#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GPR25	2848	hgsc.bcm.edu	37	1	200843152	200843178	+	In_Frame_Del	DEL	GGCGCGAAGGATCAGCTCAGCCTCCTC	GGCGCGAAGGATCAGCTCAGCCTCCTC	-	rs367604641		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	GGCGCGAAGGATCAGCTCAGCCTCCTC	GGCGCGAAGGATCAGCTCAGCCTCCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:200843152_200843178delGGCGCGAAGGATCAGCTCAGCCTCCTC	ENST00000304244.2	+	1	1070_1096	c.987_1013delGGCGCGAAGGATCAGCTCAGCCTCCTC	c.(985-1014)ctggcgcgaaggatcagctcagcctcctcg>ctg	p.ARRISSASS330del		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	330					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						CCGGCCGCCTGGCGCGAAGGATCAGCTCAGCCTCCTCGCTCTCCAGG	0.718																																					p.329_338del		Atlas-Indel	.											.	GPR25	23	.	0			c.986_1012del						PASS	.																																			SO:0001651	inframe_deletion	2848	exon1			.	U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.987_1013delGGCGCGAAGGATCAGCTCAGCCTCCTC	1.37:g.200843152_200843178delGGCGCGAAGGATCAGCTCAGCCTCCTC	ENSP00000301917:p.Ala330_Ser338del	100.0	0.0	0		99.0	15.0	0.151515	NM_005298	A0AVJ5	In_Frame_Del	DEL	ENST00000304244.2	37	CCDS1405.1																																																																																			.	.	none		0.718	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087056.1	NM_005298	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056512	26056513	+	Frame_Shift_Ins	INS	-	-	CA	rs201575715		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26056512_26056513insCA	ENST00000343677.2	-	1	186_187	c.144_145insTG	c.(142-147)gtggccfs	p.A49fs		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	49	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TTAGAGGCGGCCACAGCCTTGG	0.569																																					p.A49fs		Atlas-Indel	.											.	HIST1H1C	80	.	0			c.145_146insTG						PASS	.																																			SO:0001589	frameshift_variant	3006	exon1			.	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.143_144dupTG	6.37:g.26056515_26056516dupCA	ENSP00000339566:p.Ala49fs	76.0	0.0	0		73.0	12.0	0.164384	NM_005319	A8K4I2	Frame_Shift_Ins	INS	ENST00000343677.2	37	CCDS4577.1																																																																																			.	.	none		0.569	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
CUBN	8029	hgsc.bcm.edu	37	10	16883024	16883024	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:16883024delT	ENST00000377833.4	-	61	9751	c.9686delA	c.(9685-9687)aatfs	p.N3229fs		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3229	CUB 24. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAAGTTCGCATTTTCACTATC	0.363																																					p.N3229fs		Atlas-Indel	.											.	CUBN	515	.	0			c.9687delT						PASS	.						84.0	76.0	78.0					10																	16883024		2203	4300	6503	SO:0001589	frameshift_variant	8029	exon61			.	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9686delA	10.37:g.16883024delT	ENSP00000367064:p.Asn3229fs	73.0	0.0	0		75.0	10.0	0.133333	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Frame_Shift_Del	DEL	ENST00000377833.4	37	CCDS7113.1																																																																																			.	.	none		0.363	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
PCDH1	5097	hgsc.bcm.edu	37	5	141248200	141248200	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:141248200delC	ENST00000394536.3	-	2	976	c.837delG	c.(835-837)aagfs	p.K279fs	PCDH1_ENST00000503492.1_Frame_Shift_Del_p.K279fs|PCDH1_ENST00000287008.3_Frame_Shift_Del_p.K279fs|PCDH1_ENST00000511044.1_5'Flank|PCDH1_ENST00000536585.1_Frame_Shift_Del_p.K257fs|PCDH1_ENST00000456271.1_Frame_Shift_Del_p.K267fs	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	279	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		GCCGCTCAAACTTGGGGGCGT	0.607																																					p.F280fs	Ovarian(132;1609 1739 4190 14731 45037)	Pindel,Atlas-Indel	.											.	PCDH1	119	.	0			c.838delT						PASS	.						40.0	41.0	41.0					5																	141248200		2203	4300	6503	SO:0001589	frameshift_variant	5097	exon2			.	AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.837delG	5.37:g.141248200delC	ENSP00000378043:p.Lys279fs	84.0	0.0	.		62.0	10.0	0.161	NM_032420	Q8IUP2	Frame_Shift_Del	DEL	ENST00000394536.3	37	CCDS43375.1																																																																																			.	.	none		0.607	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251862.1	NM_032420	
SLC16A7	9194	hgsc.bcm.edu	37	12	60168856	60168856	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:60168856delT	ENST00000261187.4	+	4	944	c.780delT	c.(778-780)ggtfs	p.G260fs	SLC16A7_ENST00000543448.1_Frame_Shift_Del_p.G161fs|SLC16A7_ENST00000552024.1_Frame_Shift_Del_p.G260fs|SLC16A7_ENST00000547379.1_Frame_Shift_Del_p.G260fs|SLC16A7_ENST00000552432.1_Frame_Shift_Del_p.G260fs	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	260					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.G260G(1)		endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	TGTTCCTAGGTTTTTTTGCCC	0.353																																					p.G260fs		Pindel,Atlas-Indel	.											SLC16A7,NS,carcinoma,-1,1	SLC16A7	82	1	1	Substitution - coding silent(1)	lung(1)	c.779delG						PASS	.						84.0	82.0	83.0					12																	60168856		2203	4300	6503	SO:0001589	frameshift_variant	9194	exon5			.	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.780delT	12.37:g.60168856delT	ENSP00000261187:p.Gly260fs	130.0	0.0	.		137.0	23.0	0.168	NM_001270623	Q8NEM3|Q9UPB3	Frame_Shift_Del	DEL	ENST00000261187.4	37	CCDS8961.1																																																																																			.	.	none		0.353	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
MAZ	4150	hgsc.bcm.edu	37	16	29819056	29819064	+	In_Frame_Del	DEL	AGCGCAAGG	AGCGCAAGG	-	rs141211357	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	AGCGCAAGG	AGCGCAAGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr16:29819056_29819064delAGCGCAAGG	ENST00000322945.6	+	2	1115_1123	c.950_958delAGCGCAAGG	c.(949-960)aagcgcaaggac>aac	p.317_320KRKD>N	AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000566906.2_Intron|MAZ_ENST00000545521.1_In_Frame_Del_p.294_297KRKD>N|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000568282.1_5'Flank|MAZ_ENST00000569978.1_5'Flank|MAZ_ENST00000219782.6_In_Frame_Del_p.317_320KRKD>N|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000568544.1_5'Flank|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000562337.1_Intron	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	317					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						CAGCGCTTCAAGCGCAAGGACCGCATGAG	0.632																																					p.317_319del	Colon(72;875 1167 15364 30899 37091)	Atlas-Indel	.											.	MAZ	48	.	0			c.949_957del						PASS	.																																			SO:0001651	inframe_deletion	4150	exon2			.	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.950_958delAGCGCAAGG	16.37:g.29819056_29819064delAGCGCAAGG	ENSP00000313362:p.Lys317_Asp320delinsAsn	82.0	0.0	0		74.0	13.0	0.175676	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	In_Frame_Del	DEL	ENST00000322945.6	37	CCDS42143.1																																																																																			.	.	none		0.632	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
PLEKHD1	400224	hgsc.bcm.edu	37	14	69966878	69966879	+	Frame_Shift_Ins	INS	-	-	AAAA			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr14:69966878_69966879insAAAA	ENST00000322564.7	+	2	408_409	c.196_197insAAAA	c.(196-198)gaafs	p.-68fs		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1											breast(1)|endometrium(1)|kidney(2)	4						CTCTGAGAGCGAAAAAAAGAGC	0.505																																					p.E66fs		Atlas-Indel	.											.	PLEKHD1	24	.	0			c.196_197insAAAA						PASS	.																																			SO:0001589	frameshift_variant	400224	exon2			.	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.197_200dupAAAA	14.37:g.69966879_69966882dupAAAA	ENSP00000317175:p.Lys68fs	61.0	0.0	0		66.0	12.0	0.181818	NM_001161498	B9EJC2	Frame_Shift_Ins	INS	ENST00000322564.7	37	CCDS53903.1																																																																																			.	.	none		0.505	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
