#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SGK1	6446	hgsc.bcm.edu	37	6	134494703	134494703	+	Splice_Site	DEL	G	G	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:134494703delG	ENST00000237305.7	-	4	318	c.230delC	c.(229-231)cca>ca	p.P77fs	SGK1_ENST00000475719.2_Splice_Site_p.P77fs|SGK1_ENST00000367858.5_Splice_Site_p.P172fs|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000413996.3_Splice_Site_p.P91fs|SGK1_ENST00000528577.1_Splice_Site_p.P105fs|SGK1_ENST00000367857.5_Splice_Site_p.P67fs	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	77					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		AGAAGGACTTGGCTAGAAAAA	0.368																																					p.P172fs		Atlas-Indel	.											SGK1_ENST00000528577,NS,lymphoid_neoplasm,-2,6	SGK1	387	6	0			c.516delA						PASS	.						46.0	49.0	48.0					6																	134494703		2203	4300	6503	SO:0001630	splice_region_variant	6446	exon6			.	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.229-1C>-	6.37:g.134494703delG		56.0	0.0	0		68.0	13.0	0.191176	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Frame_Shift_Del	DEL	ENST00000237305.7	37	CCDS5170.1																																																																																			.	.	none		0.368	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		Frame_Shift_Del
TOP2B	7155	hgsc.bcm.edu	37	3	25674218	25674218	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:25674218delT	ENST00000264331.4	-	9	1093	c.1094delA	c.(1093-1095)aagfs	p.K365fs	TOP2B_ENST00000435706.2_Frame_Shift_Del_p.K360fs	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	365	Interaction with DNA. {ECO:0000250}.				ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	AGCTTTGTTCTTTTTCTTAAC	0.313																																					p.K360fs		Pindel,Atlas-Indel	.											.	TOP2B	98	.	0			c.1080delG						PASS	.						141.0	142.0	141.0					3																	25674218		1859	4100	5959	SO:0001589	frameshift_variant	7155	exon9			.	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1094delA	3.37:g.25674218delT	ENSP00000264331:p.Lys365fs	204.0	0.0	.		261.0	42.0	0.161	NM_001068	Q13600|Q9UMG8|Q9UQP8	Frame_Shift_Del	DEL	ENST00000264331.4	37																																																																																				.	.	none		0.313	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
ITPKB	3707	hgsc.bcm.edu	37	1	226836447	226836447	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:226836447delT	ENST00000272117.3	-	2	1957	c.1958delA	c.(1957-1959)aacfs	p.N653fs	ITPKB_ENST00000429204.1_Frame_Shift_Del_p.N653fs			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	653					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GTGCACCATGTTTTTTATCTT	0.438																																					p.N653fs	Colon(84;110 1851 5306 33547)	Pindel,Atlas-Indel	.											.	ITPKB	158	.	0			c.1959delC						PASS	.						164.0	163.0	164.0					1																	226836447		2203	4300	6503	SO:0001589	frameshift_variant	3707	exon3			.	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1958delA	1.37:g.226836447delT	ENSP00000272117:p.Asn653fs	171.0	0.0	.		169.0	32.0	0.189	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Frame_Shift_Del	DEL	ENST00000272117.3	37	CCDS1555.1																																																																																			.	.	none		0.438	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
BNC2	54796	hgsc.bcm.edu	37	9	16436374	16436375	+	Frame_Shift_Ins	INS	-	-	G	rs116528562|rs142872531	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr9:16436374_16436375insG	ENST00000380672.4	-	6	1874_1875	c.1817_1818insC	c.(1816-1818)ccgfs	p.P606fs	BNC2_ENST00000380666.2_Frame_Shift_Ins_p.P606fs|BNC2_ENST00000380667.2_Frame_Shift_Ins_p.P539fs|BNC2_ENST00000545497.1_Frame_Shift_Ins_p.P511fs	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CAGAGGGTGGCGGGGGGTGCTG	0.564																																					p.P606fs		Pindel,Atlas-Indel	.											.	BNC2	166	.	0			c.1818_1819insC						PASS	.																																			SO:0001589	frameshift_variant	54796	exon6			.	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1818dupC	9.37:g.16436380_16436380dupG	ENSP00000370047:p.Pro606fs	99.0	0.0	.		96.0	17.0	0.177	NM_017637		Frame_Shift_Ins	INS	ENST00000380672.4	37	CCDS6482.2																																																																																			.	.	none		0.564	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
TET2	54790	hgsc.bcm.edu	37	4	106196908	106196908	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:106196908delA	ENST00000540549.1	+	11	6101	c.5241delA	c.(5239-5241)ccafs	p.P1747fs	TET2_ENST00000380013.4_Frame_Shift_Del_p.P1747fs|TET2_ENST00000545826.1_3'UTR|TET2_ENST00000513237.1_Frame_Shift_Del_p.P1768fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1747					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TGAGCAATCCAAACATGGACT	0.458			"""Mis N, F"""		MDS																																p.P1747fs		Atlas-Indel	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	0			c.5240delC						PASS	.						37.0	29.0	31.0					4																	106196908		692	1591	2283	SO:0001589	frameshift_variant	54790	exon11			.	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.5241delA	4.37:g.106196908delA	ENSP00000442788:p.Pro1747fs	91.0	0.0	0		110.0	18.0	0.163636	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	ENST00000540549.1	37	CCDS47120.1																																																																																			.	.	none		0.458	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
NF1	4763	hgsc.bcm.edu	37	17	29661926	29661927	+	Frame_Shift_Ins	INS	-	-	C	rs144808600	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:29661926_29661927insC	ENST00000358273.4	+	40	6266_6267	c.5883_5884insC	c.(5884-5886)catfs	p.H1962fs	NF1_ENST00000417592.2_5'Flank|NF1_ENST00000581113.2_3'UTR|NF1_ENST00000356175.3_Frame_Shift_Ins_p.H1941fs|NF1_ENST00000444181.2_5'Flank	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1962					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTTTTTGCAAGCATAATGATGA	0.351			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.K1961fs		Pindel,Atlas-Indel	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.5883_5884insC						PASS	.																																			SO:0001589	frameshift_variant	4763	exon40	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	.		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.5884dupC	17.37:g.29661927_29661927dupC	ENSP00000351015:p.His1962fs	125.0	0.0	.		145.0	24.0	0.166	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Ins	INS	ENST00000358273.4	37	CCDS42292.1																																																																																			.	.	none		0.351	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
ABCB1	5243	hgsc.bcm.edu	37	7	87195445	87195445	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:87195445delT	ENST00000265724.3	-	8	1060	c.643delA	c.(643-645)accfs	p.T215fs	ABCB1_ENST00000543898.1_Frame_Shift_Del_p.T151fs	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	215	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ATCACAAGGGTTAGCTTCCAA	0.428																																					p.T215fs		Pindel,Atlas-Indel	.											.	ABCB1	263	.	0			c.644delC						PASS	.						150.0	134.0	139.0					7																	87195445		2203	4300	6503	SO:0001589	frameshift_variant	5243	exon8			.	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.643delA	7.37:g.87195445delT	ENSP00000265724:p.Thr215fs	144.0	0.0	.		198.0	33.0	0.167	NM_000927	A8K294|B5AK60|Q12755|Q14812	Frame_Shift_Del	DEL	ENST00000265724.3	37	CCDS5608.1																																																																																			.	.	none		0.428	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335444.2	NM_000927	
GLI2	2736	hgsc.bcm.edu	37	2	121708820	121708820	+	Splice_Site	DEL	C	C	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:121708820delC	ENST00000452319.1	+	4	316	c.256delC	c.(256-258)ccc>cc	p.P87fs	GLI2_ENST00000361492.4_Splice_Site_p.P87fs|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TCTCTGCAGGCCCCCTGCCCT	0.622																																					p.G85fs		Pindel,Atlas-Indel	.											.	GLI2	187	.	0			c.255delG						PASS	.						99.0	112.0	107.0					2																	121708820		2203	4299	6502	SO:0001630	splice_region_variant	2736	exon3			.		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.255-1C>-	2.37:g.121708820delC		241.0	0.0	.		221.0	36.0	0.163	NM_005270		Frame_Shift_Del	DEL	ENST00000452319.1	37	CCDS33283.1																																																																																			.	.	none		0.622	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	Frame_Shift_Del
EGFL6	25975	hgsc.bcm.edu	37	X	13636081	13636082	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chrX:13636081_13636082insA	ENST00000361306.1	+	8	1268_1269	c.1011_1012insA	c.(1012-1014)aaafs	p.K338fs	EGFL6_ENST00000380602.3_Frame_Shift_Ins_p.K338fs	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	338					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						GGAATGAAGAGAAAATGAAAGA	0.465																																					p.E337fs		Pindel,Atlas-Indel	.											.	EGFL6	111	.	0			c.1011_1012insA						PASS	.																																			SO:0001589	frameshift_variant	25975	exon8			.	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.1015dupA	X.37:g.13636085_13636085dupA	ENSP00000355126:p.Lys338fs	74.0	0.0	.		79.0	22.0	0.278	NM_001167890	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Frame_Shift_Ins	INS	ENST00000361306.1	37	CCDS14155.1																																																																																			.	.	none		0.465	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507	
REST	5978	hgsc.bcm.edu	37	4	57777675	57777676	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:57777675_57777676insA	ENST00000309042.7	+	2	1185_1186	c.871_872insA	c.(871-873)tatfs	p.Y291fs	REST_ENST00000514063.1_3'UTR	NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	291					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					AAAAAACAATTATGTTCAGCAT	0.351																																					p.Y291_V292delinsX		Pindel,Atlas-Indel	.											.	REST	104	.	0			c.871_872insA						PASS	.																																			SO:0001589	frameshift_variant	5978	exon2			.	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.872dupA	4.37:g.57777676_57777676dupA	ENSP00000311816:p.Tyr291fs	97.0	0.0	.		89.0	14.0	0.157	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Frame_Shift_Ins	INS	ENST00000309042.7	37	CCDS3509.1																																																																																			.	.	none		0.351	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
GRIA2	2891	hgsc.bcm.edu	37	4	158254497	158254497	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:158254497delC	ENST00000264426.9	+	8	1426	c.1147delC	c.(1147-1149)cccfs	p.P383fs	GRIA2_ENST00000393815.2_Frame_Shift_Del_p.P336fs|GRIA2_ENST00000449365.1_Frame_Shift_Del_p.P336fs|GRIA2_ENST00000296526.7_Frame_Shift_Del_p.P383fs|GRIA2_ENST00000507898.1_Frame_Shift_Del_p.P336fs	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	383					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AACTAATGGGCCCCGGAAGGT	0.398																																					p.G382fs		Atlas-Indel	.											.	GRIA2	358	.	0			c.1146delG						PASS	.						34.0	36.0	35.0					4																	158254497		2198	4294	6492	SO:0001589	frameshift_variant	2891	exon8			.		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1147delC	4.37:g.158254497delC	ENSP00000264426:p.Pro383fs	49.0	0.0	0		68.0	11.0	0.161765	NM_001083619	A8MT92|I6L997|Q96FP6	Frame_Shift_Del	DEL	ENST00000264426.9	37	CCDS43274.1																																																																																			.	.	none		0.398	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
DRICH1	51233	hgsc.bcm.edu	37	22	23956338	23956340	+	In_Frame_Del	DEL	TCT	TCT	-	rs117546628	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr22:23956338_23956340delTCT	ENST00000317749.5	-	9	900_902	c.603_605delAGA	c.(601-606)gaagat>gat	p.E201del		NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		201	Asp-rich.									endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						GTCATCATCATCTTCTTCTTCTT	0.384																																					p.202_202del		Pindel,Atlas-Indel	.											.	C22orf43	18	.	0			c.604_606del						PASS	.																																			SO:0001651	inframe_deletion	51233	exon9			.																												ENST00000317749.5:c.603_605delAGA	22.37:g.23956347_23956349delTCT	ENSP00000316137:p.Glu201del	236.0	0.0	.		306.0	52.0	0.170	NM_016449	Q6ICJ8|Q6P4I3|Q9NU31	In_Frame_Del	DEL	ENST00000317749.5	37	CCDS42985.1																																																																																			.	.	none		0.384	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319708.2		
ASPM	259266	hgsc.bcm.edu	37	1	197070009	197070009	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:197070009C>A	ENST00000367409.4	-	18	8628	c.8372G>T	c.(8371-8373)gGt>gTt	p.G2791V	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2791					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AATCATAACACCTTCACTTTG	0.393																																					p.G2791V		Atlas-SNP	.											ASPM,right_upper_lobe,carcinoma,0,1	ASPM	444	1	0			c.G8372T						PASS	.						133.0	133.0	133.0					1																	197070009		2203	4300	6503	SO:0001583	missense	259266	exon18			ATAACACCTTCAC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8372G>T	1.37:g.197070009C>A	ENSP00000356379:p.Gly2791Val	115.0	0.0	0		157.0	33.0	0.210191	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.280914	0.23392	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.56611	0.45	4.66	-1.47	0.08772	.	1.296170	0.05105	N	0.487807	T	0.55689	0.1936	L	0.36672	1.1	0.09310	N	1	D;B	0.89917	1.0;0.112	D;B	0.87578	0.998;0.057	T	0.46034	-0.9220	10	0.23891	T	0.37	.	2.4063	0.04414	0.1324:0.1431:0.3433:0.3813	.	777;2791	E7EQ84;Q8IZT6	.;ASPM_HUMAN	V	2791;777	ENSP00000356379:G2791V	ENSP00000356376:G777V	G	-	2	0	ASPM	195336632	0.001000	0.12720	0.000000	0.03702	0.073000	0.16967	0.619000	0.24388	-0.532000	0.06332	-0.379000	0.06801	GGT	.	.	none		0.393	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
UNC80	285175	hgsc.bcm.edu	37	2	210783352	210783352	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:210783352G>A	ENST00000439458.1	+	32	5190	c.5110G>A	c.(5110-5112)Ggg>Agg	p.G1704R	UNC80_ENST00000272845.6_Missense_Mutation_p.G1699R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1704					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCAGTGCAGCGGGAGTGTCCA	0.502																																					p.G1704R		Atlas-SNP	.											.	UNC80	280	.	0			c.G5110A						PASS	.						69.0	63.0	65.0					2																	210783352		692	1591	2283	SO:0001583	missense	285175	exon32			TGCAGCGGGAGTG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.5110G>A	2.37:g.210783352G>A	ENSP00000391088:p.Gly1704Arg	141.0	0.0	0		167.0	39.0	0.233533	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	31	5.081141	0.94050	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.29655	1.56;1.56	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.36608	0.0973	N	0.22421	0.69	0.80722	D	1	D	0.67145	0.996	P	0.57679	0.825	T	0.04991	-1.0913	10	0.21014	T	0.42	-20.4916	18.9863	0.92771	0.0:0.0:1.0:0.0	.	1704	Q8N2C7	UNC80_HUMAN	R	1704;1699	ENSP00000391088:G1704R;ENSP00000272845:G1699R	ENSP00000272845:G1699R	G	+	1	0	UNC80	210491597	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.869000	0.99810	2.502000	0.84385	0.555000	0.69702	GGG	.	.	none		0.502	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
RAB8A	4218	hgsc.bcm.edu	37	19	16222712	16222712	+	Start_Codon_SNP	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr19:16222712A>C	ENST00000300935.3	+	1	274	c.1A>C	c.(1-3)Atg>Ctg	p.M1L	RAB8A_ENST00000588105.1_3'UTR|RAB8A_ENST00000586682.1_Start_Codon_SNP_p.M1L	NM_005370.4	NP_005361.2	P61006	RAB8A_HUMAN	RAB8A, member RAS oncogene family	1					axonogenesis (GO:0007409)|cellular response to insulin stimulus (GO:0032869)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi vesicle fusion to target membrane (GO:0048210)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|vesicle docking involved in exocytosis (GO:0006904)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nonmotile primary cilium (GO:0031513)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)|recycling endosome membrane (GO:0055038)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	8						AGAGTGTAATATGGCGAAGAC	0.627																																					p.M1L		Atlas-SNP	.											.	RAB8A	19	.	0			c.A1C						PASS	.						175.0	175.0	175.0					19																	16222712		2203	4300	6503	SO:0001582	initiator_codon_variant	4218	exon1			TGTAATATGGCGA		CCDS12339.1	19p13.2-p13.1	2008-05-14	2004-01-30	2004-01-30		ENSG00000167461		"""RAB, member RAS oncogene"""	7007	protein-coding gene	gene with protein product		165040	"""mel transforming oncogene (derived from cell line NK14)"""	MEL		1886711, 8408203	Standard	NM_005370		Approved	RAB8	uc002ndn.4	P61006		ENST00000300935.3:c.1A>C	19.37:g.16222712A>C	ENSP00000300935:p.Met1Leu	41.0	0.0	0		102.0	13.0	0.127451	NM_005370	B4DEK7|P24407|Q6FHV5	Missense_Mutation	SNP	ENST00000300935.3	37	CCDS12339.1	.	.	.	.	.	.	.	.	.	.	A	31	5.088240	0.94100	.	.	ENSG00000167461	ENST00000300935	T	0.61040	0.14	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.74928	0.3781	.	.	.	0.80722	D	1	D;D	0.67145	0.996;0.992	D;D	0.77004	0.989;0.989	T	0.78590	-0.2145	9	0.66056	D	0.02	.	13.478	0.61320	1.0:0.0:0.0:0.0	.	1;1	B4DEK7;P61006	.;RAB8A_HUMAN	L	1	ENSP00000300935:M1L	ENSP00000300935:M1L	M	+	1	0	RAB8A	16083712	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.560000	0.90712	2.034000	0.60081	0.402000	0.26972	ATG	.	.	none		0.627	RAB8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460186.1	NM_005370	Missense_Mutation
VGLL3	389136	hgsc.bcm.edu	37	3	87018229	87018229	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:87018229A>C	ENST00000398399.2	-	3	811	c.448T>G	c.(448-450)Ttt>Gtt	p.F150V	VGLL3_ENST00000383698.3_Missense_Mutation_p.F150V	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		CTGGTCCAAAAGGAAGTTGGG	0.483																																					p.F150V		Atlas-SNP	.											.	VGLL3	62	.	0			c.T448G						PASS	.						85.0	86.0	86.0					3																	87018229		1910	4132	6042	SO:0001583	missense	389136	exon3			TCCAAAAGGAAGT	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.448T>G	3.37:g.87018229A>C	ENSP00000381436:p.Phe150Val	32.0	0.0	0		58.0	14.0	0.241379	NM_016206		Missense_Mutation	SNP	ENST00000398399.2	37	CCDS43110.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.4|20.4	3.991213|3.991213	0.74703|0.74703	.|.	.|.	ENSG00000206538|ENSG00000206538	ENST00000398399;ENST00000383698|ENST00000494229	T;T|.	0.50277|.	0.76;0.75|.	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	0.204155|.	0.43260|.	D|.	0.000595|.	T|T	0.68026|0.68026	0.2956|0.2956	M|M	0.74881|0.74881	2.28|2.28	0.41670|0.41670	D|D	0.989238|0.989238	B|.	0.23806|.	0.091|.	B|.	0.17098|.	0.017|.	T|T	0.69892|0.69892	-0.5022|-0.5022	10|5	0.52906|.	T|.	0.07|.	-8.6808|-8.6808	10.3235|10.3235	0.43780|0.43780	0.9261:0.0:0.0739:0.0|0.9261:0.0:0.0739:0.0	.|.	150|.	A8MV65|.	VGLL3_HUMAN|.	V|R	150|83	ENSP00000381436:F150V;ENSP00000373199:F150V|.	ENSP00000373199:F150V|.	F|L	-|-	1|2	0|0	VGLL3|VGLL3	87100919|87100919	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.414000|5.414000	0.66405|0.66405	2.252000|2.252000	0.74401|0.74401	0.459000|0.459000	0.35465|0.35465	TTT|CTT	.	.	none		0.483	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206	
SFTPD	6441	hgsc.bcm.edu	37	10	81702261	81702261	+	Splice_Site	SNP	C	C	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:81702261C>A	ENST00000372292.3	-	4	357		c.e4-1			NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D						defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			CCTGGAGGTCCTGAGCAAAAG	0.572																																					.		Atlas-SNP	.											.	SFTPD	43	.	0			c.317-1G>T						PASS	.						57.0	56.0	56.0					10																	81702261		2203	4300	6503	SO:0001630	splice_region_variant	6441	exon5			GAGGTCCTGAGCA	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.317-1G>T	10.37:g.81702261C>A		63.0	0.0	0		61.0	8.0	0.131148	NM_003019	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Splice_Site	SNP	ENST00000372292.3	37	CCDS7362.1	.	.	.	.	.	.	.	.	.	.	c	13.45	2.241591	0.39598	.	.	ENSG00000133661	ENST00000372292;ENST00000444384	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8133	0.63276	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SFTPD	81692241	1.000000	0.71417	0.938000	0.37757	0.374000	0.29953	4.668000	0.61568	2.311000	0.77944	0.457000	0.33378	.	.	.	none		0.572	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		Intron
ZFC3H1	196441	hgsc.bcm.edu	37	12	72022729	72022729	+	Silent	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:72022729A>G	ENST00000378743.3	-	20	4273	c.3915T>C	c.(3913-3915)gaT>gaC	p.D1305D		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1305					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACTGTTCCTCATCACTACTGA	0.323																																					p.D1305D		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.T3915C						PASS	.						147.0	134.0	138.0					12																	72022729		1824	4077	5901	SO:0001819	synonymous_variant	196441	exon20			TTCCTCATCACTA	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.3915T>C	12.37:g.72022729A>G		70.0	0.0	0		87.0	36.0	0.413793	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	ENST00000378743.3	37	CCDS41813.1																																																																																			.	.	none		0.323	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
SH2D4B	387694	hgsc.bcm.edu	37	10	82329986	82329986	+	Silent	SNP	T	T	C	rs192169537		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:82329986T>C	ENST00000470604.2	+	2	258	c.258T>C	c.(256-258)ccT>ccC	p.P86P	SH2D4B_ENST00000339284.2_Silent_p.P87P|SH2D4B_ENST00000313455.4_Silent_p.P38P			Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B	86										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)	13			Colorectal(32;0.229)			GAGAAGGCCCTGGTGACAAGC	0.572																																					p.P87P		Atlas-SNP	.											.	SH2D4B	44	.	0			c.T261C						PASS	.						99.0	97.0	98.0					10																	82329986		2203	4300	6503	SO:0001819	synonymous_variant	387694	exon2			AGGCCCTGGTGAC		CCDS7370.1, CCDS44449.1	10q23.1	2013-02-14			ENSG00000178217	ENSG00000178217		"""SH2 domain containing"""	31440	protein-coding gene	gene with protein product							Standard	NM_207372		Approved		uc001kck.1	Q5SQS7	OTTHUMG00000018617	ENST00000470604.2:c.258T>C	10.37:g.82329986T>C		135.0	0.0	0		127.0	22.0	0.173228	NM_207372	Q5SQS5|Q6ZVW9|Q6ZVZ3	Silent	SNP	ENST00000470604.2	37																																																																																				T|1.000;A|0.000	.	alt		0.572	SH2D4B-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_351984	
PCDH17	27253	hgsc.bcm.edu	37	13	58208119	58208119	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr13:58208119A>G	ENST00000377918.3	+	1	1465	c.1439A>G	c.(1438-1440)cAg>cGg	p.Q480R		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	480	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TACGTGCTTCAGGTGCACGAG	0.602																																					p.Q480R	Melanoma(72;952 1291 1619 12849 33676)	Atlas-SNP	.											.	PCDH17	304	.	0			c.A1439G						PASS	.						48.0	44.0	46.0					13																	58208119		2203	4300	6503	SO:0001583	missense	27253	exon1			TGCTTCAGGTGCA	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1439A>G	13.37:g.58208119A>G	ENSP00000367151:p.Gln480Arg	90.0	0.0	0		94.0	12.0	0.12766	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	37	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850826	0.71719	.	.	ENSG00000118946	ENST00000377918	T	0.51071	0.72	5.68	5.68	0.88126	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.55097	0.1899	L	0.31065	0.9	0.58432	D	0.999996	D;D	0.61697	0.988;0.99	P;D	0.64877	0.775;0.93	T	0.52155	-0.8613	9	.	.	.	.	15.9249	0.79609	1.0:0.0:0.0:0.0	.	480;480	O14917-2;O14917	.;PCD17_HUMAN	R	480	ENSP00000367151:Q480R	.	Q	+	2	0	PCDH17	57106120	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.576000	0.82467	2.170000	0.68504	0.459000	0.35465	CAG	.	.	none		0.602	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
SFTPD	6441	hgsc.bcm.edu	37	10	81702260	81702260	+	Splice_Site	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:81702260C>T	ENST00000372292.3	-	4	357	c.317G>A	c.(316-318)gGa>gAa	p.G106E		NM_003019.4	NP_003010.4	P35247	SFTPD_HUMAN	surfactant protein D	106	Collagen-like.				defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|lung alveolus development (GO:0048286)|macrophage chemotaxis (GO:0048246)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of phagocytosis (GO:0050766)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|regulation of cytokine production (GO:0001817)|respiratory gaseous exchange (GO:0007585)|surfactant homeostasis (GO:0043129)	collagen trimer (GO:0005581)|endocytic vesicle (GO:0030139)|extracellular region (GO:0005576)|lysosome (GO:0005764)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)			endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|skin(4)|urinary_tract(1)	17	Breast(12;0.000615)|Prostate(51;0.0095)|all_epithelial(25;0.027)		Epithelial(14;0.0244)|all cancers(16;0.0558)|Colorectal(32;0.109)			TCCTGGAGGTCCTGAGCAAAA	0.567																																					p.G106E		Atlas-SNP	.											.	SFTPD	43	.	0			c.G317A						PASS	.						58.0	57.0	57.0					10																	81702260		2203	4300	6503	SO:0001630	splice_region_variant	6441	exon4			GGAGGTCCTGAGC	L05485	CCDS7362.1	10q22.2-q23.1	2012-11-02	2008-08-26		ENSG00000133661	ENSG00000133661		"""Collectins"""	10803	protein-coding gene	gene with protein product		178635	"""surfactant, pulmonary-associated protein D"""	SFTP4		1898081, 1339284	Standard	NM_003019		Approved	SP-D, COLEC7	uc001kbh.3	P35247	OTTHUMG00000018590	ENST00000372292.3:c.317-1G>A	10.37:g.81702260C>T		62.0	0.0	0		61.0	8.0	0.131148	NM_003019	Q5T0M3|Q6FH08|Q86YK9|Q8TCD8|Q9UCJ2|Q9UCJ3	Missense_Mutation	SNP	ENST00000372292.3	37	CCDS7362.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951636	0.53186	.	.	ENSG00000133661	ENST00000372292;ENST00000444384	D;D	0.99353	-4.61;-5.77	5.02	4.1	0.47936	.	0.000000	0.56097	D	0.000031	D	0.98883	0.9622	H	0.96889	3.9	0.39145	D	0.96211	P	0.38711	0.643	B	0.34489	0.184	D	0.98750	1.0720	10	0.87932	D	0	.	9.683	0.40080	0.0:0.9007:0.0:0.0993	.	106	P35247	SFTPD_HUMAN	E	106;119	ENSP00000361366:G106E;ENSP00000394325:G119E	ENSP00000361366:G106E	G	-	2	0	SFTPD	81692240	1.000000	0.71417	0.948000	0.38648	0.427000	0.31564	2.235000	0.43044	1.068000	0.40764	0.457000	0.33378	GGA	.	.	none		0.567	SFTPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049011.1		Missense_Mutation
CD300LB	124599	hgsc.bcm.edu	37	17	72522004	72522004	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:72522004G>A	ENST00000392621.1	-	2	368	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	CD300LB_ENST00000314401.3_Missense_Mutation_p.R122C	NM_174892.2	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	85					cellular response to lipopolysaccharide (GO:0071222)|innate immune response (GO:0045087)|neutrophil mediated immunity (GO:0002446)|positive regulation of mast cell activation (GO:0033005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(1)	21						GTGAACGTGCGGTCTTTCTGA	0.527																																					p.R122C		Atlas-SNP	.											CD300LB,lower_third,carcinoma,0,1	CD300LB	38	1	0			c.C364T						PASS	.						256.0	225.0	235.0					17																	72522004		2203	4300	6503	SO:0001583	missense	124599	exon2			ACGTGCGGTCTTT	AF427618	CCDS11700.1, CCDS11700.2	17q25.1	2013-01-11	2006-03-29		ENSG00000178789	ENSG00000178789		"""Immunoglobulin superfamily / V-set domain containing"""	30811	protein-coding gene	gene with protein product	"""triggering receptor expressed on myeloid cells 5"""	610705	"""CD300 antigen like family member B"""			12975309	Standard	NM_174892		Approved	TREM5, CLM7	uc002jkx.2	A8K4G0	OTTHUMG00000067606	ENST00000392621.1:c.364C>T	17.37:g.72522004G>A	ENSP00000376397:p.Arg122Cys	248.0	0.0	0		280.0	64.0	0.228571	NM_174892	Q1EG73|Q8IX40|Q8N6D1	Missense_Mutation	SNP	ENST00000392621.1	37	CCDS11700.1	.	.	.	.	.	.	.	.	.	.	G	6.311	0.425440	0.11987	.	.	ENSG00000178789	ENST00000392621;ENST00000314401	T	0.04502	3.61	5.17	2.03	0.26663	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.216860	0.05978	N	0.643733	T	0.07324	0.0185	M	0.73319	2.225	0.09310	N	1	B;P	0.35242	0.077;0.492	B;B	0.23716	0.019;0.048	T	0.40961	-0.9535	10	0.38643	T	0.18	-16.1436	8.9441	0.35747	0.1487:0.0:0.7281:0.1232	.	122;85	B4DQ71;A8K4G0	.;CLM7_HUMAN	C	85;122	ENSP00000317337:R122C	ENSP00000317337:R122C	R	-	1	0	CD300LB	70033599	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.013000	0.13310	0.022000	0.15160	-1.119000	0.02030	CGC	.	.	none		0.527	CD300LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145082.2	NM_174892	
GLI2	2736	hgsc.bcm.edu	37	2	121747495	121747495	+	Missense_Mutation	SNP	G	G	C	rs570401582		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:121747495G>C	ENST00000452319.1	+	14	4065	c.4005G>C	c.(4003-4005)gaG>gaC	p.E1335D	GLI2_ENST00000361492.4_Missense_Mutation_p.E1335D|GLI2_ENST00000314490.11_Intron					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				TGAGCCAGGAGGGCTACCACC	0.657																																					p.E1335D		Atlas-SNP	.											.	GLI2	187	.	0			c.G4005C						PASS	.						17.0	18.0	18.0					2																	121747495		2200	4295	6495	SO:0001583	missense	2736	exon13			CCAGGAGGGCTAC		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4005G>C	2.37:g.121747495G>C	ENSP00000390436:p.Glu1335Asp	86.0	0.0	0		79.0	19.0	0.240506	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	6.282	0.420101	0.11928	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.14516	2.5;2.5	4.55	-0.643	0.11482	.	0.579611	0.18288	N	0.145806	T	0.06508	0.0167	N	0.25647	0.755	0.09310	N	0.999998	B;B	0.09022	0.0;0.002	B;B	0.06405	0.001;0.002	T	0.32134	-0.9918	9	.	.	.	.	1.8185	0.03105	0.2117:0.2668:0.3922:0.1293	.	1335;990	P10070;P10070-2	GLI2_HUMAN;.	D	1335	ENSP00000390436:E1335D;ENSP00000354586:E1335D	.	E	+	3	2	GLI2	121463965	0.923000	0.31300	0.210000	0.23637	0.895000	0.52256	0.437000	0.21543	-0.051000	0.13334	0.455000	0.32223	GAG	.	.	none		0.657	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
GBP3	2635	hgsc.bcm.edu	37	1	89476655	89476655	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:89476655A>G	ENST00000370481.4	-	8	1514	c.1294T>C	c.(1294-1296)Tgt>Cgt	p.C432R		NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	0					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		ATAAAGAGACAATAGCCCCCT	0.423																																					p.C432R		Atlas-SNP	.											.	GBP3	53	.	0			c.T1294C						PASS	.						202.0	169.0	181.0					1																	89476655		2191	3988	6179	SO:0001583	missense	2635	exon8			AGAGACAATAGCC	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.1294T>C	1.37:g.89476655A>G	ENSP00000359512:p.Cys432Arg	339.0	0.0	0		333.0	64.0	0.192192	NM_018284	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000370481.4	37	CCDS717.2	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.185169	0.00305	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000235878	T	0.01821	4.62	3.79	-1.98	0.07480	Guanylate-binding protein, C-terminal (3);	0.843353	0.10841	N	0.628203	T	0.00109	0.0003	N	0.00258	-1.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31223	-0.9951	10	0.02654	T	1	.	5.3138	0.15845	0.2643:0.0:0.5065:0.2292	.	298;432	F6X827;Q9H0R5	.;GBP3_HUMAN	R	400;432;432	ENSP00000359512:C432R	ENSP00000235878:C432R	C	-	1	0	GBP3	89249243	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.521000	0.02239	-0.900000	0.03896	-2.405000	0.00223	TGT	.	.	none		0.423	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284	
ZG16	653808	hgsc.bcm.edu	37	16	29791721	29791721	+	Missense_Mutation	SNP	G	G	C	rs235638	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:29791721G>C	ENST00000400752.4	+	4	559	c.485G>C	c.(484-486)aGt>aCt	p.S162T	AC009133.21_ENST00000572964.1_lincRNA	NM_152338.3	NP_689551	O60844	ZG16_HUMAN	zymogen granule protein 16	162			S -> T (in dbSNP:rs235638).		protein transport (GO:0015031)	extracellular matrix (GO:0031012)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	carbohydrate binding (GO:0030246)			endometrium(1)	1						GTTTACCCCAGTAGCTGCAGC	0.552													G|||	4442	0.886981	0.6407	0.9625	5008	,	,		18876	0.9405		0.998	False		,,,				2504	0.9969				p.S162T		Atlas-SNP	.											.	ZG16	14	.	0			c.G485C						PASS	.	G	THR/SER	920,464		313,294,85	75.0	66.0	69.0		485	2.2	0.4	16	dbSNP_79	69	3178,4		1587,4,0	yes	missense	ZG16	NM_152338.3	58	1900,298,85	CC,CG,GG		0.1257,33.526,10.2497	benign	162/168	29791721	4098,468	692	1591	2283	SO:0001583	missense	653808	exon4			ACCCCAGTAGCTG	AK125559	CCDS54000.1	16p11.2	2012-12-07	2012-12-07	2009-03-11	ENSG00000174992	ENSG00000174992			30961	protein-coding gene	gene with protein product			"""jacalin-like lectin domain containing"", ""zymogen granule protein 16 homolog (rat)"""	JCLN		12477932	Standard	NM_152338		Approved	hZG16, JCLN1, ZG16A	uc002dtr.4	O60844		ENST00000400752.4:c.485G>C	16.37:g.29791721G>C	ENSP00000383563:p.Ser162Thr	0.0	0.0	.		7.0	7.0	1	NM_152338	B2R4Z3|B9EK72	Missense_Mutation	SNP	ENST00000400752.4	37	CCDS54000.1	1973	0.9033882783882784	323	0.6565040650406504	348	0.9613259668508287	545	0.9527972027972028	757	0.9986807387862797	G	11.98	1.799397	0.31869	0.66474	0.998743	ENSG00000174992	ENST00000400752	T	0.24151	1.87	5.33	2.15	0.27550	.	0.774363	0.12322	N	0.479207	T	0.00012	0.0000	.	.	.	0.53688	P	2.8999999999945736E-5	.	.	.	.	.	.	T	0.43065	-0.9414	6	0.13470	T	0.59	.	7.4081	0.27001	0.0884:0.322:0.5896:0.0	rs235638;rs17856826;rs52829584;rs235638	.	.	.	T	162	ENSP00000383563:S162T	ENSP00000383563:S162T	S	+	2	0	ZG16	29699222	0.897000	0.30589	0.429000	0.26710	0.859000	0.49053	1.196000	0.32198	0.810000	0.34279	0.655000	0.94253	AGT	G|0.120;C|0.880	0.880	strong		0.552	ZG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435523.2	NM_152338	
