203	4300	6503	56095220	SO:0001583	missense	8493	exon6			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1343A>G	17.37:g.58740438A>G	ENSP00000306682:p.Asn448Ser	1033	56095220	NM_003620	Q53XP4|Q6P991|Q8IVR6	Missense_Mutation	SNP	ENST00000305921.3	37	CCDS11625.1	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	A	15.91	2.973467	0.53614	.	.	ENSG00000170836	ENST00000305921	T	0.45276	0.9	6.08	6.08	0.98989	.	0.292567	0.38663	N	0.001613	T	0.31482	0.0798	N	0.19112	0.55	0.29580	N	0.849266	B	0.23650	0.089	B	0.20577	0.03	T	0.17837	-1.0356	10	0.35671	T	0.21	-8.302	16.6512	0.85203	1.0:0.0:0.0:0.0	.	448	O15297	PPM1D_HUMAN	S	448	ENSP00000306682:N448S	ENSP00000306682:N448S	N	+	2	0	PPM1D	56095220	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.032000	0.70918	2.333000	0.79357	0.482000	0.46254	AAT		0.443	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
FBXO39	162517	broad.mit.edu	37	17	6683561	6683561	+	Missense_Mutation	SNP	G	G	T	rs200344565	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr17:6683561G>T	ENST00000321535.4	+	2	504	c.374G>T	c.(373-375)cGt>cTt	p.R125L		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	125								p.R125L(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						AGCAACAACCGTCTGAAATCT	0.488																																					p.R125L												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G374T	17						.						74.0	76.0	75.0					17																	6683561		2203	4300	6503	6624285	SO:0001583	missense	162517	exon2			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.374G>T	17.37:g.6683561G>T	ENSP00000321386:p.Arg125Leu		6624285	NM_153230		Missense_Mutation	SNP	ENST00000321535.4	37	CCDS11082.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586546	0.66105	.	.	ENSG00000177294	ENST00000321535	T	0.52754	0.65	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000003	T	0.54902	0.1887	L	0.32530	0.975	0.48288	D	0.999624	D	0.63880	0.993	D	0.74023	0.982	T	0.39881	-0.9592	10	0.15066	T	0.55	-19.6429	15.2118	0.73230	0.0:0.0:1.0:0.0	.	125	Q8N4B4	FBX39_HUMAN	L	125	ENSP00000321386:R125L	ENSP00000321386:R125L	R	+	2	0	FBXO39	6624285	1.000000	0.71417	0.962000	0.40283	0.751000	0.42716	4.809000	0.62591	2.746000	0.94184	0.650000	0.86243	CGT		0.488	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219866.2	NM_153230	
TP53	7157	broad.mit.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	A	rs587782664		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr17:7577570C>A	ENST00000269305.4	-	7	900	c.711G>T	c.(709-711)atG>atT	p.M237I	TP53_ENST00000420246.2_Missense_Mutation_p.M237I|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000445888.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.M237I	Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,oesophagus,NS,Substitution - Missense,0 	.	139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	c.G711T	17	GRCh37	CM011014	TP53	M		.						130.0	102.0	112.0					17																	7577570		2203	4300	6503	7518295	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>T	17.37:g.7577570C>A	ENSP00000269305:p.Met237Ile		7518295	NM_001126114	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282984	0.80692	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999982	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SMARCD2	6603	broad.mit.edu	37	17	61910964	61910964	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr17:61910964C>T	ENST00000448276.2	-	10	1565	c.1300G>A	c.(1300-1302)Gcc>Acc	p.A434T	SMARCD2_ENST00000323347.10_Missense_Mutation_p.A386T|SMARCD2_ENST00000225742.9_Missense_Mutation_p.A359T	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	434					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)	p.A378T(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						TCAAGGGAGGCGATCTCCTGC	0.562																																					p.A434T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1300A	17						.						102.0	103.0	103.0					17																	61910964		2024	4187	6211	59264696	SO:0001583	missense	6603	exon10			U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.1300G>A	17.37:g.61910964C>T	ENSP00000392617:p.Ala434Thr		59264696	NM_001098426	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	ENST00000448276.2	37	CCDS45756.1	.	.	.	.	.	.	.	.	.	.	.	11.30	1.599479	0.28534	.	.	ENSG00000108604	ENST00000448276;ENST00000225742;ENST00000450364;ENST00000323347	T;T	0.46451	0.87;0.89	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.61540	0.2355	M	0.70595	2.14	0.80722	D	1	D;B;B	0.76494	0.999;0.121;0.204	D;B;B	0.77557	0.99;0.015;0.022	T	0.53528	-0.8426	10	0.15066	T	0.55	.	16.8112	0.85720	0.0:1.0:0.0:0.0	.	386;397;434	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	T	434;376;397;386	ENSP00000392617:A434T;ENSP00000318451:A386T	ENSP00000225742:A376T	A	-	1	0	SMARCD2	59264696	1.000000	0.71417	0.997000	0.53966	0.066000	0.16364	5.827000	0.69300	2.837000	0.97791	0.655000	0.94253	GCC		0.562	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426	
CCDC40	55036	broad.mit.edu	37	17	78013870	78013870	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr17:78013870G>A	ENST00000397545.4	+	3	380	c.353G>A	c.(352-354)aGt>aAt	p.S118N	CCDC40_ENST00000374877.3_Missense_Mutation_p.S118N|CCDC40_ENST00000269318.5_Missense_Mutation_p.S118N|CCDC40_ENST00000374876.4_Missense_Mutation_p.S118N	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	118					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.S118N(2)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CCGTATTTCAGTCCTCCTCAG	0.522																																					p.S118N												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G353A	17						.						75.0	78.0	77.0					17																	78013870		1935	4138	6073	75628465	SO:0001583	missense	55036	exon3			AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.353G>A	17.37:g.78013870G>A	ENSP00000380679:p.Ser118Asn		75628465	NM_017950	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	ENST00000397545.4	37	CCDS42395.1	.	.	.	.	.	.	.	.	.	.	G	9.255	1.041818	0.19748	.	.	ENSG00000141519	ENST00000374877;ENST00000269318;ENST00000374876;ENST00000397545	T;T;T;T	0.53640	0.63;0.61;0.63;0.69	2.73	-0.414	0.12359	.	.	.	.	.	T	0.35828	0.0945	N	0.14661	0.345	0.09310	N	1	P;B	0.51449	0.945;0.334	P;B	0.51866	0.682;0.015	T	0.21245	-1.0251	9	0.59425	D	0.04	.	5.1832	0.15171	0.4316:0.0:0.5684:0.0	.	118;118	Q4G0X9-5;Q4G0X9	.;CCD40_HUMAN	N	118	ENSP00000364011:S118N;ENSP00000269318:S118N;ENSP00000364010:S118N;ENSP00000380679:S118N	ENSP00000269318:S118N	S	+	2	0	CCDC40	75628465	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.549000	0.23329	-0.041000	0.13558	-0.142000	0.14014	AGT		0.522	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256005.2	XM_371082	
CTAGE1	64693	broad.mit.edu	37	18	19997412	19997412	+	5'Flank	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr18:19997412C>T	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Silent_p.E121E			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)		p.E121E(2)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					CTTCTTTTAACTCTTTTTCTA	0.378																																					p.E121E												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G363A	18						.						96.0	107.0	103.0					18																	19997412		2178	4290	6468	18251410	SO:0001631	upstream_gene_variant	64693	exon1			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19997412C>T	Exception_encountered		18251410	NM_172241	B0YIZ3	Silent	SNP	ENST00000525417.1	37																																																																																					0.378	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000386767.1	NM_022663, NM_172241	
SERPINB11	89778	broad.mit.edu	37	18	61388073	61388073	+	RNA	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr18:61388073T>C	ENST00000382749.5	+	0	872				SERPINB11_ENST00000544088.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000536691.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.N209N(1)		breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				AGGGTAAAAATGTAACTGTGG	0.368																																					p.N209N	Ovarian(27;496 784 5942 8975 23930)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T627C	18						.						42.0	40.0	40.0					18																	61388073		1846	4076	5922	59539053			89778	exon7					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61388073T>C			59539053	NM_080475	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Silent	SNP	ENST00000382749.5	37																																																																																					0.368	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000207392.3	NM_080475	
ZNF628	89887	broad.mit.edu	37	19	55994543	55994544	+	Frame_Shift_Ins	INS	-	-	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	-	-					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr19:55994543_55994544insC	ENST00000598519.1	+	3	2536_2537	c.1983_1984insC	c.(1984-1986)cccfs	p.P662fs	NAT14_ENST00000591590.1_5'Flank|ZNF628_ENST00000391718.2_Frame_Shift_Ins_p.P658fs|NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000205194.4_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	662	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A660fs*222(1)		endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		CCGGCCCCCAGCCCCCTGCTCC	0.743																																					p.Q657fs												.	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1971_1972insC	19						.																																			60686356	SO:0001589	frameshift_variant	89887	exon3			AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1988dupC	19.37:g.55994548_55994548dupC	ENSP00000469591:p.Pro662fs		60686355	NM_033113	Q86X34	Frame_Shift_Ins	INS	ENST00000598519.1	37	CCDS33116.3																																																																																				0.743	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
PDE4A	5141	broad.mit.edu	37	19	10578043	10578043	+	Missense_Mutation	SNP	G	G	A	rs200409316		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr19:10578043G>A	ENST00000352831.6	+	15	2517	c.2407G>A	c.(2407-2409)Gtg>Atg	p.V803M	PDE4A_ENST00000344979.3_Missense_Mutation_p.V564M|PDE4A_ENST00000440014.2_Missense_Mutation_p.V742M|PDE4A_ENST00000293683.5_Missense_Mutation_p.V777M|PDE4A_ENST00000380702.2_Missense_Mutation_p.V781M|PDE4A_ENST00000592685.1_Missense_Mutation_p.V781M	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	803					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)	p.V564M(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	GGAGGAATTCGTGGTTGCTGT	0.617																																					p.V742M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2224A	19						.						84.0	82.0	82.0					19																	10578043		2203	4300	6503	10439043	SO:0001583	missense	5141	exon15				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.2407G>A	19.37:g.10578043G>A	ENSP00000270474:p.Val803Met		10439043	NM_001111309	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	g	8.893	0.954366	0.18431	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979	T;T;T;T;T	0.69306	-0.37;-0.37;-0.39;-0.37;-0.08	3.53	1.27	0.21489	.	29.869100	0.00695	N	0.000745	T	0.42539	0.1207	N	0.08118	0	0.09310	N	1	B;P;B;B	0.34780	0.275;0.468;0.216;0.046	B;B;B;B	0.24269	0.023;0.052;0.023;0.011	T	0.37361	-0.9709	10	0.25106	T	0.35	.	6.0447	0.19753	0.2511:0.0:0.7489:0.0	.	564;742;777;803	P27815-4;P27815-6;P27815-2;P27815	.;.;.;PDE4A_HUMAN	M	781;803;777;742;564	ENSP00000370078:V781M;ENSP00000270474:V803M;ENSP00000293683:V777M;ENSP00000394754:V742M;ENSP00000341007:V564M	ENSP00000293683:V777M	V	+	1	0	PDE4A	10439043	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-1.069000	0.03444	0.293000	0.22520	0.479000	0.44913	GTG		0.617	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451244.1		
OR7C1	26664	broad.mit.edu	37	19	14910722	14910722	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr19:14910722G>A	ENST00000248073.2	-	1	301	c.227C>T	c.(226-228)aCg>aTg	p.T76M	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	76					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T76M(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						TGGGACAGTCGTGGAGGTAAA	0.443																																					p.T76M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C227T	19						.						93.0	86.0	88.0					19																	14910722		2203	4300	6503	14771722	SO:0001583	missense	26664	exon1			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.227C>T	19.37:g.14910722G>A	ENSP00000248073:p.Thr76Met		14771722	NM_198944	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	ENST00000248073.2	37	CCDS12317.1	.	.	.	.	.	.	.	.	.	.	g	8.544	0.873844	0.17322	.	.	ENSG00000127530	ENST00000248073	T	0.00433	7.43	3.64	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37955	U	0.001872	T	0.01695	0.0054	H	0.97962	4.115	0.09310	N	1	D	0.89917	1.0	D	0.75020	0.985	T	0.23762	-1.0179	10	0.87932	D	0	.	5.9459	0.19219	0.0:0.208:0.5779:0.2141	.	76	O76099	OR7C1_HUMAN	M	76	ENSP00000248073:T76M	ENSP00000248073:T76M	T	-	2	0	OR7C1	14771722	0.000000	0.05858	0.404000	0.26397	0.005000	0.04900	-0.515000	0.06290	2.024000	0.59613	0.543000	0.68304	ACG		0.443	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
FCGBP	8857	broad.mit.edu	37	19	40408043	40408043	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr19:40408043C>A	ENST00000221347.6	-	9	4685	c.4678G>T	c.(4678-4680)Gat>Tat	p.D1560Y		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1560	Cys-rich.|TIL 3.					extracellular vesicular exosome (GO:0070062)		p.D1560Y(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCACACCCATCCTGGCACTGT	0.617																																					p.D1560Y												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G4678T	19						.						82.0	69.0	74.0					19																	40408043		2203	4300	6503	45099883	SO:0001583	missense	8857	exon9			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4678G>T	19.37:g.40408043C>A	ENSP00000221347:p.Asp1560Tyr		45099883	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	3.951	-0.012181	0.07727	.	.	ENSG00000090920	ENST00000221347	D	0.91011	-2.77	3.64	2.55	0.30701	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	.	.	.	.	D	0.89262	0.6665	L	0.47716	1.5	0.09310	N	1	P	0.50710	0.938	P	0.49140	0.601	T	0.81304	-0.0993	9	0.62326	D	0.03	.	10.4399	0.44460	0.0:0.8948:0.0:0.1052	.	1560	Q9Y6R7	FCGBP_HUMAN	Y	1560	ENSP00000221347:D1560Y	ENSP00000221347:D1560Y	D	-	1	0	FCGBP	45099883	0.000000	0.05858	0.013000	0.15412	0.002000	0.02628	0.036000	0.13819	1.865000	0.54081	0.491000	0.48974	GAT		0.617	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