RTCA	8634	hgsc.bcm.edu	37	1	100731979	100731985	+	Intron	DEL	GAGTACA	GAGTACA	-	rs375253987		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	GAGTACA	GAGTACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:100731979_100731985delGAGTACA	ENST00000370128.4	+	1	214				RTCA_ENST00000498617.1_Intron|RP11-305E17.6_ENST00000421185.1_RNA|RTCA_ENST00000370126.1_Intron|RTCA_ENST00000260563.4_Intron	NM_003729.3	NP_003720.1	O00442	RTCA_HUMAN	RNA 3'-terminal phosphate cyclase						RNA processing (GO:0006396)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA-3'-phosphate cyclase activity (GO:0003963)										TGGAAGGGGTGAGTACAGAGCGAAGCG	0.667																																					.		Atlas-Indel	.											.	.	.	.	0			.						PASS	.																																			SO:0001627	intron_variant	8634	.			.	Y11651	CCDS768.1, CCDS44178.1	1p13.3	2012-03-30	2012-03-30	2012-03-30	ENSG00000137996	ENSG00000137996	6.5.1.4		17981	protein-coding gene	gene with protein product		611286	"""RTC domain containing 1"", ""RNA terminal phosphate cyclase domain 1"""	RTCD1		9184239	Standard	NM_003729		Approved	RPC, RTC1	uc001dtd.3	O00442	OTTHUMG00000010920	ENST00000370128.4:c.45+3GAGTACA>-	1.37:g.100731979_100731985delGAGTACA		98.0	0.0	0		105.0	12.0	0.114286	.	Q5VVL5|Q5VVL6|Q96E99	Splice_Site	DEL	ENST00000370128.4	37	CCDS768.1																																																																																			.	.	none		0.667	RTCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030098.2		
HIST1H3F	8968	hgsc.bcm.edu	37	6	26250470	26250480	+	Frame_Shift_Del	DEL	GCATGATAGTC	GCATGATAGTC	-			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	GCATGATAGTC	GCATGATAGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26250470_26250480delGCATGATAGTC	ENST00000446824.2	-	1	355_365	c.354_364delGACTATCATGC	c.(352-366)gtgactatcatgcccfs	p.TIMP119fs	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	119					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						ATGTCCTTGGGCATGATAGTCACTCGCTTGG	0.583											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.119_122del		Pindel,Atlas-Indel	.											.	HIST1H3F	16	.	0			c.355_365del						PASS	.																																			SO:0001589	frameshift_variant	8968	exon1			.	Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.354_364delGACTATCATGC	6.37:g.26250470_26250480delGCATGATAGTC	ENSP00000444823:p.Thr119fs	94.0	0.0	.	785	69.0	14.0	0.203	NM_021018	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Frame_Shift_Del	DEL	ENST00000446824.2	37	CCDS4600.1																																																																																			.	.	none		0.583	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040098.1	NM_021018	
KRTAP5-3	387266	hgsc.bcm.edu	37	11	1629430	1629431	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:1629430_1629431insC	ENST00000399685.1	-	1	262_263	c.185_186insG	c.(184-186)ggcfs	p.G62fs		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	62	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		CCCCCTTGGAGCCCCCACAGGA	0.678																																					p.G62fs		Atlas-Indel	.											.	KRTAP5-3	33	.	0			c.186_187insG						PASS	.																																			SO:0001589	frameshift_variant	387266	exon1			.	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.186dupG	11.37:g.1629435_1629435dupC	ENSP00000382592:p.Gly62fs	199.0	0.0	0		136.0	25.0	0.183824	NM_001012708	Q6PL44|Q701N3	Frame_Shift_Ins	INS	ENST00000399685.1	37	CCDS41591.1																																																																																			.	.	none		0.678	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
DSPP	1834	hgsc.bcm.edu	37	4	88537205	88537213	+	In_Frame_Del	DEL	GACAGCAGT	GACAGCAGT	-	rs143067236|rs151217478|rs551655835	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	GACAGCAGT	GACAGCAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr4:88537205_88537213delGACAGCAGT	ENST00000282478.7	+	4	3424_3432	c.3391_3399delGACAGCAGT	c.(3391-3399)gacagcagtdel	p.DSS1137del	DSPP_ENST00000399271.1_In_Frame_Del_p.DSS1137del|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1137	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgacagcagtgatagcagtg	0.569																																					p.1130_1133del		Atlas-Indel	.											.	DSPP	174	.	0			c.3390_3398del						PASS	.			357,1999		74,209,895						-1.1	0.0			19	1005,3537		137,731,1403	no	coding	DSPP	NM_014208.3		211,940,2298	A1A1,A1R,RR		22.1268,15.1528,19.7449				1362,5536				SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3391_3399delGACAGCAGT	4.37:g.88537205_88537213delGACAGCAGT	ENSP00000282478:p.Asp1137_Ser1139del	71.0	0.0	0		87.0	77.0	0.885057	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	none		0.569	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
CRIP1	1396	hgsc.bcm.edu	37	14	105954680	105954681	+	Frame_Shift_Del	DEL	CC	CC	-			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr14:105954680_105954681delCC	ENST00000330233.7	+	3	1091_1092	c.148_149delCC	c.(148-150)cccfs	p.P50fs	C14orf80_ENST00000329886.7_5'Flank|CRIP1_ENST00000409393.2_Frame_Shift_Del_p.P50fs|C14orf80_ENST00000392522.3_5'Flank|C14orf80_ENST00000334656.7_5'Flank|C14orf80_ENST00000392527.1_5'Flank|CRIP1_ENST00000551180.1_Frame_Shift_Del_p.T18fs|C14orf80_ENST00000354560.6_5'Flank|C14orf80_ENST00000392523.4_5'Flank|CRIP1_ENST00000392531.3_Frame_Shift_Del_p.P50fs			P50238	CRIP1_HUMAN	cysteine-rich protein 1 (intestinal)	50	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|cellular response to antibiotic (GO:0071236)|cellular response to UV-B (GO:0071493)|heart development (GO:0007507)|immune response (GO:0006955)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|prostate gland stromal morphogenesis (GO:0060741)|regulation of gene expression (GO:0010468)|response to organic substance (GO:0010033)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)	AT DNA binding (GO:0003680)|DNA binding, bending (GO:0008301)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)						Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.235)		CGAAGGCAAACCCTACTGCAAC	0.658																																					p.49_50del		Atlas-Indel	.											.	CRIP1	1	.	0			c.147_148del						PASS	.																																			SO:0001589	frameshift_variant	1396	exon4			.		CCDS10004.1	14q32.33	2004-06-18			ENSG00000213145	ENSG00000213145			2360	protein-coding gene	gene with protein product		123875				9480758	Standard	NM_001311		Approved	CRIP	uc001yri.4	P50238	OTTHUMG00000029908	ENST00000330233.7:c.148_149delCC	14.37:g.105954680_105954681delCC	ENSP00000332449:p.Pro50fs	136.0	0.0	0		101.0	15.0	0.148515	NM_001311	H3BPI2|Q13628|Q53XY7|Q96J34	Frame_Shift_Del	DEL	ENST00000330233.7	37	CCDS10004.1																																																																																			.	.	none		0.658	CRIP1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335466.2	NM_001311	
EHD1	10938	hgsc.bcm.edu	37	11	64645661	64645661	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:64645661delG	ENST00000320631.3	-	1	530	c.276delC	c.(274-276)cccfs	p.P92fs	EHD1_ENST00000359393.2_Frame_Shift_Del_p.P92fs	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	92	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						AGTCGGTGGTGGGCTCGGGCC	0.682																																					p.T93fs		Atlas-Indel	.											.	EHD1	31	.	0			c.277delA						PASS	.						98.0	76.0	83.0					11																	64645661		2201	4297	6498	SO:0001589	frameshift_variant	10938	exon1			.	AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.276delC	11.37:g.64645661delG	ENSP00000320516:p.Pro92fs	82.0	0.0	0		67.0	12.0	0.179104	NM_006795	O14611|Q2M3Q4|Q9UNR3	Frame_Shift_Del	DEL	ENST00000320631.3	37	CCDS8084.1																																																																																			.	.	none		0.682	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143229.2	NM_006795	
HIST1H4E	8367	hgsc.bcm.edu	37	6	26204831	26204967	+	Start_Codon_Del	DEL	GTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAA	GTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAA	-	rs371154912|rs368144763|rs143652738|rs370851019|rs372764747|rs140853277|rs199914113|rs572544472|rs201304438|rs368355176|rs533676183|rs374139942|rs147263244|rs201324703|rs532184358|rs540442619|rs139616312|rs368745174|rs145699171|rs377601396|rs376058980|rs184503150|rs144621549|rs144595768|rs376989143|rs61742995|rs202183095|rs61742993|rs201319649|rs372683763	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	GTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAA	GTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26204831_26204967delGTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAA	ENST00000360441.4	+	0	0_110					NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e						CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R20S(2)|p.G5C(1)|p.N26I(1)|p.G5D(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				ACCGTCGCTTGTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAAGCCTGCCATC	0.537											OREG0017239	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		Pindel	.											.	HIST1H4E	22	.	5	Substitution - Missense(5)	lung(3)|upper_aerodigestive_tract(1)|breast(1)	.						PASS	.																																			SO:0001582	initiator_codon_variant	8367	wholegene			.	Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441		6.37:g.26204831_26204967delGTTTTTCAGATTTTTGCGGCTATTTTCGTTGGTGTGTTGGTCATGTCTGGTCGCGGCAAAGGCGGAAAGGGACTGGGTAAAGGAGGCGCTAAGCGTCACCGTAAGGTCCTGCGAGATAACATCCAGGGCATTACCAA		69.0	0.0	.	784	56.0	12.0	0.214	NM_003545	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Frame_Shift_Del	DEL	ENST00000360441.4	37	CCDS4593.1																																																																																			.	.	none		0.537	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040104.1	NM_003545	