ZNF181	339318	hgsc.bcm.edu	37	19	35232469	35232469	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr19:35232469C>T	ENST00000492450.1	+	4	1272	c.1183C>T	c.(1183-1185)Cat>Tat	p.H395Y	ZNF181_ENST00000392232.3_Missense_Mutation_p.H439Y|ZNF181_ENST00000459757.2_Missense_Mutation_p.H394Y			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			CCTTACTCGACATCAAAGAAT	0.388																																					p.H395Y		Atlas-SNP	.											.	ZNF181	65	.	0			c.C1183T						PASS	.						72.0	67.0	68.0					19																	35232469		2203	4298	6501	SO:0001583	missense	339318	exon4			ACTCGACATCAAA	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1183C>T	19.37:g.35232469C>T	ENSP00000420727:p.His395Tyr	137.0	0.0	0		122.0	19.0	0.155738	NM_001029997	B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	37	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285590	0.59867	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	D;D;D	0.86769	-2.17;-2.17;-2.17	2.84	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.95098	0.8412	H	0.97611	4.04	0.34829	D	0.739442	D;P	0.71674	0.998;0.95	D;D	0.66847	0.944;0.947	D	0.97572	1.0105	9	0.87932	D	0	.	11.88	0.52568	0.0:1.0:0.0:0.0	.	394;395	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	Y	439;394;395;394	ENSP00000376065:H439Y;ENSP00000420727:H395Y;ENSP00000419435:H394Y	ENSP00000376065:H439Y	H	+	1	0	ZNF181	39924309	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.481000	0.73608	1.876000	0.54355	0.561000	0.74099	CAT	.	.	none		0.388	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45970774	45970774	+	Missense_Mutation	SNP	G	G	A	rs76536096|rs67692969|rs71199610	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr21:45970774G>A	ENST00000391621.1	-	1	614	c.568C>T	c.(568-570)Cct>Tct	p.P190S	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	190	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						CAGCAGACAGGCTTGCAGCAG	0.607																																					p.P190S		Atlas-SNP	.											.	KRTAP10-2	21	.	0			c.C568T						PASS	.						110.0	112.0	111.0					21																	45970774		2192	4279	6471	SO:0001583	missense	386679	exon1			AGACAGGCTTGCA	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.568C>T	21.37:g.45970774G>A	ENSP00000375479:p.Pro190Ser	94.0	0.0	0		119.0	12.0	0.10084	NM_198693	Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	9.523	1.108901	0.20714	.	.	ENSG00000205445	ENST00000391621	T	0.01705	4.68	3.28	0.222	0.15288	.	.	.	.	.	T	0.02083	0.0065	L	0.49455	1.56	0.09310	N	1	B	0.26672	0.156	B	0.24394	0.053	T	0.42310	-0.9459	9	0.62326	D	0.03	.	4.9369	0.13944	0.2108:0.1755:0.6137:0.0	.	190	P60368	KR102_HUMAN	S	190	ENSP00000375479:P190S	ENSP00000375479:P190S	P	-	1	0	KRTAP10-2	44795202	0.105000	0.21958	0.000000	0.03702	0.002000	0.02628	1.284000	0.33249	-0.177000	0.10690	0.462000	0.41574	CCT	G|0.917;A|0.083	0.083	strong		0.607	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
NFASC	23114	hgsc.bcm.edu	37	1	204943936	204943936	+	Missense_Mutation	SNP	C	C	T	rs149731085		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:204943936C>T	ENST00000401399.1	+	13	1742	c.1543C>T	c.(1543-1545)Cgc>Tgc	p.R515C	NFASC_ENST00000367170.4_Missense_Mutation_p.R515C|NFASC_ENST00000367169.4_Missense_Mutation_p.R515C|NFASC_ENST00000339876.6_Missense_Mutation_p.R515C|NFASC_ENST00000367171.4_Missense_Mutation_p.R515C|NFASC_ENST00000338515.6_Missense_Mutation_p.R515C|NFASC_ENST00000404907.1_Missense_Mutation_p.R526C|NFASC_ENST00000539706.1_Missense_Mutation_p.R526C|NFASC_ENST00000338586.6_Missense_Mutation_p.R515C|NFASC_ENST00000404076.1_Missense_Mutation_p.R509C|NFASC_ENST00000513543.1_Missense_Mutation_p.R526C|NFASC_ENST00000367172.4_Missense_Mutation_p.R515C|NFASC_ENST00000403080.1_Missense_Mutation_p.R515C|NFASC_ENST00000360049.4_Missense_Mutation_p.R526C			O94856	NFASC_HUMAN	neurofascin	515	Ig-like C2-type 5.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AAACCAAGTCCGCCTGGAGGT	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		21343	0.0		0.001	False		,,,				2504	0.0				p.R526C		Atlas-SNP	.											.	NFASC	396	.	0			c.C1576T						PASS	.	C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	99.0	92.0	95.0		1543,1543,1576,1576,1525,1576	5.8	1.0	1	dbSNP_134	95	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense,missense,missense,missense	NFASC	NM_001005388.2,NM_001005389.1,NM_001160331.1,NM_001160332.1,NM_001160333.1,NM_015090.3	180,180,180,180,180,180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	515/1241,515/620,526/1190,526/1175,509/614,526/1170	204943936	2,13004	2203	4300	6503	SO:0001583	missense	23114	exon14			CAAGTCCGCCTGG	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1543C>T	1.37:g.204943936C>T	ENSP00000385637:p.Arg515Cys	131.0	0.0	0		116.0	30.0	0.258621	NM_015090	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	37	CCDS53460.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	34	5.399757	0.96030	0.0	2.33E-4	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3;-0.3	5.8	5.8	0.92144	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.237674	0.29822	N	0.011105	T	0.80105	0.4562	L	0.61387	1.9	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.962;0.999;1.0;1.0;0.998;0.995	D;P;P;D;P;P;P	0.66497	0.943;0.501;0.905;0.944;0.648;0.814;0.804	T	0.78816	-0.2055	10	0.49607	T	0.09	.	19.7118	0.96099	0.0:1.0:0.0:0.0	.	515;526;526;515;515;526;515	O94856;O94856-11;O94856-8;F8W791;O94856-9;O94856-3;O94856-2	NFASC_HUMAN;.;.;.;.;.;.	C	515;515;515;515;515;515;526;526;526;515;515;509;515;526;526;502	ENSP00000356140:R515C;ENSP00000356139:R515C;ENSP00000356138:R515C;ENSP00000342128:R515C;ENSP00000344786:R515C;ENSP00000343509:R515C;ENSP00000438614:R526C;ENSP00000353154:R526C;ENSP00000356137:R515C;ENSP00000384875:R515C;ENSP00000385676:R509C;ENSP00000385637:R515C;ENSP00000384061:R526C;ENSP00000425908:R526C;ENSP00000415031:R502C	ENSP00000295776:R526C	R	+	1	0	NFASC	203210559	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.975000	0.70475	2.764000	0.94973	0.485000	0.47835	CGC	C|1.000;T|0.000	0.000	strong		0.512	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
TMPRSS2	7113	hgsc.bcm.edu	37	21	42851153	42851153	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr21:42851153A>T	ENST00000332149.5	-	7	763	c.629T>A	c.(628-630)aTg>aAg	p.M210K	TMPRSS2_ENST00000398585.3_Missense_Mutation_p.M247K|TMPRSS2_ENST00000458356.1_Missense_Mutation_p.M210K	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	210	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GTTCAGTTTCATAAAGCTGGT	0.353			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																p.M247K		Atlas-SNP	.		Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	.	TMPRSS2	148	.	0			c.T740A						PASS	.						146.0	145.0	146.0					21																	42851153		2203	4300	6503	SO:0001583	missense	7113	exon7			AGTTTCATAAAGC	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.629T>A	21.37:g.42851153A>T	ENSP00000330330:p.Met210Lys	102.0	0.0	0		88.0	4.0	0.0454545	NM_001135099	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	ENST00000332149.5	37	CCDS33564.1	.	.	.	.	.	.	.	.	.	.	A	13.10	2.137229	0.37728	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356;ENST00000454499;ENST00000424093	T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21	5.43	4.25	0.50352	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.065677	0.64402	D	0.000007	T	0.62527	0.2435	M	0.72479	2.2	0.39156	D	0.962314	D;P	0.55800	0.973;0.85	P;P	0.54174	0.735;0.744	T	0.62324	-0.6878	10	0.12766	T	0.61	.	9.4178	0.38532	0.8205:0.1795:0.0:0.0	.	247;210	F8WES1;O15393	.;TMPS2_HUMAN	K	210;247;210;210;170	ENSP00000330330:M210K;ENSP00000381588:M247K;ENSP00000391216:M210K;ENSP00000389006:M210K;ENSP00000397846:M170K	ENSP00000330330:M210K	M	-	2	0	TMPRSS2	41773023	1.000000	0.71417	0.597000	0.28824	0.032000	0.12392	4.796000	0.62496	0.872000	0.35775	0.448000	0.29417	ATG	.	.	none		0.353	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195189.1		
LTB	4050	hgsc.bcm.edu	37	6	31549632	31549632	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:31549632G>A	ENST00000429299.2	-	2	174	c.167C>T	c.(166-168)aCg>aTg	p.T56M	LTB_ENST00000446745.2_Intron|LTB_ENST00000483972.1_Intron	NM_002341.1	NP_002332.1	Q06643	TNFC_HUMAN	lymphotoxin beta (TNF superfamily, member 3)	56					cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|signal transduction (GO:0007165)|skin development (GO:0043588)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9						GGCCGTCTCCGTTACCTGGTT	0.627																																					p.T56M		Atlas-SNP	.											.	LTB	19	.	0			c.C167T						PASS	.						80.0	89.0	86.0					6																	31549632		1509	2709	4218	SO:0001583	missense	4050	exon2			GTCTCCGTTACCT	L11015	CCDS4703.1, CCDS4704.1	6p21.3	2013-05-22			ENSG00000227507	ENSG00000227507		"""Tumor necrosis factor (ligand) superfamily"""	6711	protein-coding gene	gene with protein product		600978		TNFC		7916655, 1714477	Standard	NM_002341		Approved	p33, TNFSF3	uc003nuk.3	Q06643	OTTHUMG00000031136	ENST00000429299.2:c.167C>T	6.37:g.31549632G>A	ENSP00000410481:p.Thr56Met	99.0	0.0	0		82.0	13.0	0.158537	NM_002341	P78370|Q52LU8|Q99761	Missense_Mutation	SNP	ENST00000429299.2	37	CCDS4703.1	.	.	.	.	.	.	.	.	.	.	G	11.08	1.534745	0.27475	.	.	ENSG00000227507	ENST00000429299	T	0.21932	1.98	5.45	-0.999	0.10208	.	1.156080	0.06349	N	0.709538	T	0.03871	0.0109	N	0.22421	0.69	0.09310	N	0.999997	B	0.13145	0.007	B	0.08055	0.003	T	0.42732	-0.9434	10	0.44086	T	0.13	-0.0223	3.3408	0.07118	0.3298:0.0:0.3705:0.2997	.	56	Q06643	TNFC_HUMAN	M	56	ENSP00000410481:T56M	ENSP00000410481:T56M	T	-	2	0	LTB	31657611	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.359000	0.20233	-0.203000	0.10251	-0.742000	0.03525	ACG	.	.	none		0.627	LTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076239.3		
GNAT3	346562	hgsc.bcm.edu	37	7	80117974	80117974	+	Silent	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:80117974A>C	ENST00000398291.3	-	3	273	c.180T>G	c.(178-180)ggT>ggG	p.G60G	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	60					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						GCTCACTGTAACCATTCTTAT	0.343																																					p.G60G		Atlas-SNP	.											.	GNAT3	65	.	0			c.T180G						PASS	.						119.0	100.0	106.0					7																	80117974		1847	4095	5942	SO:0001819	synonymous_variant	346562	exon3			ACTGTAACCATTC		CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.180T>G	7.37:g.80117974A>C		113.0	0.0	0		143.0	26.0	0.181818	NM_001102386	A4D1B2|A4D1B3|B9EJG5	Silent	SNP	ENST00000398291.3	37	CCDS47625.1																																																																																			.	.	none		0.343	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339909.3	XM_294370	
PCDH7	5099	hgsc.bcm.edu	37	4	30723952	30723952	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:30723952A>C	ENST00000361762.2	+	1	1916	c.908A>C	c.(907-909)gAc>gCc	p.D303A	PCDH7_ENST00000543491.1_Missense_Mutation_p.D303A	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	303	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GACGTGAACGACAACAGCCCC	0.682																																					p.D303A		Atlas-SNP	.											.	PCDH7	215	.	0			c.A908C						PASS	.						11.0	14.0	13.0					4																	30723952		2196	4284	6480	SO:0001583	missense	5099	exon1			TGAACGACAACAG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.908A>C	4.37:g.30723952A>C	ENSP00000355243:p.Asp303Ala	78.0	0.0	0		64.0	6.0	0.09375	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.270608	0.80469	.	.	ENSG00000169851	ENST00000361762;ENST00000543491	T;T	0.71579	-0.58;-0.58	5.18	5.18	0.71444	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.88250	0.6386	H	0.94964	3.605	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.91602	0.5296	9	0.87932	D	0	.	15.0142	0.71570	1.0:0.0:0.0:0.0	.	303;303	F5GWJ1;O60245	.;PCDH7_HUMAN	A	303	ENSP00000355243:D303A;ENSP00000441802:D303A	ENSP00000355243:D303A	D	+	2	0	PCDH7	30333050	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.322000	0.96357	1.934000	0.56057	0.459000	0.35465	GAC	.	.	none		0.682	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
MUC12	10071	hgsc.bcm.edu	37	7	100648117	100648117	+	Missense_Mutation	SNP	C	C	G	rs11766125	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:100648117C>G	ENST00000379442.3	+	5	14702	c.14702C>G	c.(14701-14703)aCa>aGa	p.T4901R	MUC12_ENST00000536621.1_Missense_Mutation_p.T4758R			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4901	Ser-rich.			T -> R (in Ref. 2; AAD55678). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.T4758R(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GCCAGCATGACAAGCTCCAGC	0.537													-|||	2353	0.469848	0.3449	0.366	5008	,	,		22309	0.6111		0.5129	False		,,,				2504	0.5225				p.T4758R		Atlas-SNP	.											MUC12,NS,carcinoma,0,1	MUC12	140	1	1	Substitution - Missense(1)	stomach(1)	c.C14273G						scavenged	.	C	ARG/THR	560,824		100,360,232	177.0	162.0	166.0		14273	-1.0	0.0	7	dbSNP_120	166	1634,1548		435,764,392	yes	missense	MUC12	NM_001164462.1	71	535,1124,624	GG,GC,CC		48.6486,40.4624,48.0508		4758/5336	100648117	2194,2372	692	1591	2283	SO:0001583	missense	10071	exon2			GCATGACAAGCTC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.14702C>G	7.37:g.100648117C>G	ENSP00000368755:p.Thr4901Arg	4.0	1.0	0.25		11.0	4.0	0.363636	NM_001164462	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	ENST00000379442.3	37		1060	0.48534798534798534	193	0.39227642276422764	143	0.39502762430939226	332	0.5804195804195804	392	0.5171503957783641	c	0.012	-1.654591	0.00779	0.404624	0.513514	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.09538	2.97;2.97	0.49	-0.979	0.10276	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.36841	-0.9731	5	0.19147	T	0.46	.	.	.	.	rs11766125;rs52795737;rs11766125	.	.	.	R	4901;4758	ENSP00000368755:T4901R;ENSP00000441929:T4758R	ENSP00000368755:T4901R	T	+	2	0	MUC12	100434837	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.538000	0.02204	-1.413000	0.02027	-1.296000	0.01341	ACA	C|0.499;G|0.501	0.501	strong		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347234.1	XM_379904	
GLYR1	84656	hgsc.bcm.edu	37	16	4882161	4882161	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:4882161C>T	ENST00000321919.9	-	5	432	c.356G>A	c.(355-357)aGg>aAg	p.R119K	GLYR1_ENST00000436648.5_Intron|GLYR1_ENST00000586901.1_5'UTR|GLYR1_ENST00000591451.1_Missense_Mutation_p.R119K|GLYR1_ENST00000381983.3_Missense_Mutation_p.R119K	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	119					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						TGAGTTTGGCCTACTTCTCTC	0.433																																					p.R119K		Atlas-SNP	.											.	GLYR1	49	.	0			c.G356A						PASS	.						177.0	156.0	163.0					16																	4882161		2197	4300	6497	SO:0001583	missense	84656	exon5			TTTGGCCTACTTC	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.356G>A	16.37:g.4882161C>T	ENSP00000322716:p.Arg119Lys	257.0	0.0	0		255.0	43.0	0.168627	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	37	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651816	0.29336	.	.	ENSG00000140632	ENST00000321919;ENST00000381983	T;T	0.61742	0.08;0.08	5.29	4.32	0.51571	.	0.300170	0.38326	N	0.001739	T	0.33673	0.0871	N	0.08118	0	0.28988	N	0.888228	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.13045	-1.0524	10	0.37606	T	0.19	-24.4605	8.8028	0.34918	0.0:0.8427:0.0:0.1573	.	119;119;119	Q49A26-3;Q49A26-2;Q49A26	.;.;GLYR1_HUMAN	K	119	ENSP00000322716:R119K;ENSP00000371413:R119K	ENSP00000322716:R119K	R	-	2	0	GLYR1	4822162	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.203000	0.42752	2.634000	0.89283	0.650000	0.86243	AGG	.	.	none		0.433	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
NRG3	10718	hgsc.bcm.edu	37	10	84498369	84498369	+	Silent	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:84498369A>G	ENST00000404547.1	+	3	990	c.990A>G	c.(988-990)caA>caG	p.Q330Q	NRG3_ENST00000404576.2_Silent_p.Q134Q|NRG3_ENST00000556918.1_Silent_p.Q160Q|NRG3_ENST00000372142.2_Silent_p.Q109Q|NRG3_ENST00000372141.2_Silent_p.Q330Q			P56975	NRG3_HUMAN	neuregulin 3	330					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		GTTGTGATCAATTTCTGCCGA	0.398																																					p.Q330Q		Atlas-SNP	.											.	NRG3	301	.	0			c.A990G						PASS	.						161.0	142.0	149.0					10																	84498369		2203	4300	6503	SO:0001819	synonymous_variant	10718	exon3			TGATCAATTTCTG	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.990A>G	10.37:g.84498369A>G		191.0	0.0	0		213.0	40.0	0.187793	NM_001165972	A4D7U1|Q0PEH2|Q5VYH3	Silent	SNP	ENST00000404547.1	37	CCDS31233.1																																																																																			.	.	none		0.398	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
SEL1L3	23231	hgsc.bcm.edu	37	4	25783964	25783964	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:25783964T>A	ENST00000399878.3	-	15	2479	c.2357A>T	c.(2356-2358)tAc>tTc	p.Y786F	SEL1L3_ENST00000264868.5_Missense_Mutation_p.Y751F|SEL1L3_ENST00000502949.1_Missense_Mutation_p.Y633F	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	786						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						TTTTAACCAGTACTTTGCTGC	0.433																																					p.Y786F		Atlas-SNP	.											SEL1L3,NS,carcinoma,+1,2	SEL1L3	62	2	0			c.A2357T						scavenged	.						207.0	190.0	195.0					4																	25783964		1870	4113	5983	SO:0001583	missense	23231	exon15			AACCAGTACTTTG	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2357A>T	4.37:g.25783964T>A	ENSP00000382767:p.Tyr786Phe	184.0	1.0	0.00543478		175.0	45.0	0.257143	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	37	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.316857	0.81469	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.55930	0.49;0.49;0.49	5.66	5.66	0.87406	Tetratricopeptide-like helical (1);	0.414434	0.25291	N	0.031738	T	0.60573	0.2279	L	0.27053	0.805	0.43103	D	0.99479	P;D	0.67145	0.924;0.996	P;D	0.67725	0.652;0.953	T	0.65274	-0.6208	10	0.72032	D	0.01	-18.4383	15.9017	0.79384	0.0:0.0:0.0:1.0	.	193;786	B4DTH5;Q68CR1	.;SE1L3_HUMAN	F	786;751;633	ENSP00000382767:Y786F;ENSP00000264868:Y751F;ENSP00000425438:Y633F	ENSP00000264868:Y751F	Y	-	2	0	SEL1L3	25393062	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.721000	0.61951	2.153000	0.67306	0.460000	0.39030	TAC	.	.	none		0.433	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
SOCS3	9021	hgsc.bcm.edu	37	17	76354959	76354959	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:76354959C>T	ENST00000330871.2	-	2	633	c.218G>A	c.(217-219)aGc>aAc	p.S73N	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	73	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			CTGGTCCGAGCTGTCGCGGAT	0.647																																					p.S73N		Atlas-SNP	.											.	SOCS3	16	.	0			c.G218A						PASS	.						31.0	28.0	29.0					17																	76354959		2203	4300	6503	SO:0001583	missense	9021	exon2			TCCGAGCTGTCGC	AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.218G>A	17.37:g.76354959C>T	ENSP00000330341:p.Ser73Asn	62.0	0.0	0		84.0	20.0	0.238095	NM_003955	O14509	Missense_Mutation	SNP	ENST00000330871.2	37	CCDS11756.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.046512	0.75846	.	.	ENSG00000184557	ENST00000330871	D	0.95069	-3.6	4.13	4.13	0.48395	SH2 motif (4);	0.200591	0.51477	D	0.000091	D	0.98140	0.9386	H	0.96208	3.785	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99847	1.1067	10	0.87932	D	0	-16.133	16.3864	0.83505	0.0:1.0:0.0:0.0	.	73	O14543	SOCS3_HUMAN	N	73	ENSP00000330341:S73N	ENSP00000330341:S73N	S	-	2	0	SOCS3	73866554	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	3.837000	0.55820	1.845000	0.53610	0.313000	0.20887	AGC	.	.	none		0.647	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437300.1		
VCAN	1462	hgsc.bcm.edu	37	5	82816658	82816658	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr5:82816658A>C	ENST00000265077.3	+	7	3098	c.2533A>C	c.(2533-2535)Agt>Cgt	p.S845R	VCAN_ENST00000342785.4_Missense_Mutation_p.S845R|VCAN_ENST00000512590.2_Missense_Mutation_p.S797R|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	845	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AGACATCCCAAGTTTCACTGA	0.428																																					p.S845R		Atlas-SNP	.											.	VCAN	498	.	0			c.A2533C						PASS	.						105.0	105.0	105.0					5																	82816658		2203	4300	6503	SO:0001583	missense	1462	exon7			ATCCCAAGTTTCA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2533A>C	5.37:g.82816658A>C	ENSP00000265077:p.Ser845Arg	63.0	0.0	0		84.0	22.0	0.261905	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	A	2.468	-0.322533	0.05350	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.24538	1.85;1.85;1.85	5.76	-2.5	0.06384	.	0.320753	0.31589	N	0.007394	T	0.17023	0.0409	L	0.48362	1.52	0.20926	N	0.999821	B;B	0.12630	0.005;0.006	B;B	0.12156	0.007;0.006	T	0.15037	-1.0451	10	0.44086	T	0.13	.	6.2271	0.20714	0.4327:0.1508:0.4164:0.0	.	845;845	P13611-3;P13611	.;CSPG2_HUMAN	R	845;845;797	ENSP00000265077:S845R;ENSP00000342768:S845R;ENSP00000425959:S797R	ENSP00000265077:S845R	S	+	1	0	VCAN	82852414	0.073000	0.21202	0.880000	0.34516	0.109000	0.19521	0.804000	0.27098	-0.051000	0.13334	0.528000	0.53228	AGT	.	.	none		0.428	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
HDDC2	51020	hgsc.bcm.edu	37	6	125621684	125621684	+	Splice_Site	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:125621684C>T	ENST00000398153.2	-	2	248	c.206G>A	c.(205-207)cGa>cAa	p.R69Q	HDDC2_ENST00000608284.1_Splice_Site_p.R69Q|HDDC2_ENST00000368377.4_Splice_Site_p.R69Q|HDDC2_ENST00000608295.1_Splice_Site_p.R69Q	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	69	HD.			R -> P (in Ref. 2; AAD34125). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		CTCAGCTTACCGGTCTTTGTT	0.468																																					p.R69Q		Atlas-SNP	.											.	HDDC2	21	.	0			c.G206A						PASS	.						87.0	93.0	91.0					6																	125621684		1978	4164	6142	SO:0001630	splice_region_variant	51020	exon2			GCTTACCGGTCTT	AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.206+1G>A	6.37:g.125621684C>T		193.0	0.0	0		186.0	40.0	0.215054	NM_016063	Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	ENST00000398153.2	37	CCDS43503.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402058	0.83120	.	.	ENSG00000111906	ENST00000318787;ENST00000398153;ENST00000368377	T;T;T	0.53857	1.01;0.6;1.01	5.53	5.53	0.82687	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.045026	0.85682	D	0.000000	T	0.63640	0.2528	M	0.87682	2.9	0.42936	D	0.994335	D	0.62365	0.991	P	0.56612	0.802	T	0.63659	-0.6587	10	0.19147	T	0.46	.	18.2254	0.89915	0.0:1.0:0.0:0.0	.	69	Q7Z4H3	HDDC2_HUMAN	Q	69	ENSP00000316242:R69Q;ENSP00000381220:R69Q;ENSP00000357361:R69Q	ENSP00000316242:R69Q	R	-	2	0	HDDC2	125663383	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	5.636000	0.67848	2.593000	0.87608	0.655000	0.94253	CGG;CGA;CGA	.	.	none		0.468	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472493.1	NM_016063	Missense_Mutation
MPZL1	9019	hgsc.bcm.edu	37	1	167741720	167741720	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:167741720A>G	ENST00000359523.2	+	3	669	c.467A>G	c.(466-468)gAa>gGa	p.E156G	MPZL1_ENST00000474859.1_Missense_Mutation_p.E156G|MPZL1_ENST00000392121.3_Intron	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1	156					cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					TATGTCGTAGAAAAAGGTACT	0.408																																					p.E156G		Atlas-SNP	.											.	MPZL1	25	.	0			c.A467G						PASS	.						83.0	74.0	77.0					1																	167741720		2203	4300	6503	SO:0001583	missense	9019	exon3			TCGTAGAAAAAGG	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.467A>G	1.37:g.167741720A>G	ENSP00000352513:p.Glu156Gly	160.0	0.0	0		186.0	30.0	0.16129	NM_024569	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	Missense_Mutation	SNP	ENST00000359523.2	37	CCDS1264.1	.	.	.	.	.	.	.	.	.	.	A	19.55	3.848702	0.71603	.	.	ENSG00000197965	ENST00000359523;ENST00000474859;ENST00000367853	D;D;D	0.97850	-4.15;-4.57;-4.55	4.81	4.81	0.61882	.	0.224105	0.45867	D	0.000339	D	0.95236	0.8455	L	0.32530	0.975	0.35992	D	0.836794	D;P	0.53462	0.96;0.651	P;B	0.51229	0.663;0.273	D	0.94779	0.7952	9	0.34782	T	0.22	.	15.0743	0.72066	1.0:0.0:0.0:0.0	.	156;156	O95297-3;O95297	.;MPZL1_HUMAN	G	156;156;130	ENSP00000352513:E156G;ENSP00000420455:E156G;ENSP00000356827:E130G	ENSP00000352513:E156G	E	+	2	0	MPZL1	166008344	1.000000	0.71417	0.995000	0.50966	0.910000	0.53928	2.674000	0.46867	2.116000	0.64780	0.455000	0.32223	GAA	.	.	none		0.408	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083655.2	NM_024569	
NOX4	50507	hgsc.bcm.edu	37	11	89182653	89182653	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:89182653T>C	ENST00000263317.4	-	4	542	c.304A>G	c.(304-306)Aga>Gga	p.R102G	NOX4_ENST00000535633.1_Missense_Mutation_p.R78G|NOX4_ENST00000413594.2_Missense_Mutation_p.R123G|NOX4_ENST00000343727.5_Missense_Mutation_p.R78G|NOX4_ENST00000527956.1_Missense_Mutation_p.R78G|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000532825.1_Missense_Mutation_p.R78G|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000424319.1_Missense_Mutation_p.R78G|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000528341.1_Missense_Mutation_p.R77G|NOX4_ENST00000542487.1_Missense_Mutation_p.R78G|NOX4_ENST00000525196.1_Missense_Mutation_p.R102G|NOX4_ENST00000534731.1_Missense_Mutation_p.R102G			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	102	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TGGAATGTTCTGCTTTTATCC	0.299																																					p.R102G		Atlas-SNP	.											.	NOX4	101	.	0			c.A304G						PASS	.						88.0	85.0	86.0					11																	89182653		2201	4295	6496	SO:0001583	missense	50507	exon4			ATGTTCTGCTTTT	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.304A>G	11.37:g.89182653T>C	ENSP00000263317:p.Arg102Gly	140.0	0.0	0		120.0	28.0	0.233333	NM_001143836	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.701251	0.48307	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000528341;ENST00000413594	D;D;D;D;D;D;D;D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76;-2.76;-2.76;-2.76;-2.76;-2.76;-2.76;-2.76	5.42	4.22	0.49857	Flavoprotein transmembrane component (1);	0.105540	0.64402	D	0.000010	D	0.88321	0.6405	L	0.47716	1.5	0.29673	N	0.842284	B;P;B;B;B	0.43287	0.154;0.802;0.049;0.077;0.154	B;P;B;B;B	0.45577	0.102;0.486;0.025;0.259;0.175	D	0.84793	0.0780	9	.	.	.	-8.7869	11.2298	0.48905	0.0:0.0:0.1532:0.8468	.	78;77;102;102;102	E9PMY6;E9PPP2;E9PI95;Q9NPH5-6;Q9NPH5	.;.;.;.;NOX4_HUMAN	G	78;78;78;102;102;102;78;78;78;77;123	ENSP00000412446:R78G;ENSP00000440172:R78G;ENSP00000344747:R78G;ENSP00000436892:R102G;ENSP00000436716:R102G;ENSP00000263317:R102G;ENSP00000434924:R78G;ENSP00000433797:R78G;ENSP00000439373:R78G;ENSP00000436970:R77G;ENSP00000405705:R123G	.	R	-	1	2	NOX4	88822301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.714000	0.47202	2.043000	0.60533	0.533000	0.62120	AGA	.	.	none		0.299	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
KIF16B	55614	hgsc.bcm.edu	37	20	16348090	16348090	+	Intron	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr20:16348090G>A	ENST00000354981.2	-	22	3656				KIF16B_ENST00000355755.3_Intron|KIF16B_ENST00000378003.2_Intron|KIF16B_ENST00000408042.1_Missense_Mutation_p.P1294S	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B						ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						GCACCCGGAGGAGGTATGTTT	0.438																																					p.P1294S		Atlas-SNP	.											.	KIF16B	305	.	0			c.C3880T						PASS	.						226.0	208.0	214.0					20																	16348090		876	1991	2867	SO:0001627	intron_variant	55614	exon23			CCGGAGGAGGTAT	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3498+3140C>T	20.37:g.16348090G>A		175.0	0.0	0		188.0	25.0	0.132979	NM_001199866	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	ENST00000354981.2	37	CCDS13122.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106630	0.37145	.	.	ENSG00000089177	ENST00000408042	T	0.70516	-0.49	5.62	3.43	0.39272	.	0.835806	0.10985	N	0.612294	T	0.56485	0.1988	.	.	.	0.09310	N	0.999999	B	0.17667	0.023	B	0.14578	0.011	T	0.49615	-0.8921	9	0.54805	T	0.06	.	3.8299	0.08870	0.3117:0.0:0.5246:0.1636	.	1294	Q96L93-2	.	S	1294	ENSP00000384164:P1294S	ENSP00000384164:P1294S	P	-	1	0	KIF16B	16296090	0.044000	0.20184	0.004000	0.12327	0.647000	0.38526	1.008000	0.29872	0.540000	0.28808	0.544000	0.68410	CCT	.	.	none		0.438	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
CHTF18	63922	hgsc.bcm.edu	37	16	847932	847932	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:847932C>G	ENST00000262315.9	+	22	2948	c.2885C>G	c.(2884-2886)tCc>tGc	p.S962C	CHTF18_ENST00000455171.2_Missense_Mutation_p.S990C|CHTF18_ENST00000317063.6_Missense_Mutation_p.S1171C	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	962					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				GAGGGTGTCTCCAACGCCGTG	0.657																																					p.S962C		Atlas-SNP	.											.	CHTF18	52	.	0			c.C2885G						PASS	.						33.0	40.0	38.0					16																	847932		2120	4231	6351	SO:0001583	missense	63922	exon22			GTGTCTCCAACGC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2885C>G	16.37:g.847932C>G	ENSP00000262315:p.Ser962Cys	88.0	0.0	0		81.0	7.0	0.0864198	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196489	0.58126	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.22134	1.97;2.11;2.08	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.51890	0.1701	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.57711	-0.7764	10	0.87932	D	0	-42.161	17.6563	0.88179	0.0:1.0:0.0:0.0	.	990;962	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	C	1171;990;962	ENSP00000313029:S1171C;ENSP00000406252:S990C;ENSP00000262315:S962C	ENSP00000262315:S962C	S	+	2	0	CHTF18	787933	1.000000	0.71417	0.996000	0.52242	0.334000	0.28698	7.419000	0.80179	2.529000	0.85273	0.561000	0.74099	TCC	.	.	none		0.657	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
SLC18A1	6570	hgsc.bcm.edu	37	8	20031913	20031913	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr8:20031913C>T	ENST00000276373.5	-	5	856	c.590G>A	c.(589-591)cGa>cAa	p.R197Q	SLC18A1_ENST00000437980.1_Missense_Mutation_p.R197Q|SLC18A1_ENST00000524272.1_5'UTR|SLC18A1_ENST00000381608.4_Missense_Mutation_p.R197Q|SLC18A1_ENST00000440926.1_Missense_Mutation_p.R197Q|SLC18A1_ENST00000265808.7_Missense_Mutation_p.R197Q|SLC18A1_ENST00000519026.1_Missense_Mutation_p.R197Q	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	197					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	TTGAAGGGTTCGGGCCACAAA	0.468																																					p.R197Q		Atlas-SNP	.											SLC18A1,NS,carcinoma,-1,1	SLC18A1	68	1	0			c.G590A						PASS	.						159.0	137.0	145.0					8																	20031913		2203	4300	6503	SO:0001583	missense	6570	exon6			AGGGTTCGGGCCA		CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.590G>A	8.37:g.20031913C>T	ENSP00000276373:p.Arg197Gln	144.0	0.0	0		139.0	24.0	0.172662	NM_001142324	E9PDJ5|Q9BRE4	Missense_Mutation	SNP	ENST00000276373.5	37	CCDS6013.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107635	0.77096	.	.	ENSG00000036565	ENST00000265808;ENST00000276373;ENST00000440926;ENST00000437980;ENST00000519026;ENST00000381608	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	5.6	4.73	0.59995	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.054237	0.85682	N	0.000000	D	0.85974	0.5822	H	0.94345	3.525	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.89609	0.3840	10	0.87932	D	0	-8.6207	13.4319	0.61059	0.0:0.9232:0.0:0.0768	.	197;197;197	E9PB33;E9PDJ5;P54219	.;.;VMAT1_HUMAN	Q	197	ENSP00000265808:R197Q;ENSP00000276373:R197Q;ENSP00000387549:R197Q;ENSP00000413361:R197Q;ENSP00000429664:R197Q;ENSP00000371021:R197Q	ENSP00000265808:R197Q	R	-	2	0	SLC18A1	20076193	0.965000	0.33210	0.695000	0.30226	0.332000	0.28634	5.733000	0.68571	1.487000	0.48415	0.655000	0.94253	CGA	.	.	none		0.468	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214106.1		
NCAPD3	23310	hgsc.bcm.edu	37	11	134076494	134076494	+	Splice_Site	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:134076494C>T	ENST00000534548.2	-	8	1080	c.1016G>A	c.(1015-1017)aGc>aAc	p.S339N		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	339					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TGTGCTTCACCTGATAAACTG	0.453																																					p.S339N		Atlas-SNP	.											.	NCAPD3	141	.	0			c.G1016A						PASS	.						136.0	122.0	127.0					11																	134076494		2201	4297	6498	SO:0001630	splice_region_variant	23310	exon8			CTTCACCTGATAA	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1016+1G>A	11.37:g.134076494C>T		259.0	0.0	0		284.0	63.0	0.221831	NM_015261	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	ENST00000534548.2	37	CCDS31723.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240992	0.79912	.	.	ENSG00000151503	ENST00000534548	T	0.08546	3.08	5.67	5.67	0.87782	Armadillo-type fold (1);	0.116016	0.85682	D	0.000000	T	0.18467	0.0443	M	0.66939	2.045	0.80722	D	1	P	0.48764	0.915	P	0.47251	0.542	T	0.00206	-1.1920	9	.	.	.	-11.7273	20.1313	0.98000	0.0:1.0:0.0:0.0	.	339	P42695	CNDD3_HUMAN	N	339	ENSP00000433681:S339N	.	S	-	2	0	NCAPD3	133581704	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.469000	0.66749	2.837000	0.97791	0.655000	0.94253	AGC	.	.	none		0.453	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	Missense_Mutation
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45970772	45970772	+	Silent	SNP	A	A	G	rs76021731|rs67692969|rs71199610	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr21:45970772A>G	ENST00000391621.1	-	1	616	c.570T>C	c.(568-570)ccT>ccC	p.P190P	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	190	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						TGCAGCAGACAGGCTTGCAGC	0.607																																					p.P190P		Atlas-SNP	.											.	KRTAP10-2	21	.	0			c.T570C						PASS	.						111.0	112.0	112.0					21																	45970772		2192	4282	6474	SO:0001819	synonymous_variant	386679	exon1			GCAGACAGGCTTG	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.570T>C	21.37:g.45970772A>G		96.0	0.0	0		120.0	14.0	0.116667	NM_198693	Q70LJ5	Silent	SNP	ENST00000391621.1	37	CCDS42955.1																																																																																			A|0.908;G|0.092	0.092	strong		0.607	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
CYSRT1	375791	hgsc.bcm.edu	37	9	140120215	140120215	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr9:140120215G>A	ENST00000359069.2	+	2	192	c.142G>A	c.(142-144)Ggg>Agg	p.G48R	C9orf169_ENST00000409414.1_Missense_Mutation_p.G88R|RNF224_ENST00000445101.2_5'Flank	NM_199001.2	NP_945352.2	A8MQ03	CRTP1_HUMAN		48						extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)	1						CCTGCCAGTGGGGCCCTGTGC	0.677																																					p.G48R		Atlas-SNP	.											.	C9orf169	6	.	0			c.G142A						PASS	.						19.0	25.0	23.0					9																	140120215		692	1587	2279	SO:0001583	missense	375791	exon2			CCAGTGGGGCCCT																												ENST00000359069.2:c.142G>A	9.37:g.140120215G>A	ENSP00000351967:p.Gly48Arg	69.0	0.0	0		56.0	13.0	0.232143	NM_199001	Q86UY7	Missense_Mutation	SNP	ENST00000359069.2	37	CCDS48064.1	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246913	0.22796	.	.	ENSG00000197191	ENST00000409414;ENST00000359069	.	.	.	3.18	2.27	0.28462	.	.	.	.	.	T	0.34745	0.0908	N	0.19112	0.55	0.09310	N	1	D	0.63046	0.992	P	0.60415	0.874	T	0.10064	-1.0646	8	0.36615	T	0.2	.	5.8886	0.18896	0.1497:0.0:0.8503:0.0	.	48	A8MQ03	CI169_HUMAN	R	88;48	.	ENSP00000351967:G48R	G	+	1	0	C9orf169	139240036	0.008000	0.16893	0.001000	0.08648	0.107000	0.19398	1.496000	0.35638	0.550000	0.28991	0.462000	0.41574	GGG	.	.	none		0.677	C9orf169-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
AMICA1	120425	hgsc.bcm.edu	37	11	118085545	118085545	+	Silent	SNP	A	A	G	rs553861053	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:118085545A>G	ENST00000356289.5	-	2	210	c.37T>C	c.(37-39)Tta>Cta	p.L13L	AMICA1_ENST00000292067.7_5'Flank|AMICA1_ENST00000526620.1_Intron|AMICA1_ENST00000533261.1_Silent_p.L13L	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	13					blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TTACCCAGTAACACTGGCAGC	0.383													A|||	12	0.00239617	0.0	0.0	5008	,	,		20342	0.0		0.0	False		,,,				2504	0.0123				p.L13L		Atlas-SNP	.											.	AMICA1	49	.	0			c.T37C						PASS	.						124.0	119.0	120.0					11																	118085545		1843	4089	5932	SO:0001819	synonymous_variant	120425	exon2			CCAGTAACACTGG	AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.37T>C	11.37:g.118085545A>G		37.0	0.0	0		46.0	7.0	0.152174	NM_001098526	B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Silent	SNP	ENST00000356289.5	37	CCDS41723.1																																																																																			.	.	none		0.383	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2	NM_153206	
