#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PARP9	83666	hgsc.bcm.edu	37	3	122247338	122247343	+	In_Frame_Del	DEL	GCCTGC	GCCTGC	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	GCCTGC	GCCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:122247338_122247343delGCCTGC	ENST00000360356.2	-	11	2660_2665	c.2433_2438delGCAGGC	c.(2431-2439)atgcaggct>att	p.811_813MQA>I	PARP9_ENST00000492382.1_In_Frame_Del_p.356_358MQA>I|PARP9_ENST00000477522.2_In_Frame_Del_p.776_778MQA>I|PARP9_ENST00000471785.1_In_Frame_Del_p.776_778MQA>I	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	811	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CTGAGGTATAGCCTGCATGCCACTAA	0.466																																					p.812_813del		Atlas-Indel	.											.	PARP9	72	.	0			c.2434_2439del						PASS	.																																			SO:0001651	inframe_deletion	83666	exon11			.	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2433_2438delGCAGGC	3.37:g.122247338_122247343delGCCTGC	ENSP00000353512:p.Met811_Ala813delinsIle	149.0	0.0	0		115.0	26.0	0.226087	NM_001146102	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	In_Frame_Del	DEL	ENST00000360356.2	37	CCDS3014.1																																																																																			.	.	none		0.466	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
PARP9	83666	hgsc.bcm.edu	37	3	122247346	122247346	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:122247346delG	ENST00000360356.2	-	11	2657	c.2430delC	c.(2428-2430)ggcfs	p.G810fs	PARP9_ENST00000492382.1_Frame_Shift_Del_p.G355fs|PARP9_ENST00000477522.2_Frame_Shift_Del_p.G775fs|PARP9_ENST00000471785.1_Frame_Shift_Del_p.G775fs	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	810	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TAGCCTGCATGCCACTAAAAA	0.448																																					p.M811fs		Atlas-Indel	.											.	PARP9	72	.	0			c.2431delA						PASS	.						125.0	111.0	116.0					3																	122247346		2203	4300	6503	SO:0001589	frameshift_variant	83666	exon11			.	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2430delC	3.37:g.122247346delG	ENSP00000353512:p.Gly810fs	144.0	0.0	0		120.0	28.0	0.233333	NM_001146102	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Frame_Shift_Del	DEL	ENST00000360356.2	37	CCDS3014.1																																																																																			.	.	none		0.448	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
DLG5	9231	hgsc.bcm.edu	37	10	79565519	79565520	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:79565519_79565520insA	ENST00000372391.2	-	27	5072_5073	c.5067_5068insT	c.(5065-5070)tttcggfs	p.R1690fs	DLG5_ENST00000372388.2_Frame_Shift_Ins_p.R1350fs|DLG5_ENST00000459739.1_5'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1690					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGTTTCCTCCGAAAAAAGGACC	0.535																																					p.R1690fs		Pindel,Atlas-Indel	.											.	DLG5	154	.	0			c.5068_5069insT						PASS	.																																			SO:0001589	frameshift_variant	9231	exon27			.	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.5068dupT	10.37:g.79565525_79565525dupA	ENSP00000361467:p.Arg1690fs	0.0	0.0	.		17.0	17.0	1.000	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Frame_Shift_Ins	INS	ENST00000372391.2	37	CCDS7353.2																																																																																			.	.	none		0.535	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
ANKRD23	200539	hgsc.bcm.edu	37	2	97507820	97507821	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:97507820_97507821insG	ENST00000318357.4	-	3	317_318	c.276_277insC	c.(274-279)cccaggfs	p.R93fs	ANKRD23_ENST00000331001.2_Frame_Shift_Ins_p.R93fs|ANKRD23_ENST00000476975.1_5'UTR|ANKRD23_ENST00000418232.1_Frame_Shift_Ins_p.R93fs	NM_144994.7	NP_659431.5	Q86SG2	ANR23_HUMAN	ankyrin repeat domain 23	93					fatty acid metabolic process (GO:0006631)|response to mechanical stimulus (GO:0009612)	I band (GO:0031674)|intercalated disc (GO:0014704)|nucleus (GO:0005634)	titin binding (GO:0031432)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)	9						TCAGGTTTCCTGGGGGGGACTC	0.53																																					p.R93fs		Pindel,Atlas-Indel	.											.	ANKRD23	28	.	0			c.277_278insC						PASS	.			3,4263		0,3,2130						4.5	1.0			89	6,8248		0,6,4121	no	frameshift	ANKRD23	NM_144994.7		0,9,6251	A1A1,A1R,RR		0.0727,0.0703,0.0719				9,12511				SO:0001589	frameshift_variant	200539	exon3			.		CCDS2027.1	2q11.2	2013-01-10			ENSG00000163126	ENSG00000163126		"""Ankyrin repeat domain containing"""	24470	protein-coding gene	gene with protein product	"""diabetes related ankyrin repeat protein"""	610736				12456686	Standard	NM_144994		Approved	DARP, FLJ32449, MARP3	uc002sxa.3	Q86SG2	OTTHUMG00000130534	ENST00000318357.4:c.277dupC	2.37:g.97507827_97507827dupG	ENSP00000321679:p.Arg93fs	0.0	0.0	.		20.0	20.0	1.000	NM_144994	Q711K7|Q8NAJ7	Frame_Shift_Ins	INS	ENST00000318357.4	37	CCDS2027.1																																																																																			.	.	none		0.530	ANKRD23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252956.1	NM_144994	
PARP9	83666	hgsc.bcm.edu	37	3	122247336	122247347	+	In_Frame_Del	DEL	TAGCCTGCATGC	TAGCCTGCATGC	-			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	TAGCCTGCATGC	TAGCCTGCATGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:122247336_122247347delTAGCCTGCATGC	ENST00000360356.2	-	11	2656_2667	c.2429_2440delGCATGCAGGCTA	c.(2428-2442)ggcatgcaggctata>gta	p.810_814GMQAI>V	PARP9_ENST00000492382.1_In_Frame_Del_p.355_359GMQAI>V|PARP9_ENST00000477522.2_In_Frame_Del_p.775_779GMQAI>V|PARP9_ENST00000471785.1_In_Frame_Del_p.775_779GMQAI>V	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	810	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		TACTGAGGTATAGCCTGCATGCCACTAAAAAT	0.453																																					p.810_814del		Pindel	.											.	PARP9	72	.	0			c.2430_2441del						PASS	.																																			SO:0001651	inframe_deletion	83666	exon11			.	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.2429_2440delGCATGCAGGCTA	3.37:g.122247336_122247347delTAGCCTGCATGC	ENSP00000353512:p.Gly810_Ile814delinsVal	0.0	0.0	.		26.0	26.0	1.000	NM_001146102	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	In_Frame_Del	DEL	ENST00000360356.2	37	CCDS3014.1																																																																																			.	.	none		0.453	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
B3GALTL	145173	hgsc.bcm.edu	37	13	31891810	31891810	+	Missense_Mutation	SNP	C	C	T	rs144117014		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr13:31891810C>T	ENST00000343307.4	+	13	1321	c.1172C>T	c.(1171-1173)aCg>aTg	p.T391M		NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	391					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		AGCTACATCACGGGAGGAGGA	0.522																																					p.T391M		Atlas-SNP	.											.	B3GALTL	48	.	0			c.C1172T						PASS	.	C	MET/THR	0,4406		0,0,2203	107.0	100.0	102.0		1172	4.9	0.9	13	dbSNP_134	102	2,8598	2.2+/-6.3	0,2,4298	no	missense	B3GALTL	NM_194318.3	81	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	391/499	31891810	2,13004	2203	4300	6503	SO:0001583	missense	145173	exon13			ACATCACGGGAGG	AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.1172C>T	13.37:g.31891810C>T	ENSP00000343002:p.Thr391Met	63.0	0.0	0		39.0	14.0	0.358974	NM_194318	A8K5F8|Q5W0H2|Q6NUI3	Missense_Mutation	SNP	ENST00000343307.4	37	CCDS9341.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700733	0.88924	0.0	2.33E-4	ENSG00000187676	ENST00000343307	T	0.72394	-0.65	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.82250	0.4996	M	0.64630	1.985	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.81430	-0.0936	10	0.39692	T	0.17	-18.4961	18.5122	0.90921	0.0:1.0:0.0:0.0	.	391	Q6Y288	B3GLT_HUMAN	M	391	ENSP00000343002:T391M	ENSP00000343002:T391M	T	+	2	0	B3GALTL	30789810	1.000000	0.71417	0.922000	0.36590	0.873000	0.50193	7.264000	0.78432	2.432000	0.82394	0.650000	0.86243	ACG	C|1.000;T|0.000	0.000	weak		0.522	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044396.3	NM_194318	
SMYD1	150572	hgsc.bcm.edu	37	2	88387391	88387391	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:88387391C>T	ENST00000419482.2	+	3	410	c.325C>T	c.(325-327)Cgc>Tgc	p.R109C	SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000444564.2_Missense_Mutation_p.R109C|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	109	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GCTGGCGGCGCGCATCATGTG	0.607																																					p.R109C		Atlas-SNP	.											.	SMYD1	95	.	0			c.C325T						PASS	.						28.0	25.0	26.0					2																	88387391		2197	4297	6494	SO:0001583	missense	150572	exon3			GCGGCGCGCATCA	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.325C>T	2.37:g.88387391C>T	ENSP00000393453:p.Arg109Cys	148.0	0.0	0		142.0	48.0	0.338028	NM_198274	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737350	0.69304	.	.	ENSG00000115593	ENST00000419482;ENST00000444564	T;T	0.36520	1.25;1.27	4.82	3.88	0.44766	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.58878	0.2153	M	0.77406	2.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64007	-0.6508	10	0.87932	D	0	-22.6609	12.1981	0.54309	0.284:0.716:0.0:0.0	.	109	Q8NB12	SMYD1_HUMAN	C	109	ENSP00000393453:R109C;ENSP00000407888:R109C	ENSP00000393453:R109C	R	+	1	0	SMYD1	88168506	0.988000	0.35896	0.938000	0.37757	0.765000	0.43378	2.757000	0.47557	2.363000	0.80096	0.561000	0.74099	CGC	.	.	none		0.607	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338229.2	XM_097915	
MFSD6	54842	hgsc.bcm.edu	37	2	191300917	191300917	+	Silent	SNP	A	A	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:191300917A>C	ENST00000392328.1	+	3	486	c.162A>C	c.(160-162)atA>atC	p.I54I	MFSD6_ENST00000281416.7_Silent_p.I54I	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	54					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						AGGAGGAAATAGACTGGATAG	0.403																																					p.I54I		Atlas-SNP	.											.	MFSD6	58	.	0			c.A162C						PASS	.						108.0	110.0	109.0					2																	191300917		2203	4300	6503	SO:0001819	synonymous_variant	54842	exon3			GGAAATAGACTGG		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.162A>C	2.37:g.191300917A>C		168.0	0.0	0		188.0	84.0	0.446809	NM_017694	D3KSZ4|Q86TH2|Q9NXM3	Silent	SNP	ENST00000392328.1	37	CCDS2306.1																																																																																			.	.	none		0.403	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
SOCS3	9021	hgsc.bcm.edu	37	17	76354835	76354835	+	Silent	SNP	C	C	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:76354835C>A	ENST00000330871.2	-	2	757	c.342G>T	c.(340-342)gtG>gtT	p.V114V	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	114	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			CGAAGCGGGGCACGGGCTGCG	0.667																																					p.V114V		Atlas-SNP	.											.	SOCS3	16	.	0			c.G342T						PASS	.						29.0	30.0	30.0					17																	76354835		2201	4298	6499	SO:0001819	synonymous_variant	9021	exon2			GCGGGGCACGGGC	AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.342G>T	17.37:g.76354835C>A		79.0	0.0	0		64.0	34.0	0.53125	NM_003955	O14509	Silent	SNP	ENST00000330871.2	37	CCDS11756.1																																																																																			.	.	none		0.667	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437300.1		
ZCWPW2	152098	hgsc.bcm.edu	37	3	28476649	28476649	+	Silent	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:28476649T>G	ENST00000383768.2	+	4	569	c.381T>G	c.(379-381)acT>acG	p.T127T	ZCWPW2_ENST00000421010.1_Silent_p.T127T			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	127	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						AATATGTAACTTATGACCCGG	0.358																																					p.T127T		Atlas-SNP	.											.	ZCWPW2	49	.	0			c.T381G						PASS	.						96.0	97.0	97.0					3																	28476649		2203	4300	6503	SO:0001819	synonymous_variant	152098	exon3			TGTAACTTATGAC	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.381T>G	3.37:g.28476649T>G		364.0	1.0	0.00274725		363.0	129.0	0.355372	NM_001040432		Silent	SNP	ENST00000383768.2	37	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	T	5.612	0.297711	0.10622	.	.	ENSG00000206559	ENST00000428875	.	.	.	6.06	1.1	0.20463	.	.	.	.	.	T	0.50565	0.1623	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33394	-0.9870	4	.	.	.	1.5734	4.335	0.11081	0.1458:0.5228:0.0:0.3314	.	.	.	.	V	111	.	.	L	+	1	2	ZCWPW2	28451653	0.463000	0.25799	0.677000	0.29947	0.479000	0.33129	-0.481000	0.06552	-0.073000	0.12842	-0.859000	0.03014	TTA	.	.	none		0.358	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
DMBT1	1755	hgsc.bcm.edu	37	10	124352028	124352028	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:124352028A>G	ENST00000338354.3	+	20	2523	c.2417A>G	c.(2416-2418)gAg>gGg	p.E806G	DMBT1_ENST00000330163.4_Intron|DMBT1_ENST00000344338.3_Missense_Mutation_p.E796G|DMBT1_ENST00000368909.3_Missense_Mutation_p.E806G|DMBT1_ENST00000368956.2_Intron|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.E796G			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	806	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCAGGACACGAGTCCTACCTG	0.617																																					p.E806G	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	0			c.A2417G						PASS	.						144.0	104.0	117.0					10																	124352028		2018	4109	6127	SO:0001583	missense	1755	exon20			GACACGAGTCCTA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2417A>G	10.37:g.124352028A>G	ENSP00000342210:p.Glu806Gly	25.0	0.0	0		15.0	14.0	0.933333	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	A	10.04	1.242226	0.22796	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000344338;ENST00000368909;ENST00000368955	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	3.75	2.6	0.31112	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	D	0.84365	0.5456	H	0.97852	4.09	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.996;0.998	D	0.84836	0.0805	9	0.87932	D	0	.	8.8898	0.35425	0.9078:0.0:0.0922:0.0	.	567;806;796;806	Q9UGM3-4;Q9UGM3-6;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	G	806;806;806;806;806;806;796;806;796	ENSP00000342210:E806G;ENSP00000343175:E796G;ENSP00000357905:E806G;ENSP00000357951:E796G	ENSP00000342210:E806G	E	+	2	0	DMBT1	124342018	1.000000	0.71417	0.022000	0.16811	0.047000	0.14425	6.948000	0.75965	0.438000	0.26450	0.460000	0.39030	GAG	.	.	none		0.617	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
DSCAM	1826	hgsc.bcm.edu	37	21	41414420	41414420	+	Missense_Mutation	SNP	G	G	A	rs200410460		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr21:41414420G>A	ENST00000400454.1	-	32	6041	c.5564C>T	c.(5563-5565)aCg>aTg	p.T1855M		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1855					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CAGACTGTCCGTGTACTCATT	0.527																																					p.T1855M	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.C5564T						PASS	.	G	MET/THR	1,4227		0,1,2113	185.0	179.0	181.0		5564	5.3	1.0	21		181	1,8449		0,1,4224	yes	missense	DSCAM	NM_001389.3	81	0,2,6337	AA,AG,GG		0.0118,0.0237,0.0158	probably-damaging	1855/2013	41414420	2,12676	2114	4225	6339	SO:0001583	missense	1826	exon32			CTGTCCGTGTACT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5564C>T	21.37:g.41414420G>A	ENSP00000383303:p.Thr1855Met	67.0	0.0	0		81.0	31.0	0.382716	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	g	18.87	3.716437	0.68844	2.37E-4	1.18E-4	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60424	0.19;0.29	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.64789	0.2630	L	0.27053	0.805	0.36068	D	0.841933	D	0.89917	1.0	D	0.83275	0.996	T	0.73458	-0.3976	10	0.72032	D	0.01	.	14.4825	0.67592	0.0:0.1467:0.8533:0.0	.	1855	O60469	DSCAM_HUMAN	M	1855;1607	ENSP00000383303:T1855M;ENSP00000385342:T1607M	ENSP00000383303:T1855M	T	-	2	0	DSCAM	40336290	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.419000	0.73345	2.458000	0.83093	0.655000	0.94253	ACG	.	.	weak		0.527	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