LPHN2	23266	hgsc.bcm.edu	37	1	82415874	82415874	+	Splice_Site	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:82415874G>T	ENST00000370728.1	+	9	1845	c.1200G>T	c.(1198-1200)gtG>gtT	p.V400V	LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370725.1_Splice_Site_p.V400V|LPHN2_ENST00000359929.3_Splice_Site_p.V400V|LPHN2_ENST00000370721.1_Intron|LPHN2_ENST00000370713.1_Splice_Site_p.V400V|LPHN2_ENST00000370717.2_Splice_Site_p.V400V|LPHN2_ENST00000370730.1_Splice_Site_p.V400V|LPHN2_ENST00000394879.1_Splice_Site_p.V400V|LPHN2_ENST00000335786.5_Splice_Site_p.V400V|LPHN2_ENST00000271029.4_Splice_Site_p.V400V|LPHN2_ENST00000370723.1_Splice_Site_p.V400V|LPHN2_ENST00000319517.6_Splice_Site_p.V400V|LPHN2_ENST00000370727.1_Splice_Site_p.V400V|LPHN2_ENST00000370715.1_Splice_Site_p.V400V			O95490	LPHN2_HUMAN	latrophilin 2	400					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TTTCCATAGTGCCTACCACAG	0.418																																					p.V400V		Atlas-SNP	.											.	LPHN2	464	.	0			c.G1200T						PASS	.						161.0	165.0	163.0					1																	82415874		2203	4299	6502	SO:0001630	splice_region_variant	23266	exon6			CATAGTGCCTACC	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.1199-1G>T	1.37:g.82415874G>T		116.0	0.0	0		120.0	27.0	0.225	NM_012302	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Silent	SNP	ENST00000370728.1	37		.	.	.	.	.	.	.	.	.	.	G	11.46	1.644199	0.29246	.	.	ENSG00000117114	ENST00000449420	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	T	0.72614	0.3482	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68507	-0.5390	4	.	.	.	.	20.6402	0.99549	0.0:0.0:1.0:0.0	.	.	.	.	F	268	.	.	C	+	2	0	LPHN2	82188462	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.513000	0.60476	2.885000	0.99019	0.655000	0.94253	TGC	.	.	none		0.418	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000027188.1	NM_012302	Silent
ANKS6	203286	hgsc.bcm.edu	37	9	101518730	101518730	+	Silent	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr9:101518730G>T	ENST00000353234.4	-	12	2345	c.2298C>A	c.(2296-2298)ggC>ggA	p.G766G	ANKS6_ENST00000375018.1_Silent_p.G767G|ANKS6_ENST00000375019.2_Silent_p.G465G|ANKS6_ENST00000540940.1_Silent_p.G571G			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	766	Ser-rich.					cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				CACTGCTGGAGCCCCCACTGC	0.602																																					p.G766G		Atlas-SNP	.											.	ANKS6	59	.	0			c.C2298A						PASS	.						83.0	84.0	83.0					9																	101518730		2056	4201	6257	SO:0001819	synonymous_variant	203286	exon12			GCTGGAGCCCCCA	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.2298C>A	9.37:g.101518730G>T		69.0	0.0	0		42.0	6.0	0.142857	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Silent	SNP	ENST00000353234.4	37	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	G	9.761	1.169977	0.21621	.	.	ENSG00000165138	ENST00000444472	.	.	.	5.27	2.18	0.27775	.	.	.	.	.	T	0.46541	0.1398	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37103	-0.9720	4	.	.	.	-27.5593	3.861	0.08996	0.2675:0.0:0.5604:0.1721	.	.	.	.	I	236	.	.	L	-	1	0	ANKS6	100558551	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.132000	0.31418	1.239000	0.43787	0.484000	0.47621	CTC	.	.	none		0.602	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	
OSBPL10	114884	hgsc.bcm.edu	37	3	32022446	32022446	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:32022446C>T	ENST00000396556.2	-	1	348	c.226G>A	c.(226-228)Gcg>Acg	p.A76T	ZNF860_ENST00000360311.4_5'Flank|OSBPL10_ENST00000438237.2_Missense_Mutation_p.A76T	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	76	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CCCTCGAGCGCCGGCTCCCTC	0.766																																					p.A76T		Atlas-SNP	.											.	OSBPL10	160	.	0			c.G226A						PASS	.						14.0	15.0	15.0					3																	32022446		2192	4286	6478	SO:0001583	missense	114884	exon1			CGAGCGCCGGCTC	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.226G>A	3.37:g.32022446C>T	ENSP00000379804:p.Ala76Thr	43.0	0.0	0		50.0	6.0	0.12	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825617	0.16749	.	.	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.22945	1.93;2.22	4.02	3.14	0.36123	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.820194	0.10442	N	0.674159	T	0.12475	0.0303	N	0.05351	-0.065	0.23577	N	0.997376	P;P	0.37914	0.611;0.611	B;B	0.40256	0.324;0.324	T	0.15694	-1.0428	10	0.09843	T	0.71	-11.5122	6.3054	0.21135	0.0:0.7736:0.0:0.2264	.	76;76	B4E212;Q9BXB5	.;OSB10_HUMAN	T	76	ENSP00000379804:A76T;ENSP00000406124:A76T	ENSP00000379804:A76T	A	-	1	0	OSBPL10	31997450	0.997000	0.39634	0.993000	0.49108	0.014000	0.08584	0.681000	0.25320	1.043000	0.40175	0.462000	0.41574	GCG	.	.	none		0.766	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
SLC12A6	9990	hgsc.bcm.edu	37	15	34628685	34628685	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr15:34628685G>A	ENST00000354181.3	-	2	689	c.197C>T	c.(196-198)gCc>gTc	p.A66V	SLC12A6_ENST00000558667.1_Missense_Mutation_p.A66V|SLC12A6_ENST00000560611.1_Missense_Mutation_p.A66V|SLC12A6_ENST00000458406.2_Missense_Mutation_p.A7V|SLC12A6_ENST00000397707.2_Missense_Mutation_p.A66V|SLC12A6_ENST00000397702.2_Missense_Mutation_p.A7V|SLC12A6_ENST00000558589.1_Missense_Mutation_p.A57V			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	66					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	CGAAGTGGTGGCCCCAGACAT	0.562																																					p.A66V		Atlas-SNP	.											.	SLC12A6	205	.	0			c.C197T						PASS	.						63.0	70.0	68.0					15																	34628685		2178	4286	6464	SO:0001583	missense	9990	exon1			GTGGTGGCCCCAG	AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.197C>T	15.37:g.34628685G>A	ENSP00000346112:p.Ala66Val	93.0	0.0	0		76.0	11.0	0.144737	NM_133647	A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	ENST00000354181.3	37	CCDS58352.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755564	0.49362	.	.	ENSG00000140199	ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406	D;D;D	0.83992	-1.79;-1.79;-1.79	4.89	3.97	0.46021	.	0.237554	0.33938	N	0.004416	T	0.63522	0.2518	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.55560	-0.8122	10	0.13108	T	0.6	.	10.0434	0.42173	0.0939:0.0:0.9061:0.0	.	66;66	Q9UHW9-3;Q9UHW9	.;S12A6_HUMAN	V	66;57;7;7	ENSP00000380819:A66V;ENSP00000380814:A7V;ENSP00000387725:A7V	ENSP00000346112:A57V	A	-	2	0	SLC12A6	32415977	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.116000	0.50399	1.285000	0.44548	0.563000	0.77884	GCC	.	.	none		0.562	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000417991.1	NM_005135	
LIMD1	8994	hgsc.bcm.edu	37	3	45636656	45636656	+	Silent	SNP	C	C	T	rs143647674		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:45636656C>T	ENST00000273317.4	+	1	306	c.285C>T	c.(283-285)agC>agT	p.S95S	AC099539.1_ENST00000516118.1_RNA|LIMD1_ENST00000440097.1_Silent_p.S95S|LIMD1_ENST00000465039.1_Intron	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	95	Mediates nuclear export.				cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		TTGTGGGCAGCAAGCTGACTG	0.677																																					p.S95S		Atlas-SNP	.											.	LIMD1	34	.	0			c.C285T						PASS	.						19.0	24.0	22.0					3																	45636656		2197	4292	6489	SO:0001819	synonymous_variant	8994	exon1			GGGCAGCAAGCTG	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.285C>T	3.37:g.45636656C>T		39.0	0.0	0		29.0	6.0	0.206897	NM_014240	Q17RQ1|Q9BQQ9|Q9NQ47	Silent	SNP	ENST00000273317.4	37	CCDS2729.1																																																																																			C|1.000;G|0.000	.	alt		0.677	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	
ALX3	257	hgsc.bcm.edu	37	1	110607400	110607400	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:110607400G>A	ENST00000369792.4	-	2	490	c.403C>T	c.(403-405)Cct>Tct	p.P135S	RP4-773N10.4_ENST00000554749.1_RNA	NM_006492.2	NP_006483.2	O95076	ALX3_HUMAN	ALX homeobox 3	135					embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|pattern specification process (GO:0007389)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(81;2.35e-05)|all_epithelial(167;7.69e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.015)|all cancers(265;0.0706)|Epithelial(280;0.0758)|Colorectal(144;0.113)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGGGAAAGAGGAAGATGCAGG	0.632																																					p.P135S		Atlas-SNP	.											.	ALX3	16	.	0			c.C403T						PASS	.						70.0	78.0	76.0					1																	110607400		2203	4300	6503	SO:0001583	missense	257	exon2			AAAGAGGAAGATG	AF008203	CCDS819.1	1p13.3	2014-02-04	2008-11-04		ENSG00000156150	ENSG00000156150		"""Homeoboxes / PRD class"""	449	protein-coding gene	gene with protein product		606014	"""aristaless-like homeobox 3"", ""frontonasal dysplasia"""	FND		15226305, 11807986, 19409524	Standard	NM_006492		Approved		uc001dzb.3	O95076	OTTHUMG00000011650	ENST00000369792.4:c.403C>T	1.37:g.110607400G>A	ENSP00000358807:p.Pro135Ser	150.0	0.0	0		119.0	26.0	0.218487	NM_006492	O95075|Q5T8M4	Missense_Mutation	SNP	ENST00000369792.4	37	CCDS819.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235321	0.39498	.	.	ENSG00000156150	ENST00000369792	D	0.95447	-3.71	3.51	3.51	0.40186	Homeodomain-like (1);	0.158416	0.29806	N	0.011154	D	0.87386	0.6164	N	0.24115	0.695	0.09310	N	1	D	0.58620	0.983	P	0.51016	0.656	T	0.80659	-0.1284	10	0.24483	T	0.36	.	6.899	0.24273	0.1283:0.0:0.8717:0.0	.	135	O95076	ALX3_HUMAN	S	135	ENSP00000358807:P135S	ENSP00000358807:P135S	P	-	1	0	ALX3	110408923	0.987000	0.35691	0.899000	0.35326	0.924000	0.55760	3.339000	0.52135	1.940000	0.56252	0.462000	0.41574	CCT	.	.	none		0.632	ALX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032232.2	NM_006492	