FCGBP	8857	broad.mit.edu	37	19	40408315	40408315	+	Silent	SNP	G	G	A	rs373732668		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr19:40408315G>A	ENST00000221347.6	-	8	4531	c.4524C>T	c.(4522-4524)taC>taT	p.Y1508Y		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1508						extracellular vesicular exosome (GO:0070062)		p.Y1508Y(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AAGCACTCACGTAGGCATGGA	0.597																																					p.Y1508Y												.	.	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C4524T	19						.						47.0	40.0	42.0					19																	40408315		2203	4291	6494	45100155	SO:0001819	synonymous_variant	8857	exon8			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4524C>T	19.37:g.40408315G>A			45100155	NM_003890	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																				0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZIK1	284307	broad.mit.edu	37	19	58101417	58101417	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr19:58101417G>A	ENST00000597850.1	+	4	453	c.238G>A	c.(238-240)Gac>Aac	p.D80N	ZIK1_ENST00000599456.1_Missense_Mutation_p.D25N|ZIK1_ENST00000307468.4_Silent_p.L24L|ZIK1_ENST00000536878.2_Missense_Mutation_p.D67N	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	80	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D80N(1)		NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GACACCTTCTGACCAGAATGT	0.453																																					p.D80N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G238A	19						.						86.0	74.0	78.0					19																	58101417		2203	4300	6503	62793229	SO:0001583	missense	284307	exon4			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.238G>A	19.37:g.58101417G>A	ENSP00000472867:p.Asp80Asn		62793229	NM_001010879	O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	ENST00000597850.1	37	CCDS33135.1	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469548	0.26423	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	T	0.00840	5.63	2.6	2.6	0.31112	Krueppel-associated box (3);	.	.	.	.	T	0.00724	0.0024	N	0.10760	0.04	0.09310	N	1	B;B	0.18166	0.0;0.026	B;B	0.14023	0.001;0.01	T	0.48258	-0.9051	9	0.66056	D	0.02	.	8.8351	0.35107	0.0:0.0:1.0:0.0	.	67;80	F5H435;Q3SY52	.;ZIK1_HUMAN	N	67;61;80	ENSP00000438487:D67N	ENSP00000303820:D80N	D	+	1	0	ZIK1	62793229	0.000000	0.05858	0.061000	0.19648	0.614000	0.37383	0.327000	0.19663	1.757000	0.51966	0.555000	0.69702	GAC		0.453	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466791.1	NM_001010879	
VCAM1	7412	broad.mit.edu	37	1	101188776	101188776	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:101188776A>G	ENST00000294728.2	+	3	642	c.541A>G	c.(541-543)Acc>Gcc	p.T181A	VCAM1_ENST00000370115.1_Missense_Mutation_p.T181A|VCAM1_ENST00000347652.2_Missense_Mutation_p.T181A|VCAM1_ENST00000370119.4_Missense_Mutation_p.T119A	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	181	Ig-like C2-type 2.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)	p.T181A(1)		central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	TTTGGAAGTAACCTTTACTCC	0.433																																					p.T119A												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A355G	1						.						122.0	114.0	117.0					1																	101188776		2203	4300	6503	100961364	SO:0001583	missense	7412	exon3			M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.541A>G	1.37:g.101188776A>G	ENSP00000294728:p.Thr181Ala		100961364	NM_001199834	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	ENST00000294728.2	37	CCDS773.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.612867	0.46631	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.42	4.3	0.51218	Immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.281863	0.38720	N	0.001582	T	0.13415	0.0325	M	0.79258	2.445	0.44282	D	0.997147	B;B;B	0.24768	0.009;0.111;0.009	B;B;B	0.19391	0.017;0.022;0.025	T	0.11665	-1.0578	10	0.07325	T	0.83	-5.0749	9.0922	0.36619	0.9153:0.0:0.0847:0.0	.	119;181;181	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	A	119;181;181;181	ENSP00000359137:T119A;ENSP00000304611:T181A;ENSP00000294728:T181A;ENSP00000359133:T181A	ENSP00000294728:T181A	T	+	1	0	VCAM1	100961364	0.087000	0.21565	0.997000	0.53966	0.970000	0.65996	0.655000	0.24933	1.008000	0.39264	0.482000	0.46254	ACC		0.433	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030213.1	NM_001078	
FLG	2312	broad.mit.edu	37	1	152276882	152276882	+	Nonsense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:152276882G>A	ENST00000368799.1	-	3	10515	c.10480C>T	c.(10480-10482)Caa>Taa	p.Q3494*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3494	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.Q3494*(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTCCTGATTGTTCGTCATTA	0.572									Ichthyosis																												p.Q3494X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C10480T	1						.						281.0	276.0	278.0					1																	152276882		2203	4297	6500	150543506	SO:0001587	stop_gained	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.10480C>T	1.37:g.152276882G>A	ENSP00000357789:p.Gln3494*		150543506	NM_002016	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	49	15.709188	0.99842	.	.	ENSG00000143631	ENST00000368799	.	.	.	2.98	0.926	0.19430	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	3.6444	0.08178	0.1448:0.0:0.6128:0.2424	.	.	.	.	X	3494	.	ENSP00000357789:Q3494X	Q	-	1	0	FLG	150543506	0.002000	0.14202	0.000000	0.03702	0.015000	0.08874	1.014000	0.29950	-0.044000	0.13491	0.398000	0.26397	CAA		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CREB3L4	148327	broad.mit.edu	37	1	153946391	153946391	+	Silent	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:153946391T>C	ENST00000368607.3	+	10	1304	c.1038T>C	c.(1036-1038)aaT>aaC	p.N346N	CREB3L4_ENST00000271889.4_Silent_p.N346N|CREB3L4_ENST00000468845.1_3'UTR|JTB_ENST00000471173.1_5'Flank|CREB3L4_ENST00000368600.3_Silent_p.N326N|CREB3L4_ENST00000405694.3_Silent_p.N199N|CREB3L4_ENST00000368603.1_Silent_p.N346N	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	346					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.N346N(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TAACAGAAAATCTGGAGACCC	0.537																																					p.N346N												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1038C	1						.						61.0	58.0	59.0					1																	153946391		2203	4300	6503	152213015	SO:0001819	synonymous_variant	148327	exon10			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.1038T>C	1.37:g.153946391T>C			152213015	NM_130898	D3DV62|Q5T4L0|Q86YW6	Silent	SNP	ENST00000368607.3	37	CCDS1056.1																																																																																				0.537	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090291.1	NM_130898	
BCAN	63827	broad.mit.edu	37	1	156622230	156622230	+	Silent	SNP	C	C	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:156622230C>G	ENST00000329117.5	+	8	1824	c.1488C>G	c.(1486-1488)ccC>ccG	p.P496P	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Silent_p.P496P	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	496					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.P496P(1)		cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTCTCTCCCCACTGAGCCAG	0.622																																					p.P496P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1488G	1						.						13.0	13.0	13.0					1																	156622230		2199	4296	6495	154888854	SO:0001819	synonymous_variant	63827	exon8			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1488C>G	1.37:g.156622230C>G			154888854	NM_021948	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	37	CCDS1149.1																																																																																				0.622	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
RASAL2	9462	broad.mit.edu	37	1	178414654	178414654	+	Splice_Site	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:178414654A>G	ENST00000462775.1	+	7	1165	c.1040A>G	c.(1039-1041)gAt>gGt	p.D347G	RASAL2_ENST00000367649.3_Splice_Site_p.D495G|RASAL2_ENST00000448150.3_Splice_Site_p.D477G	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	347	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)	p.D477G(1)|p.D495G(1)		biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TTCTACCAGGATTTTCTGACT	0.388																																					p.D495G												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A1484G	1						.						137.0	123.0	128.0					1																	178414654		2203	4300	6503	176681277	SO:0001630	splice_region_variant	9462	exon9			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1039-1A>G	1.37:g.178414654A>G			176681277	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	37	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.693898	0.88735	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	D;T;D	0.82619	-1.63;2.18;-1.63	5.28	5.28	0.74379	Rho GTPase activation protein (1);Ras GTPase-activating protein (3);	0.000000	0.85682	D	0.000000	D	0.90246	0.6950	M	0.70842	2.15	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.87578	0.998;0.903	D	0.91447	0.5178	10	0.87932	D	0	.	15.2195	0.73299	1.0:0.0:0.0:0.0	.	347;495	Q9UJF2;F8W755	NGAP_HUMAN;.	G	477;495;347	ENSP00000407768:D477G;ENSP00000356621:D495G;ENSP00000420558:D347G	ENSP00000356621:D495G	D	+	2	0	RASAL2	176681277	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.135000	0.94478	1.996000	0.58369	0.533000	0.62120	GAT		0.388	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	Missense_Mutation
LEFTY2	7044	broad.mit.edu	37	1	226127174	226127174	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:226127174C>T	ENST00000366820.5	-	3	972	c.624G>A	c.(622-624)ctG>ctA	p.L208L	LEFTY2_ENST00000474493.1_5'UTR|LEFTY2_ENST00000420304.2_Silent_p.L174L|RP4-559A3.6_ENST00000513672.1_RNA	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	208					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)		p.L208L(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					CCAGCGGGCCCAGATGCTCCC	0.716																																					p.L174L	Colon(172;116 2643 9098 43333)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G522A	1						.						9.0	13.0	12.0					1																	226127174		2162	4200	6362	224193797	SO:0001819	synonymous_variant	7044	exon4			U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.624G>A	1.37:g.226127174C>T			224193797	NM_001172425	B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Silent	SNP	ENST00000366820.5	37	CCDS1549.1																																																																																				0.716	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240	
DMBX1	127343	broad.mit.edu	37	1	46972811	46972811	+	Silent	SNP	G	G	A	rs145308708	byFrequency	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:46972811G>A	ENST00000360032.3	+	1	143	c.129G>A	c.(127-129)gcG>gcA	p.A43A	DMBX1_ENST00000371956.4_Silent_p.A43A	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1									p.A43A(1)		endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					CAGTGCATGCGCTTACATTGG	0.637													G|||	4	0.000798722	0.0023	0.0	5008	,	,		18069	0.0		0.0	False		,,,				2504	0.001				p.A43A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G129A	1						.	G	,	5,4401	9.9+/-24.2	0,5,2198	45.0	41.0	42.0		129,129	-10.5	0.0	1	dbSNP_134	42	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	DMBX1	NM_147192.2,NM_172225.1	,	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	,	43/383,43/378	46972811	5,13001	2203	4300	6503	46745398	SO:0001819	synonymous_variant	127343	exon1			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.129G>A	1.37:g.46972811G>A			46745398	NM_172225		Silent	SNP	ENST00000360032.3	37	CCDS536.1																																																																																				0.637	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021895.1		
F3	2152	broad.mit.edu	37	1	94998694	94998694	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:94998694C>T	ENST00000334047.7	-	4	706	c.543G>A	c.(541-543)aaG>aaA	p.K181K	F3_ENST00000370207.4_Silent_p.K181K|F3_ENST00000480356.1_5'UTR	NM_001993.4	NP_001984.1	P13726	TF_HUMAN	coagulation factor III (thromboplastin, tissue factor)	181					activation of blood coagulation via clotting cascade (GO:0002543)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of plasma proteins involved in acute inflammatory response (GO:0002541)|blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)|protease binding (GO:0002020)	p.K181K(1)		NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)	14		all_lung(203;0.00106)|Lung NSC(277;0.00475)		all cancers(265;0.0232)|Epithelial(280;0.121)	Coagulation factor VIIa(DB00036)	AAATTAAGTCCTTGCCAAAAA	0.353																																					p.K181K	Melanoma(40;358 1339 15970 39161)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G543A	1						.						82.0	78.0	79.0					1																	94998694		2203	4300	6503	94771282	SO:0001819	synonymous_variant	2152	exon4			BC011029	CCDS750.1, CCDS53345.1	1p22-p21	2012-10-02			ENSG00000117525	ENSG00000117525		"""CD molecules"""	3541	protein-coding gene	gene with protein product		134390					Standard	NM_001993		Approved	CD142	uc001dqr.3	P13726	OTTHUMG00000010716	ENST00000334047.7:c.543G>A	1.37:g.94998694C>T			94771282	NM_001993	D3DT47|Q6FHG2|Q86WH4	Silent	SNP	ENST00000334047.7	37	CCDS750.1																																																																																				0.353	F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029593.1	NM_001993	
OR2M2	391194	broad.mit.edu	37	1	248343471	248343471	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr1:248343471C>T	ENST00000359682.2	+	1	184	c.184C>T	c.(184-186)Ctc>Ttc	p.L62F		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L62F(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CATGTACTTCCTCCTCAGCCA	0.532																																					p.L62F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C184T	1						.						320.0	302.0	308.0					1																	248343471		2203	4298	6501	246410094	SO:0001583	missense	391194	exon1			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.184C>T	1.37:g.248343471C>T	ENSP00000352710:p.Leu62Phe		246410094	NM_001004688	A3KFT4	Missense_Mutation	SNP	ENST00000359682.2	37	CCDS31106.1	.	.	.	.	.	.	.	.	.	.	c	3.879	-0.026369	0.07589	.	.	ENSG00000198601	ENST00000359682	T	0.00848	5.62	2.03	-2.46	0.06461	GPCR, rhodopsin-like superfamily (1);	0.692054	0.11077	N	0.602273	T	0.00552	0.0018	N	0.04116	-0.275	0.09310	N	1	B	0.23735	0.09	B	0.23574	0.047	T	0.45131	-0.9282	10	0.21014	T	0.42	.	7.5873	0.27999	0.0:0.3757:0.0:0.6243	.	62	Q96R28	OR2M2_HUMAN	F	62	ENSP00000352710:L62F	ENSP00000352710:L62F	L	+	1	0	OR2M2	246410094	0.204000	0.23447	0.003000	0.11579	0.182000	0.23217	0.530000	0.23036	-0.547000	0.06207	0.454000	0.30748	CTC		0.532	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097356.2	NM_001004688	