ZNF782	158431	hgsc.bcm.edu	37	9	99581542	99581542	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:99581542T>C	ENST00000481138.1	-	6	1424	c.763A>G	c.(763-765)Aaa>Gaa	p.K255E	ZNF782_ENST00000466833.1_5'Flank|ZNF782_ENST00000535338.1_Missense_Mutation_p.K123E	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	255					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				AAGGTTGATTTATCATATTTG	0.328																																					p.K255E		Atlas-SNP	.											.	ZNF782	64	.	0			c.A763G						PASS	.						81.0	86.0	84.0					9																	99581542		2202	4299	6501	SO:0001583	missense	158431	exon6			TTGATTTATCATA	AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.763A>G	9.37:g.99581542T>C	ENSP00000419397:p.Lys255Glu	67.0	0.0	0		79.0	22.0	0.278481	NM_001001662	B2RNR0	Missense_Mutation	SNP	ENST00000481138.1	37	CCDS35075.1	.	.	.	.	.	.	.	.	.	.	T	11.88	1.770680	0.31320	.	.	ENSG00000196597	ENST00000481138;ENST00000535338	T;T	0.07021	3.44;3.23	3.53	2.39	0.29439	.	0.000000	0.35708	N	0.003027	T	0.05914	0.0154	L	0.48362	1.52	0.09310	N	1	B	0.32203	0.36	B	0.24269	0.052	T	0.31752	-0.9932	10	0.41790	T	0.15	.	3.0506	0.06168	0.2109:0.1157:0.0:0.6734	.	255	Q6ZMW2	ZN782_HUMAN	E	255;123	ENSP00000419397:K255E;ENSP00000440624:K123E	ENSP00000419397:K255E	K	-	1	0	ZNF782	98621363	0.009000	0.17119	0.003000	0.11579	0.035000	0.12851	0.984000	0.29565	0.730000	0.32425	0.529000	0.55759	AAA	.	.	none		0.328	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356810.1	NM_001001662	
MUC16	94025	hgsc.bcm.edu	37	19	9047271	9047271	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:9047271G>A	ENST00000397910.4	-	5	34563	c.34360C>T	c.(34360-34362)Cct>Tct	p.P11454S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11456	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGCACCAGGGGAGACAGGG	0.493																																					p.P11454S		Atlas-SNP	.											.	MUC16	4315	.	0			c.C34360T						PASS	.						173.0	169.0	170.0					19																	9047271		2012	4170	6182	SO:0001583	missense	94025	exon5			CACCAGGGGAGAC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34360C>T	19.37:g.9047271G>A	ENSP00000381008:p.Pro11454Ser	76.0	0.0	0		81.0	31.0	0.382716	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.483	0.274203	0.10403	.	.	ENSG00000181143	ENST00000397910	T	0.01947	4.54	3.21	-3.54	0.04653	.	.	.	.	.	T	0.02455	0.0075	L	0.55481	1.735	.	.	.	B	0.27166	0.17	B	0.28709	0.093	T	0.43475	-0.9389	8	0.87932	D	0	.	2.7963	0.05402	0.3391:0.0:0.2952:0.3658	.	11454	B5ME49	.	S	11454	ENSP00000381008:P11454S	ENSP00000381008:P11454S	P	-	1	0	MUC16	8908271	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.871000	0.00720	-0.590000	0.05866	-1.173000	0.01734	CCT	.	.	none		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
VPS13D	55187	hgsc.bcm.edu	37	1	12387807	12387807	+	Missense_Mutation	SNP	C	C	T	rs143572864		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:12387807C>T	ENST00000358136.3	+	36	8223	c.8093C>T	c.(8092-8094)gCg>gTg	p.A2698V	VPS13D_ENST00000356315.4_Missense_Mutation_p.A2698V	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCTGTGGCAGCGCCATTGATC	0.502																																					p.A2698V		Atlas-SNP	.											VPS13D,NS,carcinoma,+1,1	VPS13D	316	1	0			c.C8093T						PASS	.	C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	155.0	149.0	151.0		8093,8093	5.5	0.1	1	dbSNP_134	151	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	VPS13D	NM_015378.2,NM_018156.2	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	2698/4389,2698/4364	12387807	1,13005	2203	4300	6503	SO:0001583	missense	55187	exon36			TGGCAGCGCCATT	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8093C>T	1.37:g.12387807C>T	ENSP00000350854:p.Ala2698Val	127.0	0.0	0		120.0	51.0	0.425	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.04|13.04	2.119674|2.119674	0.37436|0.37436	0.0|0.0	1.16E-4|1.16E-4	ENSG00000048707|ENSG00000048707	ENST00000356315;ENST00000358136|ENST00000011700	T;T|.	0.46451|.	0.87;0.87|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	0.368669|.	0.31290|.	N|.	0.007902|.	T|T	0.40423|0.40423	0.1116|0.1116	L|L	0.44542|0.44542	1.39|1.39	0.29599|0.29599	N|N	0.847863|0.847863	B;B;B|.	0.33857|.	0.041;0.429;0.303|.	B;B;B|.	0.27380|.	0.003;0.079;0.054|.	T|T	0.36744|0.36744	-0.9735|-0.9735	10|5	0.24483|.	T|.	0.36|.	.|.	7.5184|7.5184	0.27614|0.27614	0.0:0.8005:0.0:0.1995|0.0:0.8005:0.0:0.1995	.|.	605;2698;2698|.	B1AJZ2;Q5THJ4-2;Q5THJ4|.	.;.;VP13D_HUMAN|.	V|C	2698|1521	ENSP00000348666:A2698V;ENSP00000350854:A2698V|.	ENSP00000348666:A2698V|.	A|R	+|+	2|1	0|0	VPS13D|VPS13D	12310394|12310394	0.143000|0.143000	0.22626|0.22626	0.058000|0.058000	0.19502|0.19502	0.510000|0.510000	0.34073|0.34073	3.538000|3.538000	0.53597|0.53597	2.750000|2.750000	0.94351|0.94351	0.655000|0.655000	0.94253|0.94253	GCG|CGC	C|1.000;T|0.000	0.000	weak		0.502	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
PSG3	5671	hgsc.bcm.edu	37	19	43234049	43234049	+	Missense_Mutation	SNP	A	A	T	rs28698193	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:43234049A>T	ENST00000327495.5	-	4	1053	c.869T>A	c.(868-870)aTt>aAt	p.I290N	PSG3_ENST00000595140.1_Missense_Mutation_p.I290N	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	290	Ig-like C2-type 2.		I -> N (in dbSNP:rs28698193).		defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				CCTGTTTTCAATGGGTCGCTT	0.488													.|||	690	0.13778	0.3116	0.1225	5008	,	,		21813	0.0248		0.0706	False		,,,				2504	0.0992				p.I290N		Atlas-SNP	.											.	PSG3	82	.	0			c.T869A						PASS	.	T	ASN/ILE	845,2175		128,589,793	84.0	85.0	85.0		869	-2.2	0.0	19	dbSNP_125	85	372,5032		10,352,2340	no	missense	PSG3	NM_021016.3	149	138,941,3133	TT,TA,AA		6.8838,27.9801,14.4468	possibly-damaging	290/429	43234049	1217,7207	1510	2702	4212	SO:0001583	missense	5671	exon4			TTTTCAATGGGTC		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.869T>A	19.37:g.43234049A>T	ENSP00000332215:p.Ile290Asn	54.0	0.0	0		53.0	5.0	0.0943396	NM_021016	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	ENST00000327495.5	37	CCDS12611.1	273	0.125	154	0.3130081300813008	52	0.143646408839779	8	0.013986013986013986	59	0.07783641160949868	t	0.001	-3.244528	0.00022	0.279801	0.068838	ENSG00000221826	ENST00000327495	T	0.09255	3.0	1.1	-2.21	0.06973	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	N	0.00077	-2.24	0.80722	P	0.0	B;B	0.14012	0.009;0.001	B;B	0.17979	0.02;0.004	T	0.31752	-0.9932	8	0.12103	T	0.63	.	0.3073	0.00282	0.2656:0.215:0.3044:0.2151	rs28698193;rs60112374	268;290	Q08266;Q16557	.;PSG3_HUMAN	N	290	ENSP00000332215:I290N	ENSP00000332215:I290N	I	-	2	0	PSG3	47925889	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.576000	0.00112	-4.294000	0.00058	-4.092000	0.00011	ATT	A|0.879;T|0.121	0.121	strong		0.488	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321423.2	NM_021016	
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31132339	31132339	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:31132339A>G	ENST00000304166.4	+	13	1325	c.1036A>G	c.(1036-1038)Agc>Ggc	p.S346G	ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.S346G|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.S346G|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.S325G	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	346					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CAATGAGTCCAGCATCTACTT	0.488																																					p.S346G	Ovarian(44;225 1186 2158 11092)	Atlas-SNP	.											.	ADCYAP1R1	78	.	0			c.A1036G						PASS	.						96.0	90.0	92.0					7																	31132339		2203	4300	6503	SO:0001583	missense	117	exon13			GAGTCCAGCATCT		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1036A>G	7.37:g.31132339A>G	ENSP00000306620:p.Ser346Gly	49.0	0.0	0		41.0	27.0	0.658537	NM_001118	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.07|18.07	3.541658|3.541658	0.65085|0.65085	.|.	.|.	ENSG00000078549|ENSG00000078549	ENST00000436116|ENST00000304166;ENST00000381667;ENST00000409363;ENST00000396211;ENST00000409489	.|T;T;T;T	.|0.46063	.|1.15;1.17;0.88;1.09	5.72|5.72	5.72|5.72	0.89469|0.89469	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57242|0.57242	0.2040|0.2040	L|L	0.52266|0.52266	1.64|1.64	0.80722|0.80722	D|D	1|1	.|P;B;D;B;B	.|0.71674	.|0.952;0.118;0.998;0.02;0.056	.|P;B;D;B;B	.|0.71184	.|0.792;0.082;0.972;0.033;0.056	T|T	0.54944|0.54944	-0.8217|-0.8217	5|10	.|0.41790	.|T	.|0.15	.|.	14.2607|14.2607	0.66083|0.66083	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|346;346;346;325;346	.|B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.|.;.;.;.;PACR_HUMAN	R|G	62|346;117;325;346;346	.|ENSP00000306620:S346G;ENSP00000387335:S325G;ENSP00000379514:S346G;ENSP00000386395:S346G	.|ENSP00000306620:S346G	Q|S	+|+	2|1	0|0	ADCYAP1R1|ADCYAP1R1	31098864|31098864	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.748000|8.748000	0.91615|0.91615	2.317000|2.317000	0.78254|0.78254	0.460000|0.460000	0.39030|0.39030	CAG|AGC	.	.	none		0.488	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
ABCC6	368	hgsc.bcm.edu	37	16	16248757	16248757	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:16248757C>T	ENST00000205557.7	-	28	4043	c.4014G>A	c.(4012-4014)ctG>ctA	p.L1338L		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1338	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TCCTGGAGCGCAGTGTGTGCA	0.687																																					p.L1338L		Atlas-SNP	.											.	ABCC6	110	.	0			c.G4014A						PASS	.						29.0	27.0	28.0					16																	16248757		2197	4299	6496	SO:0001819	synonymous_variant	368	exon28			GGAGCGCAGTGTG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4014G>A	16.37:g.16248757C>T		98.0	0.0	0		93.0	33.0	0.354839	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	ENST00000205557.7	37	CCDS10568.1																																																																																			.	.	none		0.687	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
DPM1	8813	hgsc.bcm.edu	37	20	49575721	49575721	+	5'Flank	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:49575721T>C	ENST00000371588.5	-	0	0				MOCS3_ENST00000244051.1_Silent_p.Y114Y|DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000466152.1_5'Flank|DPM1_ENST00000371582.4_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						TTGTGGACTATGACGTGGTAG	0.692																																					p.Y114Y		Atlas-SNP	.											.	MOCS3	44	.	0			c.T342C						PASS	.						46.0	57.0	53.0					20																	49575721		2192	4282	6474	SO:0001631	upstream_gene_variant	27304	exon1			GGACTATGACGTG	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575721T>C	Exception_encountered	59.0	0.0	0		52.0	17.0	0.326923	NM_014484	O15157|Q6IB78|Q96HK0	Silent	SNP	ENST00000371588.5	37	CCDS13434.1																																																																																			.	.	none		0.692	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
CYP26C1	340665	hgsc.bcm.edu	37	10	94824263	94824263	+	Silent	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:94824263G>T	ENST00000285949.5	+	4	831	c.831G>T	c.(829-831)ctG>ctT	p.L277L		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	277					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				CAAGGGAGCTGGGCCATGAGC	0.587																																					p.L277L		Atlas-SNP	.											.	CYP26C1	25	.	0			c.G831T						PASS	.						96.0	90.0	92.0					10																	94824263		2203	4300	6503	SO:0001819	synonymous_variant	340665	exon4			GGAGCTGGGCCAT		CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	ENST00000285949.5:c.831G>T	10.37:g.94824263G>T		129.0	0.0	0		97.0	5.0	0.0515464	NM_183374	Q5VXH6	Silent	SNP	ENST00000285949.5	37	CCDS7425.1																																																																																			.	.	none		0.587	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374	
ME3	10873	hgsc.bcm.edu	37	11	86198437	86198437	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:86198437C>T	ENST00000393324.3	-	6	1004	c.751G>A	c.(751-753)Gtg>Atg	p.V251M	ME3_ENST00000543262.1_Missense_Mutation_p.V251M|ME3_ENST00000359636.2_Missense_Mutation_p.V251M|ME3_ENST00000323418.6_Missense_Mutation_p.V189M|RP11-317J19.1_ENST00000524610.1_RNA|ME3_ENST00000525957.1_5'UTR	NM_001014811.1	NP_001014811.1	Q16798	MAON_HUMAN	malic enzyme 3, NADP(+)-dependent, mitochondrial	251					aerobic respiration (GO:0009060)|malate metabolic process (GO:0006108)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|pyruvate metabolic process (GO:0006090)	mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|skin(3)|stomach(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)				TTCCCGTGCACGCGCTGGTGT	0.512																																					p.V251M		Atlas-SNP	.											.	ME3	70	.	0			c.G751A						PASS	.						132.0	106.0	115.0					11																	86198437		2202	4299	6501	SO:0001583	missense	10873	exon7			CGTGCACGCGCTG	X79440	CCDS8277.1	11q14.2	2012-09-20			ENSG00000151376	ENSG00000151376	1.1.1.40		6985	protein-coding gene	gene with protein product		604626				7818469	Standard	NM_001161586		Approved		uc001pbz.3	Q16798	OTTHUMG00000167217	ENST00000393324.3:c.751G>A	11.37:g.86198437C>T	ENSP00000376998:p.Val251Met	82.0	0.0	0		92.0	58.0	0.630435	NM_006680	B7Z6V0|Q8TBJ0	Missense_Mutation	SNP	ENST00000393324.3	37	CCDS8277.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596022	0.46318	.	.	ENSG00000151376	ENST00000359636;ENST00000543262;ENST00000393324;ENST00000524826;ENST00000545395;ENST00000323418	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.44	4.53	0.55603	Malic enzyme, N-terminal (2);	0.187074	0.46442	N	0.000290	T	0.69169	0.3081	M	0.87547	2.89	0.58432	D	0.999995	D	0.76494	0.999	D	0.63877	0.919	T	0.74423	-0.3670	9	.	.	.	.	12.7938	0.57549	0.0:0.92:0.0:0.08	.	251	Q16798	MAON_HUMAN	M	251;251;251;251;189;189	ENSP00000352657:V251M;ENSP00000440246:V251M;ENSP00000376998:V251M;ENSP00000431182:V251M;ENSP00000315255:V189M	.	V	-	1	0	ME3	85876085	0.978000	0.34361	0.230000	0.23976	0.322000	0.28314	2.358000	0.44134	1.287000	0.44583	0.655000	0.94253	GTG	.	.	none		0.512	ME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393767.2		
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659419	43659419	+	Missense_Mutation	SNP	G	G	T	rs79064394		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:43659419G>T	ENST00000374466.3	+	5	1421	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	362					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.L362F(5)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						GAGAGGTCTTGATGTTTTTCT	0.433																																					p.L362F		Atlas-SNP	.											CSGALNACT2,NS,carcinoma,0,5	CSGALNACT2	67	5	5	Substitution - Missense(5)	endometrium(4)|kidney(1)	c.G1086T						scavenged	.						223.0	221.0	222.0					10																	43659419		2203	4300	6503	SO:0001583	missense	55454	exon5			GGTCTTGATGTTT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1086G>T	10.37:g.43659419G>T	ENSP00000363590:p.Leu362Phe	162.0	1.0	0.00617284		126.0	6.0	0.047619	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.499782	0.85176	.	.	ENSG00000169826	ENST00000374466	T	0.27256	1.68	6.08	5.17	0.71159	.	0.064535	0.64402	D	0.000004	T	0.57359	0.2048	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63721	-0.6573	10	0.87932	D	0	-11.7375	14.8306	0.70146	0.0683:0.0:0.9317:0.0	.	362	Q8N6G5	CGAT2_HUMAN	F	362	ENSP00000363590:L362F	ENSP00000363590:L362F	L	+	3	2	CSGALNACT2	42979425	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.683000	0.37638	2.894000	0.99253	0.591000	0.81541	TTG	.	.	weak		0.433	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