NFKB2	4791	hgsc.bcm.edu	37	10	104157819	104157819	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:104157819T>A	ENST00000369966.3	+	9	993	c.743T>A	c.(742-744)cTg>cAg	p.L248Q	NFKB2_ENST00000189444.6_Missense_Mutation_p.L248Q|NFKB2_ENST00000428099.1_Missense_Mutation_p.L248Q	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	248	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	GAAGTTTATCTGCTTTGTGAC	0.517			T	IGH@	B-NHL																																p.L248Q		Atlas-SNP	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48	.	0			c.T743A						PASS	.						119.0	120.0	120.0					10																	104157819		1979	4177	6156	SO:0001583	missense	4791	exon9			TTTATCTGCTTTG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.743T>A	10.37:g.104157819T>A	ENSP00000358983:p.Leu248Gln	143.0	0.0	0		114.0	16.0	0.140351	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.245955	0.80024	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.57752	0.38;0.38;0.38	5.21	5.21	0.72293	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.78811	0.4342	M	0.92833	3.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84653	0.0702	10	0.87932	D	0	.	15.1176	0.72416	0.0:0.0:0.0:1.0	.	248;248;248	D3DR86;Q00653;A8K9D9	.;NFKB2_HUMAN;.	Q	248	ENSP00000410256:L248Q;ENSP00000358983:L248Q;ENSP00000189444:L248Q	ENSP00000189444:L248Q	L	+	2	0	NFKB2	104147809	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.984000	0.88150	1.972000	0.57404	0.459000	0.35465	CTG	.	.	none		0.517	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
ABCA10	10349	hgsc.bcm.edu	37	17	67178333	67178333	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:67178333G>T	ENST00000269081.4	-	23	3639	c.2730C>A	c.(2728-2730)ttC>ttA	p.F910L	ABCA10_ENST00000416101.2_3'UTR	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	910					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					TAAGCTCCGTGAAGTTAAAAA	0.378																																					p.F910L		Atlas-SNP	.											.	ABCA10	209	.	0			c.C2730A						PASS	.						52.0	50.0	50.0					17																	67178333		2203	4300	6503	SO:0001583	missense	10349	exon23			CTCCGTGAAGTTA	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.2730C>A	17.37:g.67178333G>T	ENSP00000269081:p.Phe910Leu	302.0	0.0	0		256.0	48.0	0.1875	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	37	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	1.793	-0.478907	0.04414	.	.	ENSG00000154263	ENST00000269081	D	0.82081	-1.57	2.76	-5.52	0.02560	.	1.124900	0.07235	U	0.863186	T	0.62319	0.2418	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.49986	-0.8880	10	0.11485	T	0.65	.	2.25	0.04041	0.1658:0.1157:0.3923:0.3262	.	910;910	E5RFN6;Q8WWZ4	.;ABCAA_HUMAN	L	910	ENSP00000269081:F910L	ENSP00000269081:F910L	F	-	3	2	ABCA10	64689928	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	-0.996000	0.03709	-1.060000	0.03189	0.186000	0.17326	TTC	.	.	none		0.378	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
FAM179B	23116	hgsc.bcm.edu	37	14	45433254	45433254	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr14:45433254G>A	ENST00000361577.3	+	1	1844	c.1630G>A	c.(1630-1632)Ggt>Agt	p.G544S	KLHL28_ENST00000396128.4_5'Flank|KLHL28_ENST00000553817.1_5'UTR|FAM179B_ENST00000361462.2_Missense_Mutation_p.G544S|KLHL28_ENST00000355081.2_5'Flank|FAM179B_ENST00000382233.2_Missense_Mutation_p.G544S	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	544										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AATGGGCTCAGGTAAAACCAG	0.463																																					p.G544S		Atlas-SNP	.											.	FAM179B	115	.	0			c.G1630A						PASS	.						117.0	116.0	116.0					14																	45433254		2203	4300	6503	SO:0001583	missense	23116	exon1			GGCTCAGGTAAAA	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.1630G>A	14.37:g.45433254G>A	ENSP00000355045:p.Gly544Ser	85.0	0.0	0		58.0	9.0	0.155172	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798793	0.70567	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.54675	0.56;0.56;0.56	4.47	3.57	0.40892	Armadillo-like helical (1);Armadillo-type fold (1);	0.073488	0.53938	N	0.000058	T	0.59918	0.2229	L	0.35723	1.085	0.58432	D	0.999997	P;D;D;P	0.89917	0.715;1.0;1.0;0.715	P;D;D;P	0.91635	0.653;0.999;0.997;0.577	T	0.55679	-0.8103	10	0.30854	T	0.27	-9.2512	12.2476	0.54578	0.0837:0.0:0.9163:0.0	.	544;544;544;544	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	S	544	ENSP00000355045:G544S;ENSP00000354917:G544S;ENSP00000371668:G544S	ENSP00000354917:G544S	G	+	1	0	FAM179B	44503004	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.158000	0.64917	1.097000	0.41459	0.561000	0.74099	GGT	.	.	none		0.463	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
CAMSAP3	57662	hgsc.bcm.edu	37	19	7670117	7670117	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:7670117G>T	ENST00000160298.4	+	2	255	c.154G>T	c.(154-156)Gtg>Ttg	p.V52L	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.V52L	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	52					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CACAGAGCACGTGCCCCCGGA	0.607																																					p.V52L		Atlas-SNP	.											KIAA1543,rectum,carcinoma,-2,4	CAMSAP3	131	4	0			c.G154T						PASS	.						107.0	117.0	114.0					19																	7670117		2016	4180	6196	SO:0001583	missense	57662	exon2			GAGCACGTGCCCC	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.154G>T	19.37:g.7670117G>T	ENSP00000160298:p.Val52Leu	83.0	0.0	0		69.0	4.0	0.057971	NM_020902	Q8NDF1	Missense_Mutation	SNP	ENST00000160298.4	37	CCDS42489.1	.	.	.	.	.	.	.	.	.	.	g	18.62	3.663861	0.67700	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.22539	1.98;1.95	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000003	T	0.47060	0.1425	M	0.73598	2.24	0.42982	D	0.994469	D;D	0.89917	1.0;0.996	D;D	0.81914	0.995;0.989	T	0.53872	-0.8377	10	0.72032	D	0.01	-29.4892	15.8571	0.78987	0.0:0.0:1.0:0.0	.	52;52	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	L	52	ENSP00000416797:V52L;ENSP00000160298:V52L	ENSP00000160298:V52L	V	+	1	0	KIAA1543	7576117	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	5.354000	0.66040	2.005000	0.58758	0.478000	0.44815	GTG	.	.	none		0.607	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459300.1	XM_048362	
SRRM5	100170229	hgsc.bcm.edu	37	19	44118178	44118178	+	Silent	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:44118178T>C	ENST00000607544.1	+	3	2227	c.1905T>C	c.(1903-1905)tcT>tcC	p.S635S	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000417606.1_Silent_p.S635S|SRRM5_ENST00000526798.1_Silent_p.S650S			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	635	Ser-rich.									endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						CTAGAACCTCTAGCAAGGAGA	0.507																																					p.S635S		Atlas-SNP	.											.	SRRM5	38	.	0			c.T1905C						PASS	.						74.0	75.0	75.0					19																	44118178		692	1591	2283	SO:0001819	synonymous_variant	100170229	exon1			AACCTCTAGCAAG	AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1905T>C	19.37:g.44118178T>C		55.0	0.0	0		40.0	8.0	0.2	NM_001145641	B4DNF0	Silent	SNP	ENST00000607544.1	37	CCDS46095.1																																																																																			.	.	none		0.507	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000384398.2	NM_001145641	
HLA-C	3107	hgsc.bcm.edu	37	6	31239047	31239047	+	Missense_Mutation	SNP	G	G	A	rs281860470		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:31239047G>A	ENST00000376228.5	-	3	436	c.422C>T	c.(421-423)gCc>gTc	p.A141V	HLA-C_ENST00000383329.3_Missense_Mutation_p.A141V	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	141	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GCCGTCGTAGGCGGACTGGTC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		12845	0.0		0.0	False		,,,				2504	0.001				p.A141V		Atlas-SNP	.											.	HLA-C	92	.	0			c.C422T						PASS	.						35.0	27.0	30.0					6																	31239047		2182	4253	6435	SO:0001583	missense	3107	exon3			TCGTAGGCGGACT	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.422C>T	6.37:g.31239047G>A	ENSP00000365402:p.Ala141Val	133.0	0.0	0		150.0	23.0	0.153333	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	37	CCDS34393.1	.	.	.	.	.	.	.	.	.	.	.	13.97	2.394451	0.42410	.	.	ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	T;T	0.00018	9.08;9.08	2.59	2.59	0.31030	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.229535	0.21218	U	0.078193	T	0.00328	0.0010	H	0.99914	4.94	0.20196	N	0.999921	D;P;P;P	0.58970	0.984;0.878;0.878;0.939	P;P;P;P	0.58391	0.838;0.482;0.61;0.662	T	0.46830	-0.9163	10	0.87932	D	0	.	7.4947	0.27481	0.0:0.2697:0.7303:0.0	.	141;141;141;141	A2AEA4;A6H578;A2AEA2;P10321	.;.;.;1C07_HUMAN	V	141;141;141;178	ENSP00000365402:A141V;ENSP00000372819:A141V	ENSP00000365402:A141V	A	-	2	0	HLA-C	31347026	0.028000	0.19301	0.011000	0.14972	0.023000	0.10783	0.934000	0.28910	1.768000	0.52137	0.305000	0.20034	GCC	.	.	weak		0.706	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