ATRN	8455	broad.mit.edu	37	20	3578644	3578644	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr20:3578644C>T	ENST00000262919.5	+	22	3629	c.3561C>T	c.(3559-3561)gaC>gaT	p.D1187D	ATRN_ENST00000446916.2_Silent_p.D1187D	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	1187					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.D1187D(1)		breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						CTACTCCTGACGAAGTAAGAT	0.368																																					p.D1187D												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C3561T	20						.						134.0	132.0	133.0					20																	3578644		2203	4300	6503	3526644	SO:0001819	synonymous_variant	8455	exon22			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3561C>T	20.37:g.3578644C>T			3526644	NM_139322	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Silent	SNP	ENST00000262919.5	37	CCDS13053.1																																																																																				0.368	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
SNTA1	6640	broad.mit.edu	37	20	31996388	31996388	+	Silent	SNP	C	C	T	rs530204062		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr20:31996388C>T	ENST00000217381.2	-	8	1714	c.1443G>A	c.(1441-1443)tcG>tcA	p.S481S		NM_003098.2	NP_003089.1	Q13424	SNTA1_HUMAN	syntrophin, alpha 1	481	SU.				muscle contraction (GO:0006936)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|neuromuscular junction development (GO:0007528)|regulation of heart rate (GO:0002027)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of vasoconstriction by circulating norepinephrine (GO:0003117)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular (GO:0005622)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	ATPase binding (GO:0051117)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)	p.S481S(1)		breast(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(1)	13						TTTTGGGACACGAGTGCAGGT	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17703	0.001		0.0	False		,,,				2504	0.0				p.S481S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G1443A	20						.						103.0	93.0	96.0					20																	31996388		2203	4300	6503	31460049	SO:0001819	synonymous_variant	6640	exon8			U40571	CCDS13220.1	20q11.2	2014-09-17	2012-06-15		ENSG00000101400	ENSG00000101400			11167	protein-coding gene	gene with protein product	"""pro-TGF-alpha cytoplasmic domain-interacting protein 1"", ""dystrophin-associated protein A1, 59kDa, acidic component"""	601017	"""syntrophin, alpha 1 (dystrophin-associated protein A1, 59kD, acidic component)"""	SNT1		8576247, 8612778	Standard	NM_003098		Approved	TACIP1, LQT12	uc002wzd.1	Q13424	OTTHUMG00000032259	ENST00000217381.2:c.1443G>A	20.37:g.31996388C>T			31460049	NM_003098	A8K7H9|B4DX40|E1P5N1|Q16438	Silent	SNP	ENST00000217381.2	37	CCDS13220.1																																																																																				0.627	SNTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078704.2	NM_003098	
ZNFX1	57169	broad.mit.edu	37	20	47888151	47888151	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr20:47888151C>T	ENST00000396105.1	-	3	444	c.198G>A	c.(196-198)agG>agA	p.R66R	ZNFX1_ENST00000371754.4_Silent_p.R66R|ZNFX1_ENST00000371752.1_Silent_p.R66R	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	66							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R66R(2)		cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ATCTCTCTTCCCTCTGCCAGT	0.577																																					p.R66R												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G198A	20						.						181.0	169.0	173.0					20																	47888151		2203	4300	6503	47321558	SO:0001819	synonymous_variant	57169	exon3			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.198G>A	20.37:g.47888151C>T			47321558	NM_021035	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	ENST00000396105.1	37	CCDS13417.1																																																																																				0.577	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079647.2	NM_021035	
PWP2	5822	broad.mit.edu	37	21	45540959	45540959	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr21:45540959G>A	ENST00000291576.7	+	13	1739	c.1612G>A	c.(1612-1614)Gag>Aag	p.E538K		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	538					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)	p.E538K(1)		cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GAGGACCAAGGAGACGCTGGC	0.607																																					p.E538K												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1612A	21						.						74.0	64.0	67.0					21																	45540959		2203	4300	6503	44365387	SO:0001583	missense	5822	exon13				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1612G>A	21.37:g.45540959G>A	ENSP00000291576:p.Glu538Lys		44365387	NM_005049	B2RAG8|Q96A77	Missense_Mutation	SNP	ENST00000291576.7	37	CCDS33579.1	.	.	.	.	.	.	.	.	.	.	G	36	5.706859	0.96821	.	.	ENSG00000241945	ENST00000291576	T	0.47528	0.84	5.08	5.08	0.68730	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.77857	0.4193	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84292	0.0500	10	0.87932	D	0	-20.3293	18.8754	0.92332	0.0:0.0:1.0:0.0	.	538	Q15269	PWP2_HUMAN	K	538	ENSP00000291576:E538K	ENSP00000291576:E538K	E	+	1	0	PWP2	44365387	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	8.779000	0.91792	2.529000	0.85273	0.655000	0.94253	GAG		0.607	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195736.3	NM_005049	
PMM1	5372	broad.mit.edu	37	22	41973354	41973354	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr22:41973354T>C	ENST00000216259.7	-	8	841	c.757A>G	c.(757-759)Att>Gtt	p.I253V		NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	253					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)	p.I253V(1)		NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						GGGAAGAAAATCTCCCGGCAT	0.587											OREG0026591	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I253V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A757G	22						.						69.0	71.0	71.0					22																	41973354		2203	4300	6503	40303300	SO:0001583	missense	5372	exon8				CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.757A>G	22.37:g.41973354T>C	ENSP00000216259:p.Ile253Val	905	40303300	NM_002676	A8K003|Q92586	Missense_Mutation	SNP	ENST00000216259.7	37	CCDS14020.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.840762	0.51057	.	.	ENSG00000100417	ENST00000216259	D	0.98234	-4.81	5.52	0.0598	0.14334	HAD-like domain (1);	0.337800	0.31834	N	0.006988	D	0.96059	0.8716	L	0.47016	1.485	0.34691	D	0.725703	B	0.02656	0.0	B	0.08055	0.003	D	0.92121	0.5704	10	0.54805	T	0.06	-21.356	16.4949	0.84237	0.0:0.0:0.5658:0.4342	.	253	Q92871	PMM1_HUMAN	V	253	ENSP00000216259:I253V	ENSP00000216259:I253V	I	-	1	0	PMM1	40303300	1.000000	0.71417	0.968000	0.41197	0.992000	0.81027	1.237000	0.32695	0.033000	0.15463	0.455000	0.32223	ATT		0.587	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320711.3	NM_002676	
LRP1B	53353	broad.mit.edu	37	2	141253147	141253147	+	Nonsense_Mutation	SNP	G	G	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:141253147G>T	ENST00000389484.3	-	56	9992	c.9021C>A	c.(9019-9021)tgC>tgA	p.C3007*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3007	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.C3007*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGAGCGATTTGCAGCCATTTG	0.428										TSP Lung(27;0.18)																											p.C3007X	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C9021A	2						.						201.0	179.0	187.0					2																	141253147		2203	4300	6503	140969617	SO:0001587	stop_gained	53353	exon56			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.9021C>A	2.37:g.141253147G>T	ENSP00000374135:p.Cys3007*		140969617	NM_018557	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	55	24.938604	0.99963	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.127	0.97984	0.0:0.0:1.0:0.0	.	.	.	.	X	3007;2945	.	ENSP00000374135:C3007X	C	-	3	2	LRP1B	140969617	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.584000	0.67490	2.775000	0.95449	0.585000	0.79938	TGC		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
FAM84A	151354	broad.mit.edu	37	2	14774287	14774287	+	Missense_Mutation	SNP	A	A	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:14774287A>C	ENST00000295092.2	+	2	472	c.184A>C	c.(184-186)Acc>Ccc	p.T62P	FAM84A_ENST00000331243.4_Missense_Mutation_p.T62P|AC011897.1_ENST00000581929.1_5'Flank	NM_145175.2	NP_660158.2	Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A	62								p.T62P(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			CCCGGGTTGCACCCCCTGCCC	0.647																																					p.T62P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A184C	2						.						22.0	27.0	25.0					2																	14774287		2203	4300	6503	14691738	SO:0001583	missense	151354	exon2			AJ417080, BC026346	CCDS1684.1	2p24.3	2005-08-09			ENSG00000162981	ENSG00000162981			20743	protein-coding gene	gene with protein product	"""neurological/sensory 1"""	611234				14702039	Standard	NM_145175		Approved	NSE1, FLJ35392	uc002rbz.2	Q96KN4	OTTHUMG00000119093	ENST00000295092.2:c.184A>C	2.37:g.14774287A>C	ENSP00000295092:p.Thr62Pro		14691738	NM_145175	A6NP76|Q86UZ2|Q8NAH7|Q8TAM5	Missense_Mutation	SNP	ENST00000295092.2	37	CCDS1684.1	.	.	.	.	.	.	.	.	.	.	A	12.55	1.972740	0.34848	.	.	ENSG00000162981	ENST00000295092;ENST00000331243;ENST00000359969	T;T	0.03745	3.82;3.82	4.96	-7.95	0.01148	.	1.213780	0.05807	N	0.613246	T	0.01189	0.0039	N	0.08118	0	0.24227	N	0.995412	P	0.37864	0.61	B	0.26517	0.07	T	0.45977	-0.9224	10	0.30078	T	0.28	-0.1287	0.2061	0.00150	0.3305:0.2319:0.2122:0.2253	.	62	Q96KN4	FA84A_HUMAN	P	62	ENSP00000295092:T62P;ENSP00000330681:T62P	ENSP00000295092:T62P	T	+	1	0	FAM84A	14691738	0.876000	0.30132	0.006000	0.13384	0.922000	0.55478	0.886000	0.28241	-1.717000	0.01385	0.533000	0.62120	ACC		0.647	FAM84A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239308.2	NM_145175	
LRP1B	53353	broad.mit.edu	37	2	141986842	141986842	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:141986842C>G	ENST00000389484.3	-	6	1731	c.760G>C	c.(760-762)Gaa>Caa	p.E254Q		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	254					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.E254Q(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTGAAGATTCTCTTGATTCA	0.318										TSP Lung(27;0.18)																											p.E254Q	Colon(99;50 2074 2507 20106)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G760C	2						.						98.0	97.0	98.0					2																	141986842		2202	4298	6500	141703312	SO:0001583	missense	53353	exon6			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.760G>C	2.37:g.141986842C>G	ENSP00000374135:p.Glu254Gln		141703312	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349212	0.24426	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.93811	-3.29	5.2	5.2	0.72013	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.232403	0.33772	U	0.004567	D	0.88001	0.6320	L	0.36672	1.1	0.34495	D	0.705431	B	0.17667	0.023	B	0.16289	0.015	D	0.85237	0.1036	10	0.14656	T	0.56	.	11.7909	0.52070	0.0:0.9183:0.0:0.0816	.	254	Q9NZR2	LRP1B_HUMAN	Q	254;192	ENSP00000374135:E254Q	ENSP00000374135:E254Q	E	-	1	0	LRP1B	141703312	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.158000	0.50723	2.440000	0.82611	0.585000	0.79938	GAA		0.318	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
KCNH7	90134	broad.mit.edu	37	2	163279904	163279904	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:163279904C>T	ENST00000332142.5	-	9	2195	c.2096G>A	c.(2095-2097)cGt>cAt	p.R699H	KCNH7_ENST00000328032.4_Missense_Mutation_p.R692H	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	699					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.R699H(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TTCTTCAAGACGTTGCCTCAG	0.453																																					p.R692H	GBM(196;1492 2208 17507 24132 45496)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2075A	2						.						252.0	235.0	241.0					2																	163279904		2203	4300	6503	162988150	SO:0001583	missense	90134	exon8			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2096G>A	2.37:g.163279904C>T	ENSP00000331727:p.Arg699His		162988150	NM_173162	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	35	5.504249	0.96371	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.97430	-4.38;-4.38	5.95	5.95	0.96441	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.98921	0.9634	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.99250	1.0887	10	0.87932	D	0	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	692;699	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	H	699;692	ENSP00000331727:R699H;ENSP00000333781:R692H	ENSP00000333781:R692H	R	-	2	0	KCNH7	162988150	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.824000	0.97209	0.655000	0.94253	CGT		0.453	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
FIGN	55137	broad.mit.edu	37	2	164467213	164467213	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:164467213T>C	ENST00000333129.3	-	3	1443	c.1129A>G	c.(1129-1131)Aag>Gag	p.K377E	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	377					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.K377E(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						TTCGTTGGCTTAAATGCTAAG	0.458																																					p.K377E												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A1129G	2						.						117.0	113.0	114.0					2																	164467213		1987	4175	6162	164175459	SO:0001583	missense	55137	exon3			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.1129A>G	2.37:g.164467213T>C	ENSP00000333836:p.Lys377Glu		164175459	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	37	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	T	13.71	2.318823	0.41096	.	.	ENSG00000182263	ENST00000333129	D	0.93859	-3.3	6.04	6.04	0.98038	.	0.097124	0.64402	D	0.000001	D	0.95714	0.8606	L	0.59436	1.845	0.80722	D	1	D	0.57571	0.98	D	0.68192	0.956	D	0.95529	0.8601	10	0.51188	T	0.08	-12.8946	16.5885	0.84745	0.0:0.0:0.0:1.0	.	377	Q5HY92	FIGN_HUMAN	E	377	ENSP00000333836:K377E	ENSP00000333836:K377E	K	-	1	0	FIGN	164175459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.317000	0.78254	0.460000	0.39030	AAG		0.458	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