KCNH1	3756	hgsc.bcm.edu	37	1	211256200	211256200	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:211256200G>T	ENST00000271751.4	-	5	507	c.480C>A	c.(478-480)agC>agA	p.S160R	KCNH1_ENST00000367007.4_Missense_Mutation_p.S160R			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	160					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		CACCCCTGCTGCTTGTCAGTG	0.557																																					p.S160R		Atlas-SNP	.											KCNH1,NS,carcinoma,0,1	KCNH1	199	1	0			c.C480A						PASS	.						95.0	77.0	84.0					1																	211256200		2203	4300	6503	SO:0001583	missense	3756	exon5			CCTGCTGCTTGTC	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.480C>A	1.37:g.211256200G>T	ENSP00000271751:p.Ser160Arg	49.0	0.0	0		43.0	18.0	0.418605	NM_172362	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	G	9.983	1.228687	0.22542	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.98617	-5.01;-5.03	5.1	4.18	0.49190	.	0.075279	0.85682	D	0.000000	D	0.91469	0.7307	N	0.01009	-1.055	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.004;0.004	D	0.88309	0.2955	10	0.02654	T	1	.	14.3963	0.67013	0.0:0.0:0.8514:0.1486	.	160;160	Q14CL3;O95259	.;KCNH1_HUMAN	R	160	ENSP00000271751:S160R;ENSP00000355974:S160R	ENSP00000271751:S160R	S	-	3	2	KCNH1	209322823	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.252000	0.72447	1.275000	0.44379	0.655000	0.94253	AGC	.	.	none		0.557	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
GPR156	165829	hgsc.bcm.edu	37	3	119892302	119892302	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:119892302C>A	ENST00000464295.1	-	9	1394	c.949G>T	c.(949-951)Gca>Tca	p.A317S	GPR156_ENST00000315843.3_Missense_Mutation_p.A317S|GPR156_ENST00000461057.1_Missense_Mutation_p.A313S			Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled GABA receptor activity (GO:0004965)	p.A317S(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|prostate(1)|skin(1)	32				GBM - Glioblastoma multiforme(114;0.19)		TCTTCAAATGCCTTCCATTGC	0.398																																					p.A317S		Atlas-SNP	.											GPR156,rectum,carcinoma,0,1	GPR156	85	1	1	Substitution - Missense(1)	large_intestine(1)	c.G949T						PASS	.						203.0	183.0	189.0					3																	119892302		2203	4300	6503	SO:0001583	missense	165829	exon8			CAAATGCCTTCCA	AF488739	CCDS2997.1, CCDS54629.1	3q13.33	2012-08-21			ENSG00000175697	ENSG00000175697		"""GPCR / Class C : Orphans"""	20844	protein-coding gene	gene with protein product		610464				12591167	Standard	NM_153002		Approved	PGR28, GABABL	uc011bjf.2	Q8NFN8	OTTHUMG00000159406	ENST00000464295.1:c.949G>T	3.37:g.119892302C>A	ENSP00000417261:p.Ala317Ser	119.0	0.0	0		109.0	36.0	0.330275	NM_153002	B7ZL66|E9PFZ4|Q14CM1|Q86SN6	Missense_Mutation	SNP	ENST00000464295.1	37	CCDS2997.1	.	.	.	.	.	.	.	.	.	.	C	12.20	1.866726	0.32977	.	.	ENSG00000175697	ENST00000464295;ENST00000315843;ENST00000461057	T;T;T	0.23348	1.91;1.91;1.91	5.48	3.58	0.41010	.	0.317821	0.27792	N	0.017826	T	0.23806	0.0576	M	0.67953	2.075	0.27786	N	0.942993	P;P	0.35077	0.483;0.483	B;B	0.30943	0.122;0.122	T	0.13019	-1.0525	9	.	.	.	-5.8605	8.9517	0.35792	0.0:0.6408:0.2041:0.1551	.	313;317	E9PFZ4;Q8NFN8	.;GP156_HUMAN	S	317;317;313	ENSP00000417261:A317S;ENSP00000324553:A317S;ENSP00000418758:A313S	.	A	-	1	0	GPR156	121374992	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.641000	0.24720	1.324000	0.45282	0.462000	0.41574	GCA	.	.	none		0.398	GPR156-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355139.1	NM_153002	
CSNK2B	1460	hgsc.bcm.edu	37	6	31637636	31637636	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:31637636C>T	ENST00000375882.2	+	7	737	c.581C>T	c.(580-582)cCg>cTg	p.P194L	LY6G5B_ENST00000409525.1_5'Flank|CSNK2B_ENST00000375865.2_Missense_Mutation_p.P194L|CSNK2B-LY6G5B-1181_ENST00000375880.2_Intron|CSNK2B_ENST00000375885.4_Missense_Mutation_p.P213L|CSNK2B_ENST00000375866.2_Missense_Mutation_p.P194L|LY6G5B_ENST00000375864.4_5'Flank	NM_001282385.1|NM_001320.5	NP_001269314.1|NP_001311.3	P67870	CSK2B_HUMAN	casein kinase 2, beta polypeptide	194				P -> A (in Ref. 3; AAA52123). {ECO:0000305}.	adiponectin-activated signaling pathway (GO:0033211)|axon guidance (GO:0007411)|cellular protein complex assembly (GO:0043623)|endothelial tube morphogenesis (GO:0061154)|mitotic cell cycle (GO:0000278)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell proliferation (GO:0008285)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|protein phosphorylation (GO:0006468)|regulation of DNA binding (GO:0051101)|regulation of protein kinase activity (GO:0045859)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein kinase CK2 complex (GO:0005956)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein kinase regulator activity (GO:0019887)|receptor binding (GO:0005102)|transcription factor binding (GO:0008134)			central_nervous_system(5)|endometrium(1)|large_intestine(2)|liver(1)|urinary_tract(1)	10						AAGATCCATCCGATGGCCTAC	0.597																																					p.P194L		Atlas-SNP	.											.	CSNK2B	15	.	0			c.C581T						PASS	.						117.0	84.0	96.0					6																	31637636		1511	2709	4220	SO:0001583	missense	1460	exon7			TCCATCCGATGGC	M30448	CCDS4712.1	6p21.33	2013-01-17			ENSG00000204435	ENSG00000204435	2.7.11.1		2460	protein-coding gene	gene with protein product		115441				2276748, 9503014	Standard	NM_001320		Approved		uc003nvr.1	P67870	OTTHUMG00000177888	ENST00000375882.2:c.581C>T	6.37:g.31637636C>T	ENSP00000365042:p.Pro194Leu	38.0	0.0	0		23.0	11.0	0.478261	NM_001320	B0UXA9|P07312|P13862|Q4VX47	Missense_Mutation	SNP	ENST00000375882.2	37	CCDS4712.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467278	0.84533	.	.	ENSG00000204435	ENST00000375885;ENST00000375882;ENST00000375865;ENST00000375866	.	.	.	5.52	5.52	0.82312	.	0.119582	0.56097	D	0.000022	T	0.52468	0.1736	M	0.84326	2.69	0.49051	D	0.999744	D	0.53462	0.96	B	0.40982	0.345	T	0.63166	-0.6698	8	0.41790	T	0.15	-20.7702	16.978	0.86319	0.0:1.0:0.0:0.0	.	194	P67870	CSK2B_HUMAN	L	213;194;194;194	.	ENSP00000365025:P194L	P	+	2	0	CSNK2B	31745615	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	6.664000	0.74437	2.873000	0.98535	0.563000	0.77884	CCG	.	.	none		0.597	CSNK2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076063.8	NM_001320	
BBS12	166379	hgsc.bcm.edu	37	4	123664881	123664881	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:123664881G>T	ENST00000314218.3	+	2	2027	c.1834G>T	c.(1834-1836)Gaa>Taa	p.E612*	BBS12_ENST00000542236.1_Nonsense_Mutation_p.E612*	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	612					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						TTACTCATCAGAATTTGAAGC	0.378									Bardet-Biedl syndrome																												p.E612X		Atlas-SNP	.											.	BBS12	63	.	0			c.G1834T						PASS	.						85.0	83.0	83.0					4																	123664881		2203	4300	6503	SO:0001587	stop_gained	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TCATCAGAATTTG	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.1834G>T	4.37:g.123664881G>T	ENSP00000319062:p.Glu612*	94.0	0.0	0		91.0	5.0	0.0549451	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Nonsense_Mutation	SNP	ENST00000314218.3	37	CCDS3728.1	.	.	.	.	.	.	.	.	.	.	G	40	8.505213	0.98841	.	.	ENSG00000181004	ENST00000314218;ENST00000542236	.	.	.	5.81	4.97	0.65823	.	0.282205	0.39274	N	0.001417	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-34.5508	16.4957	0.84242	0.0:0.1415:0.8585:0.0	.	.	.	.	X	612	.	ENSP00000319062:E612X	E	+	1	0	BBS12	123884331	1.000000	0.71417	0.698000	0.30274	0.872000	0.50106	3.556000	0.53734	1.427000	0.47276	0.591000	0.81541	GAA	.	.	none		0.378	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
C10orf90	118611	hgsc.bcm.edu	37	10	128193433	128193433	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:128193433C>T	ENST00000284694.7	-	3	456	c.336G>A	c.(334-336)ccG>ccA	p.P112P	C10orf90_ENST00000392694.1_Silent_p.P65P|C10orf90_ENST00000454341.1_Silent_p.P112P|C10orf90_ENST00000368674.1_5'UTR|C10orf90_ENST00000356858.3_Silent_p.P65P|C10orf90_ENST00000544758.1_Silent_p.P209P	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	112					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		GCTCATCTGACGGTGCCGGGA	0.597											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P112P		Atlas-SNP	.											C10orf90,NS,carcinoma,-1,1	C10orf90	121	1	0			c.G336A						PASS	.						81.0	65.0	70.0					10																	128193433		2203	4300	6503	SO:0001819	synonymous_variant	118611	exon3			ATCTGACGGTGCC	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.336G>A	10.37:g.128193433C>T		115.0	0.0	0	1563	98.0	39.0	0.397959	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Silent	SNP	ENST00000284694.7	37	CCDS31310.1																																																																																			.	.	none		0.597	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
CACNA2D1	781	hgsc.bcm.edu	37	7	81601100	81601100	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:81601100T>C	ENST00000356253.5	-	26	2425	c.2170A>G	c.(2170-2172)Aaa>Gaa	p.K724E	CACNA2D1_ENST00000535308.1_5'Flank|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.K712E			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	724					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TACATATTTTTCTGCTTACTC	0.303																																					p.K712E		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.A2134G						PASS	.						58.0	61.0	60.0					7																	81601100		2202	4293	6495	SO:0001583	missense	781	exon26			TATTTTTCTGCTT	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2170A>G	7.37:g.81601100T>C	ENSP00000348589:p.Lys724Glu	259.0	0.0	0		330.0	70.0	0.212121	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	37		.	.	.	.	.	.	.	.	.	.	T	2.518	-0.311456	0.05422	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.71698	-0.59;-0.59	4.69	4.69	0.59074	.	0.258919	0.39407	N	0.001374	T	0.45498	0.1345	N	0.19112	0.55	0.80722	D	1	B	0.10296	0.003	B	0.11329	0.006	T	0.40924	-0.9537	10	0.02654	T	1	-19.5396	4.1471	0.10220	0.1938:0.0948:0.0:0.7114	.	712	P54289-2	.	E	712;731;724	ENSP00000349320:K712E;ENSP00000348589:K724E	ENSP00000284088:K731E	K	-	1	0	CACNA2D1	81439036	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.983000	0.29552	1.953000	0.56701	0.477000	0.44152	AAA	.	.	none		0.303	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
GBA	2629	hgsc.bcm.edu	37	1	155207245	155207245	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:155207245G>A	ENST00000327247.5	-	8	1118	c.886C>T	c.(886-888)Cga>Tga	p.R296*	GBA_ENST00000536770.1_Nonsense_Mutation_p.R183*|GBA_ENST00000493842.1_5'Flank|GBA_ENST00000428024.3_Nonsense_Mutation_p.R209*|AL713999.1_ENST00000401290.1_RNA|GBA_ENST00000368373.3_Nonsense_Mutation_p.R296*|GBA_ENST00000427500.3_Nonsense_Mutation_p.R247*	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	296			R -> Q (in GD; type 2; also found in a patient with Parkinson disease). {ECO:0000269|PubMed:10796875, ECO:0000269|PubMed:19286695, ECO:0000269|PubMed:8790604}.		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	ATGAAGTCTCGCTGATGTTCA	0.557									Gaucher disease type I																												p.R296X		Atlas-SNP	.											GBA,NS,carcinoma,+1,1	GBA	46	1	0			c.C886T	GRCh37	CM980835	GBA	M		PASS	.						94.0	77.0	83.0					1																	155207245		2203	4300	6503	SO:0001587	stop_gained	2629	exon8	Familial Cancer Database	glucocerebrosidase insufficiency	AGTCTCGCTGATG	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.886C>T	1.37:g.155207245G>A	ENSP00000314508:p.Arg296*	221.0	0.0	0		160.0	49.0	0.30625	NM_001005742	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Nonsense_Mutation	SNP	ENST00000327247.5	37	CCDS1102.1	.	.	.	.	.	.	.	.	.	.	.	16.64	3.180530	0.57800	.	.	ENSG00000177628	ENST00000427500;ENST00000428024;ENST00000368373;ENST00000327247;ENST00000536770;ENST00000536555;ENST00000402928	.	.	.	3.51	1.41	0.22369	.	0.000000	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3734	8.0076	0.30334	0.0:0.0:0.5612:0.4388	.	.	.	.	X	247;209;296;296;183;253;281	.	ENSP00000314508:R296X	R	-	1	2	GBA	153473869	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	2.133000	0.42093	0.216000	0.20781	0.313000	0.20887	CGA	.	.	none		0.557	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157	
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31132340	31132340	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:31132340G>C	ENST00000304166.4	+	13	1326	c.1037G>C	c.(1036-1038)aGc>aCc	p.S346T	ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.S346T|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.S346T|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.S325T	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	346					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						AATGAGTCCAGCATCTACTTG	0.488																																					p.S346T	Ovarian(44;225 1186 2158 11092)	Atlas-SNP	.											.	ADCYAP1R1	78	.	0			c.G1037C						PASS	.						95.0	88.0	91.0					7																	31132340		2203	4300	6503	SO:0001583	missense	117	exon13			AGTCCAGCATCTA		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.1037G>C	7.37:g.31132340G>C	ENSP00000306620:p.Ser346Thr	48.0	0.0	0		40.0	27.0	0.675	NM_001118	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	37	CCDS5433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.4|24.4	4.524258|4.524258	0.85600|0.85600	.|.	.|.	ENSG00000078549|ENSG00000078549	ENST00000436116|ENST00000304166;ENST00000381667;ENST00000409363;ENST00000396211;ENST00000409489	.|T;T;T;T	.|0.42900	.|1.13;1.23;0.96;1.15	5.72|5.72	5.72|5.72	0.89469|0.89469	.|GPCR, family 2-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48572|0.48572	0.1507|0.1507	L|L	0.37561|0.37561	1.115|1.115	0.80722|0.80722	D|D	1|1	.|P;P;P;B;B	.|0.46395	.|0.78;0.624;0.877;0.205;0.425	.|P;B;P;B;B	.|0.52646	.|0.604;0.42;0.705;0.215;0.324	T|T	0.29971|0.29971	-0.9994|-0.9994	5|10	.|0.44086	.|T	.|0.13	.|.	17.7518|17.7518	0.88436|0.88436	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|346;346;346;325;346	.|B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.|.;.;.;.;PACR_HUMAN	H|T	62|346;117;325;346;346	.|ENSP00000306620:S346T;ENSP00000387335:S325T;ENSP00000379514:S346T;ENSP00000386395:S346T	.|ENSP00000306620:S346T	Q|S	+|+	3|2	2|0	ADCYAP1R1|ADCYAP1R1	31098865|31098865	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.248000|9.248000	0.95456|0.95456	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	CAG|AGC	.	.	none		0.488	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
BCL11B	64919	hgsc.bcm.edu	37	14	99642463	99642463	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:99642463A>G	ENST00000357195.3	-	4	719	c.710T>C	c.(709-711)cTg>cCg	p.L237P	BCL11B_ENST00000345514.2_Missense_Mutation_p.L166P|BCL11B_ENST00000443726.2_Missense_Mutation_p.L43P	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	237					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CGCGTGCTGCAGCAGGAACCA	0.637			T	TLX3	T-ALL																																p.L237P		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	108	.	0			c.T710C						PASS	.						33.0	32.0	32.0					14																	99642463		2199	4298	6497	SO:0001583	missense	64919	exon4			TGCTGCAGCAGGA	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.710T>C	14.37:g.99642463A>G	ENSP00000349723:p.Leu237Pro	35.0	0.0	0		43.0	14.0	0.325581	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	37	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643442	0.67244	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.26223	1.81;1.75;1.8	4.68	4.68	0.58851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.103621	0.38548	N	0.001653	T	0.48059	0.1479	M	0.64170	1.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.50303	-0.8844	10	0.66056	D	0.02	-12.3029	14.4247	0.67207	1.0:0.0:0.0:0.0	.	166;237	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	P	237;166;43	ENSP00000349723:L237P;ENSP00000280435:L166P;ENSP00000387419:L43P	ENSP00000280435:L166P	L	-	2	0	BCL11B	98712216	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.163000	0.94750	1.883000	0.54544	0.533000	0.62120	CTG	.	.	none		0.637	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