FLG2	388698	hgsc.bcm.edu	37	1	152328295	152328295	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:152328295C>G	ENST00000388718.5	-	3	2039	c.1967G>C	c.(1966-1968)gGc>gCc	p.G656A	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	656	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCATATTGGCCAAAGCCAGT	0.498																																					p.G656A		Atlas-SNP	.											.	FLG2	431	.	0			c.G1967C						PASS	.						213.0	228.0	223.0					1																	152328295		2203	4300	6503	SO:0001583	missense	388698	exon3			TATTGGCCAAAGC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1967G>C	1.37:g.152328295C>G	ENSP00000373370:p.Gly656Ala	177.0	0.0	0		185.0	10.0	0.0540541	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	c	10.12	1.261737	0.23051	.	.	ENSG00000143520	ENST00000388718	T	0.17213	2.29	4.55	3.56	0.40772	.	.	.	.	.	T	0.11281	0.0275	M	0.73962	2.25	0.09310	N	1	D	0.56968	0.978	P	0.52856	0.711	T	0.17258	-1.0375	9	0.08599	T	0.76	-1.6533	4.9448	0.13984	0.2112:0.6799:0.0:0.109	.	656	Q5D862	FILA2_HUMAN	A	656	ENSP00000373370:G656A	ENSP00000373370:G656A	G	-	2	0	FLG2	150594919	0.004000	0.15560	0.014000	0.15608	0.046000	0.14306	1.621000	0.36986	2.083000	0.62718	0.561000	0.74099	GGC	.	.	none		0.498	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
SLC19A1	6573	hgsc.bcm.edu	37	21	46935613	46935613	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr21:46935613G>A	ENST00000311124.4	-	6	1887	c.1735C>T	c.(1735-1737)Cag>Tag	p.Q579*	SLC19A1_ENST00000468508.1_5'Flank|SLC19A1_ENST00000380010.4_Intron|SLC19A1_ENST00000567670.1_Intron|SLC19A1_ENST00000485649.2_Nonsense_Mutation_p.Q539*	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	579					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	GGAAGACACTGCAAACCCAGC	0.612																																					p.Q579X		Atlas-SNP	.											.	SLC19A1	53	.	0			c.C1735T						PASS	.						68.0	65.0	66.0					21																	46935613		2203	4300	6503	SO:0001587	stop_gained	6573	exon6			GACACTGCAAACC	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.1735C>T	21.37:g.46935613G>A	ENSP00000308895:p.Gln579*	90.0	0.0	0		86.0	4.0	0.0465116	NM_194255	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Nonsense_Mutation	SNP	ENST00000311124.4	37	CCDS13725.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905088	0.92035	.	.	ENSG00000173638	ENST00000311124;ENST00000485649	.	.	.	2.8	-1.34	0.09143	.	.	.	.	.	.	.	.	.	.	.	0.30402	N	0.779886	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.3474	0.21357	0.5305:0.0:0.4695:0.0	.	.	.	.	X	579;539	.	ENSP00000308895:Q579X	Q	-	1	0	SLC19A1	45760041	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-1.359000	0.02602	-0.337000	0.08426	0.467000	0.42956	CAG	.	.	none		0.612	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1		
DTX2	113878	hgsc.bcm.edu	37	7	76132841	76132841	+	Silent	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:76132841G>A	ENST00000324432.5	+	10	1998	c.1488G>A	c.(1486-1488)tcG>tcA	p.S496S	DTX2_ENST00000307569.8_Silent_p.S449S|DTX2_ENST00000446820.2_Silent_p.S449S|DTX2_ENST00000413936.2_Silent_p.S496S|DTX2_ENST00000446600.1_Silent_p.S405S|DTX2_ENST00000430490.2_Silent_p.S496S	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	496					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						TCCAGATGTCGCTCCCCGGCC	0.577																																					p.S496S		Atlas-SNP	.											.	DTX2	64	.	0			c.G1488A						PASS	.						68.0	61.0	63.0					7																	76132841		2199	4293	6492	SO:0001819	synonymous_variant	113878	exon9			GATGTCGCTCCCC		CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1488G>A	7.37:g.76132841G>A		203.0	0.0	0		219.0	51.0	0.232877	NM_001102594	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	ENST00000324432.5	37	CCDS5587.1																																																																																			.	.	none		0.577	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253104.2		
GBP3	2635	hgsc.bcm.edu	37	1	89476646	89476646	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:89476646T>C	ENST00000370481.4	-	8	1523	c.1303A>G	c.(1303-1305)Att>Gtt	p.I435V		NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	0					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		AGCTTCTGAATAAAGAGACAA	0.433																																					p.I435V		Atlas-SNP	.											.	GBP3	53	.	0			c.A1303G						PASS	.						203.0	170.0	182.0					1																	89476646		2191	3984	6175	SO:0001583	missense	2635	exon8			TCTGAATAAAGAG	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.1303A>G	1.37:g.89476646T>C	ENSP00000359512:p.Ile435Val	321.0	0.0	0		341.0	73.0	0.214076	NM_018284	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Missense_Mutation	SNP	ENST00000370481.4	37	CCDS717.2	.	.	.	.	.	.	.	.	.	.	T	7.103	0.574507	0.13623	.	.	ENSG00000117226	ENST00000370482;ENST00000370481;ENST00000235878	T	0.01887	4.58	3.57	-1.8	0.07907	Guanylate-binding protein, C-terminal (3);	1.033460	0.07626	N	0.927902	T	0.00412	0.0013	N	0.16478	0.41	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.006	T	0.47235	-0.9133	10	0.20519	T	0.43	.	0.9257	0.01324	0.1662:0.3148:0.1708:0.3482	.	301;435	F6X827;Q9H0R5	.;GBP3_HUMAN	V	403;435;435	ENSP00000359512:I435V	ENSP00000235878:I435V	I	-	1	0	GBP3	89249234	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-2.842000	0.00737	-0.211000	0.10124	0.491000	0.48974	ATT	.	.	none		0.433	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284	
MAGI2	9863	hgsc.bcm.edu	37	7	78636484	78636484	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:78636484A>C	ENST00000354212.4	-	2	593	c.340T>G	c.(340-342)Tta>Gta	p.L114V	MAGI2_ENST00000419488.1_Missense_Mutation_p.L114V|MAGI2_ENST00000522391.1_Missense_Mutation_p.L114V|MAGI2-AS2_ENST00000411616.1_RNA	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	114	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.L114V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TGAAATCGTAAGTTGAGGTAG	0.388																																					p.L114V		Atlas-SNP	.											MAGI2,caecum,carcinoma,0,1	MAGI2	246	1	1	Substitution - Missense(1)	large_intestine(1)	c.T340G						PASS	.						147.0	126.0	133.0					7																	78636484		2203	4300	6503	SO:0001583	missense	9863	exon2			ATCGTAAGTTGAG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.340T>G	7.37:g.78636484A>C	ENSP00000346151:p.Leu114Val	107.0	0.0	0		148.0	22.0	0.148649	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994850	0.74703	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.11277	2.89;2.89;2.79	5.29	4.1	0.47936	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	.	.	.	.	T	0.23492	0.0568	L	0.52573	1.65	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.91635	0.999;0.82	T	0.00647	-1.1628	9	0.35671	T	0.21	.	9.4432	0.38681	0.8477:0.0:0.1523:0.0	.	114;114	Q86UL8-2;Q86UL8	.;MAGI2_HUMAN	V	114	ENSP00000405766:L114V;ENSP00000346151:L114V;ENSP00000428389:L114V	ENSP00000346151:L114V	L	-	1	2	MAGI2	78474420	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.746000	0.55127	0.802000	0.34089	0.519000	0.50382	TTA	.	.	none		0.388	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
NLGN1	22871	hgsc.bcm.edu	37	3	173322630	173322630	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:173322630T>C	ENST00000457714.1	+	3	671	c.242T>C	c.(241-243)cTt>cCt	p.L81P	NLGN1_ENST00000401917.3_Missense_Mutation_p.L81P|NLGN1_ENST00000545397.1_Missense_Mutation_p.L81P|NLGN1_ENST00000361589.4_Missense_Mutation_p.L81P	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	81					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ATTCAATTTCTTGGGGTTCCA	0.458																																					p.L81P		Atlas-SNP	.											NLGN1,NS,carcinoma,+1,1	NLGN1	209	1	0			c.T242C						PASS	.						102.0	108.0	106.0					3																	173322630		2203	4300	6503	SO:0001583	missense	22871	exon3			AATTTCTTGGGGT	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.242T>C	3.37:g.173322630T>C	ENSP00000392500:p.Leu81Pro	56.0	0.0	0		64.0	11.0	0.171875	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	37	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.620055	0.66787	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.71934	-0.08;-0.08;-0.61;-0.08;-0.08	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000005	D	0.90202	0.6937	H	0.98089	4.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.992;0.997	D	0.93761	0.7067	10	0.87932	D	0	.	16.1135	0.81278	0.0:0.0:0.0:1.0	.	81;81	D2X2H5;Q8N2Q7-2	.;.	P	81	ENSP00000392500:L81P;ENSP00000354541:L81P;ENSP00000410374:L81P;ENSP00000441108:L81P;ENSP00000385750:L81P	ENSP00000354541:L81P	L	+	2	0	NLGN1	174805324	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.655000	0.83696	2.267000	0.75376	0.383000	0.25322	CTT	.	.	none		0.458	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
MAP3K12	7786	hgsc.bcm.edu	37	12	53880795	53880795	+	Silent	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:53880795G>A	ENST00000267079.2	-	3	507	c.282C>T	c.(280-282)tgC>tgT	p.C94C	MAP3K12_ENST00000547151.1_5'UTR|MAP3K12_ENST00000547035.1_Silent_p.C127C|MAP3K12_ENST00000547488.1_Silent_p.C127C	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	94					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						CAGGGCGCAGGCAGCCAAAGA	0.602																																					p.C127C		Atlas-SNP	.											.	MAP3K12	160	.	0			c.C381T						PASS	.						80.0	66.0	71.0					12																	53880795		2203	4300	6503	SO:0001819	synonymous_variant	7786	exon2			GCGCAGGCAGCCA	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.282C>T	12.37:g.53880795G>A		149.0	0.0	0		147.0	39.0	0.265306	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Silent	SNP	ENST00000267079.2	37	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	G	7.742	0.701512	0.15172	.	.	ENSG00000139625	ENST00000547151	.	.	.	4.73	1.91	0.25777	.	.	.	.	.	T	0.63177	0.2489	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61681	-0.7013	5	0.87932	D	0	.	7.939	0.29946	0.3359:0.0:0.6641:0.0	.	.	.	.	V	91	.	ENSP00000446800:A91V	A	-	2	0	MAP3K12	52167062	0.968000	0.33430	1.000000	0.80357	0.987000	0.75469	0.040000	0.13905	0.183000	0.20059	-0.448000	0.05591	GCC	.	.	none		0.602	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
ENPEP	2028	hgsc.bcm.edu	37	4	111397599	111397599	+	Missense_Mutation	SNP	A	A	C	rs564550794		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:111397599A>C	ENST00000265162.5	+	1	371	c.29A>C	c.(28-30)aAg>aCg	p.K10T		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	10					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GAGGGCTCTAAGAGATACTGC	0.438																																					p.K10T		Atlas-SNP	.											.	ENPEP	149	.	0			c.A29C						PASS	.						171.0	163.0	166.0					4																	111397599		2203	4300	6503	SO:0001583	missense	2028	exon1			GCTCTAAGAGATA	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.29A>C	4.37:g.111397599A>C	ENSP00000265162:p.Lys10Thr	184.0	0.0	0		212.0	31.0	0.146226	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.679199	0.88542	.	.	ENSG00000138792	ENST00000265162	T	0.01347	4.99	5.42	3.04	0.35103	.	0.352416	0.31279	N	0.007939	T	0.02848	0.0085	M	0.66939	2.045	0.48040	D	0.99957	D	0.57899	0.981	P	0.46629	0.522	T	0.55685	-0.8102	10	0.51188	T	0.08	.	9.0788	0.36538	0.8513:0.0:0.1487:0.0	.	10	Q07075	AMPE_HUMAN	T	10	ENSP00000265162:K10T	ENSP00000265162:K10T	K	+	2	0	ENPEP	111617048	1.000000	0.71417	0.278000	0.24718	0.723000	0.41478	4.877000	0.63086	0.912000	0.36772	0.260000	0.18958	AAG	.	.	none		0.438	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
BIRC8	112401	hgsc.bcm.edu	37	19	53793122	53793122	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr19:53793122G>T	ENST00000426466.1	-	1	1753	c.506C>A	c.(505-507)tCa>tAa	p.S169*		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	169					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		TCTCTGCAATGAAGTCTGATT	0.418																																					p.S169X		Atlas-SNP	.											.	BIRC8	54	.	0			c.C506A						PASS	.						87.0	86.0	86.0					19																	53793122		2203	4300	6503	SO:0001587	stop_gained	112401	exon1			TGCAATGAAGTCT	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.506C>A	19.37:g.53793122G>T	ENSP00000412957:p.Ser169*	116.0	0.0	0		110.0	17.0	0.154545	NM_033341	Q6IPY1|Q96RW5	Nonsense_Mutation	SNP	ENST00000426466.1	37	CCDS12863.1	.	.	.	.	.	.	.	.	.	.	G	43	10.235541	0.99365	.	.	ENSG00000163098	ENST00000426466	.	.	.	0.637	-0.588	0.11687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1522	4.9292	0.13909	0.2589:0.0:0.7411:0.0	.	.	.	.	X	169	.	ENSP00000412957:S169X	S	-	2	0	BIRC8	58484934	0.007000	0.16637	0.010000	0.14722	0.003000	0.03518	0.299000	0.19138	-0.140000	0.11394	-0.347000	0.07816	TCA	.	.	none		0.418	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341	
PROX1	5629	hgsc.bcm.edu	37	1	214171399	214171399	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:214171399A>C	ENST00000366958.4	+	2	2129	c.1521A>C	c.(1519-1521)aaA>aaC	p.K507N	PROX1_ENST00000435016.1_Missense_Mutation_p.K507N|PROX1_ENST00000498508.2_Missense_Mutation_p.K507N|PROX1_ENST00000261454.4_Missense_Mutation_p.K507N	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	507					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TCTCTGGAAAAGACAGAGCCT	0.552																																					p.K507N		Atlas-SNP	.											.	PROX1	124	.	0			c.A1521C						PASS	.						78.0	85.0	82.0					1																	214171399		2203	4300	6503	SO:0001583	missense	5629	exon2			TGGAAAAGACAGA	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1521A>C	1.37:g.214171399A>C	ENSP00000355925:p.Lys507Asn	49.0	0.0	0		65.0	18.0	0.276923	NM_001270616	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	A	11.80	1.748020	0.30955	.	.	ENSG00000117707	ENST00000541470;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.48836	0.81;0.8;0.81;0.81	5.71	1.66	0.24008	.	0.000000	0.85682	D	0.000000	T	0.59032	0.2164	M	0.62723	1.935	0.52501	D	0.999953	D	0.76494	0.999	D	0.85130	0.997	T	0.52223	-0.8604	10	0.22109	T	0.4	-5.3341	9.702	0.40192	0.6316:0.0:0.3684:0.0	.	507	Q92786	PROX1_HUMAN	N	79;507;507;507;507	ENSP00000420283:K507N;ENSP00000355925:K507N;ENSP00000400694:K507N;ENSP00000261454:K507N	ENSP00000261454:K507N	K	+	3	2	PROX1	212238022	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	1.513000	0.35823	0.026000	0.15269	0.533000	0.62120	AAA	.	.	none		0.552	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
SRSF1	6426	hgsc.bcm.edu	37	17	56083867	56083867	+	Nonsense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:56083867A>C	ENST00000258962.4	-	2	424	c.216T>G	c.(214-216)taT>taG	p.Y72*	SRSF1_ENST00000582730.2_Nonsense_Mutation_p.Y72*|RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000584773.1_Nonsense_Mutation_p.Y72*|SRSF1_ENST00000585096.1_Intron	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	72	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGTCGCGACCATACACCGCGT	0.627																																					p.Y72X		Atlas-SNP	.											.	SRSF1	41	.	0			c.T216G						PASS	.						28.0	25.0	26.0					17																	56083867		2202	4288	6490	SO:0001587	stop_gained	6426	exon2			GCGACCATACACC		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.216T>G	17.37:g.56083867A>C	ENSP00000258962:p.Tyr72*	149.0	0.0	0		174.0	42.0	0.241379	NM_006924	B2R6Z7|D3DTZ3|Q13809	Nonsense_Mutation	SNP	ENST00000258962.4	37	CCDS11600.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.381974	0.82792	.	.	ENSG00000136450	ENST00000258962	.	.	.	5.96	-3.56	0.04626	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7599	0.62959	0.5977:0.0:0.4023:0.0	.	.	.	.	X	72	.	ENSP00000258962:Y72X	Y	-	3	2	SRSF1	53438866	0.877000	0.30153	0.866000	0.34008	0.984000	0.73092	0.001000	0.13038	-0.941000	0.03700	-0.899000	0.02877	TAT	.	.	none		0.627	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443335.1	NM_006924	
LTB	4050	hgsc.bcm.edu	37	6	31549636	31549636	+	Splice_Site	SNP	C	C	G	rs571318566	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:31549636C>G	ENST00000429299.2	-	2	170	c.163G>C	c.(163-165)Gta>Cta	p.V55L	LTB_ENST00000446745.2_Intron|LTB_ENST00000483972.1_Intron	NM_002341.1	NP_002332.1	Q06643	TNFC_HUMAN	lymphotoxin beta (TNF superfamily, member 3)	55					cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|signal transduction (GO:0007165)|skin development (GO:0043588)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	9						GTCTCCGTTACCTGGTTGGGT	0.622																																					p.V55L		Atlas-SNP	.											.	LTB	19	.	0			c.G163C						PASS	.						78.0	87.0	84.0					6																	31549636		1509	2709	4218	SO:0001630	splice_region_variant	4050	exon2			CCGTTACCTGGTT	L11015	CCDS4703.1, CCDS4704.1	6p21.3	2013-05-22			ENSG00000227507	ENSG00000227507		"""Tumor necrosis factor (ligand) superfamily"""	6711	protein-coding gene	gene with protein product		600978		TNFC		7916655, 1714477	Standard	NM_002341		Approved	p33, TNFSF3	uc003nuk.3	Q06643	OTTHUMG00000031136	ENST00000429299.2:c.163-1G>C	6.37:g.31549636C>G		100.0	0.0	0		79.0	11.0	0.139241	NM_002341	P78370|Q52LU8|Q99761	Missense_Mutation	SNP	ENST00000429299.2	37	CCDS4703.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.307743	0.60305	.	.	ENSG00000227507	ENST00000429299	T	0.21361	2.01	5.45	5.45	0.79879	.	0.715933	0.12594	N	0.455328	T	0.22627	0.0546	L	0.49126	1.545	0.80722	D	1	D	0.67145	0.996	P	0.55161	0.77	T	0.00915	-1.1516	10	0.27082	T	0.32	-17.783	14.7884	0.69821	0.0:1.0:0.0:0.0	.	55	Q06643	TNFC_HUMAN	L	55	ENSP00000410481:V55L	ENSP00000410481:V55L	V	-	1	0	LTB	31657615	0.998000	0.40836	0.993000	0.49108	0.049000	0.14656	1.506000	0.35747	2.555000	0.86185	0.655000	0.94253	GTA	.	.	none		0.622	LTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076239.3		Missense_Mutation
NMBR	4829	hgsc.bcm.edu	37	6	142399929	142399929	+	Silent	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:142399929T>C	ENST00000258042.1	-	2	674	c.534A>G	c.(532-534)gaA>gaG	p.E178E	NMBR_ENST00000480652.1_5'Flank	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	178					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		AAAACACCGCTTCGGGAACTG	0.512																																					p.E178E		Atlas-SNP	.											NMBR,NS,carcinoma,-2,1	NMBR	62	1	0			c.A534G						PASS	.						117.0	107.0	110.0					6																	142399929		2203	4300	6503	SO:0001819	synonymous_variant	4829	exon2			CACCGCTTCGGGA		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.534A>G	6.37:g.142399929T>C		145.0	0.0	0		176.0	37.0	0.210227	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	CCDS5196.1																																																																																			.	.	none		0.512	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
LOXL3	84695	hgsc.bcm.edu	37	2	74761669	74761669	+	Silent	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:74761669G>A	ENST00000264094.3	-	10	1883	c.1812C>T	c.(1810-1812)caC>caT	p.H604H	LOXL3_ENST00000393937.2_Silent_p.H459H|LOXL3_ENST00000409549.1_Silent_p.H548H|LOXL3_ENST00000409986.1_Silent_p.H459H|LOXL3_ENST00000409249.1_Intron	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	604	Lysyl-oxidase like.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CATGGCACTCGTGCCACACCC	0.607																																					p.H604H		Atlas-SNP	.											.	LOXL3	73	.	0			c.C1812T						PASS	.						41.0	42.0	42.0					2																	74761669		2203	4300	6503	SO:0001819	synonymous_variant	84695	exon10			GCACTCGTGCCAC	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1812C>T	2.37:g.74761669G>A		153.0	0.0	0		114.0	6.0	0.0526316	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	37	CCDS1953.1																																																																																			.	.	none		0.607	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
TOX3	27324	hgsc.bcm.edu	37	16	52478202	52478202	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:52478202T>C	ENST00000219746.9	-	6	1257	c.973A>G	c.(973-975)Agc>Ggc	p.S325G	TOX3_ENST00000407228.3_Missense_Mutation_p.S320G	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	325					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						GAAACGAGGCTGGCCCTGTAT	0.478																																					p.S325G		Atlas-SNP	.											.	TOX3	121	.	0			c.A973G						PASS	.						44.0	43.0	43.0					16																	52478202		1826	4090	5916	SO:0001583	missense	27324	exon6			CGAGGCTGGCCCT	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.973A>G	16.37:g.52478202T>C	ENSP00000219746:p.Ser325Gly	64.0	0.0	0		63.0	7.0	0.111111	NM_001080430	B4DRD0|B5MCW4	Missense_Mutation	SNP	ENST00000219746.9	37	CCDS54009.1	.	.	.	.	.	.	.	.	.	.	T	19.68	3.873421	0.72180	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.45668	0.89;0.89	5.35	5.35	0.76521	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (1);	0.000000	0.85682	D	0.000000	T	0.39627	0.1085	L	0.27053	0.805	0.58432	D	0.999997	P;P	0.35612	0.512;0.512	B;B	0.42522	0.39;0.39	T	0.37865	-0.9687	10	0.59425	D	0.04	.	15.6388	0.76977	0.0:0.0:0.0:1.0	.	320;325	B4DRD0;O15405	.;TOX3_HUMAN	G	325;320	ENSP00000219746:S325G;ENSP00000385705:S320G	ENSP00000219746:S325G	S	-	1	0	TOX3	51035703	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.232000	0.72313	2.169000	0.68431	0.528000	0.53228	AGC	.	.	none		0.478	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000422534.1	XM_049037	
KIRREL3	84623	hgsc.bcm.edu	37	11	126294687	126294687	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:126294687G>A	ENST00000525144.2	-	17	2374	c.2125C>T	c.(2125-2127)Cgg>Tgg	p.R709W	KIRREL3_ENST00000529097.2_Missense_Mutation_p.R697W|KIRREL3_ENST00000416561.2_Missense_Mutation_p.R176W	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	709	Ser-rich.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TGGAACTCCCGCTCACAAAGC	0.627																																					p.R709W		Atlas-SNP	.											KIRREL3_ENST00000525144,NS,carcinoma,0,2	KIRREL3	183	2	0			c.C2125T						PASS	.						64.0	72.0	69.0					11																	126294687		2161	4274	6435	SO:0001583	missense	84623	exon17			ACTCCCGCTCACA	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.2125C>T	11.37:g.126294687G>A	ENSP00000435466:p.Arg709Trp	144.0	0.0	0		122.0	31.0	0.254098	NM_032531	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353005	0.82132	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000416561	T;T;T	0.53423	0.62;0.62;0.62	4.88	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	L	0.36672	1.1	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	T	0.62115	-0.6922	10	0.72032	D	0.01	-11.0324	14.353	0.66716	0.0:0.0:0.8508:0.1492	.	697;709	E9PRX9;Q8IZU9	.;KIRR3_HUMAN	W	709;697;176	ENSP00000435466:R709W;ENSP00000434081:R697W;ENSP00000408692:R176W	ENSP00000408692:R176W	R	-	1	2	KIRREL3	125799897	1.000000	0.71417	0.987000	0.45799	0.993000	0.82548	6.135000	0.71696	1.271000	0.44313	0.655000	0.94253	CGG	.	.	none		0.627	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230404	23230404	+	Silent	SNP	A	A	G	rs115653109	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr22:23230404A>G	ENST00000526893.1	+	1	445	c.171A>G	c.(169-171)ggA>ggG	p.G57G	IGLL5_ENST00000532223.2_Silent_p.G57G|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.G57G	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	57						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCTCAGTTGGAAGCAGCCGAT	0.662													A|||	2	0.000399361	0.0015	0.0	5008	,	,		10542	0.0		0.0	False		,,,				2504	0.0				p.E22G		Atlas-SNP	.											.	IGLL5	26	.	0			c.A65G						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			AGTTGGAAGCAGC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.171A>G	22.37:g.23230404A>G		97.0	0.0	0		59.0	14.0	0.237288	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			A|0.999;G|0.001	0.001	strong		0.662	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
HSP90AA1	3320	hgsc.bcm.edu	37	14	102552577	102552577	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr14:102552577C>G	ENST00000216281.8	-	2	344	c.139G>C	c.(139-141)Gag>Cag	p.E47Q	HSP90AA1_ENST00000441629.2_5'UTR|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.E169Q	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	47					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	GAAATGAGCTCTCTCAGAAAG	0.403																																					p.E169Q		Atlas-SNP	.											.	HSP90AA1	65	.	0			c.G505C						PASS	.						51.0	53.0	52.0					14																	102552577		2203	4300	6503	SO:0001583	missense	3320	exon3			TGAGCTCTCTCAG	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.139G>C	14.37:g.102552577C>G	ENSP00000216281:p.Glu47Gln	125.0	0.0	0		117.0	30.0	0.25641	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	37	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	C	8.396	0.840777	0.16891	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000553585	D;D;D	0.85411	-1.98;-1.98;-1.98	3.79	2.88	0.33553	Heat shock protein Hsp90, conserved site (1);Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.000000	0.85682	U	0.000000	D	0.96522	0.8865	H	0.99993	5.365	0.80722	D	1	D;D	0.69078	0.997;0.992	D;D	0.78314	0.99;0.991	D	0.96129	0.9091	10	0.87932	D	0	.	12.6451	0.56729	0.1672:0.8328:0.0:0.0	.	169;47	P07900-2;P07900	.;HS90A_HUMAN	Q	47;169;47	ENSP00000216281:E47Q;ENSP00000335153:E169Q;ENSP00000450712:E47Q	ENSP00000216281:E47Q	E	-	1	0	HSP90AA1	101622330	1.000000	0.71417	0.999000	0.59377	0.175000	0.22909	7.473000	0.81007	0.694000	0.31654	-0.312000	0.09012	GAG	.	.	none		0.403	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
DOCK5	80005	hgsc.bcm.edu	37	8	25198452	25198452	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr8:25198452T>C	ENST00000276440.7	+	23	2431	c.2387T>C	c.(2386-2388)cTt>cCt	p.L796P		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	796					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CAGTTATTTCTTGCTTTCAAT	0.423																																					p.L796P	Pancreas(145;34 1887 3271 10937 30165)	Atlas-SNP	.											.	DOCK5	167	.	0			c.T2387C						PASS	.						85.0	81.0	82.0					8																	25198452		2203	4300	6503	SO:0001583	missense	80005	exon23			TATTTCTTGCTTT		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.2387T>C	8.37:g.25198452T>C	ENSP00000276440:p.Leu796Pro	77.0	0.0	0		87.0	13.0	0.149425	NM_024940	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	CCDS6047.1	.	.	.	.	.	.	.	.	.	.	T	11.20	1.567446	0.28003	.	.	ENSG00000147459	ENST00000276440	T	0.27890	1.64	4.99	4.99	0.66335	Armadillo-type fold (1);	0.222771	0.39210	N	0.001427	T	0.28665	0.0710	L	0.40543	1.245	0.80722	D	1	B;B;B	0.30664	0.186;0.289;0.186	B;B;B	0.33339	0.162;0.162;0.162	T	0.05954	-1.0854	10	0.36615	T	0.2	.	14.8781	0.70510	0.0:0.0:0.0:1.0	.	786;571;796	D3DSS6;Q68DL4;Q9H7D0	.;.;DOCK5_HUMAN	P	796	ENSP00000276440:L796P	ENSP00000276440:L796P	L	+	2	0	DOCK5	25254369	1.000000	0.71417	0.892000	0.35008	0.266000	0.26442	7.525000	0.81892	2.095000	0.63458	0.528000	0.53228	CTT	.	.	none		0.423	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2	NM_024940	
LRP1B	53353	hgsc.bcm.edu	37	2	141356256	141356256	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:141356256A>G	ENST00000389484.3	-	43	8109	c.7138T>C	c.(7138-7140)Tca>Cca	p.S2380P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2380					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGCCATCTGAGAAATACAGC	0.398										TSP Lung(27;0.18)																											p.S2380P	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											LRP1B,NS,carcinoma,+1,3	LRP1B	1315	3	0			c.T7138C						PASS	.						165.0	147.0	153.0					2																	141356256		2203	4300	6503	SO:0001583	missense	53353	exon43			CATCTGAGAAATA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7138T>C	2.37:g.141356256A>G	ENSP00000374135:p.Ser2380Pro	246.0	0.0	0		295.0	58.0	0.19661	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.845113	0.71603	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.92249	-3.0	5.64	4.42	0.53409	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	U	0.000003	D	0.94594	0.8258	M	0.88570	2.965	0.51233	D	0.999919	D	0.57899	0.981	P	0.52109	0.69	D	0.94914	0.8067	10	0.56958	D	0.05	.	12.4181	0.55504	0.8599:0.1401:0.0:0.0	.	2380	Q9NZR2	LRP1B_HUMAN	P	2380;2318	ENSP00000374135:S2380P	ENSP00000374135:S2380P	S	-	1	0	LRP1B	141072726	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.291000	0.78721	2.156000	0.67533	0.377000	0.23210	TCA	.	.	none		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
USP44	84101	hgsc.bcm.edu	37	12	95926864	95926864	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:95926864T>C	ENST00000258499.3	-	2	1457	c.1169A>G	c.(1168-1170)cAa>cGa	p.Q390R	USP44_ENST00000552440.1_Missense_Mutation_p.Q390R|USP44_ENST00000393091.2_Missense_Mutation_p.Q390R|USP44_ENST00000537435.2_Missense_Mutation_p.Q390R	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	390	USP.				mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						CCACATGACTTGGAACAAAGT	0.453																																					p.Q390R		Atlas-SNP	.											.	USP44	83	.	0			c.A1169G						PASS	.						140.0	127.0	131.0					12																	95926864		2203	4300	6503	SO:0001583	missense	84101	exon2			ATGACTTGGAACA	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.1169A>G	12.37:g.95926864T>C	ENSP00000258499:p.Gln390Arg	195.0	0.0	0		250.0	62.0	0.248	NM_032147	B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	37	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	T	1.962	-0.438603	0.04636	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000552440;ENST00000537435	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.1	5.1	0.69264	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.100708	0.64402	D	0.000001	T	0.14270	0.0345	N	0.04090	-0.28	0.53688	D	0.999972	B	0.11235	0.004	B	0.18871	0.023	T	0.08973	-1.0696	10	0.05833	T	0.94	.	15.189	0.73028	0.0:0.0:0.0:1.0	.	390	Q9H0E7	UBP44_HUMAN	R	390	ENSP00000258499:Q390R;ENSP00000376806:Q390R;ENSP00000448670:Q390R;ENSP00000442629:Q390R	ENSP00000258499:Q390R	Q	-	2	0	USP44	94450995	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.495000	0.53280	2.049000	0.60858	0.454000	0.30748	CAA	.	.	none		0.453	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
RBMXL2	27288	hgsc.bcm.edu	37	11	7111451	7111451	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:7111451G>T	ENST00000306904.5	+	1	1287	c.1100G>T	c.(1099-1101)cGg>cTg	p.R367L		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	367	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCTTACAGCCGGTCAGGCTGC	0.652																																					p.R367L		Atlas-SNP	.											.	RBMXL2	47	.	0			c.G1100T						PASS	.						12.0	14.0	14.0					11																	7111451		2198	4295	6493	SO:0001583	missense	27288	exon1			ACAGCCGGTCAGG	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.1100G>T	11.37:g.7111451G>T	ENSP00000304139:p.Arg367Leu	68.0	0.0	0		67.0	14.0	0.208955	NM_014469	Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	ENST00000306904.5	37	CCDS7777.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170468	0.38315	.	.	ENSG00000170748	ENST00000306904	T	0.76448	-1.02	3.97	3.97	0.46021	.	0.162448	0.51477	U	0.000087	T	0.69931	0.3166	L	0.47716	1.5	0.29826	N	0.830395	P	0.48764	0.915	B	0.38712	0.28	T	0.74509	-0.3642	10	0.66056	D	0.02	.	14.3415	0.66630	0.0:0.0:1.0:0.0	.	367	O75526	HNRGT_HUMAN	L	367	ENSP00000304139:R367L	ENSP00000304139:R367L	R	+	2	0	RBMXL2	7068027	1.000000	0.71417	0.920000	0.36463	0.112000	0.19704	6.007000	0.70731	2.492000	0.84095	0.655000	0.94253	CGG	.	.	none		0.652	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	NM_014469	
IGSF9B	22997	hgsc.bcm.edu	37	11	133790483	133790483	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:133790483G>A	ENST00000321016.8	-	18	3367	c.3137C>T	c.(3136-3138)cCc>cTc	p.P1046L	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P1046L			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1046	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCCCCCGAAGGGGAATTCTGG	0.662																																					p.P1046L		Atlas-SNP	.											.	IGSF9B	290	.	0			c.C3137T						PASS	.						45.0	54.0	51.0					11																	133790483		1935	4142	6077	SO:0001583	missense	22997	exon18			CCGAAGGGGAATT	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3137C>T	11.37:g.133790483G>A	ENSP00000317980:p.Pro1046Leu	113.0	0.0	0		151.0	39.0	0.258278	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	G	17.22	3.335293	0.60853	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.69561	-0.09;-0.41	4.82	4.82	0.62117	.	0.159476	0.29737	N	0.011322	T	0.71341	0.3328	N	0.19112	0.55	0.58432	D	0.999997	D	0.89917	1.0	D	0.80764	0.994	T	0.75045	-0.3456	10	0.51188	T	0.08	.	17.5246	0.87796	0.0:0.0:1.0:0.0	.	1046	Q9UPX0	TUTLB_HUMAN	L	1046;888	ENSP00000317980:P1046L;ENSP00000436552:P888L	ENSP00000317980:P1046L	P	-	2	0	IGSF9B	133295693	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.551000	0.82182	2.220000	0.72140	0.455000	0.32223	CCC	.	.	none		0.662	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
CPXCR1	53336	hgsc.bcm.edu	37	X	88008609	88008609	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chrX:88008609A>G	ENST00000276127.4	+	3	453	c.194A>G	c.(193-195)cAa>cGa	p.Q65R	CPXCR1_ENST00000373111.1_Missense_Mutation_p.Q65R	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	65							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						GTTGTTCCTCAAGCAGCAGAA	0.463																																					p.Q65R		Atlas-SNP	.											.	CPXCR1	83	.	0			c.A194G						PASS	.						44.0	42.0	43.0					X																	88008609		2203	4300	6503	SO:0001583	missense	53336	exon3			TTCCTCAAGCAGC	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.194A>G	X.37:g.88008609A>G	ENSP00000276127:p.Gln65Arg	82.0	0.0	0		57.0	17.0	0.298246	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	37	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	A	9.947	1.219144	0.22373	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.32515	1.45;1.45	3.43	2.22	0.28083	.	0.415062	0.17767	N	0.162708	T	0.28699	0.0711	L	0.29908	0.895	0.09310	N	1	D	0.61697	0.99	P	0.54174	0.744	T	0.06092	-1.0846	9	.	.	.	.	5.9873	0.19442	0.7342:0.2658:0.0:0.0	.	65	Q8N123	CPXCR_HUMAN	R	65	ENSP00000276127:Q65R;ENSP00000362203:Q65R	.	Q	+	2	0	CPXCR1	87895265	0.000000	0.05858	0.004000	0.12327	0.089000	0.18198	-0.008000	0.12788	0.511000	0.28236	-0.387000	0.06579	CAA	.	.	none		0.463	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
MYH1	4619	hgsc.bcm.edu	37	17	10409204	10409204	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:10409204T>G	ENST00000226207.5	-	19	2193	c.2099A>C	c.(2098-2100)aAc>aCc	p.N700T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	700	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CAGCACACCGTTACACCTCAG	0.468																																					p.N700T		Atlas-SNP	.											MYH1,NS,carcinoma,+1,1	MYH1	403	1	0			c.A2099C						PASS	.						76.0	64.0	68.0					17																	10409204		2203	4298	6501	SO:0001583	missense	4619	exon19			ACACCGTTACACC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2099A>C	17.37:g.10409204T>G	ENSP00000226207:p.Asn700Thr	490.0	0.0	0		521.0	88.0	0.168906	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.381448	0.61845	.	.	ENSG00000109061	ENST00000226207	T	0.71579	-0.58	4.94	4.94	0.65067	Myosin head, motor domain (2);	0.000000	0.46442	U	0.000282	T	0.77418	0.4127	M	0.82132	2.575	0.58432	D	0.999997	P	0.38078	0.617	B	0.44085	0.44	T	0.81516	-0.0897	10	0.87932	D	0	.	15.0655	0.71992	0.0:0.0:0.0:1.0	.	700	P12882	MYH1_HUMAN	T	700	ENSP00000226207:N700T	ENSP00000226207:N700T	N	-	2	0	MYH1	10349929	1.000000	0.71417	0.896000	0.35187	0.920000	0.55202	7.698000	0.84413	2.216000	0.71823	0.528000	0.53228	AAC	.	.	none		0.468	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