TTN	7273	broad.mit.edu	37	2	179463774	179463774	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:179463774G>A	ENST00000591111.1	-	241	51964	c.51740C>T	c.(51739-51741)cCa>cTa	p.P17247L	TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P16320L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P10015L|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P18888L|TTN_ENST00000359218.5_Missense_Mutation_p.P9948L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P9823L			Q8WZ42	TITIN_HUMAN	titin	17247	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.P9823L(1)|p.P16318L(1)|p.P9948L(1)|p.P10015L(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGTTTATCTGGTGCTCCAGG	0.408																																					p.P9823L												.	.	4	Substitution - Missense(4)	large_intestine(4)	c.C29468T	2						.						57.0	54.0	55.0					2																	179463774		1863	4096	5959	179172019	SO:0001583	missense	7273	exon119			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51740C>T	2.37:g.179463774G>A	ENSP00000465570:p.Pro17247Leu		179172019	NM_003319	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.90	2.076194	0.36662	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.98	5.98	0.97165	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82549	0.5061	H	0.95712	3.71	0.48511	D	0.999667	P;P;P;P	0.43578	0.669;0.669;0.811;0.669	B;B;B;B	0.43838	0.192;0.192;0.433;0.192	D	0.87211	0.2247	9	0.87932	D	0	.	16.4726	0.84115	0.0:0.2524:0.7476:0.0	.	9823;9948;10015;17247	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	16320;9823;10015;9948;9821	ENSP00000343764:P16320L;ENSP00000434586:P9823L;ENSP00000340554:P10015L;ENSP00000352154:P9948L	ENSP00000340554:P10015L	P	-	2	0	TTN	179172019	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.806000	0.62569	2.843000	0.97960	0.650000	0.86243	CCA		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu	37	2	179594142	179594142	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:179594142C>A	ENST00000591111.1	-	62	18014	c.17790G>T	c.(17788-17790)ttG>ttT	p.L5930F	RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L5003F|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.L6247F|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12725	Ig-like 40.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L5003F(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTGTCGGTCAATGTGTATT	0.473																																					p.L5003F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G15009T	2						.						142.0	135.0	138.0					2																	179594142		1936	4130	6066	179302387	SO:0001583	missense	7273	exon61			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17790G>T	2.37:g.179594142C>A	ENSP00000465570:p.Leu5930Phe		179302387	NM_133378	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	8.274	0.814088	0.16537	.	.	ENSG00000155657	ENST00000342992	T	0.68181	-0.31	5.92	3.17	0.36434	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47060	0.1425	N	0.16567	0.415	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.35475	-0.9787	9	0.87932	D	0	.	6.4865	0.22091	0.0:0.533:0.2622:0.2048	.	5930	Q8WZ42	TITIN_HUMAN	F	5003	ENSP00000343764:L5003F	ENSP00000343764:L5003F	L	-	3	2	TTN	179302387	0.421000	0.25465	0.482000	0.27366	0.841000	0.47740	0.039000	0.13884	0.408000	0.25621	0.655000	0.94253	TTG		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC150	284992	broad.mit.edu	37	2	197597230	197597230	+	Nonsense_Mutation	SNP	A	A	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:197597230A>T	ENST00000389175.4	+	28	3385	c.3250A>T	c.(3250-3252)Aaa>Taa	p.K1084*	CCDC150_ENST00000409270.1_Nonsense_Mutation_p.K571*|CCDC150_ENST00000272831.7_Nonsense_Mutation_p.K731*	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	1084								p.K1084*(1)		breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						ATGGGAGAGAAAACAGAATCT	0.438																																					p.K1084X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.A3250T	2						.						224.0	207.0	213.0					2																	197597230		1969	4167	6136	197305475	SO:0001587	stop_gained	284992	exon28				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.3250A>T	2.37:g.197597230A>T	ENSP00000373827:p.Lys1084*		197305475	NM_001080539	Q6P5U6|Q6P663|Q8N8V5	Nonsense_Mutation	SNP	ENST00000389175.4	37	CCDS46478.1	.	.	.	.	.	.	.	.	.	.	A	38	7.174448	0.98114	.	.	ENSG00000144395	ENST00000272831;ENST00000389175;ENST00000409270	.	.	.	5.24	5.24	0.73138	.	0.239839	0.29486	N	0.012003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7773	0.57455	1.0:0.0:0.0:0.0	.	.	.	.	X	731;1084;571	.	ENSP00000272831:K731X	K	+	1	0	CCDC150	197305475	0.995000	0.38212	0.694000	0.30210	0.130000	0.20726	4.762000	0.62250	2.201000	0.70794	0.528000	0.53228	AAA		0.438	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335377.2	NM_001080539	
ATP6V1E2	90423	broad.mit.edu	37	2	46739825	46739825	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:46739825T>C	ENST00000306448.4	-	2	1139	c.26A>G	c.(25-27)aAa>aGa	p.K9R	ATP6V1E2_ENST00000522587.1_Missense_Mutation_p.K9R	NM_080653.3	NP_542384.1	Q96A05	VATE2_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2	9					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.K9R(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.151)			AATCTGCTTTTTCACATCGAC	0.483																																					p.K9R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A26G	2						.						77.0	68.0	71.0					2																	46739825		2203	4300	6503	46593329	SO:0001583	missense	90423	exon2			BC008981	CCDS1826.1	2p21	2011-02-10	2006-01-13	2002-06-21	ENSG00000250565	ENSG00000250565		"""ATPases / V-type"""	18125	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD-like 2"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 2"""	ATP6EL2, ATP6V1EL2		12036578	Standard	NM_080653		Approved	MGC9341, VMA4, ATP6E1	uc002ruy.3	Q96A05	OTTHUMG00000128819	ENST00000306448.4:c.26A>G	2.37:g.46739825T>C	ENSP00000304891:p.Lys9Arg		46593329	NM_080653		Missense_Mutation	SNP	ENST00000306448.4	37	CCDS1826.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.784481	0.31593	.	.	ENSG00000250565	ENST00000306448;ENST00000522587	.	.	.	4.08	4.08	0.47627	.	0.059962	0.64402	D	0.000002	T	0.37517	0.1006	L	0.40543	1.245	0.27556	N	0.950346	B	0.02656	0.0	B	0.06405	0.002	T	0.37150	-0.9718	9	0.72032	D	0.01	-12.4038	9.7457	0.40446	0.0:0.0:0.0:1.0	.	9	Q96A05	VATE2_HUMAN	R	9	.	ENSP00000304891:K9R	K	-	2	0	ATP6V1E2	46593329	1.000000	0.71417	0.994000	0.49952	0.083000	0.17756	5.732000	0.68563	2.062000	0.61559	0.533000	0.62120	AAA		0.483	ATP6V1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250753.1	NM_080653	
FSHR	2492	broad.mit.edu	37	2	49190249	49190249	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:49190249C>T	ENST00000406846.2	-	10	1830	c.1711G>A	c.(1711-1713)Gcc>Acc	p.A571T	FSHR_ENST00000346173.3_Missense_Mutation_p.A509T|FSHR_ENST00000304421.4_Missense_Mutation_p.A545T|FSHR_ENST00000541117.1_Missense_Mutation_p.A307T	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	571					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)	p.A571T(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	ATGCGCTTGGCGATCCTGGTG	0.532									Gonadal Dysgenesis, 46 XX																												p.A545T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1633A	2						.						90.0	78.0	82.0					2																	49190249		2203	4300	6503	49043753	SO:0001583	missense	2492	exon9	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1711G>A	2.37:g.49190249C>T	ENSP00000384708:p.Ala571Thr		49043753	NM_181446	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	ENST00000406846.2	37	CCDS1843.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621993	0.87460	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.87904	0.6295	M	0.86178	2.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.88064	0.2796	9	.	.	.	.	18.5892	0.91202	0.0:1.0:0.0:0.0	.	545;509;571	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	T	571;509;545;307	ENSP00000384708:A571T;ENSP00000333908:A509T;ENSP00000306780:A545T;ENSP00000444172:A307T	.	A	-	1	0	FSHR	49043753	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	7.609000	0.82925	2.941000	0.99782	0.655000	0.94253	GCC		0.532	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251367.2		
ERBB4	2066	broad.mit.edu	37	2	212652809	212652809	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr2:212652809A>T	ENST00000342788.4	-	4	807	c.497T>A	c.(496-498)aTt>aAt	p.I166N	ERBB4_ENST00000402597.1_Missense_Mutation_p.I166N|ERBB4_ENST00000436443.1_Missense_Mutation_p.I166N|ERBB4_ENST00000484474.1_5'UTR	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	166					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.I166N(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GTTCCGAACAATATCTTGCCA	0.338										TSP Lung(8;0.080)																											p.I166N												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T497A	2						.						99.0	95.0	96.0					2																	212652809		2203	4300	6503	212361054	SO:0001583	missense	2066	exon4			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.497T>A	2.37:g.212652809A>T	ENSP00000342235:p.Ile166Asn		212361054	NM_005235	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.3|22.3	4.273785|4.273785	0.80580|0.80580	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597;ENST00000435846|ENST00000260943	D;D;D;D|.	0.84730|.	-1.89;-1.89;-1.89;-1.89|.	5.32|5.32	5.32|5.32	0.75619|0.75619	EGF receptor, L domain (1);|.	0.048414|.	0.85682|.	D|.	0.000000|.	D|D	0.86493|0.86493	0.5946|0.5946	H|H	0.95294|0.95294	3.65|3.65	0.58432|0.58432	D|D	0.999992|0.999992	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;1.0;1.0;1.0|.	D|D	0.90361|0.90361	0.4373|0.4373	10|5	0.87932|.	D|.	0|.	.|.	13.8428|13.8428	0.63449|0.63449	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	166;166;25;166;166|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	N|M	166;166;166;107|166	ENSP00000342235:I166N;ENSP00000403204:I166N;ENSP00000385565:I166N;ENSP00000405564:I107N|.	ENSP00000342235:I166N|.	I|L	-|-	2|1	0|2	ERBB4|ERBB4	212361054|212361054	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.938000|8.938000	0.92943|0.92943	2.008000|2.008000	0.58898|0.58898	0.397000|0.397000	0.26171|0.26171	ATT|TTG		0.338	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
ABI3BP	25890	broad.mit.edu	37	3	100527007	100527007	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:100527007G>C	ENST00000284322.5	-	19	1779	c.1670C>G	c.(1669-1671)cCa>cGa	p.P557R	ABI3BP_ENST00000383691.4_Missense_Mutation_p.P511R|ABI3BP_ENST00000471714.1_Missense_Mutation_p.P1234R	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	557	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)	p.P558R(1)|p.P511R(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						ATATTTACCTGGTTGTGTTTG	0.378																																					p.P557R												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1670G	3						.						111.0	105.0	106.0					3																	100527007		1862	4097	5959	102009697	SO:0001583	missense	25890	exon19			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1670C>G	3.37:g.100527007G>C	ENSP00000284322:p.Pro557Arg		102009697	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	ENST00000284322.5	37	CCDS46880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.14|11.14	1.550538|1.550538	0.27739|0.27739	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000383692;ENST00000383691;ENST00000482765|ENST00000495591;ENST00000471901;ENST00000527943;ENST00000478235	T;T;T|.	0.54279|.	2.18;0.58;1.83|.	5.43|5.43	4.54|4.54	0.55810|0.55810	.|.	0.724575|.	0.13976|.	N|.	0.349854|.	T|T	0.66761|0.66761	0.2822|0.2822	M|M	0.72118|0.72118	2.19|2.19	0.34204|0.34204	D|D	0.673529|0.673529	P;B;D;P|.	0.54047|.	0.907;0.378;0.964;0.788|.	B;B;P;B|.	0.46940|.	0.303;0.157;0.532;0.325|.	T|T	0.76085|0.76085	-0.3088|-0.3088	10|5	0.59425|.	D|.	0.04|.	-0.437|-0.437	12.0346|12.0346	0.53417|0.53417	0.0:0.0:0.828:0.172|0.0:0.0:0.828:0.172	.|.	511;557;1234;241|.	B4DSV9;Q7Z7G0;D3YTG3;D3YTD6|.	.;TARSH_HUMAN;.;.|.	R|E	1234;557;241;511;106|613;137;63;135	ENSP00000420524:P1234R;ENSP00000284322:P557R;ENSP00000373189:P511R|.	ENSP00000284322:P557R|.	P|Q	-|-	2|1	0|0	ABI3BP|ABI3BP	102009697|102009697	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.593000|0.593000	0.36681|0.36681	2.315000|2.315000	0.43752|0.43752	1.397000|1.397000	0.46682|0.46682	0.585000|0.585000	0.79938|0.79938	CCA|CAG		0.378	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
CFAP44	55779	broad.mit.edu	37	3	113127977	113127977	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:113127977G>C	ENST00000295868.2	-	7	1028	c.866C>G	c.(865-867)aCt>aGt	p.T289S	WDR52-AS1_ENST00000473329.1_RNA|WDR52-AS1_ENST00000498480.1_RNA|WDR52_ENST00000393845.2_Missense_Mutation_p.T289S	NM_018338.3	NP_060808.2												p.T289S(1)		breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						TCCCGATGTAGTAAGCTGCTC	0.413																																					p.T289S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C866G	3						.						101.0	100.0	100.0					3																	113127977		2203	4300	6503	114610667	SO:0001583	missense	55779	exon7																														ENST00000295868.2:c.866C>G	3.37:g.113127977G>C	ENSP00000295868:p.Thr289Ser		114610667	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	37	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.227223	0.79576	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.05447	5.19;3.44	5.78	5.78	0.91487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.21631	0.0521	M	0.69358	2.11	0.80722	D	1	D	0.58620	0.983	P	0.56960	0.81	T	0.00024	-1.2322	9	0.72032	D	0.01	.	19.9976	0.97389	0.0:0.0:1.0:0.0	.	289	Q96MT7	WDR52_HUMAN	S	289	ENSP00000377428:T289S;ENSP00000295868:T289S	ENSP00000295868:T289S	T	-	2	0	WDR52	114610667	1.000000	0.71417	0.999000	0.59377	0.509000	0.34042	9.001000	0.93568	2.737000	0.93849	0.563000	0.77884	ACT		0.413	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
NEK11	79858	broad.mit.edu	37	3	130828666	130828666	+	Missense_Mutation	SNP	A	A	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:130828666A>T	ENST00000510769.1	+	4	609	c.356A>T	c.(355-357)aAa>aTa	p.K119I	NEK11_ENST00000507910.1_Missense_Mutation_p.K119I|NEK11_ENST00000412440.2_5'UTR|NEK11_ENST00000511262.1_Missense_Mutation_p.K119I|AC121332.1_ENST00000390784.1_RNA|NEK11_ENST00000508196.1_Missense_Mutation_p.K119I|NEK11_ENST00000426022.2_3'UTR|NEK11_ENST00000510688.1_Missense_Mutation_p.K119I|NEK11_ENST00000356918.4_Missense_Mutation_p.K119I|NEK11_ENST00000429253.2_Missense_Mutation_p.K119I|NEK11_ENST00000383366.4_Missense_Mutation_p.K119I					NIMA-related kinase 11									p.K119I(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						CTGGACGATAAAATTCAGGAA	0.343																																					p.K119I												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A356T	3						.						72.0	79.0	76.0					3																	130828666		2203	4299	6502	132311356	SO:0001583	missense	79858	exon5			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.356A>T	3.37:g.130828666A>T	ENSP00000421549:p.Lys119Ile		132311356	NM_024800		Missense_Mutation	SNP	ENST00000510769.1	37		.	.	.	.	.	.	.	.	.	.	A	38	7.060648	0.98036	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000356918;ENST00000510688;ENST00000511262;ENST00000383366;ENST00000507910;ENST00000508196	T;T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.88	4.68	0.58851	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.111677	0.39475	N	0.001352	T	0.58004	0.2092	N	0.05487	-0.04	0.80722	D	1	P;D;P;P;P	0.76494	0.878;0.999;0.878;0.952;0.529	P;D;P;P;B	0.71870	0.528;0.975;0.524;0.624;0.311	T	0.57464	-0.7807	10	0.27082	T	0.32	.	11.3798	0.49750	0.9271:0.0:0.0729:0.0	.	119;119;119;119;119	Q8NG66-3;E9PHI8;Q8NG66-4;Q8NG66;Q8NG66-2	.;.;.;NEK11_HUMAN;.	I	119	ENSP00000421549:K119I;ENSP00000397180:K119I;ENSP00000349389:K119I;ENSP00000423458:K119I;ENSP00000425114:K119I;ENSP00000372857:K119I;ENSP00000426662:K119I;ENSP00000421851:K119I	ENSP00000349389:K119I	K	+	2	0	NEK11	132311356	1.000000	0.71417	0.989000	0.46669	0.954000	0.61252	5.002000	0.63952	1.002000	0.39104	0.523000	0.50628	AAA		0.343	NEK11-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000356757.1	NM_024800	