PCDH15	65217	hgsc.bcm.edu	37	10	55698632	55698632	+	Nonsense_Mutation	SNP	G	G	A	rs202033121		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:55698632G>A	ENST00000320301.6	-	25	3710	c.3316C>T	c.(3316-3318)Cga>Tga	p.R1106*	PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000409834.1_Nonsense_Mutation_p.R717*|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000361849.3_Nonsense_Mutation_p.R1106*|PCDH15_ENST00000414778.1_Nonsense_Mutation_p.R1111*|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Nonsense_Mutation_p.R1113*|PCDH15_ENST00000395438.1_Nonsense_Mutation_p.R1106*|PCDH15_ENST00000395433.1_Nonsense_Mutation_p.R1084*|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Nonsense_Mutation_p.R1035*|PCDH15_ENST00000395432.2_Nonsense_Mutation_p.R1069*|PCDH15_ENST00000395430.1_Nonsense_Mutation_p.R1106*|PCDH15_ENST00000395445.1_Nonsense_Mutation_p.R1113*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1106	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GCTTGGACTCGAAGTACATAG	0.373										HNSCC(58;0.16)																											p.R1111X		Atlas-SNP	.											PCDH15_ENST00000417177,NS,malignant_melanoma,0,8	PCDH15	1715	8	0			c.C3331T						PASS	.	G	stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	119.0	110.0	113.0		3331,3316,3103,3316,3205,3250,3352,3316,3331,3316,3250,3316	4.8	1.0	10		113	1,8597	1.2+/-3.3	0,1,4298	yes	stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained	PCDH15	NM_001142763.1,NM_001142764.1,NM_001142765.1,NM_001142766.1,NM_001142767.1,NM_001142768.1,NM_001142769.1,NM_001142770.1,NM_001142771.1,NM_001142772.1,NM_001142773.1,NM_033056.3	,,,,,,,,,,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,,,,,,	1111/1963,1106/1958,1035/1887,1106/1953,1069/1916,1084/1936,1118/1791,1106/1540,1111/1683,1106/1678,1084/1933,1106/1956	55698632	1,13003	2203	4299	6502	SO:0001587	stop_gained	65217	exon26			GGACTCGAAGTAC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3316C>T	10.37:g.55698632G>A	ENSP00000322604:p.Arg1106*	44.0	0.0	0		43.0	10.0	0.232558	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	45	11.791944	0.99603	0.0	1.16E-4	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	.	.	.	5.77	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6969	0.57010	0.0:0.0:0.7007:0.2993	.	.	.	.	X	1113;1111;1106;1106;717;1113;1069;1106;1084;1106;1106;1111;1035	.	ENSP00000322604:R1106X	R	-	1	2	PCDH15	55368638	1.000000	0.71417	0.986000	0.45419	0.968000	0.65278	2.995000	0.49441	1.380000	0.46344	0.655000	0.94253	CGA	.	.	weak		0.373	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
HIST1H2AG	8969	hgsc.bcm.edu	37	6	27100963	27100963	+	Missense_Mutation	SNP	G	G	A	rs201426448		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:27100963G>A	ENST00000359193.2	+	1	132	c.113G>A	c.(112-114)gGc>gAc	p.G38D	HIST1H2BJ_ENST00000339812.2_5'Flank|HIST1H2BJ_ENST00000541790.1_5'Flank|HIST1H2BJ_ENST00000607124.1_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	38						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						CTCCGCAAAGGCAACTATGCC	0.692																																					p.G38D		Atlas-SNP	.											.	HIST1H2AG	37	.	0			c.G113A						PASS	.						32.0	37.0	35.0					6																	27100963		2203	4300	6503	SO:0001583	missense	8969	exon1			GCAAAGGCAACTA	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.113G>A	6.37:g.27100963G>A	ENSP00000352119:p.Gly38Asp	95.0	0.0	0		111.0	21.0	0.189189	NM_021064	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	37	CCDS4619.1	.	.	.	.	.	.	.	.	.	.	G	16.01	3.000701	0.54254	.	.	ENSG00000196787	ENST00000359193	T	0.68025	-0.3	4.08	4.08	0.47627	Histone-fold (2);Histone core (1);Histone H2A (1);	0.000000	0.40908	D	0.000983	T	0.70325	0.3211	.	.	.	0.43255	D	0.995186	P	0.50819	0.939	P	0.55112	0.769	T	0.75897	-0.3155	9	0.87932	D	0	.	14.6102	0.68510	0.0:0.0:1.0:0.0	.	38	P0C0S8	H2A1_HUMAN	D	38	ENSP00000352119:G38D	ENSP00000352119:G38D	G	+	2	0	HIST1H2AG	27208942	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	8.818000	0.91991	2.217000	0.71921	0.655000	0.94253	GGC	G|0.999;A|0.001	0.001	weak		0.692	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
PRMT9	90826	hgsc.bcm.edu	37	4	148594981	148594981	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr4:148594981A>C	ENST00000322396.6	-	3	625	c.383T>G	c.(382-384)gTg>gGg	p.V128G	PRMT10_ENST00000541232.1_Missense_Mutation_p.V15G	NM_138364.2	NP_612373.2	Q6P2P2	ANM9_HUMAN		128						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28						GTTTAGCTTCACTGCTTTATG	0.383																																					p.V128G		Atlas-SNP	.											.	PRMT10	68	.	0			c.T383G						PASS	.						81.0	81.0	81.0					4																	148594981		2203	4300	6503	SO:0001583	missense	90826	exon3			AGCTTCACTGCTT																												ENST00000322396.6:c.383T>G	4.37:g.148594981A>C	ENSP00000314396:p.Val128Gly	102.0	0.0	0		108.0	21.0	0.194444	NM_138364	A8KA39|B3KU92|Q6ZR58|Q8N383|Q9BT55|Q9NT98	Missense_Mutation	SNP	ENST00000322396.6	37	CCDS3771.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425487	0.83667	.	.	ENSG00000164169	ENST00000322396;ENST00000541232	D;T	0.89123	-2.47;1.7	5.37	5.37	0.77165	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.064517	0.64402	D	0.000007	D	0.89322	0.6682	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.64506	0.926	D	0.90662	0.4591	10	0.54805	T	0.06	.	15.3765	0.74610	1.0:0.0:0.0:0.0	.	128	Q6P2P2	ANM10_HUMAN	G	128;15	ENSP00000314396:V128G;ENSP00000439508:V15G	ENSP00000314396:V128G	V	-	2	0	PRMT10	148814431	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.948000	0.93006	2.045000	0.60652	0.533000	0.62120	GTG	.	.	none		0.383	PRMT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364650.1		
CCND2	894	hgsc.bcm.edu	37	12	4383364	4383364	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:4383364C>T	ENST00000261254.3	+	1	427	c.158C>T	c.(157-159)cCc>cTc	p.P53L	RP11-264F23.3_ENST00000539135.1_RNA|RP11-264F23.4_ENST00000537370.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	53	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GACATCCAACCCTACATGCGC	0.657			T	IGL@	"""NHL,CLL"""																																p.P53L		Atlas-SNP	.		Dom	yes		12	12p13	894	cyclin D2		L	.	CCND2	50	.	0			c.C158T						PASS	.						103.0	91.0	95.0					12																	4383364		2203	4300	6503	SO:0001583	missense	894	exon1			TCCAACCCTACAT	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.158C>T	12.37:g.4383364C>T	ENSP00000261254:p.Pro53Leu	194.0	0.0	0		177.0	26.0	0.146893	NM_001759	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	37	CCDS8524.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.582352	0.65992	.	.	ENSG00000118971	ENST00000261254	T	0.12039	2.72	4.17	4.17	0.49024	Cyclin, N-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.22936	0.0554	M	0.64997	1.995	0.80722	D	1	P	0.41232	0.743	P	0.46419	0.516	T	0.02269	-1.1185	10	0.87932	D	0	.	13.7742	0.63044	0.0:1.0:0.0:0.0	.	53	P30279	CCND2_HUMAN	L	53	ENSP00000261254:P53L	ENSP00000261254:P53L	P	+	2	0	CCND2	4253625	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.232000	0.78116	2.127000	0.65507	0.491000	0.48974	CCC	.	.	none		0.657	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
SPTLC3	55304	hgsc.bcm.edu	37	20	13107302	13107302	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr20:13107302C>T	ENST00000399002.2	+	9	1491	c.1217C>T	c.(1216-1218)cCg>cTg	p.P406L	SPTLC3_ENST00000378194.4_3'UTR	NM_018327.2	NP_060797.2	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base subunit 3	406					small molecule metabolic process (GO:0044281)|sphingoid biosynthetic process (GO:0046520)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(1)|endometrium(1)|large_intestine(7)|lung(14)|skin(1)|urinary_tract(1)	25						ATGAGCCCACCGATAGCAGAG	0.463																																					p.P406L		Atlas-SNP	.											.	SPTLC3	78	.	0			c.C1217T						PASS	.						227.0	213.0	218.0					20																	13107302		1937	4135	6072	SO:0001583	missense	55304	exon9			GCCCACCGATAGC	AL109983	CCDS13115.2	20p12.1	2011-07-05	2006-12-21	2006-12-21	ENSG00000172296	ENSG00000172296	2.3.1.50		16253	protein-coding gene	gene with protein product		611120	"""chromosome 20 open reading frame 38"", ""serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)"""	C20orf38, SPTLC2L		17023427	Standard	NM_018327		Approved	LCB2B, FLJ11112, hLCB2b	uc002wod.1	Q9NUV7	OTTHUMG00000031899	ENST00000399002.2:c.1217C>T	20.37:g.13107302C>T	ENSP00000381968:p.Pro406Leu	83.0	0.0	0		82.0	17.0	0.207317	NM_018327	A2A2I4|B9EK64|Q05DQ8|Q5T1U4|Q9H1L1|Q9H1Z0	Missense_Mutation	SNP	ENST00000399002.2	37	CCDS13115.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.9|25.9	4.688150|4.688150	0.88639|0.88639	.|.	.|.	ENSG00000172296|ENSG00000172296	ENST00000399002|ENST00000431275	D|.	0.94184|.	-3.37|.	6.17|6.17	5.23|5.23	0.72850|0.72850	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.187728|.	0.64402|.	D|.	0.000016|.	T|.	0.77458|.	0.4133|.	M|M	0.83774|0.83774	2.66|2.66	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.70935|.	0.971|.	T|.	0.79741|.	-0.1676|.	10|.	0.87932|.	D|.	0|.	-5.7364|-5.7364	14.6875|14.6875	0.69059|0.69059	0.0:0.9302:0.0:0.0698|0.0:0.9302:0.0:0.0698	.|.	406|.	Q9NUV7|.	SPTC3_HUMAN|.	L|X	406|4	ENSP00000381968:P406L|.	ENSP00000381968:P406L|.	P|R	+|+	2|1	0|2	SPTLC3|SPTLC3	13055302|13055302	0.977000|0.977000	0.34250|0.34250	0.122000|0.122000	0.21767|0.21767	0.929000|0.929000	0.56500|0.56500	6.079000|6.079000	0.71291|0.71291	1.598000|1.598000	0.50083|0.50083	0.655000|0.655000	0.94253|0.94253	CCG|CGA	.	.	none		0.463	SPTLC3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254544.1	NM_018327	