ZNF503	84858	hgsc.bcm.edu	37	10	77161102	77161102	+	Missense_Mutation	SNP	C	C	T	rs533859340|rs374168185	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:77161102C>T	ENST00000372524.4	-	1	562	c.76G>A	c.(76-78)Ggc>Agc	p.G26S	ZNF503-AS2_ENST00000466942.2_RNA|ZNF503-AS2_ENST00000486015.1_RNA|ZNF503_ENST00000535216.1_Missense_Mutation_p.G26S|ZNF503-AS2_ENST00000425916.3_RNA|RP11-399K21.11_ENST00000418818.2_lincRNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	26	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					TCTGCAccgccgcctccgcct	0.711																																					p.G26S		Atlas-SNP	.											.	ZNF503	25	.	0			c.G76A						PASS	.						3.0	4.0	4.0					10																	77161102		1704	3476	5180	SO:0001583	missense	84858	exon1			CACCGCCGCCTCC	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.76G>A	10.37:g.77161102C>T	ENSP00000361602:p.Gly26Ser	31.0	0.0	0		18.0	9.0	0.5	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.061|0.061	-1.224407|-1.224407	0.01530|0.01530	.|.	.|.	ENSG00000165655|ENSG00000233745	ENST00000372524;ENST00000535216;ENST00000372516|ENST00000438638	D;D|.	0.87334|.	-2.24;-2.24|.	1.32|1.32	-2.14|-2.14	0.07123|0.07123	.|.	1.267280|.	0.06383|.	N|.	0.715644|.	T|T	0.17023|0.17023	0.0409|0.0409	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999992|0.999992	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.25779|0.25779	-1.0122|-1.0122	9|6	.|0.87932	.|D	.|0	-4.8545|-4.8545	3.8606|3.8606	0.08994|0.08994	0.0:0.3276:0.2147:0.4577|0.0:0.3276:0.2147:0.4577	.|.	26|.	Q96F45|.	ZN503_HUMAN|.	S|L	26|115	ENSP00000361602:G26S;ENSP00000438988:G26S|.	.|ENSP00000391835:P115L	G|P	-|+	1|2	0|0	ZNF503|AC010997.1	76831108|76831108	0.437000|0.437000	0.25593|0.25593	0.723000|0.723000	0.30687|0.30687	0.115000|0.115000	0.19883|0.19883	-0.115000|-0.115000	0.10741|0.10741	-0.181000|-0.181000	0.10619|0.10619	0.000000|0.000000	0.15137|0.15137	GGC|CCG	.	.	none		0.711	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
SLC22A23	63027	hgsc.bcm.edu	37	6	3284179	3284179	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:3284179G>A	ENST00000406686.3	-	9	1609	c.1610C>T	c.(1609-1611)tCc>tTc	p.S537F	SLC22A23_ENST00000490273.1_Missense_Mutation_p.S256F|SLC22A23_ENST00000380302.4_Missense_Mutation_p.S256F|SLC22A23_ENST00000436008.2_Missense_Mutation_p.S545F|PSMG4_ENST00000451246.2_Intron	NM_015482.1	NP_056297.1	A1A5C7	S22AN_HUMAN	solute carrier family 22, member 23	537					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(93;0.0493)	all_hematologic(90;0.0905)				AAACGCGATGGAAAATTTGTC	0.597																																					p.S537F		Atlas-SNP	.											SLC22A23_ENST00000406686,NS,carcinoma,-1,2	SLC22A23	89	2	0			c.C1610T						scavenged	.						103.0	90.0	95.0					6																	3284179		2203	4300	6503	SO:0001583	missense	63027	exon9			GCGATGGAAAATT	AJ420525	CCDS34331.1, CCDS47363.1, CCDS75389.1	6p25.2	2013-05-22	2008-01-11	2008-01-11	ENSG00000137266	ENSG00000137266		"""Solute carriers"""	21106	protein-coding gene	gene with protein product		611697	"""chromosome 6 open reading frame 85"""	C6orf85		17714910	Standard	NM_015482		Approved	FLJ22174	uc003mvm.3	A1A5C7	OTTHUMG00000014144	ENST00000406686.3:c.1610C>T	6.37:g.3284179G>A	ENSP00000385028:p.Ser537Phe	96.0	1.0	0.0104167		83.0	37.0	0.445783	NM_015482	A1A5C8|Q5T8B8|Q6ZMH3|Q8IW73	Missense_Mutation	SNP	ENST00000406686.3	37	CCDS47363.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681253	0.88542	.	.	ENSG00000137266	ENST00000436008;ENST00000406686;ENST00000380302;ENST00000490273;ENST00000485307;ENST00000467177	T;T;T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85;-0.85;-0.85	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.054601	0.85682	D	0.000000	T	0.78336	0.4267	L	0.39898	1.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.987	T	0.79818	-0.1643	10	0.56958	D	0.05	-37.9193	18.0651	0.89388	0.0:0.0:1.0:0.0	.	545;537	C9J4Z0;A1A5C7	.;S22AN_HUMAN	F	545;537;256;256;365;363	ENSP00000410245:S545F;ENSP00000385028:S537F;ENSP00000369657:S256F;ENSP00000419463:S256F;ENSP00000418134:S365F;ENSP00000418985:S363F	ENSP00000369657:S256F	S	-	2	0	SLC22A23	3229178	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.303000	0.96183	2.491000	0.84063	0.655000	0.94253	TCC	.	.	none		0.597	SLC22A23-006	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353059.1	NM_021945	
SARDH	1757	hgsc.bcm.edu	37	9	136577806	136577806	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:136577806C>T	ENST00000371872.4	-	10	1520	c.1263G>A	c.(1261-1263)ggG>ggA	p.G421G	SARDH_ENST00000422262.2_Silent_p.G253G|SARDH_ENST00000439388.1_Silent_p.G421G	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	421					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CCAGCTCCTGCCCACAGCCAC	0.637																																					p.G421G		Atlas-SNP	.											.	SARDH	112	.	0			c.G1263A						PASS	.						55.0	56.0	55.0					9																	136577806		2203	4300	6503	SO:0001819	synonymous_variant	1757	exon10			CTCCTGCCCACAG		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1263G>A	9.37:g.136577806C>T		34.0	0.0	0		24.0	11.0	0.458333	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	37	CCDS6978.1																																																																																			.	.	none		0.637	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
PRR23C	389152	hgsc.bcm.edu	37	3	138762875	138762875	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:138762875C>T	ENST00000413199.1	-	1	859	c.588G>A	c.(586-588)ggG>ggA	p.G196G	MRPS22_ENST00000495075.1_Intron|PRR23C_ENST00000502927.2_Silent_p.G196G	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	196	Pro-rich.									breast(2)|lung(7)|skin(2)	11						GAGCACAGGGCCCTCGGATGG	0.652																																					p.G196G		Atlas-SNP	.											.	PRR23C	31	.	0			c.G588A						PASS	.						37.0	44.0	42.0					3																	138762875		692	1591	2283	SO:0001819	synonymous_variant	389152	exon1			ACAGGGCCCTCGG		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.588G>A	3.37:g.138762875C>T		111.0	0.0	0		94.0	39.0	0.414894	NM_001134657		Silent	SNP	ENST00000413199.1	37	CCDS46924.1																																																																																			.	.	none		0.652	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361502.1	NM_001134657	
VCAN	1462	hgsc.bcm.edu	37	5	82834316	82834316	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:82834316T>C	ENST00000265077.3	+	8	6059	c.5494T>C	c.(5494-5496)Ttt>Ctt	p.F1832L	VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.F845L	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1832	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TGCCTCTGTCTTTATGGAGCA	0.498																																					p.F1832L		Atlas-SNP	.											.	VCAN	498	.	0			c.T5494C						PASS	.						78.0	86.0	83.0					5																	82834316		2203	4299	6502	SO:0001583	missense	1462	exon8			TCTGTCTTTATGG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5494T>C	5.37:g.82834316T>C	ENSP00000265077:p.Phe1832Leu	122.0	0.0	0		89.0	34.0	0.382022	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.596304	0.46318	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.85484	-1.98;-1.99;3.27	5.82	3.13	0.36017	.	0.288191	0.30547	N	0.009390	T	0.79263	0.4416	L	0.49350	1.555	0.18873	N	0.999989	B;B	0.25390	0.037;0.125	B;B	0.22386	0.039;0.028	T	0.66532	-0.5900	10	0.31617	T	0.26	.	10.9593	0.47376	0.0:0.1464:0.0:0.8536	.	845;1832	P13611-2;P13611	.;CSPG2_HUMAN	L	1832;845;845	ENSP00000265077:F1832L;ENSP00000340062:F845L;ENSP00000426251:F845L	ENSP00000265077:F1832L	F	+	1	0	VCAN	82870072	0.111000	0.22076	0.003000	0.11579	0.350000	0.29205	2.000000	0.40816	1.035000	0.39972	0.533000	0.62120	TTT	.	.	none		0.498	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
TLR2	7097	hgsc.bcm.edu	37	4	154625039	154625039	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:154625039A>T	ENST00000260010.6	+	1	2388	c.980A>T	c.(979-981)gAt>gTt	p.D327V		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	327					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)	p.D327V(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	TTATTTTATGATCTGAGCACT	0.318																																					p.D327V		Atlas-SNP	.											TLR2,NS,lymphoid_neoplasm,0,3	TLR2	84	3	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.A980T						PASS	.						58.0	63.0	62.0					4																	154625039		2203	4299	6502	SO:0001583	missense	7097	exon3			TTTATGATCTGAG	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.980A>T	4.37:g.154625039A>T	ENSP00000260010:p.Asp327Val	99.0	0.0	0		109.0	41.0	0.376147	NM_003264	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	ENST00000260010.6	37	CCDS3784.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112000	0.56398	.	.	ENSG00000137462	ENST00000260010	T	0.16457	2.34	6.06	6.06	0.98353	.	0.366671	0.29165	N	0.012947	T	0.36635	0.0974	M	0.67397	2.05	0.28454	N	0.916221	D	0.61697	0.99	D	0.63113	0.911	T	0.35101	-0.9802	10	0.87932	D	0	.	11.615	0.51083	0.9314:0.0:0.0686:0.0	.	327	O60603	TLR2_HUMAN	V	327	ENSP00000260010:D327V	ENSP00000260010:D327V	D	+	2	0	TLR2	154844489	0.991000	0.36638	0.150000	0.22450	0.033000	0.12548	3.108000	0.50337	2.324000	0.78689	0.533000	0.62120	GAT	.	.	none		0.318	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365205.1		
IFT22	64792	hgsc.bcm.edu	37	7	100958542	100958542	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:100958542T>G	ENST00000315322.4	-	5	524	c.431A>C	c.(430-432)aAg>aCg	p.K144T	RABL5_ENST00000437644.2_Missense_Mutation_p.K114T|RABL5_ENST00000517481.1_Missense_Mutation_p.K67T|RABL5_ENST00000495166.1_5'UTR|RABL5_ENST00000498704.2_Missense_Mutation_p.K67T	NM_022777.2	NP_073614.1	Q9H7X7	IFT22_HUMAN		144					small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.215)					GTGCACCAGCTTCAGCTTGTT	0.423											OREG0018221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K144T		Atlas-SNP	.											.	RABL5	15	.	0			c.A431C						PASS	.						86.0	83.0	84.0					7																	100958542		2203	4300	6503	SO:0001583	missense	64792	exon5			ACCAGCTTCAGCT																												ENST00000315322.4:c.431A>C	7.37:g.100958542T>G	ENSP00000320359:p.Lys144Thr	90.0	0.0	0	1355	99.0	36.0	0.363636	NM_022777	Q49AG1|Q69YV5|Q9BSW4	Missense_Mutation	SNP	ENST00000315322.4	37	CCDS5719.1	.	.	.	.	.	.	.	.	.	.	T	8.424	0.846993	0.17034	.	.	ENSG00000128581	ENST00000517481;ENST00000315322;ENST00000498704;ENST00000437644	T	0.46451	0.87	5.41	3.03	0.35002	.	0.473361	0.23614	N	0.046303	T	0.24275	0.0588	L	0.27053	0.805	0.28871	N	0.894977	B;B	0.14438	0.01;0.004	B;B	0.12156	0.007;0.003	T	0.16070	-1.0415	10	0.21540	T	0.41	-21.9243	4.6961	0.12804	0.0:0.1701:0.1616:0.6684	.	114;144	Q9H7X7-2;Q9H7X7	.;RABL5_HUMAN	T	67;144;67;114	ENSP00000320359:K144T	ENSP00000320359:K144T	K	-	2	0	RABL5	100745262	0.995000	0.38212	1.000000	0.80357	0.998000	0.95712	0.568000	0.23623	0.360000	0.24265	0.533000	0.62120	AAG	.	.	none		0.423	RABL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347565.1		
PLPPR1	54886	hgsc.bcm.edu	37	9	104079734	104079734	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr9:104079734G>T	ENST00000374874.3	+	7	1340	c.901G>T	c.(901-903)Gct>Tct	p.A301S	LPPR1_ENST00000395056.2_Missense_Mutation_p.A301S	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		301					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										ACCCCTAATGGCTTTCCCAAG	0.493																																					p.A301S		Atlas-SNP	.											.	.	.	.	0			c.G901T						PASS	.						115.0	121.0	119.0					9																	104079734		2203	4300	6503	SO:0001583	missense	0	exon7			CTAATGGCTTTCC																												ENST00000374874.3:c.901G>T	9.37:g.104079734G>T	ENSP00000364008:p.Ala301Ser	108.0	0.0	0		134.0	41.0	0.30597	NM_207299	Q5VX23|Q9NXE2	Missense_Mutation	SNP	ENST00000374874.3	37	CCDS6751.1	.	.	.	.	.	.	.	.	.	.	G	8.333	0.826970	0.16749	.	.	ENSG00000148123	ENST00000374874;ENST00000374871;ENST00000395056	T;T	0.28454	1.61;1.61	5.79	5.79	0.91817	.	0.062463	0.64402	D	0.000004	T	0.19167	0.0460	N	0.19112	0.55	0.53688	D	0.999973	B;B	0.29378	0.004;0.243	B;B	0.21917	0.005;0.037	T	0.06267	-1.0836	10	0.02654	T	1	-36.4594	19.0195	0.92908	0.0:0.0:1.0:0.0	.	285;301	B7Z8P4;Q8TBJ4	.;LPPR1_HUMAN	S	301	ENSP00000364008:A301S;ENSP00000378496:A301S	ENSP00000364005:A301S	A	+	1	0	RP11-35N6.1	103119555	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.250000	0.78287	2.746000	0.94184	0.655000	0.94253	GCT	.	.	none		0.493	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053425.1		
AATK	9625	hgsc.bcm.edu	37	17	79098602	79098602	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:79098602C>T	ENST00000326724.4	-	9	911	c.887G>A	c.(886-888)tGg>tAg	p.W296*	MIR338_ENST00000390137.2_RNA|MIR657_ENST00000385003.1_RNA|AATK_ENST00000417379.1_Nonsense_Mutation_p.W193*|AATK_ENST00000572339.1_5'Flank	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TGGCGCGATCCAGCGCAGAGG	0.667																																					p.W296X		Atlas-SNP	.											.	AATK	102	.	0			c.G887A						PASS	.						36.0	43.0	40.0					17																	79098602		2171	4255	6426	SO:0001587	stop_gained	9625	exon9			GCGATCCAGCGCA	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.887G>A	17.37:g.79098602C>T	ENSP00000324196:p.Trp296*	146.0	0.0	0		92.0	5.0	0.0543478	NM_001080395	O75136|Q6ZN31|Q86X28	Nonsense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.718074|6.718074	0.97784|0.97784	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724;ENST00000374792	.|.	.|.	.|.	3.86|3.86	3.86|3.86	0.44501|0.44501	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|.	0.34571|.	0.0902|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33317|.	-0.9873|.	3|.	.|0.02654	.|T	.|1	.|.	14.7321|14.7321	0.69388|0.69388	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	R|X	249|296	.|.	.|ENSP00000324196:W296X	G|W	-|-	1|2	0|0	AATK|AATK	76713197|76713197	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	5.431000|5.431000	0.66507|0.66507	1.982000|1.982000	0.57802|0.57802	0.591000|0.591000	0.81541|0.81541	GGA|TGG	.	.	none		0.667	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
RPAP1	26015	hgsc.bcm.edu	37	15	41826971	41826971	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:41826971A>G	ENST00000304330.4	-	6	820	c.704T>C	c.(703-705)cTg>cCg	p.L235P	RPAP1_ENST00000568413.1_5'Flank|RPAP1_ENST00000561603.1_Missense_Mutation_p.L235P	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	235						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CATGGCCTGCAGTCTTGCTAT	0.572																																					p.L235P		Atlas-SNP	.											.	RPAP1	111	.	0			c.T704C						PASS	.						123.0	98.0	107.0					15																	41826971		2203	4300	6503	SO:0001583	missense	26015	exon6			GCCTGCAGTCTTG	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.704T>C	15.37:g.41826971A>G	ENSP00000306123:p.Leu235Pro	58.0	0.0	0		43.0	15.0	0.348837	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	37	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463125	0.84425	.	.	ENSG00000103932	ENST00000304330	T	0.35048	1.33	5.22	5.22	0.72569	RNA polymerase II-associated protein 1, N-terminal (1);	0.157253	0.43416	D	0.000570	T	0.67439	0.2893	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76000	-0.3119	10	0.87932	D	0	-14.2976	14.084	0.64944	1.0:0.0:0.0:0.0	.	235	Q9BWH6	RPAP1_HUMAN	P	235	ENSP00000306123:L235P	ENSP00000306123:L235P	L	-	2	0	RPAP1	39614263	1.000000	0.71417	0.743000	0.31040	0.974000	0.67602	8.707000	0.91367	1.977000	0.57605	0.402000	0.26972	CTG	.	.	none		0.572	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