SMC4	10051	broad.mit.edu	37	3	160131278	160131278	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:160131278G>A	ENST00000357388.3	+	8	1449	c.998G>A	c.(997-999)cGa>cAa	p.R333Q	SMC4_ENST00000360111.2_Missense_Mutation_p.R333Q|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000344722.5_Missense_Mutation_p.R333Q|SMC4_ENST00000462787.1_Missense_Mutation_p.R333Q|SMC4_ENST00000469762.1_Missense_Mutation_p.R308Q	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	333					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.R333Q(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TTGCAGAAACGAATTGCTGAA	0.279																																					p.R333Q												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G998A	3						.						33.0	34.0	34.0					3																	160131278		2173	4263	6436	161613972	SO:0001583	missense	10051	exon8			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.998G>A	3.37:g.160131278G>A	ENSP00000349961:p.Arg333Gln		161613972	NM_001002800	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698830	0.68501	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000392788;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000344722	T;T;T;T;T;T	0.74106	-0.81;-0.8;-0.8;3.14;-0.8;-0.81	5.7	5.7	0.88788	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.65657	0.2712	L	0.47016	1.485	0.58432	D	0.999995	B;B;B	0.30326	0.276;0.233;0.273	B;B;B	0.23275	0.04;0.029;0.045	T	0.61959	-0.6955	10	0.25106	T	0.35	-16.7272	14.0421	0.64681	0.072:0.0:0.928:0.0	.	333;308;333	Q9NTJ3-2;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	Q	333;333;333;308;333;333;333	ENSP00000349961:R333Q;ENSP00000353225:R333Q;ENSP00000417964:R308Q;ENSP00000420121:R333Q;ENSP00000420734:R333Q;ENSP00000341382:R333Q	ENSP00000341382:R333Q	R	+	2	0	SMC4	161613972	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.556000	0.60775	2.684000	0.91462	0.650000	0.86243	CGA		0.279	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
DVL3	1857	broad.mit.edu	37	3	183888352	183888352	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:183888352G>A	ENST00000313143.3	+	15	2208	c.1960G>A	c.(1960-1962)Ggt>Agt	p.G654S	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000431765.1_Missense_Mutation_p.G637S	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	654					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)	p.G654S(1)		breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CCCGAGCTACGGTCCTCCCGG	0.751																																					p.G654S												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1960A	3						.						28.0	39.0	35.0					3																	183888352		2196	4298	6494	185371046	SO:0001583	missense	1857	exon15			D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.1960G>A	3.37:g.183888352G>A	ENSP00000316054:p.Gly654Ser		185371046	NM_004423	B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	ENST00000313143.3	37	CCDS3253.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623636	0.46840	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765	T;T	0.03831	3.79;3.82	3.91	3.91	0.45181	Dishevelled C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.17577	0.0422	M	0.67397	2.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.983;0.972;0.997	T	0.13710	-1.0499	10	0.17832	T	0.49	-0.0045	16.2832	0.82707	0.0:0.0:1.0:0.0	.	637;486;654;654	B4E3E5;Q9UG07;F5GWR8;Q92997	.;.;.;DVL3_HUMAN	S	654;654;637	ENSP00000316054:G654S;ENSP00000405885:G637S	ENSP00000316054:G654S	G	+	1	0	DVL3	185371046	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	6.950000	0.75977	1.894000	0.54839	0.561000	0.74099	GGT		0.751	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346184.1	NM_004423	
STAC	6769	broad.mit.edu	37	3	36527669	36527669	+	Silent	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:36527669C>T	ENST00000273183.3	+	5	915	c.615C>T	c.(613-615)ttC>ttT	p.F205F	STAC_ENST00000476388.1_3'UTR|STAC_ENST00000457375.2_Silent_p.F144F	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	205					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)	p.F205F(1)		endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CCCTCCGCTTCGGCACCTCCC	0.552																																					p.F205F												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C615T	3						.						148.0	152.0	151.0					3																	36527669		2203	4300	6503	36502673	SO:0001819	synonymous_variant	6769	exon5			D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.615C>T	3.37:g.36527669C>T			36502673	NM_003149	B2R8S8	Silent	SNP	ENST00000273183.3	37	CCDS2662.1																																																																																				0.552	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
DOCK3	1795	broad.mit.edu	37	3	51102015	51102015	+	Missense_Mutation	SNP	A	A	G	rs570454630		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:51102015A>G	ENST00000266037.9	+	6	475	c.452A>G	c.(451-453)gAc>gGc	p.D151G		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	151					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.D151G(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTGCGCCTGGACTGGGGTAAT	0.463													A|||	1	0.000199681	0.0	0.0	5008	,	,		17397	0.0		0.0	False		,,,				2504	0.001				p.G137G												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A411G	3						.						81.0	83.0	83.0					3																	51102015		1953	4164	6117	51077055	SO:0001583	missense	1795	exon6			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.452A>G	3.37:g.51102015A>G	ENSP00000266037:p.Asp151Gly		51077055	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.745626	0.89663	.	.	ENSG00000088538	ENST00000266037	T	0.59502	0.26	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.76933	0.4057	M	0.82193	2.58	0.80722	D	1	D	0.71674	0.998	D	0.67103	0.949	T	0.78738	-0.2087	10	0.46703	T	0.11	.	15.9731	0.80036	1.0:0.0:0.0:0.0	.	151	Q8IZD9	DOCK3_HUMAN	G	151	ENSP00000266037:D151G	ENSP00000266037:D151G	D	+	2	0	DOCK3	51077055	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.307000	0.96226	2.250000	0.74265	0.528000	0.53228	GAC		0.463	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
PSMD2	5708	broad.mit.edu	37	3	184020271	184020271	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr3:184020271A>G	ENST00000310118.4	+	6	1376	c.818A>G	c.(817-819)aAt>aGt	p.N273S	PSMD2_ENST00000435761.1_Missense_Mutation_p.N114S|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000439383.1_Missense_Mutation_p.N143S	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	273					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)	p.N273S(1)		breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	TTGATGCTCAATGACATGGAG	0.493																																					p.N273S	Colon(24;313 636 6917 9932 15554)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A818G	3						.						102.0	93.0	96.0					3																	184020271		2203	4300	6503	185502965	SO:0001583	missense	5708	exon6			AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.818A>G	3.37:g.184020271A>G	ENSP00000310129:p.Asn273Ser		185502965	NM_002808	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Missense_Mutation	SNP	ENST00000310118.4	37	CCDS3258.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.839157	0.51057	.	.	ENSG00000175166	ENST00000310118;ENST00000417952;ENST00000538096;ENST00000435761;ENST00000439383	T;T;T	0.22539	1.95;1.95;1.95	5.37	5.37	0.77165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.50752	0.1634	M	0.88640	2.97	0.58432	D	0.999993	P;D	0.63880	0.948;0.993	P;D	0.68192	0.573;0.956	T	0.59080	-0.7521	10	0.72032	D	0.01	-22.8887	12.6753	0.56891	0.8629:0.1371:0.0:0.0	.	114;273	E9PCS3;Q13200	.;PSMD2_HUMAN	S	273;198;265;114;143	ENSP00000310129:N273S;ENSP00000402618:N114S;ENSP00000416028:N143S	ENSP00000310129:N273S	N	+	2	0	PSMD2	185502965	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.027000	0.93706	2.257000	0.74773	0.438000	0.28831	AAT		0.493	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808	
FBN2	2201	broad.mit.edu	37	5	127728882	127728882	+	Missense_Mutation	SNP	C	C	T	rs138046782		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:127728882C>T	ENST00000508053.1	-	16	2385	c.1411G>A	c.(1411-1413)Gtt>Att	p.V471I	FBN2_ENST00000508989.1_Missense_Mutation_p.V438I|FBN2_ENST00000262464.4_Missense_Mutation_p.V471I			P35556	FBN2_HUMAN	fibrillin 2	471					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.V471I(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GCTCCCCCAACGCCAGGAGAA	0.577																																					p.V471I												.	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1411A	5						.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	80.0	87.0	84.0		1411	3.8	1.0	5	dbSNP_134	84	0,8600		0,0,4300	no	missense	FBN2	NM_001999.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	471/2913	127728882	1,13005	2203	4300	6503	127756781	SO:0001583	missense	2201	exon10			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1411G>A	5.37:g.127728882C>T	ENSP00000424571:p.Val471Ile		127756781	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	3.741	-0.053523	0.07362	2.27E-4	0.0	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.85773	-1.81;-1.81;-2.03	3.8	3.8	0.43715	.	0.131649	0.33515	N	0.004839	T	0.76730	0.4028	L	0.38175	1.15	0.30642	N	0.75632	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.71318	-0.4629	10	0.34782	T	0.22	.	10.6368	0.45569	0.0:0.9089:0.0:0.0911	.	438;471	D6RJI3;P35556	.;FBN2_HUMAN	I	471;471;438	ENSP00000262464:V471I;ENSP00000424571:V471I;ENSP00000425596:V438I	ENSP00000262464:V471I	V	-	1	0	FBN2	127756781	0.678000	0.27586	0.975000	0.42487	0.269000	0.26545	0.911000	0.28584	2.402000	0.81655	0.563000	0.77884	GTT		0.577	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
HTR4	3360	broad.mit.edu	37	5	147889190	147889190	+	Missense_Mutation	SNP	T	T	C	rs553922527		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:147889190T>C	ENST00000377888.3	-	6	1043	c.905A>G	c.(904-906)tAt>tGt	p.Y302C	HTR4_ENST00000521735.1_Missense_Mutation_p.Y302C|HTR4_ENST00000521530.1_Missense_Mutation_p.Y302C|HTR4_ENST00000362016.2_Missense_Mutation_p.Y316C|HTR4_ENST00000354217.2_Missense_Mutation_p.Y302C|HTR4_ENST00000520514.1_Missense_Mutation_p.Y302C|HTR4_ENST00000360693.3_Missense_Mutation_p.Y302C|HTR4_ENST00000517929.1_Missense_Mutation_p.Y302C|HTR4_ENST00000314512.6_Missense_Mutation_p.Y302C	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled	302					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)	p.Y302C(2)|p.Y316C(1)		endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	GGAATTGATATAGCCGAGCCA	0.493																																					p.Y302C	GBM(120;370 1604 14007 17804 41573)											.	.	3	Substitution - Missense(3)	large_intestine(3)	c.A905G	5						.						94.0	93.0	93.0					5																	147889190		2203	4300	6503	147869383	SO:0001583	missense	3360	exon6			Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.905A>G	5.37:g.147889190T>C	ENSP00000367120:p.Tyr302Cys		147869383	NM_000870	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	ENST00000377888.3	37	CCDS4291.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.993782	0.54041	.	.	ENSG00000164270	ENST00000521530;ENST00000354217;ENST00000314512;ENST00000521735;ENST00000517929;ENST00000520514;ENST00000377888;ENST00000360693;ENST00000362016	T;T;T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	6.07	6.07	0.98685	GPCR, rhodopsin-like superfamily (1);	0.051321	0.85682	D	0.000000	D	0.90625	0.7060	H	0.95850	3.73	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.93305	0.6680	10	0.87932	D	0	.	15.4647	0.75390	0.0:0.0:0.0:1.0	.	302;302;302;316;302;302;302	C4WYH4;Q13639;Q712M9;Q13639-6;Q13639-3;Q13639-2;Q684M0	.;5HT4R_HUMAN;.;.;.;.;.	C	302;302;302;302;302;302;302;302;316	ENSP00000428320:Y302C;ENSP00000346156:Y302C;ENSP00000314906:Y302C;ENSP00000430979:Y302C;ENSP00000435904:Y302C;ENSP00000427913:Y302C;ENSP00000367120:Y302C;ENSP00000353915:Y302C;ENSP00000355037:Y316C	ENSP00000314906:Y302C	Y	-	2	0	HTR4	147869383	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	8.040000	0.89188	2.326000	0.78906	0.533000	0.62120	TAT		0.493	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252187.2	NM_000870	
SLC36A3	285641	broad.mit.edu	37	5	150663693	150663693	+	Missense_Mutation	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:150663693T>C	ENST00000335230.3	-	8	1297	c.886A>G	c.(886-888)Atc>Gtc	p.I296V	SLC36A3_ENST00000377713.3_Missense_Mutation_p.I337V	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	296						integral component of membrane (GO:0016021)		p.I296V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATATAGAGGATGATGACAATG	0.473																																					p.I296V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A886G	5						.						182.0	172.0	175.0					5																	150663693		2203	4300	6503	150643886	SO:0001583	missense	285641	exon8			AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.886A>G	5.37:g.150663693T>C	ENSP00000334750:p.Ile296Val		150643886	NM_181774	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	37	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	T	1.026	-0.683353	0.03353	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02177	4.41;4.41	4.34	-4.48	0.03515	.	0.967858	0.08592	N	0.922814	T	0.01124	0.0037	N	0.13299	0.325	0.21290	N	0.999734	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.14578	0.003;0.008;0.011	T	0.48234	-0.9053	10	0.02654	T	1	.	5.8563	0.18722	0.2396:0.3876:0.0:0.3728	.	337;296;281	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	V	296;337	ENSP00000334750:I296V;ENSP00000366942:I337V	ENSP00000334750:I296V	I	-	1	0	SLC36A3	150643886	0.000000	0.05858	0.798000	0.32154	0.975000	0.68041	-2.119000	0.01324	-0.668000	0.05296	0.528000	0.53228	ATC		0.473	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