IRF4	3662	hgsc.bcm.edu	37	6	393222	393222	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:393222C>G	ENST00000380956.4	+	2	196	c.70C>G	c.(70-72)Ctc>Gtc	p.L24V	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	24					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CAACGGGAAGCTCCGCCAGTG	0.701			T	IGH@	MM																																p.L24V		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C70G						PASS	.						31.0	32.0	32.0					6																	393222		2192	4286	6478	SO:0001583	missense	3662	exon2			GGGAAGCTCCGCC	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.70C>G	6.37:g.393222C>G	ENSP00000370343:p.Leu24Val	155.0	0.0	0		205.0	79.0	0.385366	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123443	0.77436	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.98747	-5.11	4.58	4.58	0.56647	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.134094	0.50627	N	0.000102	D	0.99202	0.9723	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	0.996;0.995;1.0	D;D;D	0.91635	0.997;0.994;0.999	D	0.99449	1.0940	10	0.72032	D	0.01	-24.4797	17.6301	0.88104	0.0:1.0:0.0:0.0	.	24;24;24	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	V	24;54	ENSP00000370343:L24V	ENSP00000370343:L24V	L	+	1	0	IRF4	338222	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.118000	0.57884	2.399000	0.81585	0.306000	0.20318	CTC	.	.	none		0.701	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056391	26056391	+	Missense_Mutation	SNP	C	C	T	rs370479531		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26056391C>T	ENST00000343677.2	-	1	308	c.266G>A	c.(265-267)aGc>aAc	p.S89N		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	89	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						AGTGCCCTTGCTCACCAGGCT	0.527																																					p.S89N		Atlas-SNP	.											.	HIST1H1C	80	.	0			c.G266A						PASS	.						112.0	117.0	115.0					6																	26056391		2203	4300	6503	SO:0001583	missense	3006	exon1			CCCTTGCTCACCA	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.266G>A	6.37:g.26056391C>T	ENSP00000339566:p.Ser89Asn	114.0	0.0	0		83.0	12.0	0.144578	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	11.24	1.581681	0.28180	.	.	ENSG00000187837	ENST00000343677	T	0.09538	2.97	5.63	3.74	0.42951	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.448135	0.25625	N	0.029383	T	0.04092	0.0114	L	0.48260	1.515	0.38874	D	0.956758	B	0.32968	0.392	B	0.33960	0.173	T	0.33111	-0.9881	10	0.25106	T	0.35	-23.6919	9.0651	0.36458	0.0:0.661:0.263:0.076	.	89	P16403	H12_HUMAN	N	89	ENSP00000339566:S89N	ENSP00000339566:S89N	S	-	2	0	HIST1H1C	26164370	0.006000	0.16342	1.000000	0.80357	0.345000	0.29048	-0.967000	0.03821	1.521000	0.48983	0.655000	0.94253	AGC	.	.	alt		0.527	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
ANKS1A	23294	hgsc.bcm.edu	37	6	34857318	34857318	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:34857318A>G	ENST00000360359.3	+	1	277	c.139A>G	c.(139-141)Agc>Ggc	p.S47G	TAF11_ENST00000420584.2_5'Flank|ANKS1A_ENST00000535627.1_Missense_Mutation_p.S47G|TAF11_ENST00000361288.4_5'Flank	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	47	Gly-rich.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						cggcggcggcagcggcggcgg	0.771																																					p.S47G		Atlas-SNP	.											ANKS1A,NS,carcinoma,0,1	ANKS1A	123	1	0			c.A139G						scavenged	.						2.0	2.0	2.0					6																	34857318		328	1149	1477	SO:0001583	missense	23294	exon1			GGCGGCAGCGGCG	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.139A>G	6.37:g.34857318A>G	ENSP00000353518:p.Ser47Gly	6.0	0.0	0		12.0	10.0	0.833333	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.186111	0.00026	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;D	0.88046	1.12;-2.33	0.892	-1.78	0.07957	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.39253	0.1071	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36480	-0.9746	9	0.08381	T	0.77	-3.6165	5.4862	0.16751	0.2218:0.0:0.7782:0.0	.	47;47	B4DQW8;Q92625	.;ANS1A_HUMAN	G	47	ENSP00000353518:S47G;ENSP00000438752:S47G	ENSP00000353518:S47G	S	+	1	0	ANKS1A	34965296	0.056000	0.20664	0.088000	0.20740	0.019000	0.09904	0.065000	0.14466	-1.299000	0.02344	-1.288000	0.01363	AGC	.	.	none		0.771	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
OR7G3	390883	hgsc.bcm.edu	37	19	9236917	9236917	+	Missense_Mutation	SNP	G	G	A	rs61730387|rs75266995	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:9236917G>A	ENST00000305444.2	-	1	709	c.710C>T	c.(709-711)gCt>gTt	p.A237V		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A237fs*9(1)		NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						GATGGAAAAAGCTTTATACTT	0.448																																					p.A237V		Atlas-SNP	.											.	OR7G3	41	.	1	Deletion - Frameshift(1)	liver(1)	c.C710T						PASS	.						93.0	99.0	97.0					19																	9236917		2190	4290	6480	SO:0001583	missense	390883	exon1			GAAAAAGCTTTAT		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.710C>T	19.37:g.9236917G>A	ENSP00000302867:p.Ala237Val	142.0	0.0	0		104.0	6.0	0.0576923	NM_001001958	Q6IFJ6|Q96R99	Missense_Mutation	SNP	ENST00000305444.2	37	CCDS32899.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.209809	0.79240	.	.	ENSG00000170920	ENST00000305444	T	0.00342	8.03	3.96	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.181685	0.25975	N	0.027104	T	0.00580	0.0019	M	0.79475	2.455	0.26503	N	0.974731	P	0.50710	0.938	P	0.57324	0.818	T	0.33111	-0.9881	10	0.66056	D	0.02	.	10.7615	0.46268	0.0964:0.0:0.9035:0.0	rs61730387	237	Q8NG95	OR7G3_HUMAN	V	237	ENSP00000302867:A237V	ENSP00000302867:A237V	A	-	2	0	OR7G3	9097917	0.979000	0.34478	0.007000	0.13788	0.341000	0.28922	3.298000	0.51818	1.038000	0.40049	0.551000	0.68910	GCT	G|0.935;A|0.065	0.065	strong		0.448	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384611.1		
HIBADH	11112	hgsc.bcm.edu	37	7	27702327	27702327	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr7:27702327G>A	ENST00000265395.2	-	1	287	c.81C>T	c.(79-81)agC>agT	p.S27S		NM_152740.3	NP_689953.1	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	27					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	3-hydroxyisobutyrate dehydrogenase activity (GO:0008442)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(4)|kidney(2)|lung(3)|ovary(2)|prostate(1)	12			GBM - Glioblastoma multiforme(3;0.0368)			CCGCTGCAAAGCTGCCGGCTG	0.682																																					p.S27S		Atlas-SNP	.											.	HIBADH	28	.	0			c.C81T						PASS	.						3.0	3.0	3.0					7																	27702327		1444	2917	4361	SO:0001819	synonymous_variant	11112	exon1			TGCAAAGCTGCCG	AF529362	CCDS5414.1	7p15	2009-06-12			ENSG00000106049	ENSG00000106049	1.1.1.31		4907	protein-coding gene	gene with protein product		608475					Standard	NM_152740		Approved	NS5ATP1	uc003szf.3	P31937	OTTHUMG00000097035	ENST00000265395.2:c.81C>T	7.37:g.27702327G>A		158.0	0.0	0		135.0	25.0	0.185185	NM_152740	Q546Z2|Q9UDN3	Silent	SNP	ENST00000265395.2	37	CCDS5414.1																																																																																			.	.	none		0.682	HIBADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214132.1	NM_152740	
ITGA4	3676	hgsc.bcm.edu	37	2	182322531	182322531	+	Silent	SNP	G	G	A	rs546061211		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:182322531G>A	ENST00000397033.2	+	1	580	c.150G>A	c.(148-150)acG>acA	p.T50T	ITGA4_ENST00000339307.4_Silent_p.T50T	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	50					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	CCCACAACACGCTGTTCGGCT	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		14794	0.0		0.0	False		,,,				2504	0.001				p.T50T		Atlas-SNP	.											ITGA4,colon,carcinoma,+1,1	ITGA4	142	1	0			c.G150A						PASS	.						25.0	31.0	29.0					2																	182322531		2104	4230	6334	SO:0001819	synonymous_variant	3676	exon1			CAACACGCTGTTC		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.150G>A	2.37:g.182322531G>A		82.0	0.0	0		70.0	12.0	0.171429	NM_000885	D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	37	CCDS42788.1																																																																																			.	.	none		0.647	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