SLC22A25	387601	hgsc.bcm.edu	37	11	62997098	62997098	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:62997098T>G	ENST00000306494.6	-	1	26	c.27A>C	c.(25-27)caA>caC	p.Q9H	SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						GGCCTCCAACTTGATCTAGGA	0.438																																					p.Q9H		Atlas-SNP	.											SLC22A25,right_upper_lobe,carcinoma,-2,1	SLC22A25	87	1	0			c.A27C						PASS	.						47.0	51.0	50.0					11																	62997098		2201	4298	6499	SO:0001583	missense	387601	exon1			TCCAACTTGATCT	AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.27A>C	11.37:g.62997098T>G	ENSP00000307443:p.Gln9His	42.0	0.0	0		54.0	13.0	0.240741	NM_199352		Missense_Mutation	SNP	ENST00000306494.6	37	CCDS31592.1	.	.	.	.	.	.	.	.	.	.	T	2.589	-0.295687	0.05532	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	T	0.36157	1.27	3.98	0.0938	0.14478	.	0.474947	0.22983	N	0.053281	T	0.28995	0.0720	M	0.65677	2.01	0.24828	N	0.992545	B;B	0.20671	0.01;0.047	B;B	0.23419	0.019;0.046	T	0.17531	-1.0366	10	0.30854	T	0.27	.	3.2687	0.06874	0.1778:0.3193:0.0:0.503	.	7;9	A4IF29;Q6T423	.;S22AP_HUMAN	H	9	ENSP00000307443:Q9H	ENSP00000307443:Q9H	Q	-	3	2	SLC22A25	62753674	0.256000	0.24012	0.031000	0.17742	0.131000	0.20780	1.426000	0.34870	0.062000	0.16340	0.386000	0.25728	CAA	.	.	none		0.438	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383519.3	NM_199352	
MAML2	84441	hgsc.bcm.edu	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q596Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,rectum,carcinoma,0,2	MAML2	94	2	1	Substitution - coding silent(1)	kidney(1)	c.G1788A						PASS	.						28.0	35.0	33.0					11																	95825407		2119	4148	6267	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T		192.0	0.0	0		180.0	23.0	0.127778	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|0.250;T|0.750	0.750	weak		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ZNF546	339327	hgsc.bcm.edu	37	19	40504295	40504295	+	Missense_Mutation	SNP	C	C	T	rs139751800	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr19:40504295C>T	ENST00000347077.4	+	3	278	c.62C>T	c.(61-63)cCt>cTt	p.P21L	ZNF546_ENST00000600094.1_Intron|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CAAATCATTCCTCTGCACTCA	0.403													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18331	0.0		0.0	False		,,,				2504	0.0				p.P21L		Atlas-SNP	.											.	ZNF546	93	.	0			c.C62T						PASS	.	C	LEU/PRO	4,4402	8.1+/-20.4	0,4,2199	95.0	92.0	93.0		62	-0.7	0.0	19	dbSNP_134	93	0,8600		0,0,4300	no	missense	ZNF546	NM_178544.3	98	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign	21/837	40504295	4,13002	2203	4300	6503	SO:0001583	missense	339327	exon3			TCATTCCTCTGCA	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.62C>T	19.37:g.40504295C>T	ENSP00000339823:p.Pro21Leu	107.0	0.0	0		103.0	31.0	0.300971	NM_178544	A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	c	6.834	0.523083	0.13066	9.08E-4	0.0	ENSG00000187187	ENST00000347077	T	0.06528	3.29	1.66	-0.677	0.11357	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43048	-0.9415	9	0.49607	T	0.09	.	2.2331	0.04002	0.3012:0.5036:0.0:0.1953	.	21	Q86UE3	ZN546_HUMAN	L	21	ENSP00000339823:P21L	ENSP00000339823:P21L	P	+	2	0	ZNF546	45196135	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.414000	0.07114	-0.099000	0.12263	-0.145000	0.13849	CCT	C|1.000;T|0.000	0.000	weak		0.403	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
ZBTB17	7709	hgsc.bcm.edu	37	1	16272337	16272337	+	Splice_Site	SNP	T	T	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:16272337T>A	ENST00000375743.4	-	6	768		c.e6-2		ZBTB17_ENST00000375733.2_Splice_Site|ZBTB17_ENST00000537142.1_Splice_Site|ZBTB17_ENST00000448462.2_Splice_Site|ZBTB17_ENST00000479282.1_5'Flank	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		GCTCTGCACCTGGGTGGGGGA	0.672																																					.		Atlas-SNP	.											.	ZBTB17	45	.	0			c.536-2A>T						PASS	.						41.0	48.0	46.0					1																	16272337		2203	4300	6503	SO:0001630	splice_region_variant	7709	exon7			TGCACCTGGGTGG	U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.536-2A>T	1.37:g.16272337T>A		16.0	0.0	0		16.0	5.0	0.3125	NM_003443	A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Splice_Site	SNP	ENST00000375743.4	37	CCDS165.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.340713	0.41498	.	.	ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000537142;ENST00000448462	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.584	0.33646	0.0:0.0:0.1946:0.8054	.	.	.	.	.	-1	.	.	.	-	.	.	ZBTB17	16144924	1.000000	0.71417	0.910000	0.35882	0.676000	0.39594	3.477000	0.53151	1.918000	0.55548	0.379000	0.24179	.	.	.	none		0.672	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025998.1	NM_003443	Intron
UNC45B	146862	hgsc.bcm.edu	37	17	33497208	33497208	+	Silent	SNP	C	C	T	rs531660473		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:33497208C>T	ENST00000268876.5	+	12	1720	c.1623C>T	c.(1621-1623)gaC>gaT	p.D541D	UNC45B_ENST00000591048.1_Intron|UNC45B_ENST00000433649.1_Silent_p.D541D|UNC45B_ENST00000394570.2_Silent_p.D541D|UNC45B_ENST00000378449.1_Intron	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	541					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TCACGCTGGACGCTGATGTGA	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18902	0.0		0.0	False		,,,				2504	0.0				p.D541D		Atlas-SNP	.											.	UNC45B	133	.	0			c.C1623T						PASS	.						77.0	62.0	67.0					17																	33497208		2203	4300	6503	SO:0001819	synonymous_variant	146862	exon12			GCTGGACGCTGAT	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.1623C>T	17.37:g.33497208C>T		169.0	0.0	0		150.0	23.0	0.153333	NM_001267052	Q495Q8|Q495Q9	Silent	SNP	ENST00000268876.5	37	CCDS11292.1																																																																																			.	.	none		0.617	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
AGAP1	116987	hgsc.bcm.edu	37	2	236715883	236715883	+	Splice_Site	SNP	T	T	C	rs202230563	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:236715883T>C	ENST00000304032.8	+	9	1538	c.958T>C	c.(958-960)Tct>Cct	p.S320P	AGAP1_ENST00000409457.1_Splice_Site_p.S320P|AGAP1_ENST00000428334.2_Splice_Site_p.S159P|AGAP1_ENST00000409538.1_Splice_Site_p.S585P|AGAP1_ENST00000336665.5_Splice_Site_p.S320P	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	320					protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TGCTTTGCAGTCTCGGAAAGG	0.532																																					p.S320P		Atlas-SNP	.											.	AGAP1	95	.	0			c.T958C						PASS	.	T	PRO/SER,PRO/SER	0,4406		0,0,2203	80.0	88.0	86.0		958,958	5.1	1.0	2		86	4,8596	3.7+/-12.6	0,4,4296	yes	missense-near-splice,missense-near-splice	AGAP1	NM_001037131.2,NM_014914.4	74,74	0,4,6499	CC,CT,TT		0.0465,0.0,0.0308	probably-damaging,probably-damaging	320/858,320/805	236715883	4,13002	2203	4300	6503	SO:0001630	splice_region_variant	116987	exon9			TTGCAGTCTCGGA	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.958-1T>C	2.37:g.236715883T>C		38.0	0.0	0		57.0	5.0	0.0877193	NM_014914	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	ENST00000304032.8	37	CCDS33408.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336551	0.41398	0.0	4.65E-4	ENSG00000157985	ENST00000409457;ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334	T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.48003	0.1476	L	0.46157	1.445	0.80722	D	1	D;D	0.69078	0.997;0.992	D;D	0.78314	0.991;0.98	T	0.36456	-0.9747	9	.	.	.	.	15.2676	0.73675	0.0:0.0:0.0:1.0	.	320;320	Q9UPQ3-2;Q9UPQ3	.;AGAP1_HUMAN	P	320;320;320;585;159	ENSP00000387174:S320P;ENSP00000307634:S320P;ENSP00000338378:S320P;ENSP00000386897:S585P;ENSP00000411824:S159P	.	S	+	1	0	AGAP1	236380622	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.731000	0.84895	2.064000	0.61679	0.533000	0.62120	TCT	T|0.998;C|0.002	0.002	strong		0.532	AGAP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257076.2	NM_014914	Missense_Mutation
CEPT1	10390	hgsc.bcm.edu	37	1	111724864	111724864	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:111724864G>A	ENST00000545121.1	+	6	978	c.770G>A	c.(769-771)gGg>gAg	p.G257E	RP5-1180E21.4_ENST00000607951.1_RNA|CEPT1_ENST00000467362.1_3'UTR|RP5-1180E21.5_ENST00000610049.1_RNA|CEPT1_ENST00000357172.4_Missense_Mutation_p.G257E	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1	257					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	ACTGTAGCAGGGACCATATTT	0.333																																					p.G257E		Atlas-SNP	.											.	CEPT1	25	.	0			c.G770A						PASS	.						84.0	80.0	82.0					1																	111724864		2203	4300	6503	SO:0001583	missense	10390	exon6			TAGCAGGGACCAT	AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.770G>A	1.37:g.111724864G>A	ENSP00000441980:p.Gly257Glu	137.0	0.0	0		137.0	36.0	0.262774	NM_006090	Q69YJ9|Q9P0Y8	Missense_Mutation	SNP	ENST00000545121.1	37	CCDS830.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039564	0.93630	.	.	ENSG00000134255	ENST00000545121;ENST00000357172	T;T	0.51325	0.71;0.71	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.67249	0.2873	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63139	-0.6704	10	0.30854	T	0.27	-5.595	18.3537	0.90348	0.0:0.0:1.0:0.0	.	257	Q9Y6K0	CEPT1_HUMAN	E	257	ENSP00000441980:G257E;ENSP00000349696:G257E	ENSP00000349696:G257E	G	+	2	0	CEPT1	111526387	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.937000	0.99478	0.650000	0.86243	GGG	.	.	none		0.333	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034462.2	NM_006090	
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45970771	45970771	+	Missense_Mutation	SNP	C	C	T	rs200215960|rs67692969|rs71199610	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr21:45970771C>T	ENST00000391621.1	-	1	617	c.571G>A	c.(571-573)Gtc>Atc	p.V191I	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	191	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						TTGCAGCAGACAGGCTTGCAG	0.612																																					p.V191I		Atlas-SNP	.											.	KRTAP10-2	21	.	0			c.G571A						PASS	.						114.0	116.0	115.0					21																	45970771		2203	4299	6502	SO:0001583	missense	386679	exon1			AGCAGACAGGCTT	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.571G>A	21.37:g.45970771C>T	ENSP00000375479:p.Val191Ile	100.0	0.0	0		125.0	12.0	0.096	NM_198693	Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	c	9.177	1.022646	0.19433	.	.	ENSG00000205445	ENST00000391621	T	0.01430	4.9	3.28	-6.57	0.01842	.	.	.	.	.	T	0.01627	0.0052	L	0.60904	1.88	0.09310	N	1	B	0.22604	0.072	B	0.26614	0.071	T	0.44697	-0.9311	9	0.62326	D	0.03	.	3.2055	0.06665	0.2595:0.2667:0.3822:0.0916	.	191	P60368	KR102_HUMAN	I	191	ENSP00000375479:V191I	ENSP00000375479:V191I	V	-	1	0	KRTAP10-2	44795199	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.395000	0.02516	-1.216000	0.02607	0.462000	0.41574	GTC	C|0.956;T|0.044	0.044	strong		0.612	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
DOCK1	1793	hgsc.bcm.edu	37	10	128807004	128807004	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:128807004G>A	ENST00000280333.6	+	11	1103	c.994G>A	c.(994-996)Gta>Ata	p.V332I	RP11-223P11.3_ENST00000595456.1_RNA|RP11-223P11.3_ENST00000601242.1_RNA|RP11-223P11.3_ENST00000601826.1_RNA|RP11-223P11.3_ENST00000594614.1_RNA|RP11-223P11.3_ENST00000594559.1_RNA	NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	332					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		AGTGATGGATGTAACAGATAT	0.353																																					p.V332I		Atlas-SNP	.											.	DOCK1	188	.	0			c.G994A						PASS	.						77.0	76.0	76.0					10																	128807004		1953	4194	6147	SO:0001583	missense	1793	exon11			ATGGATGTAACAG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.994G>A	10.37:g.128807004G>A	ENSP00000280333:p.Val332Ile	141.0	0.0	0		107.0	14.0	0.130841	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	7.557	0.663827	0.14710	.	.	ENSG00000150760	ENST00000280333	T	0.16457	2.34	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.04363	0.0120	N	0.00280	-1.71	0.54753	D	0.999984	B;B	0.16166	0.008;0.016	B;B	0.14023	0.01;0.01	T	0.40905	-0.9538	10	0.02654	T	1	.	18.5603	0.91097	0.0:0.0:1.0:0.0	.	332;332	B2RUU3;Q14185	.;DOCK1_HUMAN	I	332	ENSP00000280333:V332I	ENSP00000280333:V332I	V	+	1	0	DOCK1	128696994	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.530000	0.81962	2.624000	0.88883	0.650000	0.86243	GTA	.	.	none		0.353	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
ARHGAP44	9912	hgsc.bcm.edu	37	17	12859254	12859254	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:12859254G>A	ENST00000379672.5	+	14	1507	c.1207G>A	c.(1207-1209)Gca>Aca	p.A403T	ARHGAP44_ENST00000340825.3_Missense_Mutation_p.A403T|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.A403T	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	403	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						CAGTAATATGGCAATTGTTTT	0.428																																					p.A403T		Atlas-SNP	.											.	ARHGAP44	55	.	0			c.G1207A						PASS	.						72.0	69.0	70.0					17																	12859254		1959	4140	6099	SO:0001583	missense	9912	exon14			AATATGGCAATTG		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.1207G>A	17.37:g.12859254G>A	ENSP00000368994:p.Ala403Thr	236.0	0.0	0		210.0	38.0	0.180952	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	ENST00000379672.5	37	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.406245	0.62288	.	.	ENSG00000006740	ENST00000379672;ENST00000544416;ENST00000340825	T;T	0.25250	1.81;1.81	5.89	5.89	0.94794	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	H	0.97564	4.03	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.91635	0.999;0.998;0.997;0.992	T	0.79415	-0.1813	10	0.87932	D	0	.	17.7556	0.88447	0.0:0.0:1.0:0.0	.	403;48;65;403	A6NCP5;Q9Y4Q4;F5H6L3;Q17R89	.;.;.;RHG44_HUMAN	T	403;65;403	ENSP00000368994:A403T;ENSP00000342566:A403T	ENSP00000342566:A403T	A	+	1	0	ARHGAP44	12799979	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.420000	0.97426	2.793000	0.96121	0.655000	0.94253	GCA	.	.	none		0.428	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
RNF216	54476	hgsc.bcm.edu	37	7	5662542	5662542	+	Silent	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:5662542C>T	ENST00000425013.2	-	17	2774	c.2550G>A	c.(2548-2550)ctG>ctA	p.L850L	RNF216_ENST00000389902.3_Silent_p.L907L|RNF216_ENST00000469375.1_5'Flank	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	850	Pro-rich.				apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		GGTTGTGCTCCAGGGGCATGT	0.617																																					p.L907L		Atlas-SNP	.											.	RNF216	71	.	0			c.G2721A						PASS	.						108.0	118.0	114.0					7																	5662542		2203	4300	6503	SO:0001819	synonymous_variant	54476	exon17			GTGCTCCAGGGGC	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.2550G>A	7.37:g.5662542C>T		47.0	0.0	0		51.0	8.0	0.156863	NM_207111	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Silent	SNP	ENST00000425013.2	37	CCDS34595.1																																																																																			.	.	none		0.617	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
OR5AP2	338675	hgsc.bcm.edu	37	11	56409697	56409697	+	Silent	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:56409697A>C	ENST00000302981.1	-	1	218	c.219T>G	c.(217-219)tcT>tcG	p.S73S	OR5AP2_ENST00000544374.1_Silent_p.S74S	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						CATCTACAAAAGAGAGGCTAC	0.443																																					p.S73S		Atlas-SNP	.											.	OR5AP2	69	.	0			c.T219G						PASS	.						65.0	64.0	65.0					11																	56409697		2201	4296	6497	SO:0001819	synonymous_variant	338675	exon1			TACAAAAGAGAGG	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.219T>G	11.37:g.56409697A>C		82.0	0.0	0		102.0	15.0	0.147059	NM_001002925	B2RNM8	Silent	SNP	ENST00000302981.1	37	CCDS31534.1																																																																																			.	.	none		0.443	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925	
GNL2	29889	hgsc.bcm.edu	37	1	38032563	38032563	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:38032563G>A	ENST00000373062.3	-	16	2187	c.2089C>T	c.(2089-2091)Cgc>Tgc	p.R697C	GNL2_ENST00000462812.1_5'UTR	NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	697					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				TCATAGTAGCGCACACCAACT	0.403																																					p.R697C		Atlas-SNP	.											.	GNL2	58	.	0			c.C2089T						PASS	.						188.0	170.0	176.0					1																	38032563		2203	4300	6503	SO:0001583	missense	29889	exon16			AGTAGCGCACACC	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.2089C>T	1.37:g.38032563G>A	ENSP00000362153:p.Arg697Cys	142.0	0.0	0		133.0	27.0	0.203008	NM_013285	Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	CCDS421.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138938	0.94560	.	.	ENSG00000134697	ENST00000373062	T	0.25579	1.79	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.52386	0.1731	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.52503	-0.8567	10	0.72032	D	0.01	-9.6294	19.4985	0.95083	0.0:0.0:1.0:0.0	.	697	Q13823	NOG2_HUMAN	C	697	ENSP00000362153:R697C	ENSP00000362153:R697C	R	-	1	0	GNL2	37805150	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	7.721000	0.84768	2.698000	0.92095	0.561000	0.74099	CGC	.	.	none		0.403	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
DDX42	11325	hgsc.bcm.edu	37	17	61895140	61895140	+	Silent	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:61895140T>C	ENST00000578681.1	+	19	2800	c.2199T>C	c.(2197-2199)agT>agC	p.S733S	DDX42_ENST00000457800.2_Silent_p.S733S|DDX42_ENST00000583590.1_Silent_p.S733S|DDX42_ENST00000359353.5_Silent_p.S614S|DDX42_ENST00000582985.1_Intron|DDX42_ENST00000389924.2_Silent_p.S733S	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	733					protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GGTGGACTAGTGCAGGGAGCT	0.517																																					p.S733S		Atlas-SNP	.											.	DDX42	86	.	0			c.T2199C						PASS	.						105.0	98.0	100.0					17																	61895140		2203	4300	6503	SO:0001819	synonymous_variant	11325	exon18			GACTAGTGCAGGG	BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.2199T>C	17.37:g.61895140T>C		208.0	0.0	0		215.0	44.0	0.204651	NM_203499	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Silent	SNP	ENST00000578681.1	37	CCDS32704.1																																																																																			.	.	none		0.517	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444368.1	NM_007372	
TBC1D14	57533	hgsc.bcm.edu	37	4	7008366	7008366	+	Silent	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:7008366T>C	ENST00000409757.4	+	9	1483	c.1359T>C	c.(1357-1359)ggT>ggC	p.G453G	TBC1D14_ENST00000451522.2_Silent_p.G173G|TBC1D14_ENST00000448507.1_Silent_p.G453G|TBC1D14_ENST00000410031.1_Silent_p.G225G|TBC1D14_ENST00000446947.2_Silent_p.G66G	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	453	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						CAGATGCTGGTTTTTCAGCAG	0.403																																					p.G453G		Atlas-SNP	.											.	TBC1D14	110	.	0			c.T1359C						PASS	.						90.0	89.0	90.0					4																	7008366		2203	4300	6503	SO:0001819	synonymous_variant	57533	exon9			TGCTGGTTTTTCA	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1359T>C	4.37:g.7008366T>C		98.0	0.0	0		125.0	26.0	0.208	NM_001113361	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Silent	SNP	ENST00000409757.4	37	CCDS3394.2																																																																																			.	.	none		0.403	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
SGK1	6446	hgsc.bcm.edu	37	6	134494704	134494704	+	Splice_Site	SNP	G	G	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:134494704G>C	ENST00000237305.7	-	4	317	c.229C>G	c.(229-231)Cca>Gca	p.P77A	SGK1_ENST00000475719.2_Splice_Site_p.P77A|SGK1_ENST00000367858.5_Splice_Site_p.P172A|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000413996.3_Splice_Site_p.P91A|SGK1_ENST00000528577.1_Splice_Site_p.P105A|SGK1_ENST00000367857.5_Splice_Site_p.P67A	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	77					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)	p.P172S(1)|p.P77S(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GAAGGACTTGGCTAGAAAAAA	0.368																																					p.P172A		Atlas-SNP	.											SGK1_ENST00000528577,NS,lymphoid_neoplasm,0,6	SGK1	387	6	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.C514G						PASS	.						44.0	48.0	47.0					6																	134494704		2203	4300	6503	SO:0001630	splice_region_variant	6446	exon6			GACTTGGCTAGAA	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.229-1C>G	6.37:g.134494704G>C		51.0	0.0	0		50.0	5.0	0.1	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.594913	0.46318	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.72394	3.18;3.18;3.18;3.18;3.18;-0.65	6.02	6.02	0.97574	Protein kinase-like domain (1);	0.050195	0.85682	D	0.000000	T	0.56558	0.1993	M	0.62723	1.935	0.80722	D	1	B;P;B;B;B;B	0.42871	0.065;0.792;0.014;0.05;0.232;0.008	B;B;B;B;B;B	0.34138	0.064;0.121;0.028;0.061;0.176;0.011	T	0.59359	-0.7469	10	0.21014	T	0.42	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	105;91;77;67;172;77	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	A	172;91;77;67;105;77;141	ENSP00000356832:P172A;ENSP00000396242:P91A;ENSP00000237305:P77A;ENSP00000356831:P67A;ENSP00000434450:P105A;ENSP00000434302:P77A	ENSP00000237305:P77A	P	-	1	0	SGK1	134536397	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.563000	0.82314	2.865000	0.98341	0.655000	0.94253	CCA	.	.	none		0.368	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		Missense_Mutation
RHOA	387	hgsc.bcm.edu	37	3	49413009	49413009	+	Missense_Mutation	SNP	C	C	T	rs11552758		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:49413009C>T	ENST00000418115.1	-	2	398	c.14G>A	c.(13-15)cGg>cAg	p.R5Q	RHOA_ENST00000422781.1_Missense_Mutation_p.R5Q|RHOA_ENST00000454011.2_Missense_Mutation_p.R5Q	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A	5					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.R5Q(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CAGTTTCTTCCGGATGGCAGC	0.473																																					p.R5Q		Atlas-SNP	.											RHOA,NS,lymphoid_neoplasm,0,7	RHOA	46	7	1	Substitution - Missense(1)	large_intestine(1)	c.G14A						PASS	.						106.0	97.0	100.0					3																	49413009		2203	4300	6503	SO:0001583	missense	387	exon2			TTCTTCCGGATGG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838	ENST00000418115.1:c.14G>A	3.37:g.49413009C>T	ENSP00000400175:p.Arg5Gln	233.0	0.0	0		171.0	51.0	0.298246	NM_001664	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	C	33	5.291209	0.95546	.	.	ENSG00000067560	ENST00000418115;ENST00000454011;ENST00000422781;ENST00000445425;ENST00000431929	T;T;T;T;T	0.70399	-0.3;1.78;-0.33;-0.48;2.14	5.89	5.89	0.94794	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	T	0.65943	0.2740	L	0.38175	1.15	0.80722	D	1	B	0.18166	0.026	B	0.20184	0.028	T	0.61926	-0.6962	10	0.87932	D	0	.	18.8947	0.92419	0.0:1.0:0.0:0.0	.	5	P61586	RHOA_HUMAN	Q	5	ENSP00000400175:R5Q;ENSP00000394483:R5Q;ENSP00000413587:R5Q;ENSP00000408402:R5Q;ENSP00000400747:R5Q	ENSP00000400175:R5Q	R	-	2	0	RHOA	49388013	1.000000	0.71417	0.999000	0.59377	0.896000	0.52359	7.652000	0.83633	2.809000	0.96659	0.558000	0.71614	CGG	.	.	weak		0.473	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
KALRN	8997	hgsc.bcm.edu	37	3	124103697	124103697	+	Silent	SNP	G	G	A	rs574174504	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:124103697G>A	ENST00000240874.3	+	11	1927	c.1770G>A	c.(1768-1770)acG>acA	p.T590T	KALRN_ENST00000460856.1_Silent_p.T590T|KALRN_ENST00000360013.3_Silent_p.T590T	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	590					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GGCAGAATACGTACACCAATG	0.612													G|||	2	0.000399361	0.0	0.0029	5008	,	,		17008	0.0		0.0	False		,,,				2504	0.0				p.T590T		Atlas-SNP	.											KALRN_ENST00000360013,NS,carcinoma,+1,4	KALRN	556	4	0			c.G1770A						PASS	.						83.0	71.0	75.0					3																	124103697		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon11			GAATACGTACACC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.1770G>A	3.37:g.124103697G>A		277.0	0.0	0		279.0	52.0	0.18638	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	37	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	G	7.665	0.685732	0.14973	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.35	-10.7	0.00240	.	.	.	.	.	T	0.40398	0.1115	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50816	-0.8783	4	.	.	.	.	4.2215	0.10559	0.1084:0.3716:0.3202:0.1998	.	.	.	.	H	568	.	.	R	+	2	0	KALRN	125586387	0.000000	0.05858	0.080000	0.20451	0.960000	0.62799	-4.083000	0.00298	-3.444000	0.00162	-0.878000	0.02970	CGT	.	.	none		0.612	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
PLOD2	5352	hgsc.bcm.edu	37	3	145841964	145841964	+	Silent	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:145841964T>G	ENST00000360060.3	-	2	339	c.162A>C	c.(160-162)cgA>cgC	p.R54R	PLOD2_ENST00000494950.1_5'UTR|PLOD2_ENST00000282903.5_Silent_p.R54R	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	54					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	ACTGCATAAATCGATGGAATC	0.313																																					p.R54R		Atlas-SNP	.											PLOD2,colon,carcinoma,-2,5	PLOD2	81	5	0			c.A162C						PASS	.						154.0	151.0	152.0					3																	145841964		2202	4299	6501	SO:0001819	synonymous_variant	5352	exon2			CATAAATCGATGG	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.162A>C	3.37:g.145841964T>G		85.0	0.0	0		97.0	16.0	0.164948	NM_182943	B3KWS3|Q59ED2|Q8N170	Silent	SNP	ENST00000360060.3	37	CCDS3131.1																																																																																			.	.	none		0.313	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
USH2A	7399	hgsc.bcm.edu	37	1	216221971	216221971	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:216221971A>G	ENST00000307340.3	-	31	6454	c.6068T>C	c.(6067-6069)cTa>cCa	p.L2023P	USH2A_ENST00000366943.2_Missense_Mutation_p.L2023P	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2023	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTGAAGGGTAGCAAGCCTGT	0.413										HNSCC(13;0.011)																											p.L2023P		Atlas-SNP	.											.	USH2A	1168	.	0			c.T6068C						PASS	.						161.0	158.0	159.0					1																	216221971		2203	4300	6503	SO:0001583	missense	7399	exon31			AAGGGTAGCAAGC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6068T>C	1.37:g.216221971A>G	ENSP00000305941:p.Leu2023Pro	167.0	0.0	0		175.0	50.0	0.285714	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	11.46	1.644095	0.29246	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.57907	0.37;0.37	6.16	3.75	0.43078	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.558741	0.13626	N	0.374070	T	0.64000	0.2559	M	0.70275	2.135	0.34933	D	0.749578	D	0.53885	0.963	P	0.60541	0.876	T	0.65010	-0.6272	10	0.30854	T	0.27	.	6.883	0.24183	0.4969:0.1739:0.0:0.3292	.	2023	O75445	USH2A_HUMAN	P	2023	ENSP00000305941:L2023P;ENSP00000355910:L2023P	ENSP00000305941:L2023P	L	-	2	0	USH2A	214288594	0.218000	0.23608	0.304000	0.25085	0.998000	0.95712	0.502000	0.22594	0.491000	0.27793	0.528000	0.53228	CTA	.	.	none		0.413	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CD274	29126	hgsc.bcm.edu	37	9	5457196	5457196	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr9:5457196G>A	ENST00000381577.3	+	3	256	c.170G>A	c.(169-171)tGg>tAg	p.W57*	CD274_ENST00000498261.1_3'UTR|CD274_ENST00000381573.4_Intron	NM_014143.3	NP_054862.1	Q9NZQ7	PD1L1_HUMAN	CD274 molecule	57	Ig-like V-type.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000742)|Lung(218;0.111)		ATTGTCTATTGGGAAATGGAG	0.428			T	CIITA	"""PMBL, Hodgkin Lymphona, """																																p.W57X		Atlas-SNP	.		Dom	yes		9	9p24	29126	CD274 molecule		L	CD274,spleen,lymphoid_neoplasm,-1,1	CD274	26	1	0			c.G170A						PASS	.						94.0	94.0	94.0					9																	5457196		2203	4300	6503	SO:0001587	stop_gained	29126	exon3			TCTATTGGGAAAT	AF177937	CCDS6464.1, CCDS59118.1	9p24.1	2014-01-30	2006-03-28	2005-02-25	ENSG00000120217	ENSG00000120217		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17635	protein-coding gene	gene with protein product	"""B7 homolog 1"""	605402	"""programmed cell death 1 ligand 1"", ""CD274 antigen"""	PDCD1LG1		11015443, 10581077	Standard	NM_014143		Approved	B7-H, B7H1, PD-L1, PDL1, B7-H1	uc003zje.3	Q9NZQ7	OTTHUMG00000019503	ENST00000381577.3:c.170G>A	9.37:g.5457196G>A	ENSP00000370989:p.Trp57*	93.0	0.0	0		130.0	20.0	0.153846	NM_014143	B2RBA2|B4DU27|Q14CJ2|Q2V8D5|Q66RK1|Q6WEX4|Q9NUZ5	Nonsense_Mutation	SNP	ENST00000381577.3	37	CCDS6464.1	.	.	.	.	.	.	.	.	.	.	G	37	6.439266	0.97568	.	.	ENSG00000120217	ENST00000381577	.	.	.	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-5.8249	18.3892	0.90477	0.0:0.0:1.0:0.0	.	.	.	.	X	57	.	ENSP00000370989:W57X	W	+	2	0	CD274	5447196	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	6.301000	0.72782	2.791000	0.96007	0.655000	0.94253	TGG	.	.	none		0.428	CD274-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051631.2	NM_014143	
MTNR1A	4543	hgsc.bcm.edu	37	4	187455075	187455075	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:187455075T>C	ENST00000307161.5	-	2	1022	c.821A>G	c.(820-822)gAg>gGg	p.E274G	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	274					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	AAACAGCCACTCTGGGATCCT	0.502																																					p.E274G		Atlas-SNP	.											.	MTNR1A	46	.	0			c.A821G						PASS	.						73.0	79.0	77.0					4																	187455075		2203	4300	6503	SO:0001583	missense	4543	exon2			AGCCACTCTGGGA		CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.821A>G	4.37:g.187455075T>C	ENSP00000302811:p.Glu274Gly	131.0	0.0	0		137.0	14.0	0.10219	NM_005958	A0AVC5|B0M0L2	Missense_Mutation	SNP	ENST00000307161.5	37	CCDS3848.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.224502	0.79576	.	.	ENSG00000168412	ENST00000307161	T	0.73047	-0.71	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.049677	0.85682	D	0.000000	T	0.77398	0.4124	M	0.89353	3.025	0.80722	D	1	B	0.29909	0.261	B	0.36378	0.223	T	0.76963	-0.2764	10	0.33940	T	0.23	-23.224	14.6218	0.68592	0.0:0.0:0.0:1.0	.	274	P48039	MTR1A_HUMAN	G	274	ENSP00000302811:E274G	ENSP00000302811:E274G	E	-	2	0	MTNR1A	187692069	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	6.145000	0.71769	1.860000	0.53959	0.533000	0.62120	GAG	.	.	none		0.502	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1		
C1orf87	127795	hgsc.bcm.edu	37	1	60491072	60491072	+	Splice_Site	SNP	C	C	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:60491072C>G	ENST00000371201.3	-	8	1235		c.e8+1		C1orf87_ENST00000450089.2_Splice_Site	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87								calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AGTTGACTTACTTTATTTCAT	0.388																																					.	NSCLC(75;811 1386 4923 13371 51772)	Atlas-SNP	.											.	C1orf87	55	.	0			c.1127+1G>C						PASS	.						120.0	121.0	121.0					1																	60491072		2203	4300	6503	SO:0001630	splice_region_variant	127795	exon9			GACTTACTTTATT	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.1127+1G>C	1.37:g.60491072C>G		77.0	0.0	0		79.0	20.0	0.253165	NM_152377	Q6ZU07|Q8IVS0	Splice_Site	SNP	ENST00000371201.3	37	CCDS614.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.060848	0.55432	.	.	ENSG00000162598	ENST00000371201;ENST00000450089	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.851	0.63496	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C1orf87	60263660	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	3.775000	0.55349	2.648000	0.89879	0.555000	0.69702	.	.	.	none		0.388	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377	Intron
HIST1H2BL	8340	hgsc.bcm.edu	37	6	27775641	27775641	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:27775641G>A	ENST00000377401.2	-	1	68	c.44C>T	c.(43-45)tCc>tTc	p.S15F	HIST1H2AI_ENST00000358739.3_5'Flank|HIST1H3H_ENST00000369163.2_5'Flank	NM_003519.3	NP_003510.1	Q99880	H2B1L_HUMAN	histone cluster 1, H2bl	15					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(7)|urinary_tract(1)	12						CGCCTTCTTGGAGCCCTTCTT	0.527																																					p.S15F		Atlas-SNP	.											.	HIST1H2BL	48	.	0			c.C44T						PASS	.						98.0	99.0	99.0					6																	27775641		2203	4300	6503	SO:0001583	missense	8340	exon1			TTCTTGGAGCCCT	Z83740	CCDS4625.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000185130	ENSG00000185130		"""Histones / Replication-dependent"""	4748	protein-coding gene	gene with protein product		602800	"""H2B histone family, member C"", ""histone 1, H2bl"""	H2BFC		9439656, 12408966	Standard	NM_003519		Approved	H2B/c, dJ97D16.4	uc003njl.3	Q99880	OTTHUMG00000014485	ENST00000377401.2:c.44C>T	6.37:g.27775641G>A	ENSP00000366618:p.Ser15Phe	272.0	0.0	0		286.0	71.0	0.248252	NM_003519	B2R5A3|Q52LW9	Missense_Mutation	SNP	ENST00000377401.2	37	CCDS4625.1	.	.	.	.	.	.	.	.	.	.	.	24.0	4.484608	0.84854	.	.	ENSG00000185130	ENST00000377401	T	0.22945	1.93	4.35	4.35	0.52113	Histone-fold (2);	.	.	.	.	T	0.33177	0.0854	L	0.45228	1.405	0.58432	D	0.999991	D	0.69078	0.997	D	0.71656	0.974	T	0.05022	-1.0911	9	0.46703	T	0.11	.	16.7381	0.85452	0.0:0.0:1.0:0.0	.	15	Q99880	H2B1L_HUMAN	F	15	ENSP00000366618:S15F	ENSP00000366618:S15F	S	-	2	0	HIST1H2BL	27883620	1.000000	0.71417	0.997000	0.53966	0.633000	0.38033	4.668000	0.61568	2.331000	0.79229	0.650000	0.86243	TCC	.	.	none		0.527	HIST1H2BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040153.1	NM_003519	
ABR	29	hgsc.bcm.edu	37	17	970326	970326	+	Silent	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:970326G>A	ENST00000302538.5	-	10	1319	c.1173C>T	c.(1171-1173)atC>atT	p.I391I	ABR_ENST00000536794.2_Silent_p.I173I|ABR_ENST00000544583.2_Silent_p.I345I|ABR_ENST00000291107.2_Silent_p.I354I|ABR_ENST00000574437.1_Silent_p.I345I	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	391	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CCTCCTTCTGGATTTCACTCT	0.572																																					p.I391I	Esophageal Squamous(197;2016 2115 4129 29033 46447)	Atlas-SNP	.											.	ABR	119	.	0			c.C1173T						PASS	.						55.0	43.0	47.0					17																	970326		2203	4300	6503	SO:0001819	synonymous_variant	29	exon10			CTTCTGGATTTCA	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1173C>T	17.37:g.970326G>A		110.0	0.0	0		76.0	21.0	0.276316	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Silent	SNP	ENST00000302538.5	37	CCDS10999.1																																																																																			.	.	none		0.572	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