GRIA1	2890	broad.mit.edu	37	5	153065862	153065862	+	Silent	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:153065862T>C	ENST00000285900.5	+	8	1450	c.1107T>C	c.(1105-1107)atT>atC	p.I369I	GRIA1_ENST00000518783.1_Silent_p.I379I|GRIA1_ENST00000521843.2_Silent_p.I300I|GRIA1_ENST00000518142.1_Silent_p.I289I|GRIA1_ENST00000448073.4_Silent_p.I379I|GRIA1_ENST00000340592.5_Silent_p.I369I	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	369					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.I369I(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TCCACGTGATTGAAATGAAAC	0.502																																					p.I369I												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1107C	5						.						132.0	118.0	123.0					5																	153065862		2203	4300	6503	153046055	SO:0001819	synonymous_variant	2890	exon8				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1107T>C	5.37:g.153065862T>C			153046055	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	CCDS4322.1																																																																																				0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
GRIA1	2890	broad.mit.edu	37	5	153181927	153181927	+	Silent	SNP	C	C	T	rs140534681		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:153181927C>T	ENST00000285900.5	+	15	2740	c.2397C>T	c.(2395-2397)agC>agT	p.S799S	GRIA1_ENST00000518783.1_Silent_p.S809S|GRIA1_ENST00000521843.2_Silent_p.S730S|GRIA1_ENST00000518142.1_Silent_p.S719S|GRIA1_ENST00000448073.4_Silent_p.S809S|GRIA1_ENST00000340592.5_Silent_p.S799S	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	799					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)	p.S799S(1)		NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	ACAAGACAAGCGCTCTGAGCC	0.502																																					p.S799S												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2397T	5						.	C	,	0,4406		0,0,2203	136.0	118.0	124.0		2397,2397	-8.5	0.7	5	dbSNP_134	124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GRIA1	NM_000827.3,NM_001114183.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	799/907,799/907	153181927	1,13005	2203	4300	6503	153162120	SO:0001819	synonymous_variant	2890	exon15				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2397C>T	5.37:g.153181927C>T			153162120	NM_001114183	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937151	0.52972	0.0	1.16E-4	ENSG00000155511	ENST00000537037	.	.	.	5.44	-8.47	0.00939	.	.	.	.	.	T	0.70351	0.3214	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79904	-0.1606	5	0.72032	D	0.01	.	17.8791	0.88834	0.0:0.1775:0.0:0.8225	.	.	.	.	V	715	.	ENSP00000441507:A715V	A	+	2	0	GRIA1	153162120	0.001000	0.12720	0.679000	0.29978	0.972000	0.66771	-1.615000	0.02055	-1.482000	0.01860	-0.794000	0.03295	GCG		0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
ADAMTS16	170690	broad.mit.edu	37	5	5306817	5306817	+	Missense_Mutation	SNP	C	C	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:5306817C>A	ENST00000274181.7	+	21	3525	c.3387C>A	c.(3385-3387)agC>agA	p.S1129R		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1129	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S1129R(1)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CGAGGGGCAGCTGGTTTGCCT	0.687																																					p.S1129R												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C3387A	5						.						16.0	18.0	17.0					5																	5306817		1923	4133	6056	5359817	SO:0001583	missense	170690	exon21			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3387C>A	5.37:g.5306817C>A	ENSP00000274181:p.Ser1129Arg		5359817	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	C	7.773	0.707834	0.15239	.	.	ENSG00000145536	ENST00000274181	T	0.17691	2.26	5.51	2.63	0.31362	.	0.546266	0.19688	N	0.108353	T	0.07548	0.0190	N	0.10837	0.055	0.29968	N	0.81879	B	0.06786	0.001	B	0.04013	0.001	T	0.18618	-1.0331	10	0.23302	T	0.38	.	6.2137	0.20644	0.0:0.6662:0.1566:0.1772	.	1129	Q8TE57	ATS16_HUMAN	R	1129	ENSP00000274181:S1129R	ENSP00000274181:S1129R	S	+	3	2	ADAMTS16	5359817	0.995000	0.38212	0.827000	0.32855	0.875000	0.50365	2.914000	0.48797	1.339000	0.45563	0.561000	0.74099	AGC		0.687	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
CDH9	1007	broad.mit.edu	37	5	26902750	26902750	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:26902750G>C	ENST00000231021.4	-	7	1260	c.1088C>G	c.(1087-1089)cCt>cGt	p.P363R		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	363	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P363L(1)|p.P363R(1)		breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATCTTTGAAAGGTCCCAGGTG	0.368																																					p.P363R	Melanoma(8;187 585 15745 40864 52829)											.	.	2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.C1088G	5						.						108.0	107.0	107.0					5																	26902750		2203	4300	6503	26938507	SO:0001583	missense	1007	exon7			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1088C>G	5.37:g.26902750G>C	ENSP00000231021:p.Pro363Arg		26938507	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	37	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797777	0.70567	.	.	ENSG00000113100	ENST00000231021	T	0.40476	1.03	5.62	5.62	0.85841	Cadherin (3);Cadherin-like (1);	0.109437	0.64402	D	0.000007	T	0.66790	0.2825	M	0.83483	2.645	0.49389	D	0.999782	P	0.50943	0.94	P	0.62382	0.901	T	0.68187	-0.5475	9	.	.	.	.	18.2244	0.89913	0.0:0.0:1.0:0.0	.	363	Q9ULB4	CADH9_HUMAN	R	363	ENSP00000231021:P363R	.	P	-	2	0	CDH9	26938507	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.460000	0.73518	2.648000	0.89879	0.650000	0.86243	CCT		0.368	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
POLK	51426	broad.mit.edu	37	5	74872703	74872703	+	Silent	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:74872703T>C	ENST00000241436.4	+	6	811	c.639T>C	c.(637-639)aaT>aaC	p.N213N	POLK_ENST00000515295.1_Silent_p.N213N|POLK_ENST00000352007.5_Silent_p.N213N|POLK_ENST00000508526.1_Silent_p.N213N|POLK_ENST00000506928.1_3'UTR|POLK_ENST00000504026.1_Silent_p.N213N|POLK_ENST00000380481.3_Silent_p.N123N	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	213	UmuC.				DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)	p.N213N(2)		endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		AAAGACAAAATTGGCCTGAGG	0.343								DNA polymerases (catalytic subunits)																													p.N213N												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.T639C	5						.						69.0	68.0	68.0					5																	74872703		2202	4299	6501	74908459	SO:0001819	synonymous_variant	51426	exon6			AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.639T>C	5.37:g.74872703T>C			74908459	NM_016218	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Silent	SNP	ENST00000241436.4	37	CCDS4030.1																																																																																				0.343	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	
APC	324	broad.mit.edu	37	5	112175594	112175594	+	Frame_Shift_Del	DEL	A	A	-			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:112175594delA	ENST00000457016.1	+	16	4683	c.4303delA	c.(4303-4305)agafs	p.R1435fs	APC_ENST00000508376.2_Frame_Shift_Del_p.R1435fs|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Frame_Shift_Del_p.R1435fs			P25054	APC_HUMAN	adenomatous polyposis coli	1435	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.R1435*(3)|p.R1435fs*38(1)|p.?(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.P1432fs*35(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GCCACCAAGCAGAAGTAAAAC	0.478		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.R1417fs	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	APC,large_intestine,NS,Substitution - Nonsense,0 	.	8	Deletion - Frameshift(4)|Substitution - Nonsense(3)|Unknown(1)	large_intestine(6)|soft_tissue(1)|skin(1)	c.4249delA	5						.						114.0	102.0	106.0					5																	112175594		2202	4300	6502	112203493	SO:0001589	frameshift_variant	324	exon14	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4303delA	5.37:g.112175594delA	ENSP00000413133:p.Arg1435fs		112203493	NM_001127511	D3DT03|Q15162|Q15163|Q93042	Frame_Shift_Del	DEL	ENST00000457016.1	37	CCDS4107.1																																																																																				0.478	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
KCNIP1	30820	broad.mit.edu	37	5	169780924	169780924	+	Missense_Mutation	SNP	T	T	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr5:169780924T>G	ENST00000377360.4	+	1	434	c.44T>G	c.(43-45)tTt>tGt	p.F15C	KCNIP1_ENST00000518527.1_3'UTR	NM_001034838.2	NP_001030010.1	Q9NZI2	KCIP1_HUMAN	Kv channel interacting protein 1	0					detection of calcium ion (GO:0005513)|positive regulation of action potential (GO:0045760)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|potassium channel complex (GO:0034705)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|voltage-gated ion channel activity (GO:0005244)	p.F15C(1)		autonomic_ganglia(1)|large_intestine(7)|lung(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	18	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCGTGAAATTTGCCCAGACC	0.562																																					p.F15C												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T44G	5						.						107.0	88.0	95.0					5																	169780924		2203	4300	6503	169713502	SO:0001583	missense	30820	exon1			AF199597	CCDS34285.1, CCDS34286.1, CCDS4374.1, CCDS64312.1, CCDS64313.1	5q35	2013-01-10			ENSG00000182132	ENSG00000182132		"""EF-hand domain containing"""	15521	protein-coding gene	gene with protein product		604660				10676964	Standard	NM_001278339		Approved	KCHIP1	uc003map.3	Q9NZI2	OTTHUMG00000130442	ENST00000377360.4:c.44T>G	5.37:g.169780924T>G	ENSP00000366577:p.Phe15Cys		169713502	NM_001034838	B7Z7B4|Q3YAD0|Q3YAD1|Q3YAD2|Q3YAD3|Q5U822	Missense_Mutation	SNP	ENST00000377360.4	37	CCDS34285.1	.	.	.	.	.	.	.	.	.	.	T	6.972	0.549417	0.13374	.	.	ENSG00000182132	ENST00000377360	T	0.69306	-0.39	5.3	4.1	0.47936	.	.	.	.	.	T	0.48466	0.1501	N	0.24115	0.695	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.28902	-1.0029	8	.	.	.	.	9.0315	0.36262	0.0:0.0:0.1864:0.8136	.	15	Q3YAD3	.	C	15	ENSP00000366577:F15C	.	F	+	2	0	KCNIP1	169713502	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	2.456000	0.44997	0.822000	0.34565	0.533000	0.62120	TTT		0.562	KCNIP1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000371845.1		
SLC35F1	222553	broad.mit.edu	37	6	118598660	118598660	+	Silent	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr6:118598660T>C	ENST00000360388.4	+	6	999	c.798T>C	c.(796-798)gcT>gcC	p.A266A		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	266					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.A266A(1)		breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		TTTGCAGAGCTATAATGGAGC	0.398																																					p.A266A												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T798C	6						.						169.0	161.0	164.0					6																	118598660		2203	4300	6503	118705353	SO:0001819	synonymous_variant	222553	exon6			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.798T>C	6.37:g.118598660T>C			118705353	NM_001029858	E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Silent	SNP	ENST00000360388.4	37	CCDS34524.1																																																																																				0.398	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041991.2	XM_167044	
BCLAF1	9774	broad.mit.edu	37	6	136599281	136599281	+	Silent	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr6:136599281G>A	ENST00000531224.1	-	4	990	c.738C>T	c.(736-738)ccC>ccT	p.P246P	BCLAF1_ENST00000530767.1_Silent_p.P246P|BCLAF1_ENST00000527536.1_Silent_p.P246P|BCLAF1_ENST00000527759.1_Silent_p.P244P|BCLAF1_ENST00000353331.4_Silent_p.P244P|BCLAF1_ENST00000392348.2_Silent_p.P244P	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	246					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.P246P(1)		haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TACTGAGCATGGGAGCATCAG	0.458																																					p.P246P	Colon(142;1534 1789 5427 7063 28491)											.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C738T	6						.						160.0	153.0	155.0					6																	136599281		2203	4298	6501	136640974	SO:0001819	synonymous_variant	9774	exon4			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.738C>T	6.37:g.136599281G>A			136640974	NM_014739	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	ENST00000531224.1	37	CCDS5177.1																																																																																				0.458	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
SASH1	23328	broad.mit.edu	37	6	148869561	148869561	+	Missense_Mutation	SNP	G	G	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr6:148869561G>C	ENST00000367467.3	+	20	4086	c.3611G>C	c.(3610-3612)aGc>aCc	p.S1204T		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1204	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)	p.S1204T(1)		breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GCGGGCTTCAGCACACTGAGC	0.572																																					p.S1204T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3611C	6						.						102.0	105.0	104.0					6																	148869561		2203	4300	6503	148911254	SO:0001583	missense	23328	exon20			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3611G>C	6.37:g.148869561G>C	ENSP00000356437:p.Ser1204Thr		148911254	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	5.144	0.212186	0.09757	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	D	0.83755	-1.76	5.22	3.15	0.36227	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.431451	0.29389	N	0.012299	T	0.46092	0.1375	N	0.05124	-0.11	0.30266	N	0.792758	B	0.17667	0.023	B	0.12837	0.008	T	0.33214	-0.9877	10	0.45353	T	0.12	-12.9587	6.4604	0.21954	0.1266:0.3418:0.5315:0.0	.	1204	O94885	SASH1_HUMAN	T	1204;614	ENSP00000356437:S1204T	ENSP00000356437:S1204T	S	+	2	0	SASH1	148911254	1.000000	0.71417	0.864000	0.33941	0.095000	0.18619	3.685000	0.54678	2.451000	0.82905	0.561000	0.74099	AGC		0.572	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SYNE1	23345	broad.mit.edu	37	6	152461265	152461265	+	Silent	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr6:152461265G>A	ENST00000367255.5	-	140	25879	c.25278C>T	c.(25276-25278)gcC>gcT	p.A8426A	SYNE1_ENST00000539504.1_Silent_p.A581A|SYNE1_ENST00000265368.4_Silent_p.A8426A|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000356820.4_Silent_p.A2950A|SYNE1_ENST00000423061.1_Silent_p.A8378A|SYNE1_ENST00000354674.4_Silent_p.A604A|SYNE1_ENST00000341594.5_Silent_p.A8038A|SYNE1_ENST00000448038.1_Silent_p.A8378A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8426					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.A8426A(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCAATGCCTGGGCCTGGAGAA	0.493										HNSCC(10;0.0054)																											p.A2950A												.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.C8850T	6						.						127.0	107.0	114.0					6																	152461265		2203	4300	6503	152502958	SO:0001819	synonymous_variant	23345	exon55			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.25278C>T	6.37:g.152461265G>A			152502958	NM_015293	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																				0.493	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