TFAP2D	83741	hgsc.bcm.edu	37	6	50712940	50712940	+	Missense_Mutation	SNP	A	A	G	rs201424626		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:50712940A>G	ENST00000008391.3	+	6	1232	c.1004A>G	c.(1003-1005)aAa>aGa	p.K335R	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACAGCAAGAAAAAAGATGATC	0.403													A|||	1	0.000199681	0.0008	0.0	5008	,	,		20233	0.0		0.0	False		,,,				2504	0.0				p.K335R		Atlas-SNP	.											TFAP2D,NS,carcinoma,0,1	TFAP2D	144	1	0			c.A1004G						scavenged	.						121.0	117.0	119.0					6																	50712940		2203	4300	6503	SO:0001583	missense	83741	exon6			CAAGAAAAAAGAT	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1004A>G	6.37:g.50712940A>G	ENSP00000008391:p.Lys335Arg	198.0	1.0	0.00505051		182.0	39.0	0.214286	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	A	17.94	3.512600	0.64522	.	.	ENSG00000008197	ENST00000008391	D	0.96992	-4.2	5.77	5.77	0.91146	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92001	0.7466	L	0.39898	1.24	0.80722	D	1	P	0.37207	0.587	B	0.37091	0.241	D	0.93015	0.6435	10	0.54805	T	0.06	-8.0383	16.0828	0.81017	1.0:0.0:0.0:0.0	.	335	Q7Z6R9	AP2D_HUMAN	R	335	ENSP00000008391:K335R	ENSP00000008391:K335R	K	+	2	0	TFAP2D	50820899	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.206000	0.71126	0.477000	0.44152	AAA	A|1.000;G|0.000	0.000	strong		0.403	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
ANXA11	311	hgsc.bcm.edu	37	10	81930597	81930597	+	Missense_Mutation	SNP	T	T	A	rs539258237		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:81930597T>A	ENST00000438331.1	-	5	612	c.130A>T	c.(130-132)Acc>Tcc	p.T44S	ANXA11_ENST00000422982.3_Missense_Mutation_p.T44S|ANXA11_ENST00000463657.1_5'Flank|ANXA11_ENST00000537102.1_Missense_Mutation_p.T11S|ANXA11_ENST00000360615.4_Missense_Mutation_p.T44S|ANXA11_ENST00000265447.4_Missense_Mutation_p.T44S|ANXA11_ENST00000372231.3_Missense_Mutation_p.T44S|ANXA11_ENST00000535999.1_Missense_Mutation_p.T44S	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	44					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			CCCGCATAGGTGGCCACGTTA	0.632																																					p.T44S		Atlas-SNP	.											ANXA11,right_upper_lobe,carcinoma,0,1	ANXA11	32	1	0			c.A130T						scavenged	.						78.0	67.0	71.0					10																	81930597		2203	4300	6503	SO:0001583	missense	311	exon4			CATAGGTGGCCAC	L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.130A>T	10.37:g.81930597T>A	ENSP00000398610:p.Thr44Ser	68.0	1.0	0.0147059		42.0	13.0	0.309524	NM_145868	B4DVE7	Missense_Mutation	SNP	ENST00000438331.1	37	CCDS7364.1	.	.	.	.	.	.	.	.	.	.	.	11.12	1.544761	0.27563	.	.	ENSG00000122359	ENST00000372231;ENST00000422982;ENST00000438331;ENST00000372234;ENST00000360615;ENST00000265447;ENST00000535999;ENST00000537102;ENST00000445524;ENST00000437799	T;T;T;T;T;T;T	0.01725	4.67;4.67;4.67;4.67;4.67;4.67;4.67	4.69	3.55	0.40652	.	2.338380	0.01769	N	0.031065	T	0.01558	0.0050	N	0.08118	0	0.09310	N	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31420	-0.9944	10	0.30078	T	0.28	.	8.0097	0.30347	0.0:0.0986:0.0:0.9014	.	144;44;44	B7Z6L0;Q5T0G8;P50995	.;.;ANX11_HUMAN	S	44;44;44;44;44;44;44;11;44;44	ENSP00000361305:T44S;ENSP00000404412:T44S;ENSP00000398610:T44S;ENSP00000353827:T44S;ENSP00000265447:T44S;ENSP00000441748:T44S;ENSP00000441400:T11S	ENSP00000265447:T44S	T	-	1	0	ANXA11	81920577	0.998000	0.40836	0.969000	0.41365	0.033000	0.12548	1.684000	0.37649	1.886000	0.54624	0.364000	0.22116	ACC	.	.	none		0.632	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869	
GDI1	2664	hgsc.bcm.edu	37	X	153670076	153670076	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:153670076A>G	ENST00000447750.2	+	8	1261	c.926A>G	c.(925-927)aAg>aGg	p.K309R	FAM50A_ENST00000393600.3_5'Flank	NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	309					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CACCCCATCAAGAACACCAAC	0.577																																					p.K309R		Atlas-SNP	.											.	GDI1	36	.	0			c.A926G						PASS	.						166.0	139.0	148.0					X																	153670076		2203	4300	6503	SO:0001583	missense	2664	exon8			CCATCAAGAACAC	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.926A>G	X.37:g.153670076A>G	ENSP00000394071:p.Lys309Arg	105.0	0.0	0		137.0	29.0	0.211679	NM_001493	P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	ENST00000447750.2	37	CCDS35452.1	.	.	.	.	.	.	.	.	.	.	A	15.70	2.912341	0.52439	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	T	0.59364	0.27	5.43	3.02	0.34903	.	0.000000	0.85682	D	0.000000	T	0.45196	0.1330	L	0.39397	1.21	0.51767	D	0.999934	B	0.02656	0.0	B	0.09377	0.004	T	0.31166	-0.9953	10	0.66056	D	0.02	-30.0025	7.5464	0.27770	0.8186:0.0:0.1814:0.0	.	309	P31150	GDIA_HUMAN	R	309;293	ENSP00000394071:K309R	ENSP00000358756:K293R	K	+	2	0	GDI1	153323270	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.797000	0.55514	0.231000	0.21079	-0.424000	0.05967	AAG	.	.	none		0.577	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081649.2	NM_001493	
SYNE1	23345	hgsc.bcm.edu	37	6	152671306	152671306	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:152671306G>C	ENST00000367255.5	-	72	12499	c.11898C>G	c.(11896-11898)caC>caG	p.H3966Q	SYNE1_ENST00000423061.1_Intron|SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000341594.5_Missense_Mutation_p.H3890Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.H3966Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3966					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGGGTACCTTGTGGTGGGCCA	0.562										HNSCC(10;0.0054)																											p.H3966Q		Atlas-SNP	.											.	SYNE1	3227	.	0			c.C11898G						PASS	.						98.0	87.0	91.0					6																	152671306		2203	4300	6503	SO:0001583	missense	23345	exon72			TACCTTGTGGTGG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11898C>G	6.37:g.152671306G>C	ENSP00000356224:p.His3966Gln	83.0	0.0	0		61.0	13.0	0.213115	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022767	0.35701	.	.	ENSG00000131018	ENST00000367255;ENST00000265368;ENST00000341594	T;T;T	0.43294	0.95;0.95;0.95	5.61	2.8	0.32819	.	0.089810	0.48767	N	0.000173	T	0.20210	0.0486	M	0.64997	1.995	0.80722	D	1	P;P;P	0.44478	0.836;0.836;0.836	B;B;B	0.42138	0.377;0.377;0.377	T	0.10497	-1.0627	10	0.12766	T	0.61	.	9.0358	0.36287	0.0673:0.0:0.5578:0.3749	.	3966;3966;3966	B7ZBC3;Q8NF91;E7EQI5	.;SYNE1_HUMAN;.	Q	3966;3966;3890	ENSP00000356224:H3966Q;ENSP00000265368:H3966Q;ENSP00000341887:H3890Q	ENSP00000265368:H3966Q	H	-	3	2	SYNE1	152712999	1.000000	0.71417	0.987000	0.45799	0.958000	0.62258	3.159000	0.50731	0.288000	0.22398	0.561000	0.74099	CAC	.	.	none		0.562	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SCRN2	90507	hgsc.bcm.edu	37	17	45915662	45915662	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:45915662C>A	ENST00000290216.9	-	7	1218	c.1093G>T	c.(1093-1095)Gcc>Tcc	p.A365S	SCRN2_ENST00000407215.3_Missense_Mutation_p.A365S|SCRN2_ENST00000584123.1_Missense_Mutation_p.A373S	NM_001145023.1|NM_138355.3	NP_001138495.1|NP_612364.2	Q96FV2	SCRN2_HUMAN	secernin 2	365						extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)			cervix(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	14						AGCCCCAGGGCTGCCTGGTGT	0.597																																					p.A365S		Atlas-SNP	.											.	SCRN2	35	.	0			c.G1093T						PASS	.						59.0	60.0	59.0					17																	45915662		2203	4300	6503	SO:0001583	missense	90507	exon7			CCAGGGCTGCCTG	BC002980	CCDS11519.1, CCDS45723.1	17q21	2008-02-05							30381	protein-coding gene	gene with protein product		614966				12221138	Standard	NM_001145023		Approved		uc002imd.3	Q96FV2		ENST00000290216.9:c.1093G>T	17.37:g.45915662C>A	ENSP00000290216:p.Ala365Ser	72.0	0.0	0		48.0	14.0	0.291667	NM_138355	A8K3N1|B7Z8S7|E9PBV5|Q96AC3|Q9BU04	Missense_Mutation	SNP	ENST00000290216.9	37	CCDS11519.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.850840	0.91277	.	.	ENSG00000141295	ENST00000290216;ENST00000407215	T;T	0.10573	3.09;2.86	5.66	5.66	0.87406	.	0.046551	0.85682	D	0.000000	T	0.39708	0.1088	M	0.85041	2.73	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.991;0.994;0.991	T	0.24225	-1.0166	10	0.56958	D	0.05	-23.5455	18.5098	0.90911	0.0:1.0:0.0:0.0	.	365;365;365	E9PBV5;Q96FV2;B7Z8S7	.;SCRN2_HUMAN;.	S	365	ENSP00000290216:A365S;ENSP00000383935:A365S	ENSP00000290216:A365S	A	-	1	0	SCRN2	43270661	1.000000	0.71417	0.975000	0.42487	0.775000	0.43874	5.320000	0.65841	2.675000	0.91044	0.655000	0.94253	GCC	.	.	none		0.597	SCRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441383.1	NM_138355	