MYC	4609	hgsc.bcm.edu	37	8	128750844	128750844	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:128750844C>T	ENST00000259523.6	+	2	1541	c.336C>T	c.(334-336)aaC>aaT	p.N112N	MYC_ENST00000377970.2_Silent_p.N127N|MYC_ENST00000524013.1_Silent_p.N126N			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	112					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACATGGTGAACCAGAGTTTCA	0.607		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N127N		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.C381T						PASS	.						65.0	65.0	65.0					8																	128750844		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon2			GGTGAACCAGAGT		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.336C>T	8.37:g.128750844C>T		118.0	0.0	0	1567	90.0	36.0	0.4	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37																																																																																				.	.	none		0.607	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
C5orf47	133491	hgsc.bcm.edu	37	5	173416306	173416306	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr5:173416306C>T	ENST00000340147.6	+	1	145	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	C5orf47_ENST00000522195.1_Intron	NM_001144954.1	NP_001138426.1	Q569G3	CE047_HUMAN	chromosome 5 open reading frame 47	14										kidney(1)|prostate(1)	2						GGACTCGGCGCGCTTCGTCTA	0.701																																					p.R14C		Atlas-SNP	.											.	C5orf47	14	.	0			c.C40T						PASS	.						21.0	36.0	31.0					5																	173416306		692	1590	2282	SO:0001583	missense	133491	exon1			TCGGCGCGCTTCG		CCDS47343.1	5q35.2	2012-02-24			ENSG00000185056	ENSG00000185056			27026	protein-coding gene	gene with protein product						12477932	Standard	NM_001144954		Approved	LOC133491	uc003mcw.4	Q569G3	OTTHUMG00000163349	ENST00000340147.6:c.40C>T	5.37:g.173416306C>T	ENSP00000340887:p.Arg14Cys	67.0	0.0	0		77.0	29.0	0.376623	NM_001144954	Q8IYU7	Missense_Mutation	SNP	ENST00000340147.6	37	CCDS47343.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.460826	0.43736	.	.	ENSG00000185056	ENST00000340147	.	.	.	2.46	2.46	0.29980	.	.	.	.	.	T	0.55049	0.1896	L	0.29908	0.895	0.36128	D	0.845921	D	0.89917	1.0	D	0.75020	0.985	T	0.62421	-0.6858	8	0.87932	D	0	-7.6926	6.5122	0.22228	0.2879:0.7121:0.0:0.0	.	14	Q569G3	CE047_HUMAN	C	14	.	ENSP00000340887:R14C	R	+	1	0	C5orf47	173348912	0.764000	0.28473	0.919000	0.36401	0.346000	0.29079	0.547000	0.23299	1.351000	0.45789	0.313000	0.20887	CGC	.	.	none		0.701	C5orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372926.1	NM_001144954	
RECQL5	9400	hgsc.bcm.edu	37	17	73654377	73654377	+	Splice_Site	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:73654377C>T	ENST00000317905.5	-	7	1309		c.e7+1		RECQL5_ENST00000420326.2_Splice_Site|RECQL5_ENST00000423245.2_Splice_Site|RECQL5_ENST00000340830.5_Splice_Site|RECQL5_ENST00000584999.1_Splice_Site	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CCAAGCCTTACCTGGAGTTTT	0.502								Other identified genes with known or suspected DNA repair function																													.		Atlas-SNP	.											.	RECQL5	77	.	0			c.1149+1G>A						PASS	.						196.0	185.0	189.0					17																	73654377		2203	4300	6503	SO:0001630	splice_region_variant	9400	exon8			GCCTTACCTGGAG	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1149+1G>A	17.37:g.73654377C>T		60.0	0.0	0		55.0	18.0	0.327273	NM_004259	Q9H0B1|Q9P1W7|Q9UNC8	Splice_Site	SNP	ENST00000317905.5	37	CCDS42380.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679018	0.47886	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1346	0.98019	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RECQL5	71165972	1.000000	0.71417	0.999000	0.59377	0.594000	0.36715	7.003000	0.76310	2.765000	0.95021	0.655000	0.94253	.	.	.	none		0.502	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448207.1	NM_004259	Intron
NCOA3	8202	hgsc.bcm.edu	37	20	46279884	46279884	+	Silent	SNP	A	A	G	rs112355546		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:46279884A>G	ENST00000371998.3	+	20	4001	c.3810A>G	c.(3808-3810)caA>caG	p.Q1270Q	NCOA3_ENST00000341724.6_Silent_p.Q1196Q|NCOA3_ENST00000372004.3_Silent_p.Q1266Q|NCOA3_ENST00000371997.3_Silent_p.Q1261Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1270	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcaacagcaacagcagcaac	0.572																																					p.Q1270Q		Atlas-SNP	.											.	NCOA3	156	.	0			c.A3810G						PASS	.						92.0	92.0	92.0					20																	46279884		2203	4300	6503	SO:0001819	synonymous_variant	8202	exon20			ACAGCAACAGCAG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3810A>G	20.37:g.46279884A>G		68.0	0.0	0		61.0	4.0	0.0655738	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			A|0.500;G|0.500	0.500	weak		0.572	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
AHNAK2	113146	hgsc.bcm.edu	37	14	105412163	105412163	+	Missense_Mutation	SNP	C	C	G	rs201181175		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:105412163C>G	ENST00000333244.5	-	7	9744	c.9625G>C	c.(9625-9627)Gtg>Ctg	p.V3209L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3209						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGCTTCACGTCCACCTGG	0.607																																					p.V3209L		Atlas-SNP	.											AHNAK2_ENST00000333244,NS,carcinoma,0,1	AHNAK2	719	1	0			c.G9625C						scavenged	.						108.0	70.0	83.0					14																	105412163		1920	3847	5767	SO:0001583	missense	113146	exon7			GCTTCACGTCCAC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9625G>C	14.37:g.105412163C>G	ENSP00000353114:p.Val3209Leu	134.0	2.0	0.0149254		105.0	6.0	0.0571429	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	9.043	0.990179	0.18966	.	.	ENSG00000185567	ENST00000333244	T	0.01119	5.31	2.98	-2.26	0.06867	.	.	.	.	.	T	0.00906	0.0030	L	0.35723	1.085	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.48875	-0.8996	9	0.22109	T	0.4	.	0.8864	0.01245	0.2903:0.3589:0.1435:0.2074	.	3209	Q8IVF2	AHNK2_HUMAN	L	3209	ENSP00000353114:V3209L	ENSP00000353114:V3209L	V	-	1	0	AHNAK2	104483208	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.193000	0.00564	-0.054000	0.13266	0.313000	0.20887	GTG	.	.	weak		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
TTN	7273	hgsc.bcm.edu	37	2	179400129	179400129	+	Missense_Mutation	SNP	C	C	T	rs192391568	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:179400129C>T	ENST00000591111.1	-	308	96514	c.96290G>A	c.(96289-96291)cGt>cAt	p.R32097H	TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R33738H|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R24673H|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R31170H|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R24865H|TTN_ENST00000359218.5_Missense_Mutation_p.R24798H|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000589842.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32097	Fibronectin type-III 132. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> C. {ECO:0000269|PubMed:17344846}.		adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTCCTACACGGAGCCATCT	0.433													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		23700	0.0		0.0	False		,,,				2504	0.0				p.R33738H		Atlas-SNP	.											.	TTN	18412	.	0			c.G101213A						PASS	.						98.0	96.0	97.0					2																	179400129		1951	4152	6103	SO:0001583	missense	7273	exon358			CCTACACGGAGCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96290G>A	2.37:g.179400129C>T	ENSP00000465570:p.Arg32097His	67.0	0.0	0		69.0	38.0	0.550725	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	18.13	3.556169	0.65425	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	5.52	5.52	0.82312	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68165	0.2971	L	0.45285	1.41	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.69405	-0.5154	9	0.87932	D	0	.	19.8108	0.96545	0.0:1.0:0.0:0.0	.	24673;24798;24865;32097	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	31170;24673;24865;24798;24670	ENSP00000343764:R31170H;ENSP00000434586:R24673H;ENSP00000340554:R24865H;ENSP00000352154:R24798H	ENSP00000340554:R24865H	R	-	2	0	TTN	179108375	1.000000	0.71417	0.971000	0.41717	0.961000	0.63080	7.776000	0.85560	2.754000	0.94517	0.557000	0.71058	CGT	C|1.000;T|0.000	0.000	strong		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
VWCE	220001	hgsc.bcm.edu	37	11	61048187	61048187	+	Silent	SNP	G	G	A	rs375996793		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:61048187G>A	ENST00000335613.5	-	9	1619	c.1233C>T	c.(1231-1233)gaC>gaT	p.D411D		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	411	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TCACCTTCCCGTCCTAGAAGC	0.592																																					p.D411D		Atlas-SNP	.											.	VWCE	84	.	0			c.C1233T						PASS	.	G		0,4406		0,0,2203	96.0	79.0	85.0		1233	-6.0	0.5	11		85	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	VWCE	NM_152718.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		411/956	61048187	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	220001	exon9			CTTCCCGTCCTAG	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1233C>T	11.37:g.61048187G>A		64.0	0.0	0		67.0	34.0	0.507463	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1																																																																																			.	.	weak		0.592	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
CACNA1G	8913	hgsc.bcm.edu	37	17	48674136	48674136	+	Missense_Mutation	SNP	C	C	T	rs573756072		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:48674136C>T	ENST00000359106.5	+	16	3110	c.3110C>T	c.(3109-3111)cCg>cTg	p.P1037L	CACNA1G_ENST00000512389.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000505165.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000515165.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000515411.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000513964.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000354983.4_Missense_Mutation_p.P1014L|CACNA1G_ENST00000510366.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000514717.1_Missense_Mutation_p.P1014L|CACNA1G_ENST00000515765.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000352832.5_Missense_Mutation_p.P1014L|CACNA1G_ENST00000514181.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000429973.2_Missense_Mutation_p.P1037L|CACNA1G_ENST00000514079.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000442258.2_Missense_Mutation_p.P1014L|CACNA1G_ENST00000507896.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000507609.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000513689.2_Missense_Mutation_p.P1037L|CACNA1G_ENST00000507336.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000503485.1_Missense_Mutation_p.P1037L|CACNA1G_ENST00000502264.1_Missense_Mutation_p.P1014L|CACNA1G_ENST00000510115.1_Missense_Mutation_p.P1014L|CACNA1G_ENST00000360761.4_Missense_Mutation_p.P1014L|CACNA1G_ENST00000507510.2_Missense_Mutation_p.P1037L|CACNA1G_ENST00000358244.5_Missense_Mutation_p.P1014L|CACNA1G_ENST00000416767.4_Missense_Mutation_p.P1037L	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1037					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	AGCCTGCTGCCGCCTCTCATC	0.711													C|||	1	0.000199681	0.0	0.0	5008	,	,		13405	0.0		0.001	False		,,,				2504	0.0				p.P1037L		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C3110T						PASS	.						17.0	21.0	20.0					17																	48674136		2090	4220	6310	SO:0001583	missense	8913	exon16			TGCTGCCGCCTCT	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.3110C>T	17.37:g.48674136C>T	ENSP00000352011:p.Pro1037Leu	39.0	0.0	0		37.0	13.0	0.351351	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	37	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	c	22.2	4.262675	0.80358	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69;-2.69	4.78	4.78	0.61160	.	0.494671	0.21871	N	0.067899	D	0.92971	0.7763	L	0.47716	1.5	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;P;P;D;D;D;P;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.998;1.0;0.99;1.0;0.999;0.627;0.827;0.995;1.0;1.0;0.953;1.0;0.98;0.982;0.744	D;D;D;D;D;D;D;D;D;D;D;D;D;P;D;D;B;B;P;D;D;P;D;P;P;B	0.91635	0.994;0.957;0.999;0.997;0.999;0.999;0.996;0.999;0.996;0.957;0.999;0.926;0.971;0.87;0.999;0.952;0.053;0.18;0.867;0.995;0.992;0.481;0.999;0.579;0.459;0.115	D	0.93116	0.6521	10	0.62326	D	0.03	.	12.8738	0.57980	0.1627:0.8373:0.0:0.0	.	1014;1037;1037;1037;1037;1037;1037;1037;1037;1037;1037;1014;1037;1037;1037;1037;1037;1014;1037;1014;1014;1014;1014;1037;1014;1037	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	L	1014;1014;1037;1014;1014;1014;1037;1037;1014;1037;1037;1037;1037;1037;1037;1014;1037;1037;1037;1037;1014;1037;1037;1037;1037;1037	ENSP00000353990:P1014L;ENSP00000339302:P1014L;ENSP00000392390:P1037L;ENSP00000347078:P1014L;ENSP00000409759:P1014L;ENSP00000425522:P1014L;ENSP00000426261:P1037L;ENSP00000425451:P1037L;ENSP00000422407:P1014L;ENSP00000426814:P1037L;ENSP00000427238:P1037L;ENSP00000423112:P1037L;ENSP00000420918:P1037L;ENSP00000426172:P1037L;ENSP00000423045:P1037L;ENSP00000427173:P1014L;ENSP00000426098:P1037L;ENSP00000425698:P1037L;ENSP00000426232:P1037L;ENSP00000423317:P1037L;ENSP00000350979:P1014L;ENSP00000352011:P1037L;ENSP00000414388:P1037L;ENSP00000423155:P1037L;ENSP00000422268:P1037L;ENSP00000421518:P1037L	ENSP00000339302:P1014L	P	+	2	0	CACNA1G	46029135	1.000000	0.71417	0.592000	0.28758	0.943000	0.58893	7.487000	0.81328	2.210000	0.71456	0.491000	0.48974	CCG	.	.	none		0.711	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
SPATA18	132671	hgsc.bcm.edu	37	4	52938302	52938302	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:52938302G>T	ENST00000295213.4	+	6	1112	c.738G>T	c.(736-738)gaG>gaT	p.E246D	SPATA18_ENST00000419395.2_Missense_Mutation_p.E214D|SPATA18_ENST00000506829.1_3'UTR	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	246					cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)		p.E246E(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TGTCTGCTGAGAAAAGTGCAC	0.453																																					p.E246D		Atlas-SNP	.											SPATA18_ENST00000295213,colon,carcinoma,+2,5	SPATA18	222	5	1	Substitution - coding silent(1)	ovary(1)	c.G738T						PASS	.						79.0	75.0	76.0					4																	52938302		2203	4300	6503	SO:0001583	missense	132671	exon6			TGCTGAGAAAAGT	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.738G>T	4.37:g.52938302G>T	ENSP00000295213:p.Glu246Asp	203.0	0.0	0		203.0	78.0	0.384236	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507772	0.27036	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	T;D	0.88354	0.43;-2.37	4.97	-1.64	0.08318	.	0.047408	0.85682	D	0.000000	D	0.92499	0.7618	M	0.78049	2.395	0.43080	D	0.994736	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.80764	0.994;0.994;0.99	D	0.90626	0.4563	10	0.72032	D	0.01	-26.6162	11.075	0.48025	0.3755:0.0:0.6245:0.0	.	214;246;246	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	D	246;214	ENSP00000295213:E246D;ENSP00000415309:E214D	ENSP00000295213:E246D	E	+	3	2	SPATA18	52633059	1.000000	0.71417	0.464000	0.27143	0.008000	0.06430	0.397000	0.20883	-0.461000	0.06993	-0.355000	0.07637	GAG	.	.	none		0.453	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