DOPEY1	23033	broad.mit.edu	37	6	83847602	83847602	+	Missense_Mutation	SNP	T	T	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr6:83847602T>A	ENST00000349129.2	+	21	4101	c.3841T>A	c.(3841-3843)Tcg>Acg	p.S1281T	DOPEY1_ENST00000237163.5_Missense_Mutation_p.S1262T|DOPEY1_ENST00000369739.3_Missense_Mutation_p.S1272T|DOPEY1_ENST00000484282.1_3'UTR	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1281					protein transport (GO:0015031)			p.S1281T(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AGAAAAAGTTTCGGAGAAGGA	0.348																																					p.S1281T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T3841A	6						.						42.0	43.0	43.0					6																	83847602		2203	4299	6502	83904321	SO:0001583	missense	23033	exon21			AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.3841T>A	6.37:g.83847602T>A	ENSP00000195654:p.Ser1281Thr		83904321	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	T	8.629	0.893227	0.17613	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T;T	0.27402	1.88;1.88;1.67	6.16	3.81	0.43845	.	0.327870	0.33346	N	0.005013	T	0.06781	0.0173	N	0.19112	0.55	0.80722	D	1	P;B;B	0.39782	0.688;0.255;0.435	B;B;B	0.33750	0.169;0.078;0.078	T	0.11518	-1.0584	10	0.44086	T	0.13	.	4.8338	0.13454	0.1384:0.1449:0.0:0.7167	.	1172;1272;1281	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	T	1281;1262;1262	ENSP00000195654:S1281T;ENSP00000237163:S1262T;ENSP00000358754:S1262T	ENSP00000237163:S1262T	S	+	1	0	DOPEY1	83904321	0.989000	0.36119	0.990000	0.47175	0.971000	0.66376	1.156000	0.31712	1.146000	0.42352	0.528000	0.53228	TCG		0.348	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
CNKSR3	154043	broad.mit.edu	37	6	154762469	154762469	+	Missense_Mutation	SNP	T	T	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr6:154762469T>G	ENST00000607772.1	-	4	1008	c.464A>C	c.(463-465)aAa>aCa	p.K155T	CNKSR3_ENST00000479339.1_Missense_Mutation_p.K75T	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	155	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.K155T(1)		breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		CTGGATAATTTTGTTCTTCGT	0.408																																					p.K155T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A464C	6						.						115.0	115.0	115.0					6																	154762469		2203	4300	6503	154804161	SO:0001583	missense	154043	exon4			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.464A>C	6.37:g.154762469T>G	ENSP00000475915:p.Lys155Thr		154804161	NM_173515	Q5SGD5|Q96N65	Missense_Mutation	SNP	ENST00000607772.1	37	CCDS5246.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.957557	0.73902	.	.	ENSG00000153721	ENST00000367213;ENST00000479339	T;T	0.47177	1.44;0.85	5.91	4.75	0.60458	CRIC domain (1);CRIC domain, Chordata (1);	0.099013	0.64402	D	0.000003	T	0.29850	0.0746	L	0.44542	1.39	0.37542	D	0.918366	P	0.47841	0.901	P	0.48598	0.583	T	0.08973	-1.0696	10	0.27082	T	0.32	.	9.5121	0.39082	0.0:0.1529:0.0:0.8471	.	155	Q6P9H4	CNKR3_HUMAN	T	155;75	ENSP00000356182:K155T;ENSP00000418975:K75T	ENSP00000356182:K155T	K	-	2	0	CNKSR3	154804161	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.806000	0.55583	1.060000	0.40578	0.533000	0.62120	AAA		0.408	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
CARD11	84433	broad.mit.edu	37	7	2969697	2969697	+	Missense_Mutation	SNP	C	C	T	rs367917190		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr7:2969697C>T	ENST00000396946.4	-	12	1985	c.1582G>A	c.(1582-1584)Gag>Aag	p.E528K		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	528					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.E521K(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CCTTCTTCCTCGTGCCCCTTG	0.617			Mis		DLBCL																																p.E528K			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1582A	7						.	C	LYS/GLU	0,4406		0,0,2203	105.0	71.0	83.0		1582	3.1	0.1	7		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	CARD11	NM_032415.4	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	528/1155	2969697	1,13005	2203	4300	6503	2936223	SO:0001583	missense	84433	exon12			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1582G>A	7.37:g.2969697C>T	ENSP00000380150:p.Glu528Lys		2936223	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320396	0.23994	0.0	1.16E-4	ENSG00000198286	ENST00000396946	T	0.30981	1.51	4.0	3.1	0.35709	.	0.587434	0.17651	N	0.166670	T	0.12987	0.0315	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.23013	-1.0200	10	0.09590	T	0.72	-13.7174	9.1019	0.36673	0.0:0.8895:0.0:0.1105	.	528	Q9BXL7	CAR11_HUMAN	K	528	ENSP00000380150:E528K	ENSP00000380150:E528K	E	-	1	0	CARD11	2936223	0.999000	0.42202	0.055000	0.19348	0.008000	0.06430	1.419000	0.34793	2.225000	0.72522	0.561000	0.74099	GAG		0.617	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
TAX1BP1	8887	broad.mit.edu	37	7	27831685	27831685	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr7:27831685C>T	ENST00000396319.2	+	9	1187	c.1099C>T	c.(1099-1101)Cgg>Tgg	p.R367W	TAX1BP1_ENST00000265393.6_Missense_Mutation_p.R367W|TAX1BP1_ENST00000543117.1_Missense_Mutation_p.R367W|TAX1BP1_ENST00000409980.1_Missense_Mutation_p.R367W|TAX1BP1_ENST00000433216.2_Missense_Mutation_p.R210W	NM_006024.6	NP_006015.4	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I) binding protein 1	367	Oligomerization.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)	cytosol (GO:0005829)	kinase binding (GO:0019900)	p.R367W(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(8)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31			GBM - Glioblastoma multiforme(3;0.0823)			TCAGGCAACTCGGCAAGAAGT	0.423																																					p.R367W												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1099T	7						.						105.0	98.0	100.0					7																	27831685		2203	4300	6503	27798210	SO:0001583	missense	8887	exon9			U33821	CCDS5415.1, CCDS43561.1, CCDS56471.1	7p15	2010-08-05			ENSG00000106052	ENSG00000106052			11575	protein-coding gene	gene with protein product		605326				10435631	Standard	NM_006024		Approved	TXBP151, CALCOCO3	uc003szl.3	Q86VP1	OTTHUMG00000023377	ENST00000396319.2:c.1099C>T	7.37:g.27831685C>T	ENSP00000379612:p.Arg367Trp		27798210	NM_006024	B4DKU7|E7ENV2|O60398|O95770|Q13311|Q9BQG5|Q9UI88	Missense_Mutation	SNP	ENST00000396319.2	37	CCDS5415.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435998	0.62955	.	.	ENSG00000106052	ENST00000543117;ENST00000265393;ENST00000409980;ENST00000433216;ENST00000396319	T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92	5.75	5.75	0.90469	.	0.153770	0.29995	N	0.010674	T	0.13756	0.0333	L	0.48642	1.525	0.42567	D	0.99316	P;P;B	0.39157	0.662;0.562;0.354	B;B;B	0.40375	0.14;0.327;0.169	T	0.00561	-1.1670	10	0.87932	D	0	-12.7449	13.2697	0.60153	0.2584:0.7415:0.0:0.0	.	210;367;367	E7ENV2;Q86VP1;Q86VP1-2	.;TAXB1_HUMAN;.	W	367;367;367;210;367	ENSP00000444811:R367W;ENSP00000265393:R367W;ENSP00000386515:R367W;ENSP00000391907:R210W;ENSP00000379612:R367W	ENSP00000265393:R367W	R	+	1	2	TAX1BP1	27798210	0.978000	0.34361	1.000000	0.80357	0.985000	0.73830	1.480000	0.35464	2.878000	0.98634	0.650000	0.86243	CGG		0.423	TAX1BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214142.1	NM_006024	
ZNF804B	219578	broad.mit.edu	37	7	88956678	88956678	+	Missense_Mutation	SNP	A	A	T	rs374034643		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr7:88956678A>T	ENST00000333190.4	+	3	879	c.270A>T	c.(268-270)caA>caT	p.Q90H		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	90							metal ion binding (GO:0046872)	p.Q90H(1)		NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AATTAAAGCAACGGGAATTTG	0.338										HNSCC(36;0.09)																											p.Q90H												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.A270T	7						.						68.0	73.0	71.0					7																	88956678		2203	4299	6502	88794614	SO:0001583	missense	219578	exon3			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.270A>T	7.37:g.88956678A>T	ENSP00000329638:p.Gln90His		88794614	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.720589	0.48728	.	.	ENSG00000182348	ENST00000333190	T	0.19806	2.12	5.04	-2.37	0.06643	.	0.104638	0.42821	N	0.000642	T	0.12178	0.0296	L	0.49778	1.585	0.30045	N	0.812252	B	0.34200	0.441	B	0.28305	0.088	T	0.07009	-1.0795	10	0.51188	T	0.08	-8.1995	2.066	0.03603	0.4723:0.1235:0.2849:0.1193	.	90	A4D1E1	Z804B_HUMAN	H	90	ENSP00000329638:Q90H	ENSP00000329638:Q90H	Q	+	3	2	ZNF804B	88794614	0.998000	0.40836	0.890000	0.34922	0.962000	0.63368	0.647000	0.24812	-0.488000	0.06726	0.528000	0.53228	CAA		0.338	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
SAMD9	54809	broad.mit.edu	37	7	92731862	92731862	+	Silent	SNP	C	C	T	rs200283363		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr7:92731862C>T	ENST00000379958.2	-	3	3818	c.3549G>A	c.(3547-3549)ccG>ccA	p.P1183P		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1183						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)		p.P1183P(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TTTTTGACTTCGGATACAATC	0.378													c|||	0	0.0	0.0	0.0	5008	,	,		18754	0.0		0.0	False		,,,				2504	0.0				p.P1183P												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G3549A	7						.						200.0	202.0	201.0					7																	92731862		2203	4300	6503	92569798	SO:0001819	synonymous_variant	54809	exon2			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.3549G>A	7.37:g.92731862C>T			92569798	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Silent	SNP	ENST00000379958.2	37	CCDS34680.1																																																																																				0.378	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
SGCE	8910	broad.mit.edu	37	7	94257615	94257615	+	Nonsense_Mutation	SNP	G	G	A	rs121908489		TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr7:94257615G>A	ENST00000265735.7	-	3	399	c.289C>T	c.(289-291)Cga>Tga	p.R97*	SGCE_ENST00000445866.2_Nonsense_Mutation_p.R97*|SGCE_ENST00000415788.2_Nonsense_Mutation_p.R133*|SGCE_ENST00000428696.2_Nonsense_Mutation_p.R97*|SGCE_ENST00000437425.2_Nonsense_Mutation_p.R56*|SGCE_ENST00000447873.1_Nonsense_Mutation_p.R97*	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	97					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)	p.R97*(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CATCCAGGTCGGTCTGGGTAA	0.388																																					p.R97X												.	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C289T	7	GRCh37	CM012802	SGCE	M	rs121908489	.						86.0	79.0	82.0					7																	94257615		2203	4298	6501	94095551	SO:0001587	stop_gained	8910	exon3			AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.289C>T	7.37:g.94257615G>A	ENSP00000265735:p.Arg97*		94095551	NM_003919	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Nonsense_Mutation	SNP	ENST00000265735.7	37	CCDS5637.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682791	0.88542	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000437425;ENST00000447873;ENST00000428696;ENST00000415788	.	.	.	5.5	0.725	0.18242	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-16.8508	15.792	0.78372	0.0:0.0:0.3728:0.6272	.	.	.	.	X	97;97;56;97;97;133	.	ENSP00000265735:R97X	R	-	1	2	SGCE	94095551	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	3.567000	0.53813	0.320000	0.23234	0.650000	0.86243	CGA		0.388	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		
WRN	7486	broad.mit.edu	37	8	30938396	30938396	+	Missense_Mutation	SNP	C	C	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr8:30938396C>G	ENST00000298139.5	+	9	1102	c.853C>G	c.(853-855)Cta>Gta	p.L285V		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	285					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.L285V(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TTCTATCTTACTAAAGGATAT	0.299			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												p.L285V	Ovarian(18;161 598 2706 14834 27543)	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C853G	8						.						24.0	26.0	25.0					8																	30938396		2179	4284	6463	31057938	SO:0001583	missense	7486	exon9	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.853C>G	8.37:g.30938396C>G	ENSP00000298139:p.Leu285Val		31057938	NM_000553	A1KYY9	Missense_Mutation	SNP	ENST00000298139.5	37	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885048	0.33255	.	.	ENSG00000165392	ENST00000298139	T	0.54866	0.55	5.83	-2.6	0.06190	.	0.167294	0.39687	N	0.001293	T	0.41166	0.1147	L	0.57536	1.79	0.09310	N	1	P	0.50369	0.934	B	0.43360	0.417	T	0.39121	-0.9629	10	0.51188	T	0.08	-5.7871	4.526	0.11981	0.2495:0.368:0.0:0.3825	.	285	Q14191	WRN_HUMAN	V	285	ENSP00000298139:L285V	ENSP00000298139:L285V	L	+	1	2	WRN	31057938	0.119000	0.22226	0.020000	0.16555	0.015000	0.08874	0.151000	0.16283	-0.089000	0.12484	-1.292000	0.01352	CTA		0.299	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		
MOS	4342	broad.mit.edu	37	8	57025568	57025568	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr8:57025568G>A	ENST00000311923.1	-	1	973	c.974C>T	c.(973-975)gCg>gTg	p.A325V		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	325	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)	p.A325V(1)		breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			CCTCTGCGCCGCGCTGGGTCT	0.627																																					p.A325V	Esophageal Squamous(124;373 2870 4778)											.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C974T	8						.						21.0	24.0	23.0					8																	57025568		2201	4297	6498	57188122	SO:0001583	missense	4342	exon1				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.974C>T	8.37:g.57025568G>A	ENSP00000310722:p.Ala325Val		57188122	NM_005372	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	ENST00000311923.1	37	CCDS6164.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.794988	0.50208	.	.	ENSG00000172680	ENST00000311923	D	0.93366	-3.21	5.8	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.594961	0.15450	N	0.261722	D	0.87103	0.6094	N	0.25485	0.75	0.09310	N	1	B	0.29115	0.233	B	0.20384	0.029	T	0.76809	-0.2822	10	0.30854	T	0.27	.	11.273	0.49150	0.19:0.0:0.81:0.0	.	325	P00540	MOS_HUMAN	V	325	ENSP00000310722:A325V	ENSP00000310722:A325V	A	-	2	0	MOS	57188122	0.003000	0.15002	0.003000	0.11579	0.202000	0.24057	1.356000	0.34079	1.470000	0.48102	0.561000	0.74099	GCG		0.627	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378174.1	NM_005372	