CTTNBP2	83992	hgsc.bcm.edu	37	7	117368154	117368154	+	Silent	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:117368154T>C	ENST00000160373.3	-	17	4135	c.4044A>G	c.(4042-4044)caA>caG	p.Q1348Q		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1348					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCACTGTCACTTGGGCATGCC	0.498																																					p.Q1348Q		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.A4044G						PASS	.						78.0	83.0	82.0					7																	117368154		2203	4300	6503	SO:0001819	synonymous_variant	83992	exon17			TGTCACTTGGGCA		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4044A>G	7.37:g.117368154T>C		182.0	0.0	0		177.0	33.0	0.186441	NM_033427	O43389|Q7LG11|Q9C0A5	Silent	SNP	ENST00000160373.3	37	CCDS5774.1	.	.	.	.	.	.	.	.	.	.	T	8.983	0.975850	0.18736	.	.	ENSG00000077063	ENST00000446636	.	.	.	5.43	0.0764	0.14403	.	.	.	.	.	T	0.44623	0.1302	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28554	-1.0040	4	.	.	.	3.8122	4.251	0.10695	0.2507:0.22:0.0:0.5293	.	.	.	.	G	836	.	.	S	-	1	0	CTTNBP2	117155390	0.004000	0.15560	0.997000	0.53966	0.975000	0.68041	-0.307000	0.08167	0.414000	0.25790	0.528000	0.53228	AGT	.	.	none		0.498	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
SEC62	7095	hgsc.bcm.edu	37	3	169684611	169684611	+	Start_Codon_SNP	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:169684611A>G	ENST00000337002.4	+	1	59	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RP11-379K17.4_ENST00000487580.1_RNA|SEC62_ENST00000480708.1_Start_Codon_SNP_p.M1V|RP11-379K17.4_ENST00000469301.1_RNA|RP11-379K17.4_ENST00000483289.2_RNA|RP11-379K17.4_ENST00000600502.1_RNA	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	1					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						AGCGGCCAACATGGCGGAACG	0.672																																					p.M1V		Atlas-SNP	.											.	SEC62	27	.	0			c.A1G						PASS	.						26.0	23.0	24.0					3																	169684611		2137	4176	6313	SO:0001582	initiator_codon_variant	7095	exon1			GCCAACATGGCGG	D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.1A>G	3.37:g.169684611A>G	ENSP00000337688:p.Met1Val	214.0	0.0	0		173.0	33.0	0.190751	NM_003262	D3DNQ0|O00682|O00729	Missense_Mutation	SNP	ENST00000337002.4	37	CCDS3210.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.382105	0.61845	.	.	ENSG00000008952	ENST00000337002;ENST00000537426;ENST00000544081;ENST00000480708	.	.	.	4.92	4.92	0.64577	.	0.095017	0.64402	D	0.000001	T	0.60996	0.2312	.	.	.	0.80722	D	1	B	0.31435	0.323	B	0.38194	0.267	T	0.65294	-0.6203	8	0.87932	D	0	-9.7133	12.5634	0.56295	1.0:0.0:0.0:0.0	.	1	Q99442	SEC62_HUMAN	V	1	.	ENSP00000337688:M1V	M	+	1	0	SEC62	171167305	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.666000	0.74446	2.052000	0.61016	0.460000	0.39030	ATG	.	.	none		0.672	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352043.1		Missense_Mutation
ZNF471	57573	hgsc.bcm.edu	37	19	57036891	57036891	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr19:57036891A>C	ENST00000308031.5	+	5	1588	c.1455A>C	c.(1453-1455)aaA>aaC	p.K485N	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_3'UTR	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	485					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		CTGGTGAAAAACCCTATGAAT	0.383																																					p.K485N	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	Atlas-SNP	.											.	ZNF471	99	.	0			c.A1455C						PASS	.						55.0	56.0	55.0					19																	57036891		2203	4300	6503	SO:0001583	missense	57573	exon5			TGAAAAACCCTAT	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.1455A>C	19.37:g.57036891A>C	ENSP00000309161:p.Lys485Asn	64.0	0.0	0		61.0	7.0	0.114754	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	37	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.913227	0.52439	.	.	ENSG00000196263	ENST00000308031	T	0.26067	1.76	3.66	2.59	0.31030	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43166	0.1235	M	0.76727	2.345	0.80722	D	1	D	0.76494	0.999	D	0.65684	0.937	T	0.27434	-1.0074	9	0.72032	D	0.01	.	5.8421	0.18639	0.8355:0.0:0.1645:0.0	.	485	Q9BX82	ZN471_HUMAN	N	485	ENSP00000309161:K485N	ENSP00000309161:K485N	K	+	3	2	ZNF471	61728703	0.004000	0.15560	0.997000	0.53966	0.985000	0.73830	-0.726000	0.04936	0.497000	0.27926	0.379000	0.24179	AAA	.	.	none		0.383	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
COL4A3	1285	hgsc.bcm.edu	37	2	228173618	228173618	+	Missense_Mutation	SNP	C	C	A	rs200818438		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:228173618C>A	ENST00000396578.3	+	49	4628	c.4466C>A	c.(4465-4467)aCt>aAt	p.T1489N	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	1489	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.|Required for the anti-angiogenic activity of tumstatin.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TCATTAGGAACTCTTGGCAGC	0.363																																					p.T1489N		Atlas-SNP	.											.	COL4A3	293	.	0			c.C4466A						PASS	.						104.0	93.0	97.0					2																	228173618		1903	4123	6026	SO:0001583	missense	1285	exon49			TAGGAACTCTTGG		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.4466C>A	2.37:g.228173618C>A	ENSP00000379823:p.Thr1489Asn	103.0	0.0	0		105.0	33.0	0.314286	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	ENST00000396578.3	37	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948596	0.73787	.	.	ENSG00000169031	ENST00000396578;ENST00000328380	D	0.94280	-3.39	5.97	5.97	0.96955	C-type lectin fold (1);	0.102311	0.43260	D	0.000584	D	0.96756	0.8941	M	0.86178	2.8	0.80722	D	1	D;D	0.63046	0.992;0.979	P;P	0.62740	0.906;0.884	D	0.95139	0.8262	10	0.31617	T	0.26	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	1489;1489	Q01955-2;Q01955	.;CO4A3_HUMAN	N	1489	ENSP00000379823:T1489N	ENSP00000327594:T1489N	T	+	2	0	COL4A3	227881862	1.000000	0.71417	0.998000	0.56505	0.927000	0.56198	7.487000	0.81328	2.836000	0.97738	0.655000	0.94253	ACT	.	.	alt		0.363	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
SPATA31E1	286234	hgsc.bcm.edu	37	9	90499849	90499849	+	Silent	SNP	C	C	T	rs148586576		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr9:90499849C>T	ENST00000325643.5	+	4	513	c.447C>T	c.(445-447)ggC>ggT	p.G149G		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	149					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G149G(1)									AGCTCGCTGGCGAAGGCAGCT	0.657																																					p.G149G		Atlas-SNP	.											C9orf79,colon,carcinoma,0,1	.	.	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C447T						PASS	.	C		7,4399		0,7,2196	28.0	29.0	29.0		447	-1.0	0.0	9	dbSNP_134	29	1,8597		0,1,4298	no	coding-synonymous	C9orf79	NM_178828.4		0,8,6494	TT,TC,CC		0.0116,0.1589,0.0615		149/1446	90499849	8,12996	2203	4299	6502	SO:0001819	synonymous_variant	286234	exon4			CGCTGGCGAAGGC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.447C>T	9.37:g.90499849C>T		86.0	0.0	0		71.0	8.0	0.112676	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	ENST00000325643.5	37	CCDS6676.1																																																																																			C|1.000;T|0.000	0.000	weak		0.657	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
PDCL3	79031	hgsc.bcm.edu	37	2	101188050	101188050	+	Splice_Site	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:101188050A>G	ENST00000264254.6	+	5	746		c.e5-1			NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)	p.?(1)		endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						TGTGTTTTATAGAATTCCCCT	0.388																																					.		Atlas-SNP	.											PDCL3,NS,carcinoma,0,1	PDCL3	27	1	1	Unknown(1)	lung(1)	c.369-2A>G						PASS	.						129.0	129.0	129.0					2																	101188050		2203	4300	6503	SO:0001630	splice_region_variant	79031	exon5			TTTTATAGAATTC	AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.369-1A>G	2.37:g.101188050A>G		45.0	0.0	0		29.0	7.0	0.241379	NM_024065	B2RA00|Q53S68	Splice_Site	SNP	ENST00000264254.6	37	CCDS33261.1	.	.	.	.	.	.	.	.	.	.	a	17.13	3.311619	0.60414	.	.	ENSG00000115539	ENST00000264254;ENST00000416255;ENST00000450127	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8181	0.78621	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDCL3	100554482	1.000000	0.71417	0.985000	0.45067	0.633000	0.38033	8.950000	0.93019	2.150000	0.67090	0.514000	0.50259	.	.	.	none		0.388	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329734.1	NM_024065	Intron
GABRG3	2567	hgsc.bcm.edu	37	15	27765242	27765242	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr15:27765242A>C	ENST00000333743.6	+	7	1091	c.837A>C	c.(835-837)aaA>aaC	p.K279N	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	279					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGATCAAAAAAGATGCTACGC	0.348																																					p.K279N	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											.	GABRG3	115	.	0			c.A837C						PASS	.						65.0	61.0	62.0					15																	27765242		1844	4105	5949	SO:0001583	missense	2567	exon7			CAAAAAAGATGCT		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.837A>C	15.37:g.27765242A>C	ENSP00000331912:p.Lys279Asn	112.0	0.0	0		124.0	26.0	0.209677	NM_033223	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	37	CCDS45195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.47|18.47	3.630222|3.630222	0.67015|0.67015	.|.	.|.	ENSG00000182256|ENSG00000182256	ENST00000333743;ENST00000554696|ENST00000451330	D;D|D	0.86097|0.86030	-2.07;-2.07|-2.06	5.3|5.3	1.55|1.55	0.23275|0.23275	Neurotransmitter-gated ion-channel transmembrane domain (2);|.	0.208504|0.208504	0.49916|0.49916	D|D	0.000133|0.000133	D|D	0.83982|0.83982	0.5372|0.5372	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	D|.	0.56521|.	0.976|.	P|.	0.62560|.	0.904|.	T|T	0.80908|0.80908	-0.1172|-0.1172	10|8	0.66056|0.54805	D|T	0.02|0.06	.|.	8.4792|8.4792	0.33032|0.33032	0.6971:0.0:0.3029:0.0|0.6971:0.0:0.3029:0.0	.|.	279|.	Q99928|.	GBRG3_HUMAN|.	N|T	279;221|42	ENSP00000331912:K279N;ENSP00000451862:K221N|ENSP00000390708:K42T	ENSP00000331912:K279N|ENSP00000390708:K88T	K|K	+|+	3|2	2|0	GABRG3|GABRG3	25438837|25438837	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.094000|1.094000	0.30951|0.30951	0.430000|0.430000	0.26230|0.26230	0.528000|0.528000	0.53228|0.53228	AAA|AAG	.	.	none		0.348	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
ZNF729	100287226	hgsc.bcm.edu	37	19	22496574	22496574	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr19:22496574A>G	ENST00000601693.1	+	4	473	c.355A>G	c.(355-357)Aat>Gat	p.N119D	ZNF729_ENST00000357491.6_Missense_Mutation_p.N119D			A6NN14	ZN729_HUMAN	zinc finger protein 729	119					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TGGACATAAGAATTTACGATT	0.363																																					p.N119D		Atlas-SNP	.											.	ZNF729	78	.	0			c.A355G						PASS	.																																			SO:0001583	missense	100287226	exon4			CATAAGAATTTAC		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.355A>G	19.37:g.22496574A>G	ENSP00000469582:p.Asn119Asp	68.0	0.0	0		71.0	16.0	0.225352	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	37	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	5.888	0.347981	0.11126	.	.	ENSG00000196350	ENST00000357491	T	0.06371	3.31	1.55	0.414	0.16406	.	.	.	.	.	T	0.04998	0.0134	L	0.38175	1.15	.	.	.	.	.	.	.	.	.	T	0.41662	-0.9496	6	0.10377	T	0.69	.	5.2286	0.15410	0.8235:0.0:0.1765:0.0	.	.	.	.	D	119	ENSP00000350085:N119D	ENSP00000350085:N119D	N	+	1	0	ZNF729	22288414	0.001000	0.12720	0.001000	0.08648	0.016000	0.09150	0.308000	0.19314	-0.099000	0.12263	0.397000	0.26171	AAT	.	.	none		0.363	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
SGK1	6446	hgsc.bcm.edu	37	6	134495169	134495169	+	Missense_Mutation	SNP	G	G	C	rs141028225		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:134495169G>C	ENST00000237305.7	-	3	290	c.202C>G	c.(202-204)Ctt>Gtt	p.L68V	SGK1_ENST00000475719.2_Missense_Mutation_p.L68V|SGK1_ENST00000367858.5_Missense_Mutation_p.L163V|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000413996.3_Missense_Mutation_p.L82V|SGK1_ENST00000528577.1_Missense_Mutation_p.L96V|SGK1_ENST00000367857.5_Missense_Mutation_p.L58V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	68					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GCATTCATAAGCTCAGGCTCC	0.478																																					p.L163V		Atlas-SNP	.											.	SGK1	387	.	0			c.C487G						PASS	.	G	VAL/LEU,VAL/LEU,VAL/LEU,VAL/LEU	0,4406		0,0,2203	151.0	144.0	146.0		487,286,244,202	5.0	1.0	6	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SGK1	NM_001143676.1,NM_001143677.1,NM_001143678.1,NM_005627.3	32,32,32,32	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	163/527,96/460,82/446,68/432	134495169	1,13005	2203	4300	6503	SO:0001583	missense	6446	exon5			TCATAAGCTCAGG	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.202C>G	6.37:g.134495169G>C	ENSP00000237305:p.Leu68Val	109.0	0.0	0		110.0	22.0	0.2	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	12.84	2.057170	0.36277	0.0	1.16E-4	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.72282	-0.64;-0.63;-0.62;-0.62;-0.62;-0.63	5.99	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.51210	0.1661	L	0.54323	1.7	0.80722	D	1	B;B;B;B;B;B	0.28605	0.008;0.008;0.0;0.073;0.217;0.002	B;B;B;B;B;B	0.31946	0.012;0.002;0.001;0.088;0.138;0.004	T	0.53092	-0.8487	10	0.30854	T	0.27	.	11.0283	0.47757	0.1506:0.0:0.8494:0.0	.	96;82;68;58;163;68	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	163;82;68;58;96;68;132	ENSP00000356832:L163V;ENSP00000396242:L82V;ENSP00000237305:L68V;ENSP00000356831:L58V;ENSP00000434450:L96V;ENSP00000434302:L68V	ENSP00000237305:L68V	L	-	1	0	SGK1	134536862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.307000	0.51888	1.377000	0.46286	0.655000	0.94253	CTT	G|1.000;C|0.000	0.000	weak		0.478	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
INSC	387755	hgsc.bcm.edu	37	11	15267551	15267551	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:15267551T>G	ENST00000379554.3	+	13	1751	c.1705T>G	c.(1705-1707)Tta>Gta	p.L569V	INSC_ENST00000379556.3_Missense_Mutation_p.L522V|INSC_ENST00000530161.1_Missense_Mutation_p.L522V|INSC_ENST00000447214.2_3'UTR|INSC_ENST00000528567.1_3'UTR|INSC_ENST00000424273.1_Missense_Mutation_p.L480V|INSC_ENST00000525218.1_Missense_Mutation_p.L480V	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)	569					establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						GGACTCCTTCTTACTCTGCAG	0.547																																					p.L569V		Atlas-SNP	.											.	INSC	104	.	0			c.T1705G						PASS	.						122.0	124.0	123.0					11																	15267551		1986	4160	6146	SO:0001583	missense	387755	exon13			TCCTTCTTACTCT	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.1705T>G	11.37:g.15267551T>G	ENSP00000368872:p.Leu569Val	199.0	0.0	0		214.0	40.0	0.186916	NM_001031853	A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	Missense_Mutation	SNP	ENST00000379554.3	37	CCDS41621.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.320930	0.81580	.	.	ENSG00000188487	ENST00000379554;ENST00000379556;ENST00000424273;ENST00000530161;ENST00000525218	T;T;T;T;T	0.50277	0.75;0.79;0.94;0.79;0.94	6.17	3.57	0.40892	Armadillo-type fold (1);	0.000000	0.64402	D	0.000004	T	0.58566	0.2131	L	0.53249	1.67	0.38663	D	0.952138	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.87578	0.998;0.986;0.996	T	0.61950	-0.6957	10	0.66056	D	0.02	-7.5535	6.8426	0.23971	0.0:0.2948:0.0:0.7052	.	557;480;569	Q1MX18-5;Q1MX18-4;Q1MX18	.;.;INSC_HUMAN	V	569;522;480;522;480	ENSP00000368872:L569V;ENSP00000368874:L522V;ENSP00000389161:L480V;ENSP00000436194:L522V;ENSP00000436113:L480V	ENSP00000368872:L569V	L	+	1	2	INSC	15224127	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.660000	0.37397	1.158000	0.42547	0.533000	0.62120	TTA	.	.	none		0.547	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386590.1	NM_001031853	
SLIT2	9353	hgsc.bcm.edu	37	4	20619095	20619095	+	Silent	SNP	G	G	A	rs61746361	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:20619095G>A	ENST00000504154.1	+	36	4422	c.4170G>A	c.(4168-4170)gcG>gcA	p.A1390A	SLIT2_ENST00000273739.5_Silent_p.A1403A|SLIT2_ENST00000503823.1_Silent_p.A1382A|SLIT2_ENST00000503837.1_Silent_p.A1386A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1390					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						CCATCAATGCGTTCTCCTACA	0.522													G|||	22	0.00439297	0.0166	0.0	5008	,	,		16502	0.0		0.0	False		,,,				2504	0.0				p.A1390A		Atlas-SNP	.											.	SLIT2	290	.	0			c.G4170A						PASS	.	G		54,4352	54.9+/-90.9	0,54,2149	106.0	92.0	97.0		4170	-11.8	0.0	4	dbSNP_129	97	0,8600		0,0,4300	no	coding-synonymous	SLIT2	NM_004787.1		0,54,6449	AA,AG,GG		0.0,1.2256,0.4152		1390/1530	20619095	54,12952	2203	4300	6503	SO:0001819	synonymous_variant	9353	exon36			CAATGCGTTCTCC	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4170G>A	4.37:g.20619095G>A		330.0	0.0	0		261.0	54.0	0.206897	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	37	CCDS3426.1																																																																																			G|0.996;A|0.004	0.004	strong		0.522	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
CHRM3	1131	hgsc.bcm.edu	37	1	240071117	240071117	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:240071117G>T	ENST00000255380.4	+	5	1145	c.366G>T	c.(364-366)atG>atT	p.M122I		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	122					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)	p.M122I(1)		breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TCATTTCAATGAATCTGTTTA	0.473																																					p.M122I		Atlas-SNP	.											CHRM3,NS,carcinoma,0,1	CHRM3	118	1	1	Substitution - Missense(1)	breast(1)	c.G366T						scavenged	.						106.0	91.0	96.0					1																	240071117		2203	4300	6503	SO:0001583	missense	1131	exon5			TTCAATGAATCTG	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.366G>T	1.37:g.240071117G>T	ENSP00000255380:p.Met122Ile	377.0	1.0	0.00265252		349.0	58.0	0.166189	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331523	0.81690	.	.	ENSG00000133019	ENST00000255380	T	0.17213	2.29	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.05338	-1.0891	10	0.87932	D	0	-30.8099	20.2789	0.98501	0.0:0.0:1.0:0.0	.	122	P20309	ACM3_HUMAN	I	122	ENSP00000255380:M122I	ENSP00000255380:M122I	M	+	3	0	CHRM3	238137740	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	9.869000	0.99810	2.788000	0.95919	0.650000	0.86243	ATG	.	.	none		0.473	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
PBX2	5089	hgsc.bcm.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	T	A	rs202223627		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:32155509T>A	ENST00000375050.4	-	5	1055	c.785A>T	c.(784-786)tAt>tTt	p.Y262F	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Y262F(3)		endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						GGAGTAGAAATACTCATTTAG	0.517																																					p.Y262F		Atlas-SNP	.											PBX2,NS,carcinoma,0,4	PBX2	29	4	3	Substitution - Missense(3)	lung(3)	c.A785T						scavenged	.																																			SO:0001583	missense	5089	exon5			TAGAAATACTCAT		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.785A>T	6.37:g.32155509T>A	ENSP00000364190:p.Tyr262Phe	223.0	2.0	0.00896861		212.0	14.0	0.0660377	NM_002586	A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841111	0.71488	.	.	ENSG00000204304	ENST00000375050	D	0.83673	-1.75	4.63	4.63	0.57726	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.201957	0.34435	N	0.003969	T	0.61837	0.2379	N	0.10629	0.01	0.80722	D	1	P;P	0.42337	0.776;0.502	P;P	0.45232	0.474;0.458	T	0.71314	-0.4630	10	0.49607	T	0.09	-0.8351	12.0363	0.53427	0.0:0.0:0.0:1.0	.	262;262	Q7KZE5;P40425	.;PBX2_HUMAN	F	262	ENSP00000364190:Y262F	ENSP00000364190:Y262F	Y	-	2	0	PBX2	32263487	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.505000	0.81655	1.943000	0.56356	0.459000	0.35465	TAT	T|0.999;A|0.001	0.001	weak		0.517	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4		
PRPH2	5961	hgsc.bcm.edu	37	6	42690015	42690015	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:42690015G>T	ENST00000230381.5	-	1	297	c.58C>A	c.(58-60)Ctc>Atc	p.L20I		NM_000322.4	NP_000313.2	P23942	PRPH2_HUMAN	peripherin 2 (retinal degeneration, slow)	20					cell adhesion (GO:0007155)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	18	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)			ATGAGCCAGAGCCCTTGGGCC	0.527																																					p.L20I		Atlas-SNP	.											.	PRPH2	47	.	0			c.C58A						PASS	.						81.0	78.0	79.0					6																	42690015		2203	4300	6503	SO:0001583	missense	5961	exon1			GCCAGAGCCCTTG		CCDS4871.1	6p21.1	2013-09-20	2006-11-23	2006-11-23	ENSG00000112619	ENSG00000112619		"""Tetraspanins"""	9942	protein-coding gene	gene with protein product	retinal peripherin	179605	"""retinal degeneration, slow (retinitis pigmentosa 7)"", ""retinal degeneration, slow"""	RP7, RDS		1749427	Standard	NM_000322		Approved	TSPAN22, rd2, CACD2	uc003osk.3	P23942	OTTHUMG00000014701	ENST00000230381.5:c.58C>A	6.37:g.42690015G>T	ENSP00000230381:p.Leu20Ile	116.0	0.0	0		133.0	38.0	0.285714	NM_000322	Q5TFH5|Q6DK65	Missense_Mutation	SNP	ENST00000230381.5	37	CCDS4871.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778382	0.70107	.	.	ENSG00000112619	ENST00000230381	D	0.82526	-1.62	5.61	5.61	0.85477	.	0.057622	0.64402	D	0.000001	D	0.89203	0.6648	M	0.84585	2.705	0.51233	D	0.999911	P	0.51791	0.948	P	0.56700	0.804	D	0.88512	0.3090	10	0.44086	T	0.13	.	19.6248	0.95674	0.0:0.0:1.0:0.0	.	20	P23942	PRPH2_HUMAN	I	20	ENSP00000230381:L20I	ENSP00000230381:L20I	L	-	1	0	PRPH2	42797993	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.685000	0.54678	2.631000	0.89168	0.655000	0.94253	CTC	.	.	none		0.527	PRPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040556.1	NM_000322	
IVL	3713	hgsc.bcm.edu	37	1	152883856	152883856	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:152883856G>A	ENST00000368764.3	+	2	1647	c.1583G>A	c.(1582-1584)gGg>gAg	p.G528E	IVL_ENST00000392667.2_Missense_Mutation_p.G382E			P07476	INVO_HUMAN	involucrin	528	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			cagcaggaggggcagctgaag	0.597																																					p.G528E		Atlas-SNP	.											.	IVL	100	.	0			c.G1583A						PASS	.						70.0	66.0	67.0					1																	152883856		2203	4300	6503	SO:0001583	missense	3713	exon2			AGGAGGGGCAGCT	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.1583G>A	1.37:g.152883856G>A	ENSP00000357753:p.Gly528Glu	77.0	0.0	0		96.0	21.0	0.21875	NM_005547	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.070892	0.36566	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.47177	1.77;0.85	3.34	-1.01	0.10169	.	.	.	.	.	T	0.07234	0.0183	N	0.21545	0.675	0.09310	N	1	B	0.21905	0.062	B	0.18561	0.022	T	0.34403	-0.9830	9	0.02654	T	1	.	3.2393	0.06776	0.3377:0.0:0.447:0.2153	.	528	P07476	INVO_HUMAN	E	528;382	ENSP00000357753:G528E;ENSP00000376435:G382E	ENSP00000357753:G528E	G	+	2	0	IVL	151150480	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.649000	0.05384	-0.022000	0.13986	-0.274000	0.10170	GGG	.	.	none		0.597	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
USP31	57478	hgsc.bcm.edu	37	16	23117736	23117736	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:23117736A>C	ENST00000219689.7	-	3	843	c.844T>G	c.(844-846)Ttt>Gtt	p.F282V		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	213	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		TGCGCTTGAAAGAGTTCTTGT	0.388																																					p.F282V		Atlas-SNP	.											.	USP31	122	.	0			c.T844G						PASS	.						79.0	72.0	75.0					16																	23117736		2197	4300	6497	SO:0001583	missense	57478	exon3			CTTGAAAGAGTTC	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.844T>G	16.37:g.23117736A>C	ENSP00000219689:p.Phe282Val	201.0	0.0	0		249.0	40.0	0.160643	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.559863	0.86335	.	.	ENSG00000103404	ENST00000219689	T	0.48522	0.81	5.5	5.5	0.81552	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.060995	0.64402	D	0.000003	T	0.74824	0.3767	M	0.92026	3.265	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.81360	-0.0968	10	0.87932	D	0	-20.3252	15.0849	0.72145	1.0:0.0:0.0:0.0	.	282	Q70CQ4	UBP31_HUMAN	V	282	ENSP00000219689:F282V	ENSP00000219689:F282V	F	-	1	0	USP31	23025237	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.851000	0.92205	2.214000	0.71695	0.523000	0.50628	TTT	.	.	none		0.388	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
OR52I2	143502	hgsc.bcm.edu	37	11	4608396	4608396	+	Silent	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:4608396A>C	ENST00000312614.4	+	1	376	c.354A>C	c.(352-354)ggA>ggC	p.G118G		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCTGCTCAGGAGACAGCTCAA	0.512																																					p.G118G		Atlas-SNP	.											.	OR52I2	50	.	0			c.A354C						PASS	.						201.0	189.0	193.0					11																	4608396		2201	4298	6499	SO:0001819	synonymous_variant	143502	exon1			CTCAGGAGACAGC	BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.354A>C	11.37:g.4608396A>C		503.0	1.0	0.00198807		572.0	149.0	0.26049	NM_001005170	B2RNJ5|B9EKV8|Q6IFJ8	Silent	SNP	ENST00000312614.4	37	CCDS31355.1																																																																																			.	.	none		0.512	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385946.1	NM_001005170	
WHSC1	7468	hgsc.bcm.edu	37	4	1957912	1957912	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:1957912A>C	ENST00000382895.3	+	17	3309	c.2878A>C	c.(2878-2880)Aac>Cac	p.N960H	WHSC1_ENST00000382891.5_Missense_Mutation_p.N960H|WHSC1_ENST00000508803.1_Missense_Mutation_p.N960H|WHSC1_ENST00000382888.3_Missense_Mutation_p.N308H|WHSC1_ENST00000382892.2_Missense_Mutation_p.N960H|WHSC1_ENST00000482415.2_3'UTR	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	960					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		AGTCTTCAAAAACGGTACGGA	0.458			T	IGH@	MM																																p.N960H		Atlas-SNP	.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1	180	.	0			c.A2878C						PASS	.						54.0	64.0	61.0					4																	1957912		2199	4300	6499	SO:0001583	missense	7468	exon15			TTCAAAAACGGTA	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2878A>C	4.37:g.1957912A>C	ENSP00000372351:p.Asn960His	18.0	0.0	0		18.0	6.0	0.333333	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	37	CCDS33940.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.80|14.80	2.643251|2.643251	0.47153|0.47153	.|.	.|.	ENSG00000109685|ENSG00000109685	ENST00000514329|ENST00000508803;ENST00000382891;ENST00000382892;ENST00000382895;ENST00000382888	D|T;T;T;T;T	0.98105|0.70749	-4.72|-0.51;-0.51;-0.51;-0.51;-0.51	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	.|0.000000	.|0.64402	.|D	.|0.000017	T|T	0.56093|0.56093	0.1962|0.1962	N|N	0.15975|0.15975	0.35|0.35	0.80722|0.80722	D|D	1|1	.|B;B	.|0.25850	.|0.005;0.136	.|B;B	.|0.22753	.|0.006;0.041	T|T	0.57505|0.57505	-0.7800|-0.7800	7|10	0.87932|0.62326	D|D	0|0.03	.|.	15.4756|15.4756	0.75478|0.75478	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|308;960	.|A2A2T2;O96028	.|.;NSD2_HUMAN	T|H	283|960;960;960;960;308	ENSP00000425094:K283T|ENSP00000423972:N960H;ENSP00000372347:N960H;ENSP00000372348:N960H;ENSP00000372351:N960H;ENSP00000372344:N308H	ENSP00000425094:K283T|ENSP00000372344:N308H	K|N	+|+	2|1	0|0	WHSC1|WHSC1	1927710|1927710	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	5.838000|5.838000	0.69388|0.69388	2.062000|2.062000	0.61559|0.61559	0.533000|0.533000	0.62120|0.62120	AAA|AAC	.	.	none		0.458	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
TIAM1	7074	hgsc.bcm.edu	37	21	32554842	32554842	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr21:32554842G>T	ENST00000286827.3	-	16	3254	c.2783C>A	c.(2782-2784)cCc>cAc	p.P928H	TIAM1_ENST00000541036.1_Missense_Mutation_p.P868H	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	928					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTCCAGCTCGGGGTAGGTCCT	0.602																																					p.P928H		Atlas-SNP	.											.	TIAM1	522	.	0			c.C2783A						PASS	.						43.0	43.0	43.0					21																	32554842		2203	4300	6503	SO:0001583	missense	7074	exon16			AGCTCGGGGTAGG		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2783C>A	21.37:g.32554842G>T	ENSP00000286827:p.Pro928His	111.0	0.0	0		95.0	25.0	0.263158	NM_003253	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	ENST00000286827.3	37	CCDS13609.1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.873912	0.72180	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.49139	0.79;0.82	4.24	4.24	0.50183	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.62624	0.2443	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.64807	-0.6320	10	0.56958	D	0.05	.	13.6799	0.62476	0.0:0.0:1.0:0.0	.	868;868;928	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	H	928;769;868	ENSP00000286827:P928H;ENSP00000441570:P868H	ENSP00000286827:P928H	P	-	2	0	TIAM1	31476713	1.000000	0.71417	0.937000	0.37676	0.985000	0.73830	5.349000	0.66010	2.193000	0.70182	0.555000	0.69702	CCC	.	.	none		0.602	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192552.1	NM_003253	
B2M	567	hgsc.bcm.edu	37	15	45003745	45003745	+	Start_Codon_SNP	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr15:45003745A>G	ENST00000558401.1	+	1	71	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	B2M_ENST00000559916.1_Start_Codon_SNP_p.M1V|B2M_ENST00000544417.1_Start_Codon_SNP_p.M1V|PATL2_ENST00000558573.1_5'Flank	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	1					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.M1L(3)|p.M1V(2)|p.?(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCGGGCCGAGATGTCTCGCTC	0.612																																					p.M1V		Atlas-SNP	.											B2M,caecum,carcinoma,-2,17	B2M	99	17	6	Substitution - Missense(5)|Unknown(1)	ovary(2)|haematopoietic_and_lymphoid_tissue(2)|lung(1)|large_intestine(1)	c.A1G						scavenged	.						126.0	92.0	104.0					15																	45003745		2198	4298	6496	SO:0001582	initiator_codon_variant	567	exon1			GCCGAGATGTCTC	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.1A>G	15.37:g.45003745A>G	ENSP00000452780:p.Met1Val	140.0	1.0	0.00714286		169.0	49.0	0.289941	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	A	19.48	3.836331	0.71373	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01228	5.14	5.35	5.35	0.76521	.	.	.	.	.	T	0.02119	0.0066	.	.	.	0.80722	D	1	P;P;P	0.48407	0.86;0.91;0.78	B;B;B	0.41271	0.352;0.294;0.192	T	0.58912	-0.7552	8	0.87932	D	0	.	11.9	0.52678	1.0:0.0:0.0:0.0	.	1;1;1	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	V	1	ENSP00000437604:M1V	ENSP00000340858:M1V	M	+	1	0	B2M	42791037	0.891000	0.30450	0.406000	0.26421	0.024000	0.10985	1.849000	0.39318	2.371000	0.80710	0.533000	0.62120	ATG	.	.	none		0.612	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	Missense_Mutation
LAMP5	24141	hgsc.bcm.edu	37	20	9498795	9498795	+	Missense_Mutation	SNP	C	C	T	rs137866690		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr20:9498795C>T	ENST00000246070.2	+	5	1076	c.584C>T	c.(583-585)cCg>cTg	p.P195L	LAMP5_ENST00000427562.2_Missense_Mutation_p.P151L	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	195						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											TCTAGTGATCCGCAGAAGACG	0.512																																					p.P195L		Atlas-SNP	.											.	.	.	.	0			c.C584T						PASS	.	T	LEU/PRO,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	129.0	104.0	112.0		452,584	2.6	0.3	20	dbSNP_134	112	0,8600		0,0,4300	no	missense,missense	C20orf103	NM_001199897.1,NM_012261.3	98,98	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	151/237,195/281	9498795	1,13005	2203	4300	6503	SO:0001583	missense	24141	exon5			GTGATCCGCAGAA	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.584C>T	20.37:g.9498795C>T	ENSP00000246070:p.Pro195Leu	272.0	0.0	0		303.0	72.0	0.237624	NM_012261	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	c	10.44	1.351081	0.24512	2.27E-4	0.0	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.31510	1.49;1.49	5.84	2.59	0.31030	.	0.274631	0.40908	N	0.000994	T	0.12646	0.0307	N	0.14661	0.345	0.42298	D	0.992169	P;B	0.35192	0.489;0.004	B;B	0.22152	0.038;0.002	T	0.13764	-1.0497	9	.	.	.	-2.5454	7.7449	0.28862	0.5288:0.3877:0.0:0.0835	.	151;195	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	L	195;151	ENSP00000246070:P195L;ENSP00000406360:P151L	.	P	+	2	0	C20orf103	9446795	0.999000	0.42202	0.335000	0.25508	0.363000	0.29612	4.323000	0.59221	0.800000	0.34041	-0.119000	0.15052	CCG	C|1.000;T|0.000	0.000	weak		0.512	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261	
SYT16	83851	hgsc.bcm.edu	37	14	62536400	62536400	+	Silent	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr14:62536400C>T	ENST00000430451.2	+	2	800	c.603C>T	c.(601-603)tcC>tcT	p.S201S	RP11-355I22.5_ENST00000553990.1_lincRNA|SYT16_ENST00000446982.2_Silent_p.S201S	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	201					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TTGAGATTTCCGTGTCCCGGT	0.483																																					p.S201S		Atlas-SNP	.											.	SYT16	144	.	0			c.C603T						PASS	.						169.0	159.0	162.0					14																	62536400		1932	4125	6057	SO:0001819	synonymous_variant	83851	exon2			GATTTCCGTGTCC	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.603C>T	14.37:g.62536400C>T		212.0	0.0	0		227.0	50.0	0.220264	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Silent	SNP	ENST00000430451.2	37	CCDS45121.1																																																																																			.	.	none		0.483	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
HIPK1	204851	hgsc.bcm.edu	37	1	114495495	114495495	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:114495495C>G	ENST00000369558.1	+	3	1416	c.1184C>G	c.(1183-1185)gCt>gGt	p.A395G	HIPK1_ENST00000369553.1_5'Flank|HIPK1_ENST00000369554.2_Missense_Mutation_p.A395G|HIPK1_ENST00000406344.1_5'Flank|HIPK1_ENST00000369561.4_Missense_Mutation_p.A395G|HIPK1_ENST00000369555.2_Missense_Mutation_p.A395G|HIPK1_ENST00000426820.2_Missense_Mutation_p.A395G|HIPK1_ENST00000340480.4_Missense_Mutation_p.A21G|HIPK1_ENST00000369559.4_Missense_Mutation_p.A395G			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	395	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TATCCTGGTGCTTCAGAATAT	0.373																																					p.A395G		Atlas-SNP	.											.	HIPK1	195	.	0			c.C1184G						PASS	.						178.0	164.0	169.0					1																	114495495		2203	4300	6503	SO:0001583	missense	204851	exon3			CTGGTGCTTCAGA	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1184C>G	1.37:g.114495495C>G	ENSP00000358571:p.Ala395Gly	165.0	0.0	0		144.0	27.0	0.1875	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	ENST00000369558.1	37	CCDS867.1	.	.	.	.	.	.	.	.	.	.	C	32	5.145198	0.94603	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000369561;ENST00000340480	T;T;T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.36	5.36	0.76844	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.60431	0.2268	N	0.17800	0.525	0.80722	D	1	D;D	0.57571	0.98;0.975	D;P	0.63488	0.915;0.904	T	0.67348	-0.5693	10	0.66056	D	0.02	.	19.0806	0.93180	0.0:1.0:0.0:0.0	.	395;395	Q86Z02;Q86Z02-2	HIPK1_HUMAN;.	G	466;395;395;395;395;395;395;21	ENSP00000407442:A466G;ENSP00000358572:A395G;ENSP00000409673:A395G;ENSP00000358567:A395G;ENSP00000358568:A395G;ENSP00000358571:A395G;ENSP00000358574:A395G;ENSP00000340956:A21G	ENSP00000340956:A21G	A	+	2	0	HIPK1	114297018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.792000	0.85828	2.509000	0.84616	0.650000	0.86243	GCT	.	.	none		0.373	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