EPHA5	2044	hgsc.bcm.edu	37	4	66467586	66467586	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:66467586A>G	ENST00000273854.3	-	3	1283	c.683T>C	c.(682-684)gTa>gCa	p.V228A	EPHA5_ENST00000354839.4_Missense_Mutation_p.V228A|EPHA5_ENST00000432638.2_Missense_Mutation_p.V228A|EPHA5_ENST00000511294.1_Missense_Mutation_p.V228A	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	228	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TTTATAGTATACACGCACAGA	0.453										TSP Lung(17;0.13)																											p.V228A		Atlas-SNP	.											EPHA5,colon,carcinoma,0,1	EPHA5	315	1	0			c.T683C						PASS	.						70.0	67.0	68.0					4																	66467586		2203	4300	6503	SO:0001583	missense	2044	exon3			TAGTATACACGCA	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.683T>C	4.37:g.66467586A>G	ENSP00000273854:p.Val228Ala	102.0	0.0	0		110.0	39.0	0.354545	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	37	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044907	0.75732	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.83	5.83	0.93111	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.56097	D	0.000038	T	0.33118	0.0852	M	0.84326	2.69	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;0.998;0.999	D;D;D;D	0.91635	0.998;0.999;0.997;0.997	T	0.06303	-1.0834	10	0.52906	T	0.07	.	16.1982	0.82046	1.0:0.0:0.0:0.0	.	228;228;228;228	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	A	228	ENSP00000273854:V228A;ENSP00000389208:V228A;ENSP00000346899:V228A;ENSP00000427638:V228A	ENSP00000273854:V228A	V	-	2	0	EPHA5	66150181	1.000000	0.71417	0.997000	0.53966	0.941000	0.58515	9.339000	0.96797	2.226000	0.72624	0.533000	0.62120	GTA	.	.	none		0.453	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
HIST1H2AE	3012	hgsc.bcm.edu	37	6	26217398	26217398	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:26217398C>G	ENST00000303910.2	+	1	234	c.196C>G	c.(196-198)Cta>Gta	p.L66V	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	66						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				GATCTTAGAGCTAGCTGGCAA	0.607																																					p.L66V		Atlas-SNP	.											.	HIST1H2AE	25	.	0			c.C196G						PASS	.						57.0	57.0	57.0					6																	26217398		2203	4300	6503	SO:0001583	missense	3012	exon1			TTAGAGCTAGCTG	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.196C>G	6.37:g.26217398C>G	ENSP00000303373:p.Leu66Val	127.0	0.0	0		124.0	52.0	0.419355	NM_021052	P28001|Q76P63	Missense_Mutation	SNP	ENST00000303910.2	37	CCDS4595.1	.	.	.	.	.	.	.	.	.	.	.	10.95	1.494701	0.26774	.	.	ENSG00000168274	ENST00000303910	T	0.70631	-0.5	4.07	4.07	0.47477	.	0.000000	0.27886	U	0.017441	D	0.84311	0.5444	H	0.95884	3.735	0.38725	D	0.953543	.	.	.	.	.	.	D	0.87649	0.2527	8	0.87932	D	0	.	9.5775	0.39468	0.0:0.9023:0.0:0.0977	.	.	.	.	V	66	ENSP00000303373:L66V	ENSP00000303373:L66V	L	+	1	2	HIST1H2AE	26325377	0.997000	0.39634	1.000000	0.80357	0.029000	0.11900	0.500000	0.22562	2.263000	0.75096	0.650000	0.86243	CTA	.	.	none		0.607	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
MEP1A	4224	hgsc.bcm.edu	37	6	46766884	46766884	+	Silent	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:46766884G>T	ENST00000230588.4	+	5	237	c.228G>T	c.(226-228)acG>acT	p.T76T		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	76	Metalloprotease.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			CCAGGTGGACGTTCCCCATTC	0.438																																					p.T76T		Atlas-SNP	.											.	MEP1A	93	.	0			c.G228T						PASS	.						162.0	152.0	155.0					6																	46766884		2203	4300	6503	SO:0001819	synonymous_variant	4224	exon5			GTGGACGTTCCCC		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.228G>T	6.37:g.46766884G>T		139.0	0.0	0		135.0	43.0	0.318519	NM_005588	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	ENST00000230588.4	37	CCDS4918.1																																																																																			.	.	none		0.438	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040803.1	NM_005588	
OR4D5	219875	hgsc.bcm.edu	37	11	123811056	123811056	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr11:123811056G>A	ENST00000307033.2	+	1	807	c.733G>A	c.(733-735)Gct>Act	p.A245T		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CTCTCACATTGCTGTGGTGAC	0.532																																					p.A245T		Atlas-SNP	.											.	OR4D5	94	.	0			c.G733A						PASS	.						235.0	188.0	204.0					11																	123811056		2202	4299	6501	SO:0001583	missense	219875	exon1			CACATTGCTGTGG	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.733G>A	11.37:g.123811056G>A	ENSP00000305970:p.Ala245Thr	75.0	0.0	0		139.0	35.0	0.251799	NM_001001965	B9EGZ4|Q6IFE6	Missense_Mutation	SNP	ENST00000307033.2	37	CCDS31699.1	.	.	.	.	.	.	.	.	.	.	G	2.022	-0.424500	0.04734	.	.	ENSG00000171014	ENST00000307033	T	0.36520	1.25	4.96	4.03	0.46877	GPCR, rhodopsin-like superfamily (1);	0.437967	0.19315	N	0.117284	T	0.08891	0.0220	N	0.00462	-1.47	0.22521	N	0.999028	B	0.02656	0.0	B	0.06405	0.002	T	0.28586	-1.0039	10	0.02654	T	1	-6.2297	9.8887	0.41276	0.1608:0.0:0.8392:0.0	.	245	Q8NGN0	OR4D5_HUMAN	T	245	ENSP00000305970:A245T	ENSP00000305970:A245T	A	+	1	0	OR4D5	123316266	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	0.241000	0.18065	1.275000	0.44379	0.650000	0.86243	GCT	.	.	none		0.532	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387263.1	NM_001001965	
BCKDHA	593	hgsc.bcm.edu	37	19	41932420	41932420	+	IGR	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:41932420G>A	ENST00000269980.2	+	0	2103				B3GNT8_ENST00000321702.2_Silent_p.S88S|B3GNT8_ENST00000601379.1_Intron|CTC-435M10.6_ENST00000598887.1_RNA	NM_000709.3|NM_001164783.1	NP_000700.1|NP_001158255.1	P12694	ODBA_HUMAN	branched chain keto acid dehydrogenase E1, alpha polypeptide						branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity (GO:0003863)|alpha-ketoacid dehydrogenase activity (GO:0003826)|carboxy-lyase activity (GO:0016831)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	10						CCGTTTCAGTGCTGTCCCCAC	0.682																																					p.S88S		Atlas-SNP	.											.	B3GNT8	20	.	0			c.C264T						PASS	.						11.0	11.0	11.0					19																	41932420		2181	4275	6456	SO:0001628	intergenic_variant	374907	exon3			TTCAGTGCTGTCC	J04474	CCDS12581.1	19q13.1-q13.2	2008-07-09	2005-11-29		ENSG00000248098	ENSG00000248098			986	protein-coding gene	gene with protein product	"""maple syrup urine disease"""	608348	"""branched chain keto acid dehydrogenase E1, alpha polypeptide (maple syrup urine disease)"", ""2-oxoisovalerate dehydrogenase (lipoamide)"""	OVD1A			Standard	NM_000709		Approved	MSU	uc002oqq.3	P12694	OTTHUMG00000168128		19.37:g.41932420G>A		53.0	0.0	0		52.0	13.0	0.25	NM_198540	B4DP47|E7EW46|Q16034|Q16472	Silent	SNP	ENST00000269980.2	37	CCDS12581.1																																																																																			.	.	none		0.682	BCKDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398313.3	NM_000709	
ADAMTS3	9508	hgsc.bcm.edu	37	4	73205310	73205310	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:73205310G>A	ENST00000286657.4	-	5	798	c.762C>T	c.(760-762)aaC>aaT	p.N254N		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	254					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TATTGTAATCGTTTTCTCCCG	0.498																																					p.N254N	NSCLC(168;1941 2048 2918 13048 43078)	Atlas-SNP	.											.	ADAMTS3	164	.	0			c.C762T						PASS	.						284.0	272.0	276.0					4																	73205310		2203	4300	6503	SO:0001819	synonymous_variant	9508	exon5			GTAATCGTTTTCT	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.762C>T	4.37:g.73205310G>A		88.0	0.0	0		108.0	41.0	0.37963	NM_014243	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	37	CCDS3553.1																																																																																			.	.	none		0.498	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
KRT13	3860	hgsc.bcm.edu	37	17	39661359	39661359	+	Silent	SNP	A	A	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:39661359A>G	ENST00000246635.3	-	1	490	c.444T>C	c.(442-444)ccT>ccC	p.P148P	KRT13_ENST00000587118.1_5'Flank|KRT13_ENST00000587544.1_Silent_p.P148P|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000336861.3_Silent_p.P148P	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	148	Linker 1.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				AGTCCCGCTCAGGGCTAGCTG	0.617																																					p.P148P		Atlas-SNP	.											.	KRT13	72	.	0			c.T444C						PASS	.						100.0	92.0	94.0					17																	39661359		2203	4300	6503	SO:0001819	synonymous_variant	3860	exon1			CCGCTCAGGGCTA		CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.444T>C	17.37:g.39661359A>G		75.0	0.0	0		58.0	20.0	0.344828	NM_002274	Q53G54|Q6AZK5|Q8N240	Silent	SNP	ENST00000246635.3	37	CCDS11396.1																																																																																			.	.	none		0.617	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257297.1	NM_153490	
BTG2	7832	hgsc.bcm.edu	37	1	203274847	203274847	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:203274847T>G	ENST00000290551.4	+	1	184	c.113T>G	c.(112-114)tTc>tGc	p.F38C	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	38					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CTTAAGGTCTTCAGCGGGGCG	0.692																																					p.F38C		Atlas-SNP	.											.	BTG2	16	.	0			c.T113G						PASS	.						14.0	15.0	15.0					1																	203274847		2115	4145	6260	SO:0001583	missense	7832	exon1			AGGTCTTCAGCGG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.113T>G	1.37:g.203274847T>G	ENSP00000290551:p.Phe38Cys	119.0	0.0	0		95.0	38.0	0.4	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.936706	0.92458	.	.	ENSG00000159388	ENST00000290551	T	0.42513	0.97	4.65	4.65	0.58169	Anti-proliferative protein (3);	0.000000	0.85682	D	0.000000	T	0.73313	0.3571	H	0.95679	3.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81814	-0.0760	10	0.87932	D	0	-41.2615	13.0222	0.58794	0.0:0.0:0.0:1.0	.	38	P78543	BTG2_HUMAN	C	38	ENSP00000290551:F38C	ENSP00000290551:F38C	F	+	2	0	BTG2	201541470	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.827000	0.75303	1.958000	0.56883	0.386000	0.25728	TTC	.	.	none		0.692	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
BAI3	577	hgsc.bcm.edu	37	6	70042873	70042873	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:70042873T>C	ENST00000370598.1	+	24	3982	c.3161T>C	c.(3160-3162)cTa>cCa	p.L1054P	BAI3_ENST00000238918.8_Missense_Mutation_p.L260P|BAI3_ENST00000546190.1_Missense_Mutation_p.L18P	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1054					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1054R(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GATGGAATCCTAGATAAAAAG	0.373																																					p.L1054P		Atlas-SNP	.											BAI3,NS,carcinoma,+1,2	BAI3	451	2	1	Substitution - Missense(1)	liver(1)	c.T3161C						PASS	.						105.0	105.0	105.0					6																	70042873		2203	4299	6502	SO:0001583	missense	577	exon24			GAATCCTAGATAA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3161T>C	6.37:g.70042873T>C	ENSP00000359630:p.Leu1054Pro	151.0	0.0	0		134.0	41.0	0.30597	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.842563	0.71488	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.40476	1.03;1.03;1.03	5.28	5.28	0.74379	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	T	0.48696	0.1514	L	0.52011	1.625	0.80722	D	1	B;B;D	0.71674	0.098;0.004;0.998	B;B;D	0.66351	0.114;0.01;0.943	T	0.51180	-0.8738	10	0.56958	D	0.05	.	15.5917	0.76534	0.0:0.0:0.0:1.0	.	260;1054;1054	B7Z356;A8K0Y1;O60242	.;.;BAI3_HUMAN	P	1054;260;18	ENSP00000359630:L1054P;ENSP00000238918:L260P;ENSP00000441821:L18P	ENSP00000238918:L260P	L	+	2	0	BAI3	70099594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.147000	0.58078	2.138000	0.66242	0.524000	0.50904	CTA	.	.	none		0.373	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
ANKRD33	341405	hgsc.bcm.edu	37	12	52284586	52284586	+	Missense_Mutation	SNP	C	C	T	rs200291062		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr12:52284586C>T	ENST00000340970.4	+	5	852	c.481C>T	c.(481-483)Cgg>Tgg	p.R161W	ANKRD33_ENST00000538991.1_Missense_Mutation_p.R92W|ANKRD33_ENST00000547119.1_3'UTR|ANKRD33_ENST00000301190.6_Missense_Mutation_p.R286W			Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33	161					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|skeletal muscle cell differentiation (GO:0035914)	cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.0969)		ACTCCTAGAACGGCTGCAGGC	0.662																																					p.R286W		Atlas-SNP	.											.	ANKRD33	33	.	0			c.C856T						PASS	.	C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	25.0	24.0	24.0		481,856	0.1	0.6	12		24	4,8590		0,4,4293	yes	missense,missense	ANKRD33	NM_001130015.1,NM_182608.3	101,101	0,4,6496	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging,probably-damaging	161/273,286/453	52284586	4,12996	2203	4297	6500	SO:0001583	missense	341405	exon5			CTAGAACGGCTGC		CCDS8815.1, CCDS44892.1	12q13.13	2013-01-10	2005-01-07	2005-01-07		ENSG00000167612		"""Ankyrin repeat domain containing"""	13788	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 7"""	C12orf7		20026326	Standard	NM_182608		Approved	DKFZp686O1689, PANKY	uc001rzd.3	Q7Z3H0	OTTHUMG00000169506	ENST00000340970.4:c.481C>T	12.37:g.52284586C>T	ENSP00000344690:p.Arg161Trp	42.0	0.0	0		44.0	19.0	0.431818	NM_182608	Q0VAA7|Q5K619|Q5K621|Q5K622|Q5K623|Q5K624|Q6ZUN0	Missense_Mutation	SNP	ENST00000340970.4	37	CCDS44892.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419121	0.42918	0.0	4.65E-4	ENSG00000167612	ENST00000301190;ENST00000538991;ENST00000340970	T;T;T	0.24908	1.93;1.83;2.28	4.7	0.0507	0.14294	.	0.080339	0.47455	D	0.000234	T	0.39655	0.1086	L	0.55481	1.735	0.21473	N	0.999672	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.74674	0.965;0.984;0.977	T	0.22836	-1.0205	10	0.37606	T	0.19	-7.9632	11.629	0.51162	0.7308:0.2692:0.0:0.0	.	161;92;286	Q7Z3H0;Q0VAA8;Q7Z3H0-2	ANR33_HUMAN;.;.	W	286;92;161	ENSP00000301190:R286W;ENSP00000443722:R92W;ENSP00000344690:R161W	ENSP00000301190:R286W	R	+	1	2	ANKRD33	50570853	0.279000	0.24239	0.605000	0.28930	0.607000	0.37147	0.456000	0.21859	0.192000	0.20272	0.561000	0.74099	CGG	.	.	weak		0.662	ANKRD33-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404515.1	NM_182608	
CPXM2	119587	hgsc.bcm.edu	37	10	125557598	125557598	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr10:125557598C>T	ENST00000241305.3	-	6	937	c.783G>A	c.(781-783)gaG>gaA	p.E261E	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	261	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GGACGGGTAGCTCATTGAGAA	0.473																																					p.E261E		Atlas-SNP	.											.	CPXM2	120	.	0			c.G783A						PASS	.						130.0	111.0	118.0					10																	125557598		2203	4300	6503	SO:0001819	synonymous_variant	119587	exon6			GGGTAGCTCATTG	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.783G>A	10.37:g.125557598C>T		99.0	0.0	0		100.0	29.0	0.29	NM_198148	B4E3Q2	Silent	SNP	ENST00000241305.3	37	CCDS7637.1																																																																																			.	.	none		0.473	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050853.1	NM_198148	
PRDM1	639	hgsc.bcm.edu	37	6	106543518	106543518	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr6:106543518T>A	ENST00000369096.4	+	3	554	c.320T>A	c.(319-321)aTa>aAa	p.I107K	PRDM1_ENST00000369091.2_Missense_Mutation_p.I71K	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	107	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		AAAGAATACATACCAAAGGGC	0.343			"""D, N, Mis, F, S"""		DLBCL																																p.I107K		Atlas-SNP	.		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	.	PRDM1	195	.	0			c.T320A						PASS	.						94.0	89.0	91.0					6																	106543518		2203	4300	6503	SO:0001583	missense	639	exon3			AATACATACCAAA		CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.320T>A	6.37:g.106543518T>A	ENSP00000358092:p.Ile107Lys	123.0	0.0	0		61.0	30.0	0.491803	NM_001198	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	ENST00000369096.4	37	CCDS5054.2	.	.	.	.	.	.	.	.	.	.	T	31	5.093722	0.94149	.	.	ENSG00000057657	ENST00000369091;ENST00000369096;ENST00000456278	D;D	0.89196	-2.48;-2.48	6.06	6.06	0.98353	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.95671	0.8592	H	0.94582	3.555	0.80722	D	1	D	0.61697	0.99	D	0.69824	0.966	D	0.96716	0.9529	10	0.87932	D	0	-24.395	16.6093	0.84858	0.0:0.0:0.0:1.0	.	107	O75626	PRDM1_HUMAN	K	71;107;71	ENSP00000358087:I71K;ENSP00000358092:I107K	ENSP00000358087:I71K	I	+	2	0	PRDM1	106650211	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.040000	0.89188	2.324000	0.78689	0.533000	0.62120	ATA	.	.	none		0.343	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041661.3		