NCOA2	10499	broad.mit.edu	37	8	71071754	71071754	+	Silent	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr8:71071754T>C	ENST00000452400.2	-	10	1291	c.1110A>G	c.(1108-1110)ttA>ttG	p.L370L	NCOA2_ENST00000524223.1_5'Flank	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	370					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)	p.L370L(1)	PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GAAGCATATGTAAAGATATTA	0.368			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.L370L			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A1110G	8						.						200.0	199.0	200.0					8																	71071754		1866	4094	5960	71234308	SO:0001819	synonymous_variant	10499	exon10			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1110A>G	8.37:g.71071754T>C			71234308	NM_006540	Q14CD2	Silent	SNP	ENST00000452400.2	37	CCDS47872.1																																																																																				0.368	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
ZFHX4	79776	broad.mit.edu	37	8	77617279	77617279	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr8:77617279C>T	ENST00000521891.2	+	2	1404	c.956C>T	c.(955-957)tCc>tTc	p.S319F	ZFHX4_ENST00000518282.1_Missense_Mutation_p.S319F|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S319F|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S319F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S319F(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAATGCGTCTCCGCCATAATA	0.413										HNSCC(33;0.089)																											p.S319F												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C956T	8						.						129.0	121.0	124.0					8																	77617279		1858	4106	5964	77779834	SO:0001583	missense	79776	exon2				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.956C>T	8.37:g.77617279C>T	ENSP00000430497:p.Ser319Phe		77779834	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352434	0.41700	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.75938	-0.98;-0.91;-0.95;-0.97	5.53	5.53	0.82687	.	0.000000	0.44097	U	0.000496	D	0.87589	0.6215	M	0.80422	2.495	0.80722	D	1	D;D;D;D	0.89917	0.998;0.999;0.999;1.0	D;D;D;D	0.87578	0.991;0.996;0.996;0.998	D	0.88208	0.2888	10	0.87932	D	0	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	319;319;319;319	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	F	319	ENSP00000430497:S319F;ENSP00000399605:S319F;ENSP00000050961:S319F;ENSP00000430848:S319F	ENSP00000050961:S319F	S	+	2	0	ZFHX4	77779834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.320000	0.79064	2.882000	0.98803	0.655000	0.94253	TCC		0.413	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
VPS13B	157680	broad.mit.edu	37	8	100861103	100861103	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr8:100861103A>G	ENST00000358544.2	+	55	10228	c.10117A>G	c.(10117-10119)Att>Gtt	p.I3373V	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.I3348V	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3373					protein transport (GO:0015031)			p.I3348V(1)|p.I3373V(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGCAGGACCTATTTTAACCAA	0.393																																					p.I3348V	Colon(161;2205 2542 7338 31318)											.	.	2	Substitution - Missense(2)	large_intestine(2)	c.A10042G	8						.						154.0	139.0	144.0					8																	100861103		2203	4300	6503	100930279	SO:0001583	missense	157680	exon55			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.10117A>G	8.37:g.100861103A>G	ENSP00000351346:p.Ile3373Val		100930279	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	A	4.607	0.112854	0.08831	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.67171	-0.25;-0.25	5.73	-4.8	0.03190	.	1.232680	0.05606	N	0.577293	T	0.40448	0.1117	N	0.21373	0.66	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37865	-0.9687	10	0.02654	T	1	.	3.311	0.07016	0.2632:0.2284:0.397:0.1114	.	3348;3373	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	V	3348;3373	ENSP00000349685:I3348V;ENSP00000351346:I3373V	ENSP00000349685:I3348V	I	+	1	0	VPS13B	100930279	0.000000	0.05858	0.000000	0.03702	0.557000	0.35523	0.029000	0.13666	-1.177000	0.02744	0.528000	0.53228	ATT		0.393	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
KIAA2026	158358	broad.mit.edu	37	9	6007456	6007456	+	Missense_Mutation	SNP	G	G	A			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	G	G					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr9:6007456G>A	ENST00000399933.3	-	1	331	c.332C>T	c.(331-333)gCg>gTg	p.A111V	KIAA2026_ENST00000381461.2_Missense_Mutation_p.A111V|MIR4665_ENST00000581132.1_RNA	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	111								p.A111V(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTCCTCCTCCGCGGTGGCAAC	0.716																																					p.A111V												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C332T	9						.						11.0	13.0	13.0					9																	6007456		1846	4083	5929	5997456	SO:0001583	missense	158358	exon1			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.332C>T	9.37:g.6007456G>A	ENSP00000382815:p.Ala111Val		5997456	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	ENST00000399933.3	37		.	.	.	.	.	.	.	.	.	.	G	12.83	2.055018	0.36277	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	.	.	.	4.24	0.933	0.19471	Bromodomain (1);	.	.	.	.	T	0.21801	0.0525	N	0.22421	0.69	0.09310	N	1	P	0.35155	0.487	B	0.24701	0.055	T	0.06716	-1.0811	8	0.44086	T	0.13	.	12.2326	0.54497	0.0:0.4827:0.5173:0.0	.	111	Q5HYC2	K2026_HUMAN	V	111	.	ENSP00000370870:A111V	A	-	2	0	KIAA2026	5997456	0.000000	0.05858	0.024000	0.17045	0.861000	0.49209	0.131000	0.15870	0.331000	0.23511	-0.479000	0.04858	GCG		0.716	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
TOPORS	10210	broad.mit.edu	37	9	32542035	32542035	+	Missense_Mutation	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr9:32542035A>G	ENST00000360538.2	-	3	2604	c.2488T>C	c.(2488-2490)Tca>Cca	p.S830P	TOPORS_ENST00000379858.1_Missense_Mutation_p.S765P	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	830	Interaction with TOP1.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S830P(1)		large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TCCAATTTTGATGAAGATTTT	0.398																																					p.S765P												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2293C	9						.						148.0	145.0	146.0					9																	32542035		2203	4300	6503	32532035	SO:0001583	missense	10210	exon2			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.2488T>C	9.37:g.32542035A>G	ENSP00000353735:p.Ser830Pro		32532035	NM_001195622	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	37	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.369898	0.42003	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.17854	2.25;2.27	4.83	4.83	0.62350	.	0.179600	0.27447	N	0.019335	T	0.10766	0.0263	N	0.14661	0.345	0.24791	N	0.992754	P	0.46277	0.875	B	0.41571	0.36	T	0.13469	-1.0508	10	0.40728	T	0.16	-1.38	10.6892	0.45860	0.8401:0.1599:0.0:0.0	.	830	Q9NS56	TOPRS_HUMAN	P	830;765	ENSP00000353735:S830P;ENSP00000369187:S765P	ENSP00000353735:S830P	S	-	1	0	TOPORS	32532035	0.998000	0.40836	1.000000	0.80357	0.971000	0.66376	1.662000	0.37418	2.114000	0.64651	0.528000	0.53228	TCA		0.398	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
RNF38	152006	broad.mit.edu	37	9	36369716	36369716	+	Splice_Site	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr9:36369716C>T	ENST00000259605.6	-	4	677	c.570G>A	c.(568-570)caG>caA	p.Q190Q	RNF38_ENST00000357058.3_Splice_Site_p.Q107Q|RNF38_ENST00000353739.4_Splice_Site_p.Q140Q|RNF38_ENST00000350199.4_Splice_Site_p.Q107Q|RNF38_ENST00000377877.4_Splice_Site_p.Q114Q|RNF38_ENST00000491349.1_5'UTR|RNF38_ENST00000377885.2_Splice_Site_p.Q107Q	NM_022781.4	NP_073618.3	Q9H0F5	RNF38_HUMAN	ring finger protein 38	190					male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|sperm flagellum (GO:0036126)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q190Q(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(1)|lung(3)|stomach(1)	11			STAD - Stomach adenocarcinoma(86;0.228)			GTTATTGTACCTGATCATGTA	0.413																																					p.Q107Q												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G321A	9						.						147.0	140.0	142.0					9																	36369716		2203	4300	6503	36359716	SO:0001630	splice_region_variant	152006	exon4				CCDS6603.1, CCDS6604.1	9p	2013-01-09			ENSG00000137075	ENSG00000137075		"""RING-type (C3HC4) zinc fingers"""	18052	protein-coding gene	gene with protein product		612488					Standard	XM_005251364		Approved		uc003zzh.3	Q9H0F5	OTTHUMG00000019905	ENST00000259605.6:c.570+1G>A	9.37:g.36369716C>T			36359716	NM_194330	A6PVP9|B1AM81|B1AM82|B3KSG4|E7EVL3|Q7LB33|Q8N0Y0|Q9H748	Silent	SNP	ENST00000259605.6	37	CCDS6603.1																																																																																				0.413	RNF38-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052422.3	NM_022781	Silent
FRMPD1	22844	broad.mit.edu	37	9	37692640	37692640	+	Start_Codon_SNP	SNP	T	T	C			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr9:37692640T>C	ENST00000539465.1	+	2	595	c.2T>C	c.(1-3)aTg>aCg	p.M1T	FRMPD1_ENST00000377765.3_Start_Codon_SNP_p.M1T|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.M1T(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TTTAGGTAAATGGAAGAGCTG	0.443																																					p.M1T												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.T2C	9						.						103.0	97.0	99.0					9																	37692640		2203	4300	6503	37682640	SO:0001582	initiator_codon_variant	22844	exon2			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.2T>C	9.37:g.37692640T>C	ENSP00000444411:p.Met1Thr		37682640	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	37	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	T	18.43	3.621561	0.66787	.	.	ENSG00000070601	ENST00000377765;ENST00000539465;ENST00000359927	T;T;T	0.37235	2.77;2.77;1.21	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.65763	-0.6089	9	0.87932	D	0	-22.5007	13.4873	0.61373	0.0:0.0:0.0:1.0	.	1	Q5SYB0	FRPD1_HUMAN	T	1	ENSP00000366995:M1T;ENSP00000444411:M1T;ENSP00000439868:M1T	ENSP00000439868:M1T	M	+	2	0	FRMPD1	37682640	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.523000	0.60545	2.081000	0.62600	0.482000	0.46254	ATG		0.443	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	Missense_Mutation
ABCA1	19	broad.mit.edu	37	9	107554217	107554217	+	Splice_Site	SNP	C	C	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chr9:107554217C>G	ENST00000374736.3	-	43	6214	c.5820G>C	c.(5818-5820)gaG>gaC	p.E1940D		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1940	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)	p.E1940D(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GTGTCTTTACCTCACCAGGAG	0.408																																					p.E1940D												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G5820C	9						.						101.0	81.0	88.0					9																	107554217		2203	4300	6503	106594038	SO:0001630	splice_region_variant	19	exon43			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5820+1G>C	9.37:g.107554217C>G			106594038	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	35	5.570509	0.96540	.	.	ENSG00000165029	ENST00000374736	D	0.95307	-3.67	5.82	5.82	0.92795	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.97483	0.9176	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97070	0.9777	9	.	.	.	.	20.0953	0.97838	0.0:1.0:0.0:0.0	.	1940	O95477	ABCA1_HUMAN	D	1940	ENSP00000363868:E1940D	.	E	-	3	2	ABCA1	106594038	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.762000	0.94881	0.561000	0.74099	GAG		0.408	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	Missense_Mutation
GSPT2	23708	broad.mit.edu	37	X	51487184	51487184	+	Silent	SNP	A	A	G			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	A	A					Unknown	Unknown	Somatic	Phase_I	Capture	none			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chrX:51487184A>G	ENST00000340438.4	+	1	704	c.462A>G	c.(460-462)aaA>aaG	p.K154K		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	154					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.K154K(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					AGCACAGTAAAGAAGTAAGTG	0.478																																					p.K154K												.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.A462G	X						.						25.0	25.0	25.0					X																	51487184		2202	4299	6501	51503924	SO:0001819	synonymous_variant	23708	exon1			AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.462A>G	X.37:g.51487184A>G			51503924	NM_018094	Q9H909|Q9NVY0|Q9NY44	Silent	SNP	ENST00000340438.4	37	CCDS14336.1																																																																																				0.478	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056587.1		
TENM1	10178	broad.mit.edu	37	X	123785782	123785782	+	Missense_Mutation	SNP	C	C	T			TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	454_PCR_WGA			Illumina HiSeq	TCGA-AY-4071-01A-01W-1073-09	TCGA-AY-4071-10A-01W-1073-09	g.chrX:123785782C>T	ENST00000371130.3	-	8	1624	c.1561G>A	c.(1561-1563)Gtg>Atg	p.V521M	TENM1_ENST00000422452.2_Missense_Mutation_p.V521M	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	521					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.V523M(1)									GTAGTTAACACGAATACTTGC	0.408																																					p.V521M												.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1561A	X						.						175.0	148.0	157.0					X																	123785782		2203	4300	6503	123613463	SO:0001583	missense	10178	exon8			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1561G>A	X.37:g.123785782C>T	ENSP00000360171:p.Val521Met		123613463	NM_014253	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019339	0.35606	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.23147	1.92;1.92	5.3	5.3	0.74995	.	0.071450	0.56097	D	0.000032	T	0.16811	0.0404	N	0.14661	0.345	0.45852	D	0.99871	B;B;B	0.20164	0.041;0.042;0.036	B;B;B	0.17433	0.01;0.006;0.018	T	0.04165	-1.0972	10	0.62326	D	0.03	.	12.3907	0.55356	0.0:0.9172:0.0:0.0828	.	520;521;521	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	M	521	ENSP00000360171:V521M;ENSP00000403954:V521M	ENSP00000360171:V521M	V	-	1	0	ODZ1	123613463	0.989000	0.36119	0.998000	0.56505	0.990000	0.78478	2.271000	0.43364	2.197000	0.70478	0.600000	0.82982	GTG		0.408	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