FRAS1	80144	hgsc.bcm.edu	37	4	79399181	79399181	+	Silent	SNP	C	C	T	rs371145937		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:79399181C>T	ENST00000264895.6	+	55	8504	c.8064C>T	c.(8062-8064)agC>agT	p.S2688S		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2684	Calx-beta 2.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TTAACGAGAGCGCTGGTTTTC	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		21744	0.0		0.001	False		,,,				2504	0.0				p.S2688S		Atlas-SNP	.											.	FRAS1	779	.	0			c.C8064T						PASS	.	C		1,3763		0,1,1881	79.0	79.0	79.0		8064	-9.0	0.8	4		79	0,8244		0,0,4122	no	coding-synonymous	FRAS1	NM_025074.6		0,1,6003	TT,TC,CC		0.0,0.0266,0.0083		2688/4013	79399181	1,12007	1882	4122	6004	SO:0001819	synonymous_variant	80144	exon55			CGAGAGCGCTGGT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.8064C>T	4.37:g.79399181C>T		274.0	0.0	0		322.0	80.0	0.248447	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	0.046	-1.265514	0.01433	2.66E-4	0.0	ENSG00000138759	ENST00000512123	.	.	.	5.69	-8.98	0.00754	.	.	.	.	.	T	0.63414	0.2509	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71300	-0.4634	4	.	.	.	.	17.9308	0.88996	0.0:0.524:0.0:0.476	.	.	.	.	C	917	.	.	R	+	1	0	FRAS1	79618205	0.024000	0.19004	0.770000	0.31555	0.041000	0.13682	-0.890000	0.04140	-1.654000	0.01499	-1.152000	0.01820	CGC	.	.	weak		0.418	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LTA4H	4048	hgsc.bcm.edu	37	12	96409429	96409429	+	Nonsense_Mutation	SNP	C	C	A	rs138184255	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:96409429C>A	ENST00000228740.2	-	11	1132	c.991G>T	c.(991-993)Gga>Tga	p.G331*	LTA4H_ENST00000548375.1_5'Flank|LTA4H_ENST00000413268.2_Nonsense_Mutation_p.G307*|LTA4H_ENST00000552789.1_Nonsense_Mutation_p.G307*	NM_000895.2	NP_000886.1	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	331					arachidonic acid metabolic process (GO:0019369)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|peptide catabolic process (GO:0043171)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|leukotriene-A4 hydrolase activity (GO:0004463)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(3)|lung(4)|skin(2)|stomach(1)	12					Captopril(DB01197)	AACAATCGTCCGCAAATGTGG	0.373											OREG0022040	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G331X		Atlas-SNP	.											.	LTA4H	38	.	0			c.G991T						PASS	.						130.0	126.0	127.0					12																	96409429		2203	4300	6503	SO:0001587	stop_gained	4048	exon11			ATCGTCCGCAAAT	BC032528	CCDS9059.1, CCDS58266.1, CCDS58267.1	12q22	2005-10-06				ENSG00000111144	3.3.2.6		6710	protein-coding gene	gene with protein product		151570				7628486	Standard	NM_000895		Approved		uc001ten.2	P09960	OTTHUMG00000170355	ENST00000228740.2:c.991G>T	12.37:g.96409429C>A	ENSP00000228740:p.Gly331*	61.0	0.0	0	1320	73.0	4.0	0.0547945	NM_000895	B4DNQ9|F8VV40|Q6IAT6|Q9UCT7	Nonsense_Mutation	SNP	ENST00000228740.2	37	CCDS9059.1	.	.	.	.	.	.	.	.	.	.	C	39	7.747344	0.98468	.	.	ENSG00000111144	ENST00000228740;ENST00000552789;ENST00000413268	.	.	.	6.17	6.17	0.99709	.	0.044184	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-23.289	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	331;307;307	.	ENSP00000228740:G331X	G	-	1	0	LTA4H	94933560	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.426000	0.59882	2.941000	0.99782	0.655000	0.94253	GGA	C|0.999;T|0.001	.	alt		0.373	LTA4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408655.1	NM_000895	
RFC5	5985	hgsc.bcm.edu	37	12	118458748	118458748	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:118458748G>A	ENST00000454402.2	+	4	423	c.305G>A	c.(304-306)cGa>cAa	p.R102Q	RFC5_ENST00000392542.2_Missense_Mutation_p.R81Q|RFC5_ENST00000229043.3_Missense_Mutation_p.R17Q	NM_001206801.1|NM_007370.5	NP_001193730.1|NP_031396.1	P40937	RFC5_HUMAN	replication factor C (activator 1) 5, 36.5kDa	102					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(3)	9	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GACATCATTCGAGGACCGATC	0.388																																					p.R102Q		Atlas-SNP	.											.	RFC5	35	.	0			c.G305A						PASS	.						149.0	135.0	140.0					12																	118458748		2203	4300	6503	SO:0001583	missense	5985	exon4			TCATTCGAGGACC		CCDS9185.1, CCDS41843.2	12q24.3	2010-04-21	2002-08-29		ENSG00000111445	ENSG00000111445		"""ATPases / AAA-type"""	9973	protein-coding gene	gene with protein product		600407	"""replication factor C (activator 1) 5 (36.5kD)"""			7774928	Standard	NM_007370		Approved	RFC36	uc001twq.3	P40937	OTTHUMG00000156438	ENST00000454402.2:c.305G>A	12.37:g.118458748G>A	ENSP00000408295:p.Arg102Gln	84.0	0.0	0		83.0	19.0	0.228916	NM_007370	A8MZ62|B3KSX8	Missense_Mutation	SNP	ENST00000454402.2	37	CCDS9185.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488169	0.84854	.	.	ENSG00000111445	ENST00000449641;ENST00000537315;ENST00000229043;ENST00000484086;ENST00000420967;ENST00000454402;ENST00000392542	T;T;T;T;T	0.51817	0.96;0.69;0.69;0.69;1.39	5.38	4.49	0.54785	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.69459	0.3113	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.978;0.985;0.985	T	0.74751	-0.3559	10	0.87932	D	0	0.7778	13.1853	0.59677	0.0783:0.0:0.9217:0.0	.	81;116;102	A8MZ62;Q59GW7;P40937	.;.;RFC5_HUMAN	Q	17;17;17;134;81;102;81	ENSP00000229043:R17Q;ENSP00000445917:R134Q;ENSP00000390340:R81Q;ENSP00000408295:R102Q;ENSP00000376325:R81Q	ENSP00000229043:R17Q	R	+	2	0	RFC5	116943131	1.000000	0.71417	0.998000	0.56505	0.461000	0.32589	9.691000	0.98679	1.270000	0.44297	-0.150000	0.13652	CGA	.	.	none		0.388	RFC5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344196.2	NM_007370	
PIWIL1	9271	hgsc.bcm.edu	37	12	130855827	130855827	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:130855827C>T	ENST00000245255.3	+	20	2700	c.2428C>T	c.(2428-2430)Cgc>Tgc	p.R810C	PIWIL1_ENST00000541480.1_3'UTR	NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	810	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CCACATACAGCGCTTGACCTA	0.428																																					p.R810C		Atlas-SNP	.											.	PIWIL1	157	.	0			c.C2428T						PASS	.						192.0	164.0	174.0					12																	130855827		2203	4300	6503	SO:0001583	missense	9271	exon20			ATACAGCGCTTGA	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.2428C>T	12.37:g.130855827C>T	ENSP00000245255:p.Arg810Cys	187.0	0.0	0		202.0	39.0	0.193069	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499927	0.64298	.	.	ENSG00000125207	ENST00000245255	T	0.32515	1.45	5.45	3.49	0.39957	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.053233	0.85682	D	0.000000	T	0.52108	0.1714	M	0.81112	2.525	0.80722	D	1	P;D	0.89917	0.602;1.0	B;D	0.87578	0.178;0.998	T	0.52946	-0.8507	10	0.59425	D	0.04	-29.512	7.1092	0.25380	0.3786:0.5358:0.0:0.0856	.	810;810	Q96J94;Q96J94-2	PIWL1_HUMAN;.	C	810	ENSP00000245255:R810C	ENSP00000245255:R810C	R	+	1	0	PIWIL1	129421780	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	2.059000	0.41384	1.154000	0.42482	0.561000	0.74099	CGC	.	.	none		0.428	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
CDH20	28316	hgsc.bcm.edu	37	18	59195219	59195219	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr18:59195219A>G	ENST00000262717.4	+	7	1435	c.1037A>G	c.(1036-1038)aAg>aGg	p.K346R	CDH20_ENST00000536675.2_Missense_Mutation_p.K346R|CDH20_ENST00000538374.1_Missense_Mutation_p.K346R			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	346	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TTTGAAAGCAAGAAAAGCTAC	0.438																																					p.K346R		Atlas-SNP	.											.	CDH20	117	.	0			c.A1037G						PASS	.						73.0	69.0	70.0					18																	59195219		2203	4300	6503	SO:0001583	missense	28316	exon6			AAAGCAAGAAAAG	AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1037A>G	18.37:g.59195219A>G	ENSP00000262717:p.Lys346Arg	180.0	0.0	0		179.0	28.0	0.156425	NM_031891	Q495S3	Missense_Mutation	SNP	ENST00000262717.4	37	CCDS11977.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.104904	0.77096	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.49720	0.77;0.77;0.77	5.92	5.92	0.95590	Cadherin (5);Cadherin-like (1);	0.190290	0.53938	D	0.000052	T	0.54919	0.1888	L	0.45422	1.42	0.58432	D	0.999996	P	0.40476	0.718	P	0.51415	0.669	T	0.49952	-0.8884	10	0.35671	T	0.21	.	16.3526	0.83220	1.0:0.0:0.0:0.0	.	346	Q9HBT6	CAD20_HUMAN	R	346	ENSP00000444767:K346R;ENSP00000442226:K346R;ENSP00000262717:K346R	ENSP00000262717:K346R	K	+	2	0	CDH20	57346199	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.932000	0.92897	2.255000	0.74692	0.533000	0.62120	AAG	.	.	none		0.438	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256141.2	NM_031891	
BRAF	673	hgsc.bcm.edu	37	7	140453134	140453134	+	Missense_Mutation	SNP	T	T	C	rs397516897|rs121913364|rs121913226|rs121913377		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:140453134T>C	ENST00000288602.6	-	15	1861	c.1801A>G	c.(1801-1803)Aaa>Gaa	p.K601E		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	601	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		K -> E (in CRC). {ECO:0000269|PubMed:12198537}.|K -> Q (in CFC1). {ECO:0000269|PubMed:19206169}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.K601E(40)|p.V600_K601>E(12)|p.T599_R603>I(2)|p.K601del(1)|p.V600_S605>EK(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	CATCGAGATTTCACTGTAGCT	0.368		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.K601E	Colon(40;35 892 2973 5743 27438)	Atlas-SNP	.		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	BRAF,NS,malignant_melanoma,0,81	BRAF	36346	81	58	Substitution - Missense(40)|Complex - deletion inframe(17)|Deletion - In frame(1)	thyroid(30)|skin(15)|large_intestine(5)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|endometrium(1)|lung(1)|NS(1)	c.A1801G						PASS	.						111.0	103.0	106.0					7																	140453134		2203	4300	6503	SO:0001583	missense	673	exon15	Familial Cancer Database	CFC, CFCS	GAGATTTCACTGT	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1801A>G	7.37:g.140453134T>C	ENSP00000288602:p.Lys601Glu	87.0	0.0	0		115.0	19.0	0.165217	NM_004333	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.8|23.8	4.454487|4.454487	0.84209|0.84209	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.82711|.	-1.64|.	5.65|5.65	5.65|5.65	0.86999|0.86999	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.54464|.	0.1860|.	N|N	0.25380|0.25380	0.74|0.74	0.80722|0.80722	D|D	1|1	P|.	0.42584|.	0.784|.	P|.	0.49922|.	0.626|.	T|.	0.51108|.	-0.8747|.	10|.	0.87932|.	D|.	0|.	.|.	15.9326|15.9326	0.79675|0.79675	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	601|.	P15056|.	BRAF_HUMAN|.	E|W	601|208	ENSP00000288602:K601E|.	ENSP00000288602:K601E|.	K|X	-|-	1|3	0|0	BRAF|BRAF	140099603|140099603	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.921000|7.921000	0.87530|0.87530	2.169000|2.169000	0.68431|0.68431	0.529000|0.529000	0.55759|0.55759	AAA|TGA	.	.	weak		0.368	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348886.1	NM_004333	
FAT3	120114	hgsc.bcm.edu	37	11	92577819	92577819	+	Silent	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:92577819C>T	ENST00000298047.6	+	18	11303	c.11286C>T	c.(11284-11286)caC>caT	p.H3762H	FAT3_ENST00000409404.2_Silent_p.H3762H|FAT3_ENST00000533797.1_Silent_p.H97H|FAT3_ENST00000525166.1_Silent_p.H3612H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3762					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCGATTCCCACGCGCTCATGA	0.527										TCGA Ovarian(4;0.039)																											p.H3762H		Atlas-SNP	.											FAT3_ENST00000409404,colon,carcinoma,0,6	FAT3	1822	6	0			c.C11286T						PASS	.						101.0	100.0	101.0					11																	92577819		2143	4249	6392	SO:0001819	synonymous_variant	120114	exon18			TTCCCACGCGCTC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11286C>T	11.37:g.92577819C>T		399.0	0.0	0		451.0	80.0	0.177384	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.	.	none		0.527	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
ASUN	55726	hgsc.bcm.edu	37	12	27070328	27070328	+	Silent	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:27070328T>G	ENST00000261191.7	-	10	1562	c.1026A>C	c.(1024-1026)gtA>gtC	p.V342V	ASUN_ENST00000539625.1_Silent_p.V241V	NM_018164.2	NP_060634.2	Q9NVM9	ASUN_HUMAN	asunder spermatogenesis regulator	342					centrosome localization (GO:0051642)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|protein localization to nuclear envelope (GO:0090435)|regulation of fertilization (GO:0080154)|regulation of mitotic cell cycle (GO:0007346)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTCTACTATTTACATCTACAG	0.269																																					p.V342V		Atlas-SNP	.											.	.	.	.	0			c.A1026C						PASS	.						47.0	50.0	49.0					12																	27070328		2199	4289	6488	SO:0001819	synonymous_variant	55726	exon10			ACTATTTACATCT	AK001222	CCDS8708.1	12p12.3	2013-05-08	2013-05-08	2011-12-09	ENSG00000064102	ENSG00000064102			20174	protein-coding gene	gene with protein product	"""spermatogenesis associated 30"""	615079	"""chromosome 12 open reading frame 11"", ""asunder, spermatogenesis regulator homolog (Drosphila)"""	C12orf11		12414650, 19357193, 23097494	Standard	NM_018164		Approved	FLJ10637, NET48, Mat89Bb, SPATA30	uc001rhk.4	Q9NVM9	OTTHUMG00000169193	ENST00000261191.7:c.1026A>C	12.37:g.27070328T>G		117.0	0.0	0		168.0	40.0	0.238095	NM_018164	B4DNK1|Q86WE2|Q96HM2|Q9BTX2|Q9NTB6|Q9NVM5	Silent	SNP	ENST00000261191.7	37	CCDS8708.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.949|9.949	1.219491|1.219491	0.22373|0.22373	.|.	.|.	ENSG00000064102|ENSG00000064102	ENST00000542392|ENST00000536232	.|.	.|.	.|.	5.39|5.39	2.92|2.92	0.33932|0.33932	.|.	.|.	.|.	.|.	.|.	T|.	0.56645|.	0.1999|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.51608|.	-0.8684|.	4|.	.|.	.|.	.|.	-15.2582|-15.2582	8.0783|8.0783	0.30729|0.30729	0.0:0.0698:0.2529:0.6773|0.0:0.0698:0.2529:0.6773	.|.	.|.	.|.	.|.	Q|S	56|70	.|.	.|.	K|X	-|-	1|2	0|2	C12orf11|C12orf11	26961595|26961595	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.034000|1.034000	0.30204|0.30204	0.948000|0.948000	0.37687|0.37687	0.477000|0.477000	0.44152|0.44152	AAA|TAA	.	.	none		0.269	ASUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402819.1	NM_018164	
SCUBE1	80274	hgsc.bcm.edu	37	22	43600118	43600118	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr22:43600118G>A	ENST00000360835.4	-	22	2978	c.2852C>T	c.(2851-2853)gCg>gTg	p.A951V		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	951					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CTGGGGATGCGCCAGCACGTC	0.567																																					p.A951V		Atlas-SNP	.											.	SCUBE1	105	.	0			c.C2852T						PASS	.						157.0	140.0	146.0					22																	43600118		2203	4300	6503	SO:0001583	missense	80274	exon22			GGATGCGCCAGCA		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2852C>T	22.37:g.43600118G>A	ENSP00000354080:p.Ala951Val	212.0	0.0	0		192.0	46.0	0.239583	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	CCDS14048.1	.	.	.	.	.	.	.	.	.	.	G	31	5.082468	0.94050	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.88586	-2.4	3.95	3.95	0.45737	.	0.000000	0.85682	D	0.000000	D	0.90584	0.7048	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92328	0.5871	10	0.87932	D	0	.	16.5437	0.84408	0.0:0.0:1.0:0.0	.	951	Q8IWY4	SCUB1_HUMAN	V	951;581	ENSP00000354080:A951V	ENSP00000354080:A951V	A	-	2	0	SCUBE1	41930062	1.000000	0.71417	0.948000	0.38648	0.976000	0.68499	9.514000	0.98013	2.204000	0.70986	0.591000	0.81541	GCG	.	.	none		0.567	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
SLX4IP	128710	hgsc.bcm.edu	37	20	10603706	10603706	+	Silent	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr20:10603706G>A	ENST00000334534.5	+	8	1086	c.906G>A	c.(904-906)gcG>gcA	p.A302A		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	302																	GCAGCTCTGCGGAAGACTTCG	0.507																																					p.A302A		Atlas-SNP	.											.	.	.	.	0			c.G906A						PASS	.						89.0	99.0	96.0					20																	10603706		2203	4300	6503	SO:0001819	synonymous_variant	128710	exon8			CTCTGCGGAAGAC	AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.906G>A	20.37:g.10603706G>A		77.0	0.0	0		71.0	11.0	0.15493	NM_001009608	Q05CG2|Q05CT9	Silent	SNP	ENST00000334534.5	37	CCDS33439.1																																																																																			.	.	none		0.507	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078000.3	NM_001009608	
UBA6	55236	hgsc.bcm.edu	37	4	68514904	68514904	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:68514904T>C	ENST00000322244.5	-	14	1189	c.1130A>G	c.(1129-1131)cAt>cGt	p.H377R		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	377					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						AGAGAGCCAATGCACAATGTC	0.388																																					p.H377R		Atlas-SNP	.											.	UBA6	98	.	0			c.A1130G						PASS	.						94.0	95.0	95.0					4																	68514904		2203	4300	6503	SO:0001583	missense	55236	exon14			AGCCAATGCACAA	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1130A>G	4.37:g.68514904T>C	ENSP00000313454:p.His377Arg	205.0	0.0	0		197.0	55.0	0.279188	NM_018227	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	ENST00000322244.5	37	CCDS3516.1	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.995347	0.00435	.	.	ENSG00000033178	ENST00000322244	T	0.54866	0.55	5.08	-3.06	0.05379	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.635180	0.16937	N	0.193439	T	0.13500	0.0327	N	0.00272	-1.73	0.58432	D	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.46665	-0.9175	10	0.02654	T	1	-0.5102	14.018	0.64536	0.0:0.1147:0.0:0.8853	.	377	A0AVT1	UBA6_HUMAN	R	377	ENSP00000313454:H377R	ENSP00000313454:H377R	H	-	2	0	UBA6	68197499	0.396000	0.25262	0.545000	0.28153	0.083000	0.17756	0.448000	0.21726	-0.758000	0.04690	-0.425000	0.05940	CAT	.	.	none		0.388	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251429.2	NM_018227	
FGGY	55277	hgsc.bcm.edu	37	1	60223665	60223665	+	Splice_Site	SNP	G	G	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:60223665G>T	ENST00000303721.7	+	15	1748		c.e15+1		FGGY_ENST00000371210.1_Splice_Site|FGGY_ENST00000371212.1_Splice_Site|RP4-782L23.2_ENST00000443012.1_RNA|FGGY_ENST00000371218.4_Splice_Site	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					AGGATAAAAAGTAAGTGTGTA	0.378																																					.		Atlas-SNP	.											.	FGGY	99	.	0			c.1646+1G>T						PASS	.						95.0	91.0	92.0					1																	60223665		2203	4300	6503	SO:0001630	splice_region_variant	55277	exon16			TAAAAAGTAAGTG		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1574+1G>T	1.37:g.60223665G>T		80.0	0.0	0		73.0	9.0	0.123288	NM_001113411	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Splice_Site	SNP	ENST00000303721.7	37	CCDS611.2	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665493	0.29604	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3446	0.74327	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FGGY	59996253	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	5.100000	0.64560	2.646000	0.89796	0.563000	0.77884	.	.	.	none		0.378	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023210.2	NM_001113411	Intron
COL6A5	256076	hgsc.bcm.edu	37	3	130128909	130128909	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:130128909A>T	ENST00000432398.2	+	19	5093	c.4599A>T	c.(4597-4599)caA>caT	p.Q1533H	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q1533H	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1533	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AAGGAGAACAAGGAAGACAAG	0.308																																					p.Q1533H		Atlas-SNP	.											.	COL6A5	205	.	0			c.A4599T						PASS	.						209.0	209.0	209.0					3																	130128909		692	1591	2283	SO:0001583	missense	256076	exon19			AGAACAAGGAAGA	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4599A>T	3.37:g.130128909A>T	ENSP00000390895:p.Gln1533His	65.0	0.0	0		78.0	16.0	0.205128	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	A	12.46	1.945999	0.34377	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.93307	-3.2;-3.2	5.52	5.52	0.82312	.	.	.	.	.	D	0.92192	0.7524	M	0.68728	2.09	0.27514	N	0.951595	B	0.23540	0.087	B	0.23852	0.049	D	0.86368	0.1721	9	0.45353	T	0.12	.	13.4845	0.61357	1.0:0.0:0.0:0.0	.	1533	A8TX70-2	.	H	1533	ENSP00000390895:Q1533H;ENSP00000265379:Q1533H	ENSP00000265379:Q1533H	Q	+	3	2	COL6A5	131611599	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.344000	0.44010	2.236000	0.73375	0.528000	0.53228	CAA	.	.	none		0.308	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CHST9	83539	hgsc.bcm.edu	37	18	24496569	24496569	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr18:24496569T>C	ENST00000284224.8	-	6	1263	c.986A>G	c.(985-987)aAg>aGg	p.K329R	AQP4-AS1_ENST00000578701.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000581714.1_Missense_Mutation_p.K329R|CHST9_ENST00000580774.1_3'UTR	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	329					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					CTCTTTGAACTTGACTCCAGA	0.418																																					p.K329R		Atlas-SNP	.											CHST9_ENST00000284224,NS,carcinoma,0,2	CHST9	114	2	0			c.A986G						scavenged	.						142.0	137.0	138.0					18																	24496569		1904	4110	6014	SO:0001583	missense	83539	exon6			TTGAACTTGACTC	AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.986A>G	18.37:g.24496569T>C	ENSP00000284224:p.Lys329Arg	148.0	1.0	0.00675676		209.0	47.0	0.22488	NM_031422	Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	ENST00000284224.8	37	CCDS42422.1	.	.	.	.	.	.	.	.	.	.	T	1.905	-0.452082	0.04540	.	.	ENSG00000154080	ENST00000284224	T	0.73258	-0.73	6.17	2.49	0.30216	.	0.214382	0.41938	N	0.000787	T	0.49321	0.1550	N	0.13043	0.29	0.80722	D	1	B	0.06786	0.001	B	0.15052	0.012	T	0.30119	-0.9989	10	0.07813	T	0.8	-12.2193	13.2521	0.60057	0.0:0.1491:0.0:0.8509	.	329	Q7L1S5	CHST9_HUMAN	R	329	ENSP00000284224:K329R	ENSP00000284224:K329R	K	-	2	0	CHST9	22750567	0.999000	0.42202	0.993000	0.49108	0.700000	0.40528	1.620000	0.36976	-0.021000	0.14009	-1.715000	0.00711	AAG	.	.	none		0.418	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446549.1	NM_031422	
HIST1H1E	3008	hgsc.bcm.edu	37	6	26157012	26157012	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:26157012G>A	ENST00000304218.3	+	1	454	c.394G>A	c.(394-396)Gca>Aca	p.A132T	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	132					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						CAAGAAGCCAGCAGGAGCGGC	0.637																																					p.A132T		Atlas-SNP	.											.	HIST1H1E	69	.	0			c.G394A						PASS	.						15.0	22.0	19.0					6																	26157012		2201	4297	6498	SO:0001583	missense	3008	exon1			AAGCCAGCAGGAG	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.394G>A	6.37:g.26157012G>A	ENSP00000307705:p.Ala132Thr	103.0	0.0	0		73.0	15.0	0.205479	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	5.354	0.250648	0.10130	.	.	ENSG00000168298	ENST00000304218	T	0.26957	1.7	5.51	1.63	0.23807	.	0.267468	0.34628	N	0.003817	T	0.05135	0.0137	L	0.27053	0.805	0.32693	N	0.513953	B	0.02656	0.0	B	0.04013	0.001	T	0.40194	-0.9576	10	0.14656	T	0.56	-0.2098	9.6047	0.39626	0.1402:0.0:0.7406:0.1192	.	132	P10412	H14_HUMAN	T	132	ENSP00000307705:A132T	ENSP00000307705:A132T	A	+	1	0	HIST1H1E	26264991	0.944000	0.32072	0.001000	0.08648	0.032000	0.12392	2.034000	0.41145	0.070000	0.16634	-1.300000	0.01332	GCA	.	.	none		0.637	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
LTBP2	4053	hgsc.bcm.edu	37	14	74971792	74971792	+	Silent	SNP	C	C	T	rs61738017	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr14:74971792C>T	ENST00000261978.4	-	29	4649	c.4263G>A	c.(4261-4263)gcG>gcA	p.A1421A	LTBP2_ENST00000556690.1_Silent_p.A1377A	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1421	TB 3.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGGAGCAGGGCGCATGGCCCT	0.662													C|||	101	0.0201677	0.0703	0.0101	5008	,	,		17322	0.0		0.0	False		,,,				2504	0.001				p.A1421A		Atlas-SNP	.											LTBP2,colon,carcinoma,-1,1	LTBP2	158	1	0			c.G4263A						PASS	.	C		268,4138	150.7+/-184.7	12,244,1947	48.0	48.0	48.0		4263	-7.4	0.0	14	dbSNP_129	48	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous	LTBP2	NM_000428.2		12,256,6235	TT,TC,CC		0.1395,6.0826,2.1529		1421/1822	74971792	280,12726	2203	4300	6503	SO:0001819	synonymous_variant	4053	exon29			GCAGGGCGCATGG		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.4263G>A	14.37:g.74971792C>T		38.0	0.0	0		49.0	22.0	0.44898	NM_000428	Q99907|Q9NS51	Silent	SNP	ENST00000261978.4	37	CCDS9831.1																																																																																			C|0.979;T|0.021	0.021	strong		0.662	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
PGM1	5236	hgsc.bcm.edu	37	1	64104389	64104389	+	Silent	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:64104389G>A	ENST00000371084.3	+	7	1275	c.1062G>A	c.(1060-1062)gaG>gaA	p.E354E	PGM1_ENST00000540265.1_Silent_p.E157E|PGM1_ENST00000371083.4_Silent_p.E372E	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	354					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						CTTTGTATGAGACCCCAACTG	0.502																																					p.E372E		Atlas-SNP	.											.	PGM1	75	.	0			c.G1116A						PASS	.						179.0	169.0	172.0					1																	64104389		2203	4300	6503	SO:0001819	synonymous_variant	5236	exon7			GTATGAGACCCCA	BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1062G>A	1.37:g.64104389G>A		368.0	0.0	0		302.0	18.0	0.0596026	NM_001172818	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Silent	SNP	ENST00000371084.3	37	CCDS625.1																																																																																			.	.	none		0.502	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024868.1	NM_002633	
BIRC6	57448	hgsc.bcm.edu	37	2	32724813	32724813	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:32724813C>T	ENST00000421745.2	+	46	8802	c.8668C>T	c.(8668-8670)Cga>Tga	p.R2890*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	2890					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CGTGGGTGCTCGAGCATGCTT	0.438																																					p.R2890X	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											BIRC6_ENST00000421745,NS,carcinoma,-1,4	BIRC6	838	4	0			c.C8668T						scavenged	.						216.0	211.0	213.0					2																	32724813		2203	4300	6503	SO:0001587	stop_gained	57448	exon46			GGTGCTCGAGCAT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.8668C>T	2.37:g.32724813C>T	ENSP00000393596:p.Arg2890*	210.0	2.0	0.00952381		286.0	65.0	0.227273	NM_016252	Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	51	17.445868	0.99886	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.42	4.53	0.55603	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	14.7907	0.69841	0.2614:0.7386:0.0:0.0	.	.	.	.	X	2890	.	ENSP00000393596:R2890X	R	+	1	2	BIRC6	32578317	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.557000	0.45871	1.370000	0.46153	0.655000	0.94253	CGA	.	.	none		0.438	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
EPB41L5	57669	hgsc.bcm.edu	37	2	120799656	120799656	+	Silent	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:120799656T>G	ENST00000263713.5	+	3	469	c.255T>G	c.(253-255)ggT>ggG	p.G85G	EPB41L5_ENST00000452780.1_Silent_p.G85G|EPB41L5_ENST00000331393.4_Silent_p.G85G|EPB41L5_ENST00000443124.1_Silent_p.G85G|EPB41L5_ENST00000443902.2_Silent_p.G85G	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	85	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						ACTATTTTGGTCTGAGATTTA	0.343																																					p.G85G		Atlas-SNP	.											.	EPB41L5	98	.	0			c.T255G						PASS	.						156.0	147.0	150.0					2																	120799656		2203	4300	6503	SO:0001819	synonymous_variant	57669	exon3			TTTTGGTCTGAGA	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.255T>G	2.37:g.120799656T>G		219.0	0.0	0		241.0	36.0	0.149378	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	ENST00000263713.5	37	CCDS2130.1																																																																																			.	.	none		0.343	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
TRPC3	7222	hgsc.bcm.edu	37	4	122846198	122846198	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:122846198A>C	ENST00000379645.3	-	3	1224	c.1151T>G	c.(1150-1152)cTt>cGt	p.L384R	TRPC3_ENST00000513531.1_Missense_Mutation_p.L311R|TRPC3_ENST00000264811.5_Missense_Mutation_p.L311R	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	299					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTTAATGGCAAGTTTGACACG	0.418																																					p.L384R		Atlas-SNP	.											.	TRPC3	201	.	0			c.T1151G						PASS	.						208.0	185.0	192.0					4																	122846198		2203	4300	6503	SO:0001583	missense	7222	exon3			ATGGCAAGTTTGA	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1151T>G	4.37:g.122846198A>C	ENSP00000368966:p.Leu384Arg	205.0	0.0	0		212.0	11.0	0.0518868	NM_001130698	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.923161	0.92319	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	T;T;T	0.71103	-0.54;-0.54;-0.54	5.92	5.92	0.95590	.	0.141093	0.39341	N	0.001390	D	0.85682	0.5753	M	0.87456	2.885	0.30473	N	0.773102	P;D;P	0.71674	0.852;0.998;0.911	P;D;P	0.67725	0.736;0.953;0.821	D	0.86427	0.1758	10	0.87932	D	0	-16.0118	16.3526	0.83220	1.0:0.0:0.0:0.0	.	299;311;384	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	R	311;384;311	ENSP00000264811:L311R;ENSP00000368966:L384R;ENSP00000426899:L311R	ENSP00000264811:L311R	L	-	2	0	TRPC3	123065648	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	9.262000	0.95591	2.255000	0.74692	0.533000	0.62120	CTT	.	.	none		0.418	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
WDR72	256764	hgsc.bcm.edu	37	15	54025345	54025345	+	Start_Codon_SNP	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr15:54025345A>C	ENST00000396328.1	-	2	241	c.2T>G	c.(1-3)aTg>aGg	p.M1R	WDR72_ENST00000559418.1_Start_Codon_SNP_p.M1R|WDR72_ENST00000360509.5_Start_Codon_SNP_p.M1R|WDR72_ENST00000557913.1_Start_Codon_SNP_p.M1R	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	1										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GGAAGTCCTCATTTTGGGCGA	0.463																																					p.M1R		Atlas-SNP	.											.	WDR72	177	.	0			c.T2G						PASS	.						71.0	66.0	68.0					15																	54025345		2194	4293	6487	SO:0001582	initiator_codon_variant	256764	exon2			GTCCTCATTTTGG	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2T>G	15.37:g.54025345A>C	ENSP00000379619:p.Met1Arg	89.0	0.0	0		67.0	14.0	0.208955	NM_182758	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	ENST00000396328.1	37	CCDS10151.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.794156	0.70452	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.45276	0.9;0.9	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.68202	-0.5471	9	0.87932	D	0	.	11.9358	0.52872	1.0:0.0:0.0:0.0	.	1	Q3MJ13	WDR72_HUMAN	R	1	ENSP00000379619:M1R;ENSP00000353699:M1R	ENSP00000353699:M1R	M	-	2	0	WDR72	51812637	1.000000	0.71417	0.611000	0.29010	0.474000	0.32979	5.692000	0.68256	2.002000	0.58637	0.533000	0.62120	ATG	.	.	none		0.463	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	Missense_Mutation
HSD3B7	80270	hgsc.bcm.edu	37	16	30997460	30997460	+	Missense_Mutation	SNP	C	C	T	rs371576756		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:30997460C>T	ENST00000297679.5	+	3	350	c.257C>T	c.(256-258)aCg>aTg	p.T86M	HSD3B7_ENST00000262520.6_Missense_Mutation_p.T86M|HSD3B7_ENST00000353250.5_Missense_Mutation_p.T86M|AC135048.1_ENST00000602217.1_Missense_Mutation_p.R25H	NM_025193.3	NP_079469.2	Q9H2F3	3BHS7_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7	86					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|cholest-5-ene-3-beta,7-alpha-diol 3-beta-dehydrogenase activity (GO:0047016)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GTCATCCACACGGCTGGGCTG	0.652																																					p.T86M		Atlas-SNP	.											.	HSD3B7	33	.	0			c.C257T						PASS	.	C	MET/THR,MET/THR,MET/THR	1,4393	2.1+/-5.4	0,1,2196	56.0	48.0	51.0		257,257,257	0.2	0.9	16		51	0,8600		0,0,4300	no	missense,missense,missense	HSD3B7	NM_001142777.1,NM_001142778.1,NM_025193.3	81,81,81	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	86/197,86/197,86/370	30997460	1,12993	2197	4300	6497	SO:0001583	missense	80270	exon3			TCCACACGGCTGG	AF277719	CCDS10698.1, CCDS45466.1	16p11.2	2011-09-14			ENSG00000099377	ENSG00000099377	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	18324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 3"""	607764				11067870, 19027726	Standard	NM_001142777		Approved	C(27)-3BETA-HSD, SDR11E3	uc002eaf.2	Q9H2F3	OTTHUMG00000132417	ENST00000297679.5:c.257C>T	16.37:g.30997460C>T	ENSP00000297679:p.Thr86Met	318.0	0.0	0		355.0	74.0	0.208451	NM_025193	Q96M28|Q9BSN9	Missense_Mutation	SNP	ENST00000297679.5	37	CCDS10698.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442073	0.63067	2.28E-4	0.0	ENSG00000099377	ENST00000262520;ENST00000353250;ENST00000297679	D;D;D	0.88586	-2.4;-2.4;-2.03	4.84	0.206	0.15208	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.448337	0.25391	N	0.031012	D	0.86222	0.5881	L	0.53617	1.68	0.27401	N	0.954856	P;P	0.51057	0.941;0.895	P;P	0.46850	0.473;0.529	T	0.80193	-0.1484	10	0.62326	D	0.03	-0.1907	9.4723	0.38851	0.0:0.6139:0.0:0.3861	.	86;86	Q96M28;Q9H2F3	.;3BHS7_HUMAN	M	86	ENSP00000262520:T86M;ENSP00000370662:T86M;ENSP00000297679:T86M	ENSP00000262520:T86M	T	+	2	0	HSD3B7	30904961	0.025000	0.19082	0.859000	0.33776	0.922000	0.55478	1.024000	0.30077	0.198000	0.20407	-0.377000	0.06932	ACG	.	.	weak		0.652	HSD3B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255554.2		
IGLL5	100423062	hgsc.bcm.edu	37	22	23230315	23230315	+	Silent	SNP	C	C	T	rs148489860	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr22:23230315C>T	ENST00000526893.1	+	1	356	c.82C>T	c.(82-84)Ctg>Ttg	p.L28L	IGLL5_ENST00000532223.2_Silent_p.L28L|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.L28L	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	28						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GCCCCTGCTGCTGCTGGGTCT	0.662													C|||	11	0.00219649	0.0045	0.0	5008	,	,		12566	0.003		0.001	False		,,,				2504	0.001				p.L28L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C82T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			CTGCTGCTGCTGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.82C>T	22.37:g.23230315C>T		45.0	0.0	0		68.0	20.0	0.294118	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			C|1.000;T|0.000	0.000	strong		0.662	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
NYNRIN	57523	hgsc.bcm.edu	37	14	24878537	24878537	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr14:24878537G>A	ENST00000382554.3	+	4	1855	c.1537G>A	c.(1537-1539)Gct>Act	p.A513T		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	513					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						AGAGGGACCCGCTCCAGTGCT	0.572																																					p.A513T		Atlas-SNP	.											.	NYNRIN	120	.	0			c.G1537A						PASS	.						39.0	42.0	41.0					14																	24878537		1934	4128	6062	SO:0001583	missense	57523	exon4			GGACCCGCTCCAG	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.1537G>A	14.37:g.24878537G>A	ENSP00000371994:p.Ala513Thr	110.0	0.0	0		102.0	13.0	0.127451	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	g	7.747	0.702554	0.15172	.	.	ENSG00000205978	ENST00000382554	T	0.09817	2.94	4.63	-3.59	0.04583	.	.	.	.	.	T	0.03348	0.0097	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.44314	-0.9336	9	0.07990	T	0.79	.	2.4094	0.04420	0.2503:0.0823:0.4134:0.2539	.	513	Q9P2P1	NYNRI_HUMAN	T	513	ENSP00000371994:A513T	ENSP00000371994:A513T	A	+	1	0	NYNRIN	23948377	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.413000	0.07123	-0.640000	0.05495	-2.194000	0.00310	GCT	.	.	none		0.572	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