PFN1	5216	hgsc.bcm.edu	37	17	4851557	4851557	+	Splice_Site	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr17:4851557C>T	ENST00000225655.5	-	1	752		c.e1+1		ENO3_ENST00000519584.1_5'Flank|ENO3_ENST00000323997.6_5'Flank|PFN1_ENST00000574872.1_5'Flank	NM_005022.3	NP_005013.1	P07737	PROF1_HUMAN	profilin 1						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cell death (GO:0008219)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of ruffle assembly (GO:1900029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|proline-rich region binding (GO:0070064)			NS(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5						CCTCGCAGTACCGTGATGTTG	0.706																																					.		Atlas-SNP	.											.	PFN1	6	.	0			c.132+1G>A						PASS	.						50.0	46.0	48.0					17																	4851557		2203	4300	6503	SO:0001630	splice_region_variant	5216	exon2			GCAGTACCGTGAT	BC057828	CCDS11061.1	17p13.2	2010-07-09			ENSG00000108518	ENSG00000108518			8881	protein-coding gene	gene with protein product		176610				3356709, 1968707	Standard	NM_005022		Approved		uc002gaa.4	P07737	OTTHUMG00000099396	ENST00000225655.5:c.132+1G>A	17.37:g.4851557C>T		34.0	0.0	0		23.0	10.0	0.434783	NM_005022	Q53Y44	Splice_Site	SNP	ENST00000225655.5	37	CCDS11061.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986323	0.74589	.	.	ENSG00000108518	ENST00000225655	.	.	.	3.79	3.79	0.43588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1965	0.59740	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PFN1	4792302	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.338000	0.59316	1.953000	0.56701	0.563000	0.77884	.	.	.	none		0.706	PFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216853.1	NM_005022	Intron
AMBN	258	hgsc.bcm.edu	37	4	71468348	71468348	+	Missense_Mutation	SNP	G	G	T	rs368655454|rs141384720|rs199556863	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr4:71468348G>T	ENST00000322937.6	+	7	642	c.539G>T	c.(538-540)gGa>gTa	p.G180V	AMBN_ENST00000449493.2_Missense_Mutation_p.G165V	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	180				G -> R (in Ref. 3; AAG35772 and 4; AAG27036). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			TAGCTCCCAGGAGTAGATTTT	0.264																																					p.G180V		Atlas-SNP	.											.	AMBN	73	.	0			c.G539T						PASS	.						42.0	49.0	47.0					4																	71468348		2161	4276	6437	SO:0001583	missense	258	exon7			TCCCAGGAGTAGA	AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.539G>T	4.37:g.71468348G>T	ENSP00000313809:p.Gly180Val	303.0	0.0	0		381.0	17.0	0.0446194	NM_016519	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.097|0.097	-1.157535|-1.157535	0.01686|0.01686	.|.	.|.	ENSG00000178522|ENSG00000178522	ENST00000322937;ENST00000449493|ENST00000538728	T;T|.	0.27890|.	1.64;1.64|.	3.34|3.34	-2.84|-2.84	0.05751|0.05751	.|.	2.543920|.	0.02234|.	U|.	0.065161|.	T|T	0.18002|0.18002	0.0432|0.0432	N|N	0.22421|0.22421	0.69|0.69	0.19575|0.19575	N|N	0.999964|0.999964	B|.	0.17268|.	0.021|.	B|.	0.12837|.	0.008|.	T|T	0.24190|0.24190	-1.0167|-1.0167	10|6	0.22706|0.29301	T|T	0.39|0.29	.|.	0.3396|0.3396	0.00331|0.00331	0.3712:0.1546:0.2472:0.227|0.3712:0.1546:0.2472:0.227	.|.	180|.	Q9NP70|.	AMBN_HUMAN|.	V|L	180;165|179	ENSP00000313809:G180V;ENSP00000391234:G165V|.	ENSP00000313809:G180V|ENSP00000445605:R179L	G|R	+|+	2|2	0|0	AMBN|AMBN	71502937|71502937	0.095000|0.095000	0.21747|0.21747	0.002000|0.002000	0.10522|0.10522	0.194000|0.194000	0.23727|0.23727	-0.066000|-0.066000	0.11598|0.11598	-0.545000|-0.545000	0.06224|0.06224	0.305000|0.305000	0.20034|0.20034	GGA|CGA	.	.	weak		0.264	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519	
ABCA7	10347	hgsc.bcm.edu	37	19	1046827	1046827	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:1046827T>C	ENST00000263094.6	+	14	1880	c.1649T>C	c.(1648-1650)cTg>cCg	p.L550P	ABCA7_ENST00000433129.1_Missense_Mutation_p.L550P|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000435683.2_Missense_Mutation_p.L412P	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	550					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCGGTCGCTGCCGCTCTTC	0.697																																					p.L550P		Atlas-SNP	.											.	ABCA7	174	.	0			c.T1649C						PASS	.						18.0	16.0	17.0					19																	1046827		2119	4178	6297	SO:0001583	missense	10347	exon14			GGTCGCTGCCGCT	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1649T>C	19.37:g.1046827T>C	ENSP00000263094:p.Leu550Pro	23.0	0.0	0		23.0	6.0	0.26087	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	t	24.2	4.506096	0.85282	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.89270	-2.49;-2.49	5.06	5.06	0.68205	.	.	.	.	.	D	0.94988	0.8378	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.992	D	0.95706	0.8753	9	0.87932	D	0	.	12.7496	0.57300	0.0:0.0:0.0:1.0	.	412;550	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	P	550	ENSP00000263094:L550P;ENSP00000414062:L550P	ENSP00000263094:L550P	L	+	2	0	ABCA7	997827	1.000000	0.71417	0.999000	0.59377	0.857000	0.48899	7.824000	0.86668	1.915000	0.55452	0.454000	0.30748	CTG	.	.	none		0.697	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
SEMA3C	10512	hgsc.bcm.edu	37	7	80433481	80433481	+	Missense_Mutation	SNP	G	G	T	rs143347984		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:80433481G>T	ENST00000265361.3	-	8	1303	c.742C>A	c.(742-744)Ctg>Atg	p.L248M	SEMA3C_ENST00000419255.2_Missense_Mutation_p.L248M|SEMA3C_ENST00000536800.1_Missense_Mutation_p.L100M|SEMA3C_ENST00000544525.1_Missense_Mutation_p.L266M	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	248	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTGTCAGTCAGTTTTTCTTTG	0.368																																					p.L248M		Atlas-SNP	.											.	SEMA3C	106	.	0			c.C742A						PASS	.	G	MET/LEU	0,4406		0,0,2203	160.0	150.0	153.0		742	3.7	1.0	7	dbSNP_134	153	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEMA3C	NM_006379.3	15	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign	248/752	80433481	1,13005	2203	4300	6503	SO:0001583	missense	10512	exon8			CAGTCAGTTTTTC	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.742C>A	7.37:g.80433481G>T	ENSP00000265361:p.Leu248Met	93.0	0.0	0		147.0	48.0	0.326531	NM_006379	B4DRL8	Missense_Mutation	SNP	ENST00000265361.3	37	CCDS5596.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437638	0.43224	0.0	1.16E-4	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525;ENST00000536800	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.62	3.68	0.42216	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.064498	0.64402	D	0.000005	T	0.11452	0.0279	L	0.51422	1.61	0.52099	D	0.999948	B;B;B	0.16396	0.017;0.008;0.01	B;B;B	0.25614	0.016;0.037;0.062	T	0.05533	-1.0879	10	0.72032	D	0.01	.	7.7762	0.29039	0.1417:0.0:0.7252:0.1332	.	100;266;248	B4DRL8;F5H1Z7;Q99985	.;.;SEM3C_HUMAN	M	248;248;266;100	ENSP00000265361:L248M;ENSP00000411193:L248M;ENSP00000445649:L266M;ENSP00000438258:L100M	ENSP00000265361:L248M	L	-	1	2	SEMA3C	80271417	1.000000	0.71417	0.999000	0.59377	0.861000	0.49209	3.527000	0.53517	1.334000	0.45468	0.585000	0.79938	CTG	G|1.000;T|0.000	0.000	weak		0.368	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253279.1	NM_006379	
SOX17	64321	hgsc.bcm.edu	37	8	55372347	55372347	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:55372347C>T	ENST00000297316.4	+	2	1241	c.1037C>T	c.(1036-1038)aCg>aTg	p.T346M		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	346	Gln/Pro-rich.|Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CGGGACGGCACGGACCCCAGT	0.692																																					p.T346M		Atlas-SNP	.											.	SOX17	37	.	0			c.C1037T						PASS	.						17.0	20.0	19.0					8																	55372347		2201	4297	6498	SO:0001583	missense	64321	exon2			ACGGCACGGACCC	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.1037C>T	8.37:g.55372347C>T	ENSP00000297316:p.Thr346Met	32.0	0.0	0		18.0	9.0	0.5	NM_022454		Missense_Mutation	SNP	ENST00000297316.4	37	CCDS6159.1	.	.	.	.	.	.	.	.	.	.	C	12.98	2.100586	0.37048	.	.	ENSG00000164736	ENST00000297316	T	0.75938	-0.98	4.72	1.31	0.21738	.	0.746294	0.12225	N	0.487973	T	0.52240	0.1722	N	0.14661	0.345	0.27685	N	0.946303	B	0.18310	0.027	B	0.14023	0.01	T	0.41645	-0.9497	10	0.44086	T	0.13	.	3.8408	0.08914	0.0:0.4588:0.2057:0.3356	.	346	Q9H6I2	SOX17_HUMAN	M	346	ENSP00000297316:T346M	ENSP00000297316:T346M	T	+	2	0	SOX17	55534900	0.971000	0.33674	0.666000	0.29783	0.578000	0.36192	1.665000	0.37449	0.392000	0.25172	0.455000	0.32223	ACG	.	.	none		0.692	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378526.2		
TPO	7173	hgsc.bcm.edu	37	2	1459995	1459995	+	Missense_Mutation	SNP	G	G	A	rs371917329		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:1459995G>A	ENST00000345913.4	+	7	851	c.760G>A	c.(760-762)Ggg>Agg	p.G254R	TPO_ENST00000329066.4_Missense_Mutation_p.G254R|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Missense_Mutation_p.G254R|TPO_ENST00000382201.3_Missense_Mutation_p.G254R|TPO_ENST00000346956.3_Missense_Mutation_p.G254R|TPO_ENST00000382198.1_Missense_Mutation_p.G254R|TPO_ENST00000337415.3_Missense_Mutation_p.G254R	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	254					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	AGCTGCCTTCGGGGGAGGGGC	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21539	0.0		0.0	False		,,,				2504	0.0				p.G254R		Atlas-SNP	.											TPO,NS,carcinoma,-2,1	TPO	224	1	0			c.G760A						PASS	.	G	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	80.0	71.0	74.0		760,760,760,760,760,760	-8.7	0.0	2		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	125,125,125,125,125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign	254/934,254/934,254/877,254/877,254/890,254/761	1459995	1,13005	2203	4300	6503	SO:0001583	missense	7173	exon7			GCCTTCGGGGGAG		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.760G>A	2.37:g.1459995G>A	ENSP00000318820:p.Gly254Arg	129.0	0.0	0		96.0	36.0	0.375	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.202813	0.01581	0.0	1.16E-4	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.68025	-0.26;-0.27;-0.23;0.0;-0.27;-0.2;0.0;-0.3	4.81	-8.66	0.00866	.	1.631860	0.02746	N	0.116912	T	0.40473	0.1118	N	0.21142	0.635	0.09310	N	1	B;B;B;B	0.19073	0.011;0.008;0.027;0.033	B;B;B;B	0.14578	0.006;0.002;0.006;0.011	T	0.26950	-1.0088	10	0.15952	T	0.53	-0.1794	0.5679	0.00690	0.2306:0.1941:0.2969:0.2783	.	254;254;254;254	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	R	254;254;254;254;254;254;254;183	ENSP00000337263:G254R;ENSP00000318820:G254R;ENSP00000263886:G254R;ENSP00000332044:G254R;ENSP00000329869:G254R;ENSP00000371636:G254R;ENSP00000371633:G254R;ENSP00000405788:G183R	ENSP00000329869:G254R	G	+	1	0	TPO	1439002	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.061000	0.03472	-1.603000	0.01597	-1.571000	0.00872	GGG	.	.	weak		0.473	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
CES5A	221223	hgsc.bcm.edu	37	16	55890347	55890347	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr16:55890347G>A	ENST00000290567.9	-	9	1188	c.1067C>T	c.(1066-1068)cCt>cTt	p.P356L	CES5A_ENST00000521992.1_Missense_Mutation_p.P385L|CES5A_ENST00000541580.1_5'UTR|CES5A_ENST00000319165.9_Missense_Mutation_p.P356L|CES5A_ENST00000518005.1_Missense_Mutation_p.P250L|CES5A_ENST00000520435.1_Missense_Mutation_p.P326L	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	356						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						GAGGATCTCAGGAGCCTCCTT	0.547																																					p.P385L		Atlas-SNP	.											.	CES5A	206	.	0			c.C1154T						PASS	.						135.0	115.0	122.0					16																	55890347		2198	4300	6498	SO:0001583	missense	221223	exon10			ATCTCAGGAGCCT	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.1067C>T	16.37:g.55890347G>A	ENSP00000290567:p.Pro356Leu	48.0	0.0	0		60.0	42.0	0.7	NM_001190158	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	G	4.176	0.031232	0.08101	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000518005;ENST00000290567;ENST00000520435;ENST00000541580	T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19	3.18	3.18	0.36537	Carboxylesterase, type B (1);	0.794542	0.10319	N	0.688955	T	0.51669	0.1688	L	0.33753	1.03	0.30761	N	0.744061	B;B	0.32245	0.1;0.361	B;B	0.34242	0.066;0.178	T	0.54794	-0.8240	10	0.42905	T	0.14	.	10.1997	0.43075	0.0:0.0:1.0:0.0	.	356;356	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	L	385;356;250;356;326;136	ENSP00000428864:P385L;ENSP00000324271:P356L;ENSP00000428571:P250L;ENSP00000290567:P356L;ENSP00000428887:P326L	ENSP00000290567:P356L	P	-	2	0	CES5A	54447848	0.998000	0.40836	0.399000	0.26333	0.068000	0.16541	3.777000	0.55364	2.100000	0.63781	0.449000	0.29647	CCT	.	.	none		0.547	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
INTS3	65123	hgsc.bcm.edu	37	1	153719461	153719461	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr1:153719461G>A	ENST00000318967.2	+	4	915	c.347G>A	c.(346-348)cGt>cAt	p.R116H	INTS3_ENST00000456435.1_5'UTR|RP11-216N14.8_ENST00000453778.1_RNA|INTS3_ENST00000435409.2_Missense_Mutation_p.R116H	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	116					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CTGGTGAGTCGTGATGGCATG	0.488																																					p.R116H		Atlas-SNP	.											.	INTS3	83	.	0			c.G347A						PASS	.						109.0	108.0	108.0					1																	153719461		2203	4300	6503	SO:0001583	missense	65123	exon4			TGAGTCGTGATGG	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.347G>A	1.37:g.153719461G>A	ENSP00000318641:p.Arg116His	105.0	0.0	0		100.0	34.0	0.34	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	37	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	33	5.246806	0.95305	.	.	ENSG00000143624	ENST00000318967;ENST00000435409	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.70500	0.3231	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.72235	-0.4352	9	0.59425	D	0.04	.	15.856	0.78977	0.0:0.0:1.0:0.0	.	116	Q68E01-2	.	H	116	.	ENSP00000318641:R116H	R	+	2	0	INTS3	151986085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.867000	0.92314	2.608000	0.88229	0.561000	0.74099	CGT	.	.	none		0.488	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
LGMN	5641	hgsc.bcm.edu	37	14	93171022	93171022	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:93171022G>A	ENST00000393218.2	-	14	1559	c.1222C>T	c.(1222-1224)Ctg>Ttg	p.L408L	LGMN_ENST00000555699.1_Intron|LGMN_ENST00000557434.1_Silent_p.L351L|LGMN_ENST00000334869.4_Silent_p.L408L	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	408					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		AGGTTGACCAGCACGTACAAA	0.468																																					p.L408L		Atlas-SNP	.											.	LGMN	28	.	0			c.C1222T						PASS	.						183.0	172.0	175.0					14																	93171022		2203	4300	6503	SO:0001819	synonymous_variant	5641	exon13			TGACCAGCACGTA	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.1222C>T	14.37:g.93171022G>A		119.0	0.0	0		125.0	8.0	0.064	NM_005606	O00123|Q86TV2|Q86TV3|Q9BTY1	Silent	SNP	ENST00000393218.2	37	CCDS9904.1																																																																																			.	.	none		0.468	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412288.1	NM_005606	
OPRK1	4986	hgsc.bcm.edu	37	8	54142312	54142312	+	Missense_Mutation	SNP	C	C	T	rs186551684		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:54142312C>T	ENST00000265572.3	-	4	985	c.688G>A	c.(688-690)Gtc>Atc	p.V230I	OPRK1_ENST00000524278.1_Missense_Mutation_p.V141I|RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Missense_Mutation_p.V230I	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	230					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	AAGATGAAGACGCAGATCTTC	0.527													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19957	0.0		0.0	False		,,,				2504	0.0				p.V230I		Atlas-SNP	.											OPRK1,colon,carcinoma,0,1	OPRK1	90	1	0			c.G688A						PASS	.	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	76.0	82.0	80.0		688	5.7	1.0	8		80	0,8600		0,0,4300	no	missense	OPRK1	NM_000912.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	230/381	54142312	1,13005	2203	4300	6503	SO:0001583	missense	4986	exon4			TGAAGACGCAGAT		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.688G>A	8.37:g.54142312C>T	ENSP00000265572:p.Val230Ile	125.0	0.0	0		122.0	41.0	0.336066	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	37	CCDS6152.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	21.7	4.189259	0.78789	2.27E-4	0.0	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.71817	-0.6;-0.6;-0.6	5.7	5.7	0.88788	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76681	0.4021	L	0.31664	0.95	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.75572	-0.3271	10	0.41790	T	0.15	.	19.8351	0.96655	0.0:1.0:0.0:0.0	.	230	P41145	OPRK_HUMAN	I	230;141;230;216	ENSP00000265572:V230I;ENSP00000430923:V141I;ENSP00000429706:V230I	ENSP00000265572:V230I	V	-	1	0	OPRK1	54304865	1.000000	0.71417	0.973000	0.42090	0.620000	0.37586	7.818000	0.86416	2.693000	0.91896	0.650000	0.86243	GTC	C|1.000;T|0.000	0.000	strong		0.527	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
SLC38A6	145389	hgsc.bcm.edu	37	14	61550378	61550378	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr14:61550378G>A	ENST00000354886.2	+	17	1678	c.1514G>A	c.(1513-1515)cGt>cAt	p.R505H	SLC38A6_ENST00000456840.2_Missense_Mutation_p.V484M	NM_001172702.1	NP_001166173.1	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	0					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		agaaccaaacgtgtccacacc	0.478																																					p.R505H		Atlas-SNP	.											.	SLC38A6	87	.	0			c.G1514A						PASS	.																																			SO:0001583	missense	145389	exon17			CCAAACGTGTCCA	AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335	ENST00000354886.2:c.1514G>A	14.37:g.61550378G>A	ENSP00000346959:p.Arg505His	47.0	0.0	0		24.0	15.0	0.625	NM_001172702	C9JWA6|Q86SY5	Missense_Mutation	SNP	ENST00000354886.2	37	CCDS53900.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.89|14.89	2.670972|2.670972	0.47781|0.47781	.|.	.|.	ENSG00000139974|ENSG00000139974	ENST00000354886;ENST00000451406|ENST00000456840	T;T|T	0.06294|0.06608	3.32;3.32|3.28	2.8|2.8	-0.176|-0.176	0.13311|0.13311	.|.	.|.	.|.	.|.	.|.	T|T	0.04137|0.04137	0.0115|0.0115	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.44298|0.44298	-0.9337|-0.9337	8|8	0.87932|0.56958	D|D	0|0.05	.|.	0.479|0.479	0.00544|0.00544	0.2013:0.35:0.1969:0.2518|0.2013:0.35:0.1969:0.2518	.|.	505|484	Q8IZM9-2|E7ETF2	.|.	H|M	505;500|484	ENSP00000346959:R505H;ENSP00000395851:R500H|ENSP00000413863:V484M	ENSP00000346959:R505H|ENSP00000413863:V484M	R|V	+|+	2|1	0|0	SLC38A6|SLC38A6	60620131|60620131	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.119000|-0.119000	0.10676|0.10676	-0.303000|-0.303000	0.08856|0.08856	-1.816000|-1.816000	0.00601|0.00601	CGT|GTG	.	.	none		0.478	SLC38A6-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
MGAM	8972	hgsc.bcm.edu	37	7	141756637	141756637	+	Silent	SNP	G	G	A	rs181422456	byFrequency	TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr7:141756637G>A	ENST00000549489.2	+	30	3683	c.3588G>A	c.(3586-3588)acG>acA	p.T1196T	MGAM_ENST00000475668.2_Silent_p.T1196T	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1196	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CAGATGTGACGTTCCAGCCCC	0.522													g|||	3	0.000599042	0.0008	0.0029	5008	,	,		14732	0.0		0.0	False		,,,				2504	0.0				p.T1196T		Atlas-SNP	.											.	MGAM	767	.	0			c.G3588A						PASS	.						78.0	77.0	77.0					7																	141756637		1990	4160	6150	SO:0001819	synonymous_variant	8972	exon30			TGTGACGTTCCAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3588G>A	7.37:g.141756637G>A		58.0	0.0	0		69.0	15.0	0.217391	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	37	CCDS47727.1																																																																																			G|1.000;A|0.000	0.000	strong		0.522	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
PLEK	5341	hgsc.bcm.edu	37	2	68592512	68592512	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:68592512A>T	ENST00000234313.7	+	1	208	c.29A>T	c.(28-30)tAc>tTc	p.Y10F	AC015969.3_ENST00000366218.2_RNA	NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	10	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		AGAGAGGGCTACCTTGTGAAG	0.577																																					p.Y10F		Atlas-SNP	.											.	PLEK	64	.	0			c.A29T						PASS	.						136.0	114.0	122.0					2																	68592512		2203	4300	6503	SO:0001583	missense	5341	exon1			AGGGCTACCTTGT	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.29A>T	2.37:g.68592512A>T	ENSP00000234313:p.Tyr10Phe	77.0	0.0	0		91.0	25.0	0.274725	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	ENST00000234313.7	37	CCDS1887.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.454506	0.26161	.	.	ENSG00000115956	ENST00000234313	T	0.14640	2.49	5.85	5.85	0.93711	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	L	0.52573	1.65	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.12837	0.008;0.003	T	0.08046	-1.0741	10	0.19590	T	0.45	.	12.6189	0.56592	1.0:0.0:0.0:0.0	.	28;10	Q59GZ2;P08567	.;PLEK_HUMAN	F	10	ENSP00000234313:Y10F	ENSP00000234313:Y10F	Y	+	2	0	PLEK	68446016	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.687000	0.61708	2.234000	0.73211	0.460000	0.39030	TAC	.	.	none		0.577	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
HOXD11	3237	hgsc.bcm.edu	37	2	176972104	176972104	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:176972104C>T	ENST00000249504.5	+	1	91	c.21C>T	c.(19-21)tgC>tgT	p.C7C	HOXD11_ENST00000498438.1_Intron|AC009336.1_ENST00000401374.2_RNA	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11	7					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		TTGACGAGTGCGGCCAGAGCG	0.642			T	NUP98	AML																																p.C7C		Atlas-SNP	.		Dom	yes		2	2q31-q32	3237	homeo box D11		L	.	HOXD11	26	.	0			c.C21T						PASS	.						22.0	19.0	20.0					2																	176972104		2190	4275	6465	SO:0001819	synonymous_variant	3237	exon1			CGAGTGCGGCCAG		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.21C>T	2.37:g.176972104C>T		100.0	0.0	0		124.0	34.0	0.274194	NM_021192	A6NIS4|Q9NS02	Silent	SNP	ENST00000249504.5	37	CCDS2265.1																																																																																			.	.	none		0.642	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359250.2		
ZFHX4	79776	hgsc.bcm.edu	37	8	77690572	77690572	+	Silent	SNP	T	T	C			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr8:77690572T>C	ENST00000521891.2	+	4	3670	c.3222T>C	c.(3220-3222)acT>acC	p.T1074T	ZFHX4_ENST00000050961.6_Silent_p.T1048T|ZFHX4_ENST00000517683.1_3'UTR|ZFHX4_ENST00000455469.2_Silent_p.T1048T|ZFHX4_ENST00000518282.1_Silent_p.T1048T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1048					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATCAGCAGACTGAGGGCCTAC	0.507										HNSCC(33;0.089)																											p.T1074T		Atlas-SNP	.											.	ZFHX4	878	.	0			c.T3222C						PASS	.						148.0	158.0	154.0					8																	77690572		2068	4205	6273	SO:0001819	synonymous_variant	79776	exon4			GCAGACTGAGGGC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3222T>C	8.37:g.77690572T>C		74.0	0.0	0		80.0	29.0	0.3625	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																			.	.	none		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
NWD1	284434	hgsc.bcm.edu	37	19	16860860	16860860	+	Silent	SNP	C	C	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:16860860C>T	ENST00000552788.1	+	4	1407	c.1407C>T	c.(1405-1407)tgC>tgT	p.C469C	NWD1_ENST00000549814.1_Silent_p.C469C|NWD1_ENST00000339803.6_Silent_p.C334C|NWD1_ENST00000379808.3_Silent_p.C469C|NWD1_ENST00000524140.2_Silent_p.C469C|NWD1_ENST00000523826.1_Silent_p.C263C			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	469	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TCTCAGCTTGCTCGGGGGCAC	0.637																																					p.C469C		Atlas-SNP	.											NWD1_ENST00000524140,NS,neuroblastoma,+2,2	NWD1	303	2	0			c.C1407T						PASS	.						65.0	68.0	67.0					19																	16860860		2203	4300	6503	SO:0001819	synonymous_variant	284434	exon6			AGCTTGCTCGGGG	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1407C>T	19.37:g.16860860C>T		84.0	0.0	0		82.0	22.0	0.268293	NM_001007525	C9J021|Q68CT3	Silent	SNP	ENST00000552788.1	37																																																																																				.	.	none		0.637	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
CHRNA3	1136	hgsc.bcm.edu	37	15	78894447	78894447	+	Silent	SNP	G	G	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr15:78894447G>A	ENST00000326828.5	-	5	921	c.537C>T	c.(535-537)tcC>tcT	p.S179S	CHRNA3_ENST00000348639.3_Silent_p.S179S	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	179					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	CGTAGGACCAGGAACCGAACT	0.502																																					p.S179S		Atlas-SNP	.											.	CHRNA3	56	.	0			c.C537T						PASS	.						187.0	169.0	175.0					15																	78894447		2196	4293	6489	SO:0001819	synonymous_variant	1136	exon5			GGACCAGGAACCG		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.537C>T	15.37:g.78894447G>A		123.0	0.0	0		107.0	38.0	0.35514	NM_000743	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Silent	SNP	ENST00000326828.5	37	CCDS10305.1																																																																																			.	.	none		0.502	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		84.0	0.0	0		88.0	6.0	0.0681818	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
DPM1	8813	hgsc.bcm.edu	37	20	49575719	49575719	+	5'Flank	SNP	T	T	A			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:49575719T>A	ENST00000371588.5	-	0	0				MOCS3_ENST00000244051.1_Missense_Mutation_p.Y114N|DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000466152.1_5'Flank|DPM1_ENST00000371582.4_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						CCTTGTGGACTATGACGTGGT	0.692																																					p.Y114N		Atlas-SNP	.											.	MOCS3	44	.	0			c.T340A						PASS	.						46.0	56.0	53.0					20																	49575719		2192	4285	6477	SO:0001631	upstream_gene_variant	27304	exon1			GTGGACTATGACG	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575719T>A	Exception_encountered	62.0	0.0	0		51.0	17.0	0.333333	NM_014484	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.975590	0.74360	.	.	ENSG00000124217	ENST00000244051	T	0.28069	1.63	6.08	2.51	0.30379	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.272984	0.37955	N	0.001868	T	0.27731	0.0682	L	0.37561	1.115	0.50039	D	0.99984	P	0.42409	0.779	P	0.49683	0.619	T	0.04360	-1.0957	9	.	.	.	-10.1451	4.0058	0.09600	0.0:0.4057:0.2107:0.3836	.	114	O95396	MOCS3_HUMAN	N	114	ENSP00000244051:Y114N	.	Y	+	1	0	MOCS3	49009126	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.110000	0.41873	0.550000	0.28991	0.533000	0.62120	TAT	.	.	none		0.692	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079716.1	NM_003859	
MYT1	4661	hgsc.bcm.edu	37	20	62839368	62839368	+	Missense_Mutation	SNP	G	G	T	rs369047925		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr20:62839368G>T	ENST00000328439.1	+	7	1183	c.819G>T	c.(817-819)gaG>gaT	p.E273D	MYT1_ENST00000536311.1_Missense_Mutation_p.E273D|MYT1_ENST00000360149.4_Intron	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E273D(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					aggaggaggaggatgaagaag	0.572																																					p.E273D	GBM(59;481 1041 20555 21139 33705)	Atlas-SNP	.											MYT1,NS,carcinoma,0,1	MYT1	152	1	1	Substitution - Missense(1)	endometrium(1)	c.G819T						scavenged	.						21.0	21.0	21.0					20																	62839368		2203	4299	6502	SO:0001583	missense	4661	exon7			GGAGGAGGATGAA	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.819G>T	20.37:g.62839368G>T	ENSP00000327465:p.Glu273Asp	28.0	0.0	0		22.0	4.0	0.181818	NM_004535	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000328439.1	37	CCDS13558.1	.	.	.	.	.	.	.	.	.	.	g	6.948	0.544734	0.13312	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.74526	-0.85;-0.85	4.12	-4.11	0.03928	.	0.319667	0.24102	N	0.041536	T	0.40272	0.1110	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.03761	-1.1006	10	0.17832	T	0.49	.	1.4958	0.02466	0.2938:0.235:0.3514:0.1198	.	273	Q01538	MYT1_HUMAN	D	273	ENSP00000327465:E273D;ENSP00000442412:E273D	ENSP00000327465:E273D	E	+	3	2	MYT1	62309812	0.048000	0.20356	0.073000	0.20177	0.034000	0.12701	-1.232000	0.02936	-0.392000	0.07751	-0.260000	0.10688	GAG	.	.	alt		0.572	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080297.1	NM_004535	
KIAA2018	205717	hgsc.bcm.edu	37	3	113376116	113376116	+	Silent	SNP	C	C	T	rs112313093|rs59601191		TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr3:113376116C>T	ENST00000478658.1	-	5	4430	c.4413G>A	c.(4411-4413)caG>caA	p.Q1471Q	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Silent_p.Q1471Q			Q68DE3	K2018_HUMAN	KIAA2018	1471	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						gctgttgctgctgctgctgct	0.498																																					p.Q1471Q		Atlas-SNP	.											.	KIAA2018	180	.	0			c.G4413A						PASS	.						63.0	72.0	69.0					3																	113376116		2187	4278	6465	SO:0001819	synonymous_variant	205717	exon7			TTGCTGCTGCTGC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4413G>A	3.37:g.113376116C>T		36.0	0.0	0		28.0	10.0	0.357143	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	37	CCDS43133.1																																																																																			.	.	none		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
CD79A	973	hgsc.bcm.edu	37	19	42384803	42384803	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-A4XK-01A-11D-A31X-10	TCGA-FA-A4XK-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1c24a152-3311-444f-bda2-4612303ddc50	cbaae798-7a40-44d1-b164-ebf0f6a2b8fa	g.chr19:42384803G>T	ENST00000221972.3	+	4	750	c.565G>T	c.(565-567)Gaa>Taa	p.E189*	ARHGEF1_ENST00000354532.3_5'Flank|CD79A_ENST00000444740.2_Nonsense_Mutation_p.E151*|ARHGEF1_ENST00000347545.4_5'Flank|ARHGEF1_ENST00000599846.1_5'Flank	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	189	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.			E -> G (in Ref. 10; BAD97091). {ECO:0000305}.	B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						AAACCTTTATGAAGTGAGTGA	0.597			"""O, S"""		DLBCL																																p.E189X		Atlas-SNP	.		Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	.	CD79A	25	.	0			c.G565T						PASS	.						17.0	17.0	17.0					19																	42384803		2059	4062	6121	SO:0001587	stop_gained	973	exon4			CTTTATGAAGTGA	M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.565G>T	19.37:g.42384803G>T	ENSP00000221972:p.Glu189*	78.0	0.0	0		51.0	20.0	0.392157	NM_001783	A0N775|Q53FB8	Nonsense_Mutation	SNP	ENST00000221972.3	37	CCDS12589.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752565	0.49362	.	.	ENSG00000105369	ENST00000221972;ENST00000444740	.	.	.	3.89	3.89	0.44902	.	0.222714	0.28125	N	0.016501	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-31.5868	12.151	0.54050	0.0:0.0:1.0:0.0	.	.	.	.	X	189;151	.	ENSP00000221972:E189X	E	+	1	0	CD79A	47076643	1.000000	0.71417	0.983000	0.44433	0.048000	0.14542	4.749000	0.62155	2.135000	0.66039	0.449000	0.29647	GAA	.	.	none		0.597	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463058.1		