POU2AF1	5450	hgsc.bcm.edu	37	11	111249896	111249896	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:111249896A>G	ENST00000393067.3	-	1	521	c.7T>C	c.(7-9)Tgg>Cgg	p.W3R		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	3					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		CGTTTTTGCCAGAGCATGGCC	0.557			T	BCL6	NHL																																p.W3R		Atlas-SNP	.		Dom	yes		11	11q23.1	5450	"""POU domain, class 2, associating factor 1 (OBF1)"""		L	.	POU2AF1	23	.	0			c.T7C						PASS	.						211.0	202.0	205.0					11																	111249896		2201	4297	6498	SO:0001583	missense	5450	exon1			TTTGCCAGAGCAT		CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.7T>C	11.37:g.111249896A>G	ENSP00000376786:p.Trp3Arg	313.0	0.0	0		366.0	82.0	0.224044	NM_006235	B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	37	CCDS31675.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211438	0.79240	.	.	ENSG00000110777	ENST00000393067	T	0.31510	1.49	5.3	5.3	0.74995	.	0.572674	0.16592	N	0.207726	T	0.46073	0.1374	L	0.38175	1.15	0.45118	D	0.998132	D	0.76494	0.999	D	0.87578	0.998	T	0.40403	-0.9565	10	0.87932	D	0	.	13.2379	0.59979	1.0:0.0:0.0:0.0	.	3	Q16633	OBF1_HUMAN	R	3	ENSP00000376786:W3R	ENSP00000376786:W3R	W	-	1	0	POU2AF1	110755106	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.293000	0.65680	2.225000	0.72522	0.533000	0.62120	TGG	.	.	none		0.557	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1	NM_006235	
SACS	26278	hgsc.bcm.edu	37	13	23907902	23907902	+	Silent	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr13:23907902A>C	ENST00000382292.3	-	9	10386	c.10113T>G	c.(10111-10113)acT>acG	p.T3371T	SACS_ENST00000382298.3_Silent_p.T3371T|SACS_ENST00000402364.1_Silent_p.T2621T			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3371					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TAAATGTTGAAGTTTGGACCA	0.353																																					p.T3371T		Atlas-SNP	.											SACS_ENST00000382298,NS,carcinoma,0,2	SACS	871	2	0			c.T10113G						PASS	.						75.0	73.0	74.0					13																	23907902		2203	4299	6502	SO:0001819	synonymous_variant	26278	exon10			TGTTGAAGTTTGG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10113T>G	13.37:g.23907902A>C		90.0	0.0	0		96.0	20.0	0.208333	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	ENST00000382292.3	37	CCDS9300.2																																																																																			.	.	none		0.353	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
ST7L	54879	hgsc.bcm.edu	37	1	113153627	113153627	+	Splice_Site	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:113153627T>C	ENST00000358039.4	-	3	593		c.e3-2		ST7L_ENST00000544629.1_Splice_Site|ST7L_ENST00000543570.1_Splice_Site|ST7L_ENST00000360743.4_Splice_Site|ST7L_ENST00000369668.2_Splice_Site|ST7L_ENST00000369666.1_Splice_Site|ST7L_ENST00000369669.1_Splice_Site|ST7L_ENST00000490067.1_Splice_Site|ST7L_ENST00000463235.1_Splice_Site|ST7L_ENST00000538187.1_Splice_Site|ST7L_ENST00000343210.7_Splice_Site	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like						negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCAAATATCTATGACAAACA	0.383																																					.		Atlas-SNP	.											.	ST7L	31	.	0			c.289-2A>G						PASS	.						93.0	88.0	90.0					1																	113153627		2203	4300	6503	SO:0001630	splice_region_variant	54879	exon4			AATATCTATGACA	AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.289-2A>G	1.37:g.113153627T>C		85.0	0.0	0		92.0	20.0	0.217391	NM_138728	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Splice_Site	SNP	ENST00000358039.4	37	CCDS848.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746023	0.69418	.	.	ENSG00000007341	ENST00000358039;ENST00000360743;ENST00000544629;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187;ENST00000543570;ENST00000369664	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3058	0.73990	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ST7L	112955150	1.000000	0.71417	0.970000	0.41538	0.839000	0.47603	7.606000	0.82863	2.254000	0.74563	0.482000	0.46254	.	.	.	none		0.383	ST7L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032504.3		Intron
DMBT1	1755	hgsc.bcm.edu	37	10	124340397	124340397	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:124340397C>T	ENST00000338354.3	+	11	1125	c.1019C>T	c.(1018-1020)cCg>cTg	p.P340L	DMBT1_ENST00000344338.3_Missense_Mutation_p.P340L|DMBT1_ENST00000368955.3_Missense_Mutation_p.P340L|DMBT1_ENST00000330163.4_Missense_Mutation_p.P340L|DMBT1_ENST00000368909.3_Missense_Mutation_p.P340L|DMBT1_ENST00000359586.6_Missense_Mutation_p.P208L|DMBT1_ENST00000368956.2_Missense_Mutation_p.P340L			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	340					defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CAGTCCCGGCCGACACCCAGC	0.532																																					p.P340L	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											DMBT1_ENST00000368915,NS,carcinoma,-1,13	DMBT1	677	13	0			c.C1019T						scavenged	.						449.0	390.0	409.0					10																	124340397		1913	4113	6026	SO:0001583	missense	1755	exon11			CCCGGCCGACACC		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.1019C>T	10.37:g.124340397C>T	ENSP00000342210:p.Pro340Leu	726.0	2.0	0.00275482		784.0	158.0	0.201531	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	C	5.419	0.262446	0.10294	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.25579	1.82;1.83;1.81;1.82;1.83;1.81;1.79	1.45	1.45	0.22620	Speract/scavenger receptor-related (1);	.	.	.	.	T	0.12008	0.0292	N	0.08118	0	0.09310	N	1	B;B;P;B;D;B	0.55800	0.11;0.036;0.704;0.001;0.973;0.293	B;B;B;B;P;B	0.45343	0.018;0.004;0.041;0.001;0.477;0.034	T	0.08106	-1.0738	9	0.11182	T	0.66	.	6.398	0.21622	0.0:1.0:0.0:0.0	.	208;340;340;340;340;340	F8WEF7;Q9UGM3-4;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;DMBT1_HUMAN	L	340;340;340;340;340;340;340;340;340;340;340;340;340;208	ENSP00000342210:P340L;ENSP00000343175:P340L;ENSP00000327747:P340L;ENSP00000357905:P340L;ENSP00000357951:P340L;ENSP00000357952:P340L;ENSP00000352593:P208L	ENSP00000331522:P340L	P	+	2	0	DMBT1	124330387	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.841000	0.27613	1.165000	0.42670	0.194000	0.17425	CCG	.	.	none		0.532	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230318	23230318	+	Missense_Mutation	SNP	C	C	G	rs567537853		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr22:23230318C>G	ENST00000526893.1	+	1	359	c.85C>G	c.(85-87)Ctg>Gtg	p.L29V	IGLL5_ENST00000532223.2_Missense_Mutation_p.L29V|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.L29V	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	29						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCTGCTGCTGCTGGGTCTGGC	0.657																																					p.L29V		Atlas-SNP	.											.	IGLL5	26	.	0			c.C85G						PASS	.																																			SO:0001583	missense	100423062	exon1			CTGCTGCTGGGTC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.85C>G	22.37:g.23230318C>G	ENSP00000431254:p.Leu29Val	39.0	0.0	0		62.0	18.0	0.290323	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347544	0.61183	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00717	5.79;5.8	3.82	3.82	0.43975	.	.	.	.	.	T	0.02193	0.0068	L	0.32530	0.975	0.24893	N	0.992151	D	0.76494	0.999	D	0.75484	0.986	T	0.54159	-0.8335	9	0.66056	D	0.02	.	11.5007	0.50435	0.0:1.0:0.0:0.0	.	29	B9A064	IGLL5_HUMAN	V	29	ENSP00000436353:L29V;ENSP00000431254:L29V	ENSP00000431254:L29V	L	+	1	2	IGLL5	21560318	0.000000	0.05858	0.815000	0.32552	0.079000	0.17450	0.026000	0.13599	2.423000	0.82170	0.643000	0.83706	CTG	.	.	none		0.657	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
NECAP1	25977	hgsc.bcm.edu	37	12	8245311	8245311	+	Silent	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:8245311A>G	ENST00000339754.5	+	5	501	c.423A>G	c.(421-423)caA>caG	p.Q141Q		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	141					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)				cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		AGGAATCTCAAGAAATGGATG	0.408																																					p.Q141Q		Atlas-SNP	.											.	NECAP1	21	.	0			c.A423G						PASS	.						70.0	71.0	71.0					12																	8245311		2203	4300	6503	SO:0001819	synonymous_variant	25977	exon5			ATCTCAAGAAATG	AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.423A>G	12.37:g.8245311A>G		104.0	0.0	0		138.0	40.0	0.289855	NM_015509	Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Silent	SNP	ENST00000339754.5	37	CCDS8589.1																																																																																			.	.	none		0.408	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400244.1	NM_015509	
GPR98	84059	hgsc.bcm.edu	37	5	89948249	89948249	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr5:89948249A>T	ENST00000405460.2	+	19	3599	c.3503A>T	c.(3502-3504)gAg>gTg	p.E1168V		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1168	Calx-beta 9. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCTGGGCAGGAGTTCTATGAA	0.388																																					p.E1168V		Atlas-SNP	.											.	GPR98	605	.	0			c.A3503T						PASS	.						134.0	128.0	130.0					5																	89948249		1908	4144	6052	SO:0001583	missense	84059	exon19			GGCAGGAGTTCTA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3503A>T	5.37:g.89948249A>T	ENSP00000384582:p.Glu1168Val	168.0	0.0	0		153.0	31.0	0.202614	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	33	5.230671	0.95207	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.29917	1.55	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.47637	0.1456	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.45789	-0.9237	10	0.87932	D	0	.	16.635	0.85050	1.0:0.0:0.0:0.0	.	1168	Q8WXG9	GPR98_HUMAN	V	1168	ENSP00000384582:E1168V	ENSP00000296619:E1168V	E	+	2	0	GPR98	89984005	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.078000	0.94023	2.330000	0.79161	0.477000	0.44152	GAG	.	.	none		0.388	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230283	23230283	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr22:23230283G>A	ENST00000526893.1	+	1	324	c.50G>A	c.(49-51)gGc>gAc	p.G17D	IGLL5_ENST00000532223.2_Missense_Mutation_p.G17D|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.G17D	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	17						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GAGGAGCTGGGCCCTGGTCCC	0.672																																					p.G17D		Atlas-SNP	.											.	IGLL5	26	.	0			c.G50A						PASS	.																																			SO:0001583	missense	100423062	exon1			AGCTGGGCCCTGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.50G>A	22.37:g.23230283G>A	ENSP00000431254:p.Gly17Asp	107.0	0.0	0		142.0	38.0	0.267606	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455202	0.26161	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00614	6.21;6.22	3.24	-0.78	0.10969	.	.	.	.	.	T	0.00580	0.0019	L	0.29908	0.895	0.09310	N	1	B	0.15930	0.015	B	0.10450	0.005	T	0.45425	-0.9262	9	0.52906	T	0.07	.	3.2568	0.06835	0.325:0.2123:0.4627:0.0	.	17	B9A064	IGLL5_HUMAN	D	17	ENSP00000436353:G17D;ENSP00000431254:G17D	ENSP00000431254:G17D	G	+	2	0	IGLL5	21560283	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.154000	0.16343	-0.051000	0.13334	0.643000	0.83706	GGC	.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
RABEP2	79874	hgsc.bcm.edu	37	16	28935738	28935738	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:28935738T>C	ENST00000358201.4	-	2	848	c.260A>G	c.(259-261)cAg>cGg	p.Q87R	RABEP2_ENST00000544477.1_Intron|RABEP2_ENST00000357573.6_Missense_Mutation_p.Q87R|RABEP2_ENST00000561803.1_5'UTR	NM_024816.2	NP_079092.2	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2	87					endocytosis (GO:0006897)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	16						CAGGATGGCCTGCAGCGAGGC	0.607																																					p.Q87R	Pancreas(66;639 1284 10093 31061 49099)	Atlas-SNP	.											.	RABEP2	48	.	0			c.A260G						PASS	.						47.0	49.0	48.0					16																	28935738		2102	4240	6342	SO:0001583	missense	79874	exon2			ATGGCCTGCAGCG	AK026935	CCDS42140.1	16p11.2	2014-09-11			ENSG00000177548	ENSG00000177548			24817	protein-coding gene	gene with protein product		611869				12477932	Standard	NM_024816		Approved	FRA, FLJ23282	uc002drq.3	Q9H5N1	OTTHUMG00000176593	ENST00000358201.4:c.260A>G	16.37:g.28935738T>C	ENSP00000350934:p.Gln87Arg	73.0	0.0	0		81.0	10.0	0.123457	NM_024816		Missense_Mutation	SNP	ENST00000358201.4	37	CCDS42140.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.637917	0.47049	.	.	ENSG00000177548	ENST00000358201;ENST00000357573	T;T	0.58210	0.39;0.35	4.29	4.29	0.51040	Rabaptin coiled-coil domain (1);	0.000000	0.85682	D	0.000000	T	0.67097	0.2857	L	0.58810	1.83	0.80722	D	1	D;D;D	0.69078	0.992;0.997;0.994	D;D;D	0.81914	0.979;0.995;0.988	T	0.70461	-0.4865	10	0.72032	D	0.01	-26.7142	12.7364	0.57228	0.0:0.0:0.0:1.0	.	87;87;87	Q9H5N1-2;Q49AT6;Q9H5N1	.;.;RABE2_HUMAN	R	87	ENSP00000350934:Q87R;ENSP00000350186:Q87R	ENSP00000350186:Q87R	Q	-	2	0	RABEP2	28843239	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.284000	0.78650	1.711000	0.51337	0.454000	0.30748	CAG	.	.	none		0.607	RABEP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000432691.1	NM_024816	
PRG4	10216	hgsc.bcm.edu	37	1	186276981	186276981	+	Silent	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:186276981A>G	ENST00000445192.2	+	7	2175	c.2130A>G	c.(2128-2130)aaA>aaG	p.K710K	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.K667K|PRG4_ENST00000367485.4_Silent_p.K617K|PRG4_ENST00000367483.4_Silent_p.K669K	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	710	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTACCCCTAAAGGGACTGCTC	0.582																																					p.K710K		Atlas-SNP	.											PRG4,NS,carcinoma,0,6	PRG4	259	6	0			c.A2130G						scavenged	.						162.0	175.0	171.0					1																	186276981		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			CCCTAAAGGGACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2130A>G	1.37:g.186276981A>G		123.0	0.0	0		118.0	5.0	0.0423729	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.	.	none		0.582	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
SCN1A	6323	hgsc.bcm.edu	37	2	166847770	166847770	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:166847770T>G	ENST00000303395.4	-	26	6014	c.6015A>C	c.(6013-6015)aaA>aaC	p.K2005N	SCN1A_ENST00000423058.2_Missense_Mutation_p.K2005N|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.K1994N|SCN1A_ENST00000409050.1_Missense_Mutation_p.K1977N|AC010127.3_ENST00000595647.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	2005					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	tCCCTTTGGCTTTTTCATCTT	0.383																																					p.K2005N		Atlas-SNP	.											SCN1A_ENST00000303395,NS,carcinoma,-1,2	SCN1A	641	2	0			c.A6015C						PASS	.						75.0	70.0	72.0					2																	166847770		2201	4300	6501	SO:0001583	missense	6323	exon26			TTTGGCTTTTTCA	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.6015A>C	2.37:g.166847770T>G	ENSP00000303540:p.Lys2005Asn	45.0	0.0	0		55.0	16.0	0.290909	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	ENST00000303395.4	37	CCDS54413.1	.	.	.	.	.	.	.	.	.	.	T	9.523	1.108698	0.20714	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96168	-3.93;-3.93;-3.89;-3.86	5.67	3.33	0.38152	.	0.462954	0.22275	N	0.062216	D	0.86535	0.5956	N	0.08118	0	0.34054	D	0.656484	B	0.15473	0.013	B	0.19391	0.025	T	0.81959	-0.0694	10	0.62326	D	0.03	.	2.4206	0.04447	0.2292:0.3772:0.0:0.3937	.	1994	P35498-2	.	N	2005;2005;1994;1977	ENSP00000407030:K2005N;ENSP00000303540:K2005N;ENSP00000364554:K1994N;ENSP00000386312:K1977N	ENSP00000303540:K2005N	K	-	3	2	SCN1A	166556016	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.969000	0.40510	0.980000	0.38523	0.397000	0.26171	AAA	.	.	none		0.383	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
WASF3	10810	hgsc.bcm.edu	37	13	27239258	27239258	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr13:27239258T>C	ENST00000335327.5	+	4	405	c.227T>C	c.(226-228)cTt>cCt	p.L76P	WASF3_ENST00000361042.4_Missense_Mutation_p.L76P|WASF3_ENST00000496788.1_3'UTR	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	76					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		ATTGATCGCCTTGCTGTCAAA	0.413																																					p.L76P		Atlas-SNP	.											.	WASF3	68	.	0			c.T227C						PASS	.						92.0	85.0	88.0					13																	27239258		2203	4300	6503	SO:0001583	missense	10810	exon4			ATCGCCTTGCTGT	AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.227T>C	13.37:g.27239258T>C	ENSP00000335055:p.Leu76Pro	79.0	0.0	0		110.0	34.0	0.309091	NM_006646	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	37	CCDS9318.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.230247	0.79688	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.69040	-0.37;-0.37	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.85062	0.5611	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88329	0.2967	10	0.87932	D	0	-27.7935	15.8529	0.78947	0.0:0.0:0.0:1.0	.	76;76	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	P	76	ENSP00000354325:L76P;ENSP00000335055:L76P	ENSP00000335055:L76P	L	+	2	0	WASF3	26137258	1.000000	0.71417	0.922000	0.36590	0.865000	0.49528	7.562000	0.82300	2.147000	0.66899	0.528000	0.53228	CTT	.	.	none		0.413	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
ATG2B	55102	hgsc.bcm.edu	37	14	96771961	96771961	+	Silent	SNP	T	T	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr14:96771961T>A	ENST00000359933.4	-	31	5591	c.4698A>T	c.(4696-4698)ggA>ggT	p.G1566G	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1566					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GAGGGACTATTCCAAAATCCT	0.383																																					p.G1566G		Atlas-SNP	.											.	ATG2B	169	.	0			c.A4698T						PASS	.						67.0	63.0	64.0					14																	96771961		2203	4300	6503	SO:0001819	synonymous_variant	55102	exon31			GACTATTCCAAAA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.4698A>T	14.37:g.96771961T>A		65.0	0.0	0		51.0	18.0	0.352941	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	ENST00000359933.4	37	CCDS9944.2																																																																																			.	.	none		0.383	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
FREM2	341640	hgsc.bcm.edu	37	13	39262561	39262561	+	Silent	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr13:39262561T>C	ENST00000280481.7	+	1	1296	c.1080T>C	c.(1078-1080)acT>acC	p.T360T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	360					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCAACCTTACTTCTCCATTCC	0.572																																					p.T360T		Atlas-SNP	.											.	FREM2	385	.	0			c.T1080C						PASS	.						124.0	113.0	117.0					13																	39262561		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon1			CCTTACTTCTCCA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1080T>C	13.37:g.39262561T>C		109.0	0.0	0		132.0	28.0	0.212121	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			.	.	none		0.572	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
CPNE6	9362	hgsc.bcm.edu	37	14	24544773	24544773	+	Silent	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr14:24544773A>C	ENST00000397016.2	+	10	1148	c.837A>C	c.(835-837)tcA>tcC	p.S279S	CPNE6_ENST00000537691.1_Silent_p.S334S|CPNE6_ENST00000216775.2_Silent_p.S279S	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	279					lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		ACAAGAGCTCAGGGACGGTAG	0.552																																					p.S279S		Atlas-SNP	.											CPNE6,mouth,carcinoma,+1,1	CPNE6	40	1	0			c.A837C						PASS	.						104.0	89.0	94.0					14																	24544773		2203	4300	6503	SO:0001819	synonymous_variant	9362	exon9			GAGCTCAGGGACG	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.837A>C	14.37:g.24544773A>C		162.0	0.0	0		191.0	32.0	0.167539	NM_006032	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	ENST00000397016.2	37	CCDS9607.1																																																																																			.	.	none		0.552	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
ZNF454	285676	hgsc.bcm.edu	37	5	178392474	178392474	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr5:178392474G>A	ENST00000320129.3	+	5	1372	c.1069G>A	c.(1069-1071)Gaa>Aaa	p.E357K	ZNF454_ENST00000519564.1_Missense_Mutation_p.E357K	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		GAAACCCTTTGAATGTAATGA	0.393																																					p.E357K		Atlas-SNP	.											.	ZNF454	99	.	0			c.G1069A						PASS	.						40.0	44.0	43.0					5																	178392474		2203	4300	6503	SO:0001583	missense	285676	exon5			CCCTTTGAATGTA	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1069G>A	5.37:g.178392474G>A	ENSP00000326249:p.Glu357Lys	63.0	0.0	0		49.0	5.0	0.102041	NM_001178089	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	37	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.716785	0.48622	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.06608	3.28;3.28	4.21	4.21	0.49690	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40818	N	0.001005	T	0.04452	0.0122	N	0.01188	-0.97	0.28822	N	0.897625	P	0.51791	0.948	P	0.51866	0.682	T	0.44050	-0.9353	10	0.34782	T	0.22	-18.4194	14.4348	0.67274	0.0:0.0:1.0:0.0	.	357	Q8N9F8	ZN454_HUMAN	K	357	ENSP00000326249:E357K;ENSP00000430354:E357K	ENSP00000326249:E357K	E	+	1	0	ZNF454	178325080	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	-0.128000	0.10531	2.344000	0.79699	0.650000	0.86243	GAA	.	.	none		0.393	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
TXNDC2	84203	hgsc.bcm.edu	37	18	9887155	9887155	+	Missense_Mutation	SNP	A	A	G	rs200725516		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr18:9887155A>G	ENST00000306084.6	+	2	878	c.679A>G	c.(679-681)Acc>Gcc	p.T227A	TXNDC2_ENST00000357775.5_Missense_Mutation_p.T160A|TXNDC2_ENST00000536353.2_Intron	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	227	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						TATTGCCAAGACCTCAGTGAA	0.562																																					p.T227A		Atlas-SNP	.											TXNDC2_ENST00000306084,NS,carcinoma,0,2	TXNDC2	168	2	0			c.A679G						PASS	.						131.0	132.0	132.0					18																	9887155		2203	4300	6503	SO:0001583	missense	84203	exon2			GCCAAGACCTCAG	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.679A>G	18.37:g.9887155A>G	ENSP00000304908:p.Thr227Ala	109.0	0.0	0		137.0	9.0	0.0656934	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	ENST00000306084.6	37	CCDS42414.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	a	9.538	1.112696	0.20795	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T	0.15952	2.38;2.38	3.14	-4.09	0.03951	.	3.297290	0.00964	N	0.003154	T	0.06096	0.0158	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22695	-1.0209	9	.	.	.	-0.4193	2.0291	0.03525	0.1619:0.1351:0.4638:0.2392	.	227	Q86VQ3	TXND2_HUMAN	A	100;160;227;227	ENSP00000350419:T160A;ENSP00000304908:T227A	.	T	+	1	0	TXNDC2	9877155	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.570000	0.00427	-0.337000	0.08426	-0.528000	0.04320	ACC	A|1.000;G|0.000	0.000	strong		0.562	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
OR4C3	256144	hgsc.bcm.edu	37	11	48347041	48347041	+	Silent	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:48347041T>C	ENST00000319856.4	+	1	570	c.549T>C	c.(547-549)gtT>gtC	p.V183V		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						ATTCATTGGTTCAGCTCCTCC	0.527																																					p.V183V		Atlas-SNP	.											.	OR4C3	75	.	0			c.T549C						PASS	.						155.0	144.0	148.0					11																	48347041		2201	4298	6499	SO:0001819	synonymous_variant	256144	exon1			ATTGGTTCAGCTC	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.549T>C	11.37:g.48347041T>C		347.0	0.0	0		361.0	26.0	0.0720222	NM_001004702	B2RNF2|Q6IFB3	Silent	SNP	ENST00000319856.4	37	CCDS31489.1																																																																																			.	.	none		0.527	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
PDLIM1	9124	hgsc.bcm.edu	37	10	96998439	96998439	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr10:96998439T>C	ENST00000329399.6	-	6	797	c.689A>G	c.(688-690)gAt>gGt	p.D230G	PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1	230					regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CTTGTTGGGATCCCCTGAAAT	0.433																																					p.D230G		Atlas-SNP	.											.	PDLIM1	33	.	0			c.A689G						PASS	.						80.0	72.0	74.0					10																	96998439		2203	4300	6503	SO:0001583	missense	9124	exon6			TTGGGATCCCCTG	U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.689A>G	10.37:g.96998439T>C	ENSP00000360305:p.Asp230Gly	248.0	0.0	0		225.0	46.0	0.204444	NM_020992	B2RBS6|Q5VZH5|Q9BPZ9	Missense_Mutation	SNP	ENST00000329399.6	37	CCDS7441.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.399588	0.83120	.	.	ENSG00000107438	ENST00000329399	T	0.21734	1.99	5.23	5.23	0.72850	.	0.088256	0.85682	D	0.000000	T	0.37183	0.0994	M	0.68317	2.08	0.80722	D	1	D	0.61080	0.989	P	0.55749	0.783	T	0.09907	-1.0653	10	0.37606	T	0.19	-18.4018	14.2967	0.66318	0.0:0.0:0.0:1.0	.	230	O00151	PDLI1_HUMAN	G	230	ENSP00000360305:D230G	ENSP00000360305:D230G	D	-	2	0	PDLIM1	96988429	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.491000	0.81471	1.978000	0.57642	0.454000	0.30748	GAT	.	.	none		0.433	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049508.1		
TSPAN19	144448	hgsc.bcm.edu	37	12	85421763	85421763	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:85421763A>C	ENST00000532498.2	-	4	258	c.178T>G	c.(178-180)Ttg>Gtg	p.L60V	TSPAN19_ENST00000547403.2_Intron	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	60						integral component of membrane (GO:0016021)				ovary(1)	1						ATTCCAATCAAAATTTGAGAA	0.294																																					p.L60V		Atlas-SNP	.											TSPAN19_ENST00000532498,NS,carcinoma,+2,2	TSPAN19	23	2	0			c.T178G						PASS	.						58.0	54.0	55.0					12																	85421763		1806	4063	5869	SO:0001583	missense	144448	exon4			CAATCAAAATTTG		CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.178T>G	12.37:g.85421763A>C	ENSP00000433816:p.Leu60Val	108.0	0.0	0		119.0	22.0	0.184874	NM_001100917		Missense_Mutation	SNP	ENST00000532498.2	37	CCDS44949.1	.	.	.	.	.	.	.	.	.	.	A	10.04	1.241688	0.22711	.	.	ENSG00000231738	ENST00000532498;ENST00000547836	T;T	0.80738	-1.41;-1.41	4.4	0.887	0.19200	.	.	.	.	.	T	0.70885	0.3275	L	0.29908	0.895	0.09310	N	1	P	0.45348	0.856	P	0.45753	0.492	T	0.60342	-0.7282	9	0.51188	T	0.08	.	5.6138	0.17420	0.5677:0.0:0.4323:0.0	.	60	P0C672	TSN19_HUMAN	V	60	ENSP00000433816:L60V;ENSP00000446898:L60V	ENSP00000433816:L60V	L	-	1	2	TSPAN19	83945894	0.109000	0.22037	0.001000	0.08648	0.131000	0.20780	0.497000	0.22514	0.302000	0.22762	0.533000	0.62120	TTG	.	.	none		0.294	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388240.2	NM_001100917	
PENK	5179	hgsc.bcm.edu	37	8	57354094	57354094	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr8:57354094C>T	ENST00000314922.3	-	2	617	c.541G>A	c.(541-543)Gaa>Aaa	p.E181K	PENK_ENST00000451791.2_Missense_Mutation_p.E181K|PENK_ENST00000523274.1_5'UTR	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	181					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)	p.E181K(1)		central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			TTGCTCACTTCTTCCTCATTA	0.522																																					p.E181K		Atlas-SNP	.											PENK,NS,carcinoma,0,1	PENK	59	1	1	Substitution - Missense(1)	lung(1)	c.G541A						PASS	.						136.0	140.0	138.0					8																	57354094		2203	4300	6503	SO:0001583	missense	5179	exon4			TCACTTCTTCCTC		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.541G>A	8.37:g.57354094C>T	ENSP00000324248:p.Glu181Lys	104.0	0.0	0		116.0	20.0	0.172414	NM_001135690	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	ENST00000314922.3	37	CCDS6168.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593512	0.66219	.	.	ENSG00000181195	ENST00000539312;ENST00000314922;ENST00000451791	T;T	0.17691	2.26;2.26	5.81	4.92	0.64577	.	0.472244	0.22308	N	0.061779	T	0.19967	0.0480	L	0.55990	1.75	0.80722	D	1	P	0.42078	0.77	B	0.38803	0.282	T	0.01630	-1.1308	10	0.41790	T	0.15	-3.0444	15.9707	0.80013	0.0:0.8651:0.1349:0.0	.	181	P01210	PENK_HUMAN	K	181	ENSP00000324248:E181K;ENSP00000400894:E181K	ENSP00000324248:E181K	E	-	1	0	PENK	57516648	0.997000	0.39634	0.064000	0.19789	0.904000	0.53231	7.035000	0.76517	1.429000	0.47314	0.655000	0.94253	GAA	.	.	none		0.522	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378645.1		
ZNF629	23361	hgsc.bcm.edu	37	16	30795076	30795076	+	Silent	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:30795076C>T	ENST00000262525.4	-	3	780	c.573G>A	c.(571-573)tcG>tcA	p.S191S		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GCACCAGGTGCGAGCTCTGCG	0.662																																					p.S191S		Atlas-SNP	.											ZNF629,colon,carcinoma,-1,1	ZNF629	44	1	0			c.G573A						PASS	.						45.0	47.0	46.0					16																	30795076		2197	4300	6497	SO:0001819	synonymous_variant	23361	exon3			CAGGTGCGAGCTC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.573G>A	16.37:g.30795076C>T		16.0	0.0	0		20.0	7.0	0.35	NM_001080417	Q15938	Silent	SNP	ENST00000262525.4	37	CCDS45463.1																																																																																			.	.	none		0.662	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434291.1	NM_015309	
FREM1	158326	hgsc.bcm.edu	37	9	14859353	14859353	+	Silent	SNP	C	C	T	rs562673690	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr9:14859353C>T	ENST00000380880.3	-	4	1242	c.459G>A	c.(457-459)gcG>gcA	p.A153A	FREM1_ENST00000422223.2_Silent_p.A153A|FREM1_ENST00000380881.4_Silent_p.A153A			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	153					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTTTATCAATCGCTTGGGACA	0.488																																					p.A153A		Atlas-SNP	.											.	FREM1	261	.	0			c.G459A						PASS	.						132.0	130.0	131.0					9																	14859353		1898	4126	6024	SO:0001819	synonymous_variant	158326	exon5			ATCAATCGCTTGG	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.459G>A	9.37:g.14859353C>T		125.0	0.0	0		130.0	25.0	0.192308	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	ENST00000380880.3	37	CCDS47952.1																																																																																			.	.	none		0.488	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
LYN	4067	hgsc.bcm.edu	37	8	56910951	56910951	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr8:56910951G>A	ENST00000519728.1	+	11	1393	c.1097G>A	c.(1096-1098)cGg>cAg	p.R366Q	LYN_ENST00000520220.2_Missense_Mutation_p.R345Q|LYN_ENST00000420292.1_3'UTR	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase	366	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	TACATTCACCGGGACCTGCGA	0.448																																					p.R366Q		Atlas-SNP	.											.	LYN	54	.	0			c.G1097A						PASS	.						115.0	110.0	112.0					8																	56910951		2203	4300	6503	SO:0001583	missense	4067	exon11			TTCACCGGGACCT	M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.1097G>A	8.37:g.56910951G>A	ENSP00000428924:p.Arg366Gln	227.0	0.0	0		287.0	73.0	0.254355	NM_002350	A0AVQ5	Missense_Mutation	SNP	ENST00000519728.1	37	CCDS6162.1	.	.	.	.	.	.	.	.	.	.	G	36	5.851905	0.97023	.	.	ENSG00000254087	ENST00000519728;ENST00000520220	D;D	0.88354	-2.37;-2.37	5.52	5.52	0.82312	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97099	0.9052	H	0.98507	4.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.98468	1.0599	10	0.87932	D	0	.	19.4505	0.94865	0.0:0.0:1.0:0.0	.	436;366	Q6NUK7;P07948	.;LYN_HUMAN	Q	366;345	ENSP00000428924:R366Q;ENSP00000428424:R345Q	ENSP00000428924:R366Q	R	+	2	0	LYN	57073505	1.000000	0.71417	0.688000	0.30117	0.945000	0.59286	9.869000	0.99810	2.597000	0.87782	0.655000	0.94253	CGG	.	.	none		0.448	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378155.1	NM_002350	
ALX1	8092	hgsc.bcm.edu	37	12	85674196	85674196	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:85674196T>G	ENST00000316824.3	+	1	312	c.157T>G	c.(157-159)Ttc>Gtc	p.F53V		NM_006982.2	NP_008913.2	Q15699	ALX1_HUMAN	ALX homeobox 1	53					anterior/posterior pattern specification (GO:0009952)|brain development (GO:0007420)|cartilage condensation (GO:0001502)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|mesenchymal cell development (GO:0014031)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(16)|ovary(1)	26				GBM - Glioblastoma multiforme(134;0.134)		CGTGCAGGCCTTCGGACCCCT	0.637																																					p.F53V		Atlas-SNP	.											ALX1,lower_third,carcinoma,-2,1	ALX1	61	1	0			c.T157G						scavenged	.						43.0	44.0	44.0					12																	85674196		2203	4300	6503	SO:0001583	missense	8092	exon1			CAGGCCTTCGGAC	U31986	CCDS9028.1	12q21.31	2011-06-20	2007-07-26	2007-07-26		ENSG00000180318		"""Homeoboxes / PRD class"""	1494	protein-coding gene	gene with protein product		601527	"""cartilage paired-class homeoprotein 1"""	CART1		8756334, 7592751	Standard	NM_006982		Approved		uc001tae.4	Q15699	OTTHUMG00000169820	ENST00000316824.3:c.157T>G	12.37:g.85674196T>G	ENSP00000315417:p.Phe53Val	73.0	1.0	0.0136986		66.0	12.0	0.181818	NM_006982	Q546C8|Q96FH4	Missense_Mutation	SNP	ENST00000316824.3	37	CCDS9028.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.481878	0.63849	.	.	ENSG00000180318	ENST00000316824	D	0.91843	-2.92	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.91794	0.7404	N	0.24115	0.695	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	D	0.90594	0.4539	10	0.27082	T	0.32	.	14.7384	0.69434	0.0:0.0:0.0:1.0	.	53	Q15699	ALX1_HUMAN	V	53	ENSP00000315417:F53V	ENSP00000315417:F53V	F	+	1	0	ALX1	84198327	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.290000	0.65661	2.069000	0.61940	0.528000	0.53228	TTC	.	.	none		0.637	ALX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406072.1	NM_006982	
MUC12	10071	hgsc.bcm.edu	37	7	100635679	100635679	+	Missense_Mutation	SNP	C	C	G	rs10953314	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr7:100635679C>G	ENST00000379442.3	+	5	2264	c.2264C>G	c.(2263-2265)aCc>aGc	p.T755S	MUC12_ENST00000536621.1_Missense_Mutation_p.T612S			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	755	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CACAGCAGCACCAGATCGCCA	0.562													-|||	2362	0.471645	0.3457	0.3718	5008	,	,		31418	0.6111		0.5149	False		,,,				2504	0.5245				p.T612S		Atlas-SNP	.											.	MUC12	140	.	0			c.C1835G						PASS	.	C	SER/THR	560,824		100,360,232	309.0	331.0	325.0		1835	-1.4	0.0	7	dbSNP_120	325	1634,1548		435,764,392	no	missense	MUC12	NM_001164462.1	58	535,1124,624	GG,GC,CC		48.6486,40.4624,48.0508		612/5336	100635679	2194,2372	692	1591	2283	SO:0001583	missense	10071	exon2			GCAGCACCAGATC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.2264C>G	7.37:g.100635679C>G	ENSP00000368755:p.Thr755Ser	2.0	0.0	0		5.0	4.0	0.8	NM_001164462	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	ENST00000379442.3	37		1060	0.48534798534798534	193	0.39227642276422764	144	0.39779005524861877	331	0.5786713286713286	392	0.5171503957783641	-	0.699	-0.791553	0.02884	0.404624	0.513514	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11385	2.79;2.78	0.695	-1.39	0.08997	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.36962	-0.9726	6	0.08599	T	0.76	.	3.6015	0.08026	0.2554:0.4889:0.2557:0.0	rs10953314;rs61247694	.	.	.	S	755;612	ENSP00000368755:T755S;ENSP00000441929:T612S	ENSP00000368755:T755S	T	+	2	0	MUC12	100422399	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.139000	0.10358	-1.094000	0.03054	0.162000	0.16502	ACC	C|0.505;G|0.495	0.495	strong		0.562	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000347234.1	XM_379904	
GOLGA4	2803	hgsc.bcm.edu	37	3	37368928	37368928	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:37368928A>T	ENST00000361924.2	+	14	5925	c.5551A>T	c.(5551-5553)Att>Ttt	p.I1851F	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.I1873F	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1851	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AACCTGTCAGATTTTGGAGCA	0.368																																					p.I1873F		Atlas-SNP	.											.	GOLGA4	173	.	0			c.A5617T						PASS	.						56.0	58.0	57.0					3																	37368928		2203	4298	6501	SO:0001583	missense	2803	exon15			TGTCAGATTTTGG	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.5551A>T	3.37:g.37368928A>T	ENSP00000354486:p.Ile1851Phe	75.0	0.0	0		71.0	18.0	0.253521	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	10.50	1.367946	0.24771	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.23147	1.92;1.92;1.92	4.81	-1.98	0.07480	.	1.321480	0.05575	N	0.571778	T	0.23492	0.0568	L	0.57536	1.79	0.09310	N	1	B;B;B;B	0.26744	0.001;0.001;0.001;0.158	B;B;B;B	0.23574	0.003;0.002;0.002;0.047	T	0.39860	-0.9593	10	0.56958	D	0.05	.	5.1342	0.14926	0.445:0.0:0.36:0.1949	.	1851;1851;1873;1851	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	F	1851;1873;1722	ENSP00000354486:I1851F;ENSP00000349305:I1873F;ENSP00000405842:I1722F	ENSP00000349305:I1873F	I	+	1	0	GOLGA4	37343932	0.000000	0.05858	0.452000	0.26994	0.653000	0.38743	-0.420000	0.07062	0.009000	0.14813	-0.463000	0.05309	ATT	.	.	none		0.368	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
SGK1	6446	hgsc.bcm.edu	37	6	134495658	134495658	+	Missense_Mutation	SNP	G	G	A	rs375777416		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:134495658G>A	ENST00000237305.7	-	2	231	c.143C>T	c.(142-144)gCa>gTa	p.A48V	SGK1_ENST00000475719.2_Missense_Mutation_p.A48V|SGK1_ENST00000367858.5_Missense_Mutation_p.A143V|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000413996.3_Missense_Mutation_p.A62V|SGK1_ENST00000528577.1_Missense_Mutation_p.A76V|SGK1_ENST00000367857.5_Missense_Mutation_p.A38V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	48	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CTGTTTGCATGCATAGGAGTT	0.413											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A143V		Atlas-SNP	.											.	SGK1	387	.	0			c.C428T						PASS	.	G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	88.0	85.0	86.0		143,185,227,428	5.9	1.0	6		86	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SGK1	NM_005627.3,NM_001143678.1,NM_001143677.1,NM_001143676.1	64,64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign	48/432,62/446,76/460,143/527	134495658	1,13005	2203	4300	6503	SO:0001583	missense	6446	exon4			TTGCATGCATAGG	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.143C>T	6.37:g.134495658G>A	ENSP00000237305:p.Ala48Val	86.0	0.0	0	1611	88.0	14.0	0.159091	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	11.90	1.778015	0.31502	0.0	1.16E-4	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.38240	1.67;1.67;1.67;1.67;1.67;1.67;1.15	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.19005	0.0456	L	0.42245	1.32	0.80722	D	1	B;B;B;B;B;B	0.29988	0.001;0.264;0.0;0.004;0.013;0.001	B;B;B;B;B;B	0.24269	0.004;0.052;0.001;0.005;0.022;0.002	T	0.06267	-1.0836	10	0.15066	T	0.55	.	20.2576	0.98430	0.0:0.0:1.0:0.0	.	76;62;48;38;143;48	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	143;62;48;38;76;48;112	ENSP00000356832:A143V;ENSP00000396242:A62V;ENSP00000237305:A48V;ENSP00000356831:A38V;ENSP00000434450:A76V;ENSP00000434302:A48V;ENSP00000435577:A112V	ENSP00000237305:A48V	A	-	2	0	SGK1	134537351	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	8.062000	0.89475	2.783000	0.95769	0.655000	0.94253	GCA	.	.	weak		0.413	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
TMX4	56255	hgsc.bcm.edu	37	20	8000141	8000141	+	Silent	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr20:8000141C>T	ENST00000246024.2	-	1	335	c.120G>A	c.(118-120)caG>caA	p.Q40Q	RP5-971N18.3_ENST00000607924.1_RNA|RP5-971N18.3_ENST00000457707.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	40	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CGGTCATGGGCTGGACCCGGC	0.736																																					p.Q40Q		Atlas-SNP	.											.	TMX4	39	.	0			c.G120A						PASS	.						13.0	14.0	14.0					20																	8000141		1935	3764	5699	SO:0001819	synonymous_variant	56255	exon1			CATGGGCTGGACC		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.120G>A	20.37:g.8000141C>T		14.0	0.0	0		40.0	11.0	0.275	NM_021156	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Silent	SNP	ENST00000246024.2	37	CCDS13101.1																																																																																			.	.	none		0.736	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000077928.2	NM_021156	
PAX1	5075	hgsc.bcm.edu	37	20	21687153	21687153	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr20:21687153C>T	ENST00000398485.2	+	2	418	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	PAX1_ENST00000460221.1_Intron|PAX1_ENST00000444366.2_Missense_Mutation_p.R98C	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	122	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CATCCGCTTGCGCATTGTGGA	0.647																																					p.R122C		Atlas-SNP	.											.	PAX1	152	.	0			c.C364T						PASS	.						32.0	35.0	34.0					20																	21687153		2203	4299	6502	SO:0001583	missense	5075	exon2			CGCTTGCGCATTG		CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.364C>T	20.37:g.21687153C>T	ENSP00000381499:p.Arg122Cys	22.0	0.0	0		27.0	8.0	0.296296	NM_006192	B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	ENST00000398485.2	37	CCDS13146.2	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981240	0.53827	.	.	ENSG00000125813	ENST00000398485;ENST00000444366	D;D	0.99479	-5.98;-5.98	5.14	5.14	0.70334	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99510	0.9825	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98521	1.0623	10	0.87932	D	0	.	18.2175	0.89890	0.0:1.0:0.0:0.0	.	98;28;122	P15863-2;C9J775;P15863	.;.;PAX1_HUMAN	C	122;98	ENSP00000381499:R122C;ENSP00000410355:R98C	ENSP00000381499:R122C	R	+	1	0	PAX1	21635153	1.000000	0.71417	0.998000	0.56505	0.015000	0.08874	2.369000	0.44231	2.382000	0.81193	0.655000	0.94253	CGC	.	.	none		0.647	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078282.3		
ROPN1B	152015	hgsc.bcm.edu	37	3	125702141	125702141	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:125702141A>G	ENST00000514116.1	+	7	932	c.617A>G	c.(616-618)aAc>aGc	p.N206S	ROPN1B_ENST00000251776.4_Missense_Mutation_p.N206S|ROPN1B_ENST00000505382.1_Missense_Mutation_p.N114S|ROPN1B_ENST00000511082.1_Missense_Mutation_p.N114S			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	206					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		TTTACCCAAAACCCCAGGGTT	0.373																																					p.N206S		Atlas-SNP	.											.	ROPN1B	16	.	0			c.A617G						PASS	.						119.0	110.0	113.0					3																	125702141		2203	4300	6503	SO:0001583	missense	152015	exon6			CCCAAAACCCCAG	AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.617A>G	3.37:g.125702141A>G	ENSP00000426271:p.Asn206Ser	114.0	0.0	0		137.0	19.0	0.138686	NM_001012337	D3DNA6|Q96BM7	Missense_Mutation	SNP	ENST00000514116.1	37	CCDS33841.1	.	.	.	.	.	.	.	.	.	.	A	11.26	1.585762	0.28268	.	.	ENSG00000114547	ENST00000514116;ENST00000251776;ENST00000505382;ENST00000511082	T;T;T;T	0.22539	1.95;1.95;1.96;1.96	2.16	2.16	0.27623	.	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	N	0.22421	0.69	0.27471	N	0.95288	D	0.56035	0.974	D	0.67725	0.953	T	0.10636	-1.0621	10	0.07990	T	0.79	-14.4117	6.3386	0.21310	1.0:0.0:0.0:0.0	.	206	Q9BZX4	ROP1B_HUMAN	S	206;206;114;114	ENSP00000426271:N206S;ENSP00000251776:N206S;ENSP00000421662:N114S;ENSP00000424447:N114S	ENSP00000251776:N206S	N	+	2	0	ROPN1B	127184831	1.000000	0.71417	0.999000	0.59377	0.750000	0.42670	4.669000	0.61575	1.241000	0.43820	0.373000	0.22412	AAC	.	.	none		0.373	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369931.1	NM_001012337	
ASIC1	41	hgsc.bcm.edu	37	12	50467769	50467769	+	Intron	SNP	G	G	A	rs706793	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr12:50467769G>A	ENST00000447966.2	+	4	787				ASIC1_ENST00000228468.4_Intron|ASIC1_ENST00000552438.1_Silent_p.P134P	NM_001095.3	NP_001086.2	P78348	ASIC1_HUMAN	acid-sensing (proton-gated) ion channel 1						associative learning (GO:0008306)|calcium ion transmembrane transport (GO:0070588)|cellular response to pH (GO:0071467)|ion transmembrane transport (GO:0034220)|memory (GO:0007613)|negative regulation of neurotransmitter secretion (GO:0046929)|protein homotrimerization (GO:0070207)|regulation of membrane potential (GO:0042391)|response to acidic pH (GO:0010447)|response to pH (GO:0009268)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acid-sensing ion channel activity (GO:0044736)|ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)									Amiloride(DB00594)|Diclofenac(DB00586)	TGGCCTTCCCGGCAGTCACCC	0.577													G|||	1142	0.228035	0.1021	0.3112	5008	,	,		17370	0.0913		0.4364	False		,,,				2504	0.2658				p.P134P		Atlas-SNP	.											.	.	.	.	0			c.G402A						PASS	.																																			SO:0001627	intron_variant	41	exon1			CTTCCCGGCAGTC	U78181	CCDS8796.1, CCDS44876.1, CCDS58228.1	12q12	2012-02-23	2012-02-22	2012-02-22		ENSG00000110881		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	100	protein-coding gene	gene with protein product		602866	"""amiloride-sensitive cation channel 2, neuronal"""	ACCN2		9037075	Standard	NM_001095		Approved	BNaC2, hBNaC2	uc001rvv.4	P78348	OTTHUMG00000169812	ENST00000447966.2:c.559-3227G>A	12.37:g.50467769G>A		2.0	0.0	0		4.0	4.0	1	NM_001256830	A3KN86|E5KBL7|P78349|Q96CV2	Silent	SNP	ENST00000447966.2	37	CCDS44876.1																																																																																			G|0.753;A|0.247	0.247	strong		0.577	ASIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406004.2	NM_020039	
SCN9A	6335	hgsc.bcm.edu	37	2	167168208	167168208	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr2:167168208A>G	ENST00000409435.1	-	1	58	c.59T>C	c.(58-60)cTt>cCt	p.L20P	SCN9A_ENST00000303354.6_Missense_Mutation_p.L20P|SCN9A_ENST00000375387.4_Missense_Mutation_p.L20P|SCN9A_ENST00000409672.1_Missense_Mutation_p.L20P			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	20					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATGAGGGCAAGAGACTGTTT	0.428																																					p.L20P		Atlas-SNP	.											SCN9A,colon,carcinoma,+1,2	SCN9A	296	2	0			c.T59C						PASS	.						97.0	95.0	96.0					2																	167168208		1908	4140	6048	SO:0001583	missense	6335	exon2			AGGGCAAGAGACT	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.59T>C	2.37:g.167168208A>G	ENSP00000386330:p.Leu20Pro	90.0	0.0	0		81.0	19.0	0.234568	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	37	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	a	22.4	4.283973	0.80803	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.98012	-4.65;-4.66;-4.66;-4.66	5.43	5.43	0.79202	.	0.235814	0.30227	N	0.010109	D	0.99180	0.9716	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99100	1.0843	10	0.87932	D	0	.	15.1326	0.72536	1.0:0.0:0.0:0.0	.	20	E7EUN6	.	P	20	ENSP00000386306:L20P;ENSP00000364536:L20P;ENSP00000304748:L20P;ENSP00000386330:L20P	ENSP00000304748:L20P	L	-	2	0	SCN9A	166876454	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.307000	0.96226	2.055000	0.61198	0.533000	0.62120	CTT	.	.	none		0.428	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
PTPRT	11122	hgsc.bcm.edu	37	20	40709537	40709537	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr20:40709537T>A	ENST00000373187.1	-	31	4307	c.4308A>T	c.(4306-4308)gaA>gaT	p.E1436D	PTPRT_ENST00000373190.1_Missense_Mutation_p.E1435D|PTPRT_ENST00000373198.4_Missense_Mutation_p.E1455D|PTPRT_ENST00000373201.1_Missense_Mutation_p.E1426D|PTPRT_ENST00000373184.1_Missense_Mutation_p.E1446D|PTPRT_ENST00000356100.2_Missense_Mutation_p.E1445D|PTPRT_ENST00000373193.3_Missense_Mutation_p.E1439D			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1436	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGCTTAAATATTCCAGTGCCA	0.507																																					p.E1455D		Atlas-SNP	.											PTPRT,upper_back,malignant_melanoma,-2,1	PTPRT	372	1	0			c.A4365T						PASS	.						56.0	60.0	59.0					20																	40709537		2084	4243	6327	SO:0001583	missense	11122	exon32			TAAATATTCCAGT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.4308A>T	20.37:g.40709537T>A	ENSP00000362283:p.Glu1436Asp	39.0	0.0	0		31.0	7.0	0.225806	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.740476	0.89573	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	6.08	6.08	0.98989	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.92047	0.7480	M	0.83012	2.62	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.87578	0.997;0.998	D	0.92777	0.6237	10	0.87932	D	0	.	10.9027	0.47062	0.0:0.0695:0.0:0.9305	.	1458;1436	O14522-1;O14522	.;PTPRT_HUMAN	D	1435;1436;1439;1445;1458;1446;1426	ENSP00000362286:E1435D;ENSP00000362283:E1436D;ENSP00000362289:E1439D;ENSP00000348408:E1445D;ENSP00000362294:E1458D;ENSP00000362280:E1446D;ENSP00000362297:E1426D	ENSP00000348408:E1445D	E	-	3	2	PTPRT	40142951	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.782000	0.47758	2.333000	0.79357	0.533000	0.62120	GAA	.	.	none		0.507	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
KIRREL3	84623	hgsc.bcm.edu	37	11	126299148	126299148	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:126299148G>A	ENST00000525144.2	-	15	1981	c.1732C>T	c.(1732-1734)Cga>Tga	p.R578*	KIRREL3_ENST00000529097.2_Nonsense_Mutation_p.R566*|KIRREL3_ENST00000416561.2_Nonsense_Mutation_p.R45*	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	578					hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		ATTTCCACTCGGATATCATTT	0.458																																					p.R578X		Atlas-SNP	.											.	KIRREL3	183	.	0			c.C1732T						PASS	.						96.0	99.0	98.0					11																	126299148		1942	4138	6080	SO:0001587	stop_gained	84623	exon15			CCACTCGGATATC	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1732C>T	11.37:g.126299148G>A	ENSP00000435466:p.Arg578*	158.0	0.0	0		108.0	36.0	0.333333	NM_032531	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Nonsense_Mutation	SNP	ENST00000525144.2	37	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	G	37	6.421659	0.97555	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000416561	.	.	.	5.66	4.71	0.59529	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7594	15.9821	0.80116	0.0:0.0:0.8647:0.1353	.	.	.	.	X	578;566;45	.	ENSP00000408692:R45X	R	-	1	2	KIRREL3	125804358	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.330000	0.65899	2.668000	0.90789	0.561000	0.74099	CGA	.	.	none		0.458	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531	
MAP2K3	5606	hgsc.bcm.edu	37	17	21206529	21206529	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:21206529T>C	ENST00000342679.4	+	7	800	c.551T>C	c.(550-552)cTg>cCg	p.L184P	MAP2K3_ENST00000316920.6_Missense_Mutation_p.L155P|MAP2K3_ENST00000361818.5_Missense_Mutation_p.L155P	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	184	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CACAGCAAGCTGTCGGTGATC	0.632																																					p.L184P		Atlas-SNP	.											.	MAP2K3	135	.	0			c.T551C						PASS	.						50.0	42.0	45.0					17																	21206529		2203	4300	6503	SO:0001583	missense	5606	exon7			GCAAGCTGTCGGT	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.551T>C	17.37:g.21206529T>C	ENSP00000345083:p.Leu184Pro	89.0	0.0	0		98.0	12.0	0.122449	NM_145109	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.501712	0.44455	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.40756	1.02;1.02	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000069	T	0.63534	0.2519	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67325	-0.5699	10	0.87932	D	0	-29.8457	15.5058	0.75739	0.0:0.0:0.0:1.0	.	184	P46734	MP2K3_HUMAN	P	184;155;155;188	ENSP00000345083:L184P;ENSP00000355081:L155P	ENSP00000319139:L188P	L	+	2	0	MAP2K3	21147122	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.679000	0.84048	2.077000	0.62373	0.459000	0.35465	CTG	.	.	none		0.632	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	
VCAN	1462	hgsc.bcm.edu	37	5	82833506	82833506	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr5:82833506T>G	ENST00000265077.3	+	8	5249	c.4684T>G	c.(4684-4686)Ttt>Gtt	p.F1562V	VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000343200.5_Missense_Mutation_p.F575V|VCAN_ENST00000502527.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1562	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAAAATAGCCTTTGCAAGGGC	0.413																																					p.F1562V		Atlas-SNP	.											.	VCAN	498	.	0			c.T4684G						PASS	.						72.0	74.0	73.0					5																	82833506		2203	4300	6503	SO:0001583	missense	1462	exon8			ATAGCCTTTGCAA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.4684T>G	5.37:g.82833506T>G	ENSP00000265077:p.Phe1562Val	51.0	0.0	0		73.0	16.0	0.219178	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	5.696	0.312954	0.10789	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.86769	-2.17;-2.17;2.95	5.78	1.85	0.25348	.	0.656922	0.14873	N	0.293408	T	0.81503	0.4836	M	0.61703	1.905	0.09310	N	0.999999	B;B	0.23806	0.091;0.055	B;B	0.19946	0.027;0.012	T	0.64334	-0.6432	10	0.18276	T	0.48	.	6.8329	0.23921	0.2407:0.0:0.2497:0.5096	.	575;1562	P13611-2;P13611	.;CSPG2_HUMAN	V	1562;575;575	ENSP00000265077:F1562V;ENSP00000340062:F575V;ENSP00000426251:F575V	ENSP00000265077:F1562V	F	+	1	0	VCAN	82869262	0.055000	0.20627	0.001000	0.08648	0.056000	0.15407	1.323000	0.33701	0.436000	0.26393	0.533000	0.62120	TTT	.	.	none		0.413	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
GRK6	2870	hgsc.bcm.edu	37	5	176863212	176863212	+	Missense_Mutation	SNP	G	G	A	rs200870863		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr5:176863212G>A	ENST00000355472.5	+	12	1364	c.1196G>A	c.(1195-1197)cGg>cAg	p.R399Q	PRR7-AS1_ENST00000425316.3_RNA|GRK6_ENST00000507633.1_Missense_Mutation_p.R399Q|GRK6_ENST00000355958.5_Missense_Mutation_p.R399Q|GRK6_ENST00000528793.1_Missense_Mutation_p.R399Q|GRK6_ENST00000393576.3_Missense_Mutation_p.R365Q	NM_001004106.2|NM_002082.3	NP_001004106.1|NP_002073.2	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6	399	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)	p.R399Q(2)		breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(5)|stomach(1)	25	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGGTGGAGCGGCTGGTGAAG	0.637																																					p.R399Q		Atlas-SNP	.											GRK6,NS,carcinoma,0,1	GRK6	48	1	2	Substitution - Missense(2)	prostate(2)	c.G1196A						scavenged	.						64.0	78.0	73.0					5																	176863212		2203	4300	6503	SO:0001583	missense	2870	exon12			TGGAGCGGCTGGT		CCDS34303.1, CCDS43406.1, CCDS47348.1	5q35	2011-01-14	2004-02-04	2004-02-06	ENSG00000198055	ENSG00000198055			4545	protein-coding gene	gene with protein product		600869		GPRK6		8415712	Standard	NM_002082		Approved		uc021yiu.1	P43250	OTTHUMG00000163401	ENST00000355472.5:c.1196G>A	5.37:g.176863212G>A	ENSP00000347655:p.Arg399Gln	132.0	1.0	0.00757576		122.0	6.0	0.0491803	NM_002082	O60541|Q13652	Missense_Mutation	SNP	ENST00000355472.5	37	CCDS34303.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481147	0.63849	.	.	ENSG00000198055	ENST00000355472;ENST00000507633;ENST00000393576;ENST00000355958;ENST00000528793	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.061068	0.64402	D	0.000007	T	0.41143	0.1146	N	0.11106	0.095	0.80722	D	1	P;P;B;B	0.39535	0.598;0.677;0.139;0.28	B;B;B;B	0.26094	0.026;0.066;0.016;0.007	T	0.38134	-0.9675	10	0.25751	T	0.34	-30.4439	20.2768	0.98488	0.0:0.0:1.0:0.0	.	399;369;399;399	P43250;B3KPS5;P43250-2;D6RHX8	GRK6_HUMAN;.;.;.	Q	399;399;365;399;399	ENSP00000347655:R399Q;ENSP00000427581:R399Q;ENSP00000377204:R365Q;ENSP00000348230:R399Q;ENSP00000433511:R399Q	ENSP00000347655:R399Q	R	+	2	0	GRK6	176795818	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.675000	0.74493	2.808000	0.96608	0.650000	0.86243	CGG	.	.	weak		0.637	GRK6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373204.1	NM_002082	
ABCE1	6059	hgsc.bcm.edu	37	4	146033391	146033391	+	Splice_Site	SNP	T	T	C			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr4:146033391T>C	ENST00000296577.4	+	9	1226	c.711T>C	c.(709-711)atT>atC	p.I237I	OTUD4_ENST00000455611.2_Intron|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	237	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					TTTTTCATAGTTTCATGTTTG	0.313																																					p.I237I		Atlas-SNP	.											.	ABCE1	47	.	0			c.T711C						PASS	.						30.0	29.0	29.0					4																	146033391		2202	4297	6499	SO:0001630	splice_region_variant	6059	exon9			TCATAGTTTCATG	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.711-1T>C	4.37:g.146033391T>C		96.0	0.0	0		101.0	12.0	0.118812	NM_002940	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Silent	SNP	ENST00000296577.4	37	CCDS34071.1																																																																																			.	.	none		0.313	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	Silent
TNXB	7148	hgsc.bcm.edu	37	6	32020562	32020562	+	Silent	SNP	G	G	A	rs375459891		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr6:32020562G>A	ENST00000375244.3	-	26	9201	c.9000C>T	c.(8998-9000)ggC>ggT	p.G3000G	TNXB_ENST00000375247.2_Silent_p.G2998G			P22105	TENX_HUMAN	tenascin XB	3045	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CGCTCTCCTCGCCCCTGACAC	0.687													g|||	1	0.000199681	0.0	0.0	5008	,	,		14923	0.001		0.0	False		,,,				2504	0.0				p.G2998G		Atlas-SNP	.											.	TNXB	553	.	0			c.C8994T						PASS	.						40.0	44.0	43.0					6																	32020562		1251	2548	3799	SO:0001819	synonymous_variant	7148	exon26			CTCCTCGCCCCTG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9000C>T	6.37:g.32020562G>A		58.0	0.0	0		41.0	5.0	0.121951	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	37																																																																																				.	.	weak		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
ZBBX	79740	hgsc.bcm.edu	37	3	167023655	167023655	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:167023655A>G	ENST00000392766.2	-	17	1841	c.1501T>C	c.(1501-1503)Tcc>Ccc	p.S501P	ZBBX_ENST00000455345.2_Missense_Mutation_p.S501P|ZBBX_ENST00000392764.1_Missense_Mutation_p.S472P|ZBBX_ENST00000307529.5_Missense_Mutation_p.S501P|ZBBX_ENST00000392767.2_Missense_Mutation_p.S501P	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	501						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTTTCAAAGGAGGTGCTTTCC	0.348																																					p.S501P		Atlas-SNP	.											.	ZBBX	299	.	0			c.T1501C						PASS	.						54.0	48.0	49.0					3																	167023655		1798	4072	5870	SO:0001583	missense	79740	exon17			CAAAGGAGGTGCT	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1501T>C	3.37:g.167023655A>G	ENSP00000376519:p.Ser501Pro	54.0	0.0	0		42.0	9.0	0.214286	NM_024687	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	A	10.90	1.480260	0.26598	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.10573	3.03;3.03;3.03;3.03;2.86	5.54	-3.07	0.05363	.	1.376370	0.04080	N	0.309527	T	0.05868	0.0153	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.36040	-0.9764	10	0.33141	T	0.24	0.0641	0.6	0.00743	0.3168:0.135:0.1556:0.3926	.	501;501	A8MT70-2;A8MT70	.;ZBBX_HUMAN	P	501;501;501;501;472	ENSP00000376519:S501P;ENSP00000376520:S501P;ENSP00000390232:S501P;ENSP00000305065:S501P;ENSP00000376517:S472P	ENSP00000305065:S501P	S	-	1	0	ZBBX	168506349	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.094000	0.15107	-0.425000	0.07371	-1.159000	0.01794	TCC	.	.	none		0.348	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
FCN2	2220	hgsc.bcm.edu	37	9	137779176	137779176	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr9:137779176G>A	ENST00000291744.6	+	8	867	c.857G>A	c.(856-858)aGc>aAc	p.S286N	FCN2_ENST00000350339.2_Missense_Mutation_p.S248N	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	286	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		ACTCATGGCAGCTTTGCAAAT	0.512																																					p.S286N		Atlas-SNP	.											.	FCN2	55	.	0			c.G857A						PASS	.						85.0	83.0	83.0					9																	137779176		2203	4300	6503	SO:0001583	missense	2220	exon8			ATGGCAGCTTTGC	D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.857G>A	9.37:g.137779176G>A	ENSP00000291744:p.Ser286Asn	149.0	0.0	0		164.0	19.0	0.115854	NM_004108	A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Missense_Mutation	SNP	ENST00000291744.6	37	CCDS6983.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052816	0.55218	.	.	ENSG00000160339	ENST00000350339;ENST00000291744	T;T	0.21361	2.01;2.01	4.05	4.05	0.47172	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.000000	0.50627	D	0.000110	T	0.26304	0.0642	M	0.66297	2.02	0.22796	N	0.998726	B;B	0.29835	0.258;0.144	B;B	0.32724	0.064;0.151	T	0.19976	-1.0289	10	0.52906	T	0.07	.	13.7007	0.62606	0.0:0.0:1.0:0.0	.	248;286	Q15485-2;Q15485	.;FCN2_HUMAN	N	248;286	ENSP00000291741:S248N;ENSP00000291744:S286N	ENSP00000291744:S286N	S	+	2	0	FCN2	136918997	0.171000	0.23029	0.279000	0.24732	0.456000	0.32438	0.609000	0.24238	1.791000	0.52520	0.563000	0.77884	AGC	.	.	none		0.512	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054960.1	NM_004108	
PPFIA1	8500	hgsc.bcm.edu	37	11	70171055	70171055	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr11:70171055G>A	ENST00000253925.7	+	4	684	c.469G>A	c.(469-471)Gaa>Aaa	p.E157K	AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.E157K|CTA-797E19.2_ENST00000526017.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	157					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CGTGTCCAGCGAAGTGGAAGT	0.507																																					p.E157K		Atlas-SNP	.											.	PPFIA1	114	.	0			c.G469A						PASS	.						95.0	96.0	96.0					11																	70171055		2200	4294	6494	SO:0001583	missense	8500	exon4			TCCAGCGAAGTGG	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.469G>A	11.37:g.70171055G>A	ENSP00000253925:p.Glu157Lys	93.0	0.0	0		95.0	22.0	0.231579	NM_177423	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.	.	.	.	.	.	.	.	.	.	G	36	5.665691	0.96745	.	.	ENSG00000131626	ENST00000253925;ENST00000389547;ENST00000530746	T;T;T	0.46451	0.87;0.87;0.87	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.56702	0.2003	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.59804	-0.7385	10	0.87932	D	0	.	19.2525	0.93930	0.0:0.0:1.0:0.0	.	157;157	Q13136;Q13136-2	LIPA1_HUMAN;.	K	157	ENSP00000253925:E157K;ENSP00000374198:E157K;ENSP00000432722:E157K	ENSP00000253925:E157K	E	+	1	0	PPFIA1	69848703	1.000000	0.71417	0.791000	0.31998	0.687000	0.40016	9.522000	0.98032	2.617000	0.88574	0.650000	0.86243	GAA	.	.	none		0.507	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393905.1	NM_003626	
MAZ	4150	hgsc.bcm.edu	37	16	29821438	29821438	+	Silent	SNP	G	G	A	rs199924629|rs374878500		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr16:29821438G>A	ENST00000322945.6	+	5	1485	c.1320G>A	c.(1318-1320)gcG>gcA	p.A440A	PRRT2_ENST00000300797.6_5'Flank|PRRT2_ENST00000358758.7_5'Flank|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000562337.1_Silent_p.A135A|AC009133.15_ENST00000566537.1_RNA|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000568544.1_Silent_p.A41A|MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000563402.1_Missense_Mutation_p.G97S|MAZ_ENST00000219782.6_3'UTR|MAZ_ENST00000545521.1_Silent_p.A417A|PRRT2_ENST00000567659.1_5'Flank|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000566906.2_Splice_Site_p.G95S	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	440	Poly-Ala.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						cagcggcagcggcggcagcgg	0.662																																					p.A440A	Colon(72;875 1167 15364 30899 37091)	Atlas-SNP	.											MAZ_ENST00000322945,caecum,carcinoma,0,2	MAZ	48	2	0			c.G1320A						scavenged	.	A	,	29,4087		0,29,2029	16.0	21.0	19.0		,1320	-7.8	0.0	16		19	32,8282		0,32,4125	no	utr-3,coding-synonymous	MAZ	NM_001042539.1,NM_002383.2	,	0,61,6154	AA,AG,GG		0.3849,0.7046,0.4907	,	,440/478	29821438	61,12369	2058	4157	6215	SO:0001819	synonymous_variant	4150	exon5			GGCAGCGGCGGCA	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1320G>A	16.37:g.29821438G>A		63.0	1.0	0.015873		69.0	3.0	0.0434783	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Silent	SNP	ENST00000322945.6	37	CCDS42143.1																																																																																			G|0.993;A|0.007	0.007	strong		0.662	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
ARHGAP29	9411	hgsc.bcm.edu	37	1	94670633	94670633	+	Missense_Mutation	SNP	T	T	G	rs201001778		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr1:94670633T>G	ENST00000260526.6	-	7	863	c.681A>C	c.(679-681)gaA>gaC	p.E227D	ARHGAP29_ENST00000370217.3_Missense_Mutation_p.E227D	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	227					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TAAGCTTTTTTTCAACCCATG	0.318																																					p.E227D		Atlas-SNP	.											.	ARHGAP29	132	.	0			c.A681C						PASS	.						83.0	84.0	83.0					1																	94670633		2202	4298	6500	SO:0001583	missense	9411	exon7			CTTTTTTTCAACC		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.681A>C	1.37:g.94670633T>G	ENSP00000260526:p.Glu227Asp	133.0	0.0	0		140.0	18.0	0.128571	NM_004815	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	ENST00000260526.6	37	CCDS748.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766355	0.69878	.	.	ENSG00000137962	ENST00000260526;ENST00000370217	T;T	0.46451	0.87;0.87	5.87	2.48	0.30137	.	0.000000	0.37053	N	0.002263	T	0.25531	0.0621	L	0.53671	1.685	0.45066	D	0.998081	P;P	0.46784	0.884;0.849	P;B	0.45610	0.487;0.318	T	0.02975	-1.1087	10	0.45353	T	0.12	-29.8012	8.1775	0.31292	0.0:0.3743:0.0:0.6257	.	227;227	Q52LW3-2;Q52LW3	.;RHG29_HUMAN	D	227	ENSP00000260526:E227D;ENSP00000359237:E227D	ENSP00000260526:E227D	E	-	3	2	ARHGAP29	94443221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.684000	0.25364	0.603000	0.29913	0.533000	0.62120	GAA	T|1.000;C|0.000	.	alt		0.318	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029376.2	NM_004815	
ZNF592	9640	hgsc.bcm.edu	37	15	85328068	85328068	+	Missense_Mutation	SNP	G	G	A	rs549731730		TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr15:85328068G>A	ENST00000560079.2	+	4	2450	c.2162G>A	c.(2161-2163)cGg>cAg	p.R721Q	ZNF592_ENST00000299927.3_Missense_Mutation_p.R721Q	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	721					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAGCAGATGCGGGACTACATG	0.582																																					p.R721Q		Atlas-SNP	.											.	ZNF592	95	.	0			c.G2162A						PASS	.						77.0	71.0	73.0					15																	85328068		2203	4299	6502	SO:0001583	missense	9640	exon4			AGATGCGGGACTA	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2162G>A	15.37:g.85328068G>A	ENSP00000452877:p.Arg721Gln	250.0	0.0	0		286.0	54.0	0.188811	NM_014630	Q2M1T2|Q504Y9	Missense_Mutation	SNP	ENST00000560079.2	37	CCDS32317.1	.	.	.	.	.	.	.	.	.	.	G	5.267	0.234764	0.09969	.	.	ENSG00000166716	ENST00000299927	T	0.28454	1.61	6.07	1.72	0.24424	Zinc finger, C2H2-like (1);	0.573110	0.19945	N	0.102543	T	0.19127	0.0459	L	0.45581	1.43	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35475	-0.9787	10	0.02654	T	1	-6.9559	6.7387	0.23422	0.4709:0.0:0.5291:0.0	.	721	Q92610	ZN592_HUMAN	Q	721	ENSP00000299927:R721Q	ENSP00000299927:R721Q	R	+	2	0	ZNF592	83129072	0.011000	0.17503	0.647000	0.29507	0.998000	0.95712	0.820000	0.27323	0.467000	0.27218	0.655000	0.94253	CGG	.	.	none		0.582	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418779.2	NM_014630	
GSDMA	284110	hgsc.bcm.edu	37	17	38122591	38122591	+	Missense_Mutation	SNP	C	C	T	rs140044904	byFrequency	TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr17:38122591C>T	ENST00000301659.4	+	3	411	c.293C>T	c.(292-294)aCg>aTg	p.T98M		NM_178171.4	NP_835465.2	Q96QA5	GSDMA_HUMAN	gasdermin A	98					apoptotic process (GO:0006915)	perinuclear region of cytoplasm (GO:0048471)				NS(1)|endometrium(2)|large_intestine(3)|lung(1)	7						GTACCAAAGACGGTGAAGGTG	0.552													C|||	33	0.00658946	0.0242	0.0014	5008	,	,		18543	0.0		0.0	False		,,,				2504	0.0				p.T98M		Atlas-SNP	.											.	GSDMA	26	.	0			c.C293T						PASS	.	C	MET/THR	42,3964		0,42,1961	107.0	111.0	110.0		293	5.5	1.0	17	dbSNP_134	110	0,8332		0,0,4166	yes	missense	GSDMA	NM_178171.4	81	0,42,6127	TT,TC,CC		0.0,1.0484,0.3404	benign	98/446	38122591	42,12296	2003	4166	6169	SO:0001583	missense	284110	exon3			CAAAGACGGTGAA	AB093591	CCDS45669.1	17q21.2	2008-07-31	2008-07-31	2008-07-31		ENSG00000167914			13311	protein-coding gene	gene with protein product		611218	"""gasdermin"", ""gasdermin 1"""	GSDM, GSDM1		12883658, 15010812, 17350798	Standard	NM_178171		Approved	FLJ39120	uc002htl.1	Q96QA5		ENST00000301659.4:c.293C>T	17.37:g.38122591C>T	ENSP00000301659:p.Thr98Met	298.0	0.0	0		278.0	54.0	0.194245	NM_178171	Q32MC5|Q86VE7|Q8N1M6	Missense_Mutation	SNP	ENST00000301659.4	37	CCDS45669.1	20	0.009157509157509158	19	0.03861788617886179	1	0.0027624309392265192	0	0.0	0	0.0	C	11.66	1.704373	0.30232	0.010484	0.0	ENSG00000167914	ENST00000301659	T	0.23147	1.92	5.5	5.5	0.81552	.	0.442749	0.21282	N	0.077127	T	0.04318	0.0119	L	0.36672	1.1	0.35397	D	0.791245	P	0.39404	0.672	B	0.27887	0.084	T	0.14531	-1.0469	10	0.48119	T	0.1	-0.926	14.8824	0.70542	0.0:1.0:0.0:0.0	.	98	Q96QA5	GSDMA_HUMAN	M	98	ENSP00000301659:T98M	ENSP00000301659:T98M	T	+	2	0	GSDMA	35376117	0.987000	0.35691	0.972000	0.41901	0.744000	0.42396	3.521000	0.53472	2.581000	0.87130	0.563000	0.77884	ACG	C|0.991;T|0.009	0.009	strong		0.552	GSDMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446847.1	NM_178171	
MUC4	4585	hgsc.bcm.edu	37	3	195507985	195507985	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-8693-01A-11D-2397-10	TCGA-FA-8693-10A-01D-2397-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	62ff5bc5-21ea-47e2-bade-812ba5a9d8a2	9800e9ed-3710-40d0-b01e-c5ee272234c7	g.chr3:195507985A>G	ENST00000463781.3	-	2	10925	c.10466T>C	c.(10465-10467)cTt>cCt	p.L3489P	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L3489P|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGTGACATGAAGAGGGGTGGT	0.592																																					p.L3489P		Atlas-SNP	.											.	MUC4	1505	.	0			c.T10466C						PASS	.						28.0	25.0	26.0					3																	195507985		657	1575	2232	SO:0001583	missense	4585	exon2			ACATGAAGAGGGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10466T>C	3.37:g.195507985A>G	ENSP00000417498:p.Leu3489Pro	538.0	0.0	0		536.0	29.0	0.0541045	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	A	2.458	-0.324778	0.05350	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.37058	1.25;1.22	.	.	.	.	.	.	.	.	T	0.34308	0.0893	N	0.19112	0.55	0.09310	N	0.999995	D	0.57571	0.98	D	0.64321	0.924	T	0.16689	-1.0394	7	.	.	.	.	4.5052	0.11883	0.9993:0.0:7.0E-4:0.0	.	3361	E7ESK3	.	P	3489	ENSP00000417498:L3489P;ENSP00000420243:L3489P	.	L	-	2	0	MUC4	196992764	0.000000	0.05858	0.026000	0.17262	0.027000	0.11550	0.158000	0.16422	0.064000	0.16427	0.063000	0.15292	CTT	.	.	none		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