ZNF804B	219578	hgsc.bcm.edu	37	7	88956767	88956767	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr7:88956767A>C	ENST00000333190.4	+	3	968	c.359A>C	c.(358-360)gAg>gCg	p.E120A		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	120							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CAGCTGGCTGAGTTAAGGCAG	0.383										HNSCC(36;0.09)																											p.E120A		Atlas-SNP	.											.	ZNF804B	322	.	0			c.A359C						PASS	.						95.0	95.0	95.0					7																	88956767		2203	4300	6503	SO:0001583	missense	219578	exon3			TGGCTGAGTTAAG	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.359A>C	7.37:g.88956767A>C	ENSP00000329638:p.Glu120Ala	90.0	0.0	0		94.0	12.0	0.12766	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.776991	0.90195	.	.	ENSG00000182348	ENST00000333190	T	0.23348	1.91	5.04	5.04	0.67666	.	0.095683	0.45126	D	0.000385	T	0.42314	0.1197	M	0.77486	2.375	0.41418	D	0.987787	D	0.59767	0.986	P	0.50659	0.647	T	0.50533	-0.8817	10	0.72032	D	0.01	-12.1328	15.2309	0.73386	1.0:0.0:0.0:0.0	.	120	A4D1E1	Z804B_HUMAN	A	120	ENSP00000329638:E120A	ENSP00000329638:E120A	E	+	2	0	ZNF804B	88794703	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.105000	0.77031	2.239000	0.73571	0.528000	0.53228	GAG	.	.	none		0.383	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
PRCC	5546	hgsc.bcm.edu	37	1	156737930	156737930	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:156737930C>T	ENST00000271526.4	+	1	639	c.367C>T	c.(367-369)Ccc>Tcc	p.P123S	PRCC_ENST00000491853.1_Intron|PRCC_ENST00000353233.3_Missense_Mutation_p.P123S|HDGF_ENST00000465180.1_5'Flank	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	123					mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CCTCAATCTGCCCCCTCCAAT	0.677			T	TFE3	papillary renal																																p.P123S		Atlas-SNP	.		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	.	PRCC	39	.	0			c.C367T						PASS	.						7.0	10.0	9.0					1																	156737930		2157	4211	6368	SO:0001583	missense	5546	exon1			AATCTGCCCCCTC	X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.367C>T	1.37:g.156737930C>T	ENSP00000271526:p.Pro123Ser	46.0	0.0	0		39.0	6.0	0.153846	NM_005973	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	ENST00000271526.4	37	CCDS1157.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.398085	0.25205	.	.	ENSG00000143294	ENST00000271526;ENST00000353233;ENST00000368201	T;T	0.66638	-0.22;-0.22	4.95	4.95	0.65309	.	0.336600	0.28766	N	0.014210	T	0.32071	0.0817	L	0.36672	1.1	0.48135	D	0.999597	B;B	0.17038	0.02;0.02	B;B	0.11329	0.006;0.006	T	0.13899	-1.0492	10	0.07030	T	0.85	-2.1728	9.1785	0.37127	0.0:0.9036:0.0:0.0964	.	123;123	A6NG79;Q92733	.;PRCC_HUMAN	S	123;123;67	ENSP00000271526:P123S;ENSP00000339300:P123S	ENSP00000271526:P123S	P	+	1	0	PRCC	155004554	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.096000	0.41738	2.576000	0.86940	0.655000	0.94253	CCC	.	.	none		0.677	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098941.2	NM_005973	
C1S	716	hgsc.bcm.edu	37	12	7173133	7173133	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:7173133G>C	ENST00000406697.1	+	10	1358	c.730G>C	c.(730-732)Gat>Cat	p.D244H	C1S_ENST00000402681.3_Missense_Mutation_p.D77H|C1S_ENST00000360817.5_Missense_Mutation_p.D244H|C1S_ENST00000328916.3_Missense_Mutation_p.D244H			P09871	C1S_HUMAN	complement component 1, s subcomponent	244	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	33					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	TGTTGCAGGAGATCGGCAATT	0.393																																					p.D244H	GBM(156;750 1943 12971 24779 31015)	Atlas-SNP	.											.	C1S	93	.	0			c.G730C						PASS	.						152.0	140.0	144.0					12																	7173133		2203	4300	6503	SO:0001583	missense	716	exon7			GCAGGAGATCGGC		CCDS31735.1	12p13	2014-09-17			ENSG00000182326	ENSG00000182326	3.4.21.42	"""Complement system"""	1247	protein-coding gene	gene with protein product		120580					Standard	NM_201442		Approved		uc001qsl.3	P09871	OTTHUMG00000150305	ENST00000406697.1:c.730G>C	12.37:g.7173133G>C	ENSP00000385035:p.Asp244His	108.0	0.0	0		91.0	11.0	0.120879	NM_201442	D3DUT4|Q9UCU7|Q9UCU8|Q9UCU9|Q9UCV0|Q9UCV1|Q9UCV2|Q9UCV3|Q9UCV4|Q9UCV5|Q9UM14	Missense_Mutation	SNP	ENST00000406697.1	37	CCDS31735.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911718	0.33721	.	.	ENSG00000182326	ENST00000406697;ENST00000328916;ENST00000360817;ENST00000382222;ENST00000402681;ENST00000542978	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.75	-2.25	0.06888	CUB (5);	0.494197	0.17083	N	0.187681	T	0.26011	0.0634	L	0.46885	1.475	0.09310	N	1	P	0.45126	0.851	P	0.51055	0.657	T	0.19451	-1.0305	10	0.52906	T	0.07	.	12.5694	0.56328	0.732:0.0:0.268:0.0	.	244	P09871	C1S_HUMAN	H	244;244;244;232;77;77	ENSP00000385035:D244H;ENSP00000328173:D244H;ENSP00000354057:D244H;ENSP00000384171:D77H;ENSP00000442298:D77H	ENSP00000328173:D244H	D	+	1	0	C1S	7043394	0.002000	0.14202	0.003000	0.11579	0.432000	0.31715	-0.406000	0.07187	-0.499000	0.06623	0.561000	0.74099	GAT	.	.	none		0.393	C1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317481.1	NM_001734	
SLC13A5	284111	hgsc.bcm.edu	37	17	6607294	6607294	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:6607294G>A	ENST00000433363.2	-	4	683	c.450C>T	c.(448-450)ccC>ccT	p.P150P	SLC13A5_ENST00000573648.1_Silent_p.P150P|SLC13A5_ENST00000293800.6_Silent_p.P133P|SLC13A5_ENST00000381074.4_Silent_p.P107P	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	150					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						CCTCCACGATGGGCACCATCA	0.637																																					p.P150P		Atlas-SNP	.											.	SLC13A5	57	.	0			c.C450T						PASS	.						54.0	47.0	49.0					17																	6607294		2203	4300	6503	SO:0001819	synonymous_variant	284111	exon4			CACGATGGGCACC	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.450C>T	17.37:g.6607294G>A		48.0	0.0	0		23.0	6.0	0.26087	NM_001143838	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Silent	SNP	ENST00000433363.2	37	CCDS11079.1																																																																																			.	.	none		0.637	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219853.2	NM_177550	
NOX4	50507	hgsc.bcm.edu	37	11	89059934	89059934	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:89059934G>T	ENST00000263317.4	-	18	1965	c.1727C>A	c.(1726-1728)tCt>tAt	p.S576Y	NOX4_ENST00000527626.1_Missense_Mutation_p.S389Y|NOX4_ENST00000413594.2_Missense_Mutation_p.S597Y|NOX4_ENST00000375979.3_Missense_Mutation_p.S269Y|NOX4_ENST00000532825.1_Missense_Mutation_p.S512Y|NOX4_ENST00000424319.1_Missense_Mutation_p.S552Y|NOX4_ENST00000531342.1_Missense_Mutation_p.S229Y|NOX4_ENST00000527956.1_Missense_Mutation_p.S552Y|NOX4_ENST00000343727.5_Missense_Mutation_p.S552Y|NOX4_ENST00000542487.1_Missense_Mutation_p.S552Y|NOX4_ENST00000535633.1_Missense_Mutation_p.S552Y|NOX4_ENST00000534731.1_Missense_Mutation_p.S536Y|NOX4_ENST00000525196.1_Missense_Mutation_p.S340Y|NOX4_ENST00000528341.1_Missense_Mutation_p.S551Y			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	576					bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TCAGCTGAAAGACTCTTTATT	0.383																																					p.S576Y		Atlas-SNP	.											.	NOX4	101	.	0			c.C1727A						PASS	.						93.0	94.0	93.0					11																	89059934		2201	4299	6500	SO:0001583	missense	50507	exon18			CTGAAAGACTCTT	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1727C>A	11.37:g.89059934G>T	ENSP00000263317:p.Ser576Tyr	128.0	0.0	0		101.0	21.0	0.207921	NM_016931	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.774968	0.49786	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.95377	-3.64;-3.64;-3.64;-3.6;-3.63;-3.56;-3.69;-3.64;-3.64;-3.41;-3.61;-3.67;-3.05;-3.0	4.1	4.1	0.47936	.	0.067280	0.64402	D	0.000010	D	0.95778	0.8626	L	0.31845	0.965	0.49798	D	0.999821	B;P;D;D;D;D;D;B	0.76494	0.367;0.885;0.999;0.999;0.997;0.998;0.968;0.242	B;P;D;D;D;D;P;B	0.78314	0.097;0.513;0.979;0.988;0.991;0.935;0.693;0.186	D	0.95144	0.8266	9	.	.	.	-10.1463	16.6923	0.85325	0.0:0.0:1.0:0.0	.	512;389;551;340;229;269;536;576	E9PMY6;E9PR43;E9PPP2;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;.;NOX4_HUMAN	Y	552;552;552;536;340;576;512;552;552;389;551;597;229;269	ENSP00000412446:S552Y;ENSP00000440172:S552Y;ENSP00000344747:S552Y;ENSP00000436892:S536Y;ENSP00000436716:S340Y;ENSP00000263317:S576Y;ENSP00000434924:S512Y;ENSP00000433797:S552Y;ENSP00000439373:S552Y;ENSP00000436093:S389Y;ENSP00000436970:S551Y;ENSP00000405705:S597Y;ENSP00000435039:S229Y;ENSP00000365146:S269Y	.	S	-	2	0	NOX4	88699582	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	8.051000	0.89446	1.991000	0.58162	0.467000	0.42956	TCT	.	.	none		0.383	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
MN1	4330	hgsc.bcm.edu	37	22	28194930	28194930	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr22:28194930C>T	ENST00000302326.4	-	1	2556	c.1602G>A	c.(1600-1602)caG>caA	p.Q534Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	534	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q550_R551insQ(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgttgctgct	0.647			T	ETV6	"""AML, meningioma"""																																p.Q534Q		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	MN1,colon,carcinoma,0,4	MN1	122	4	1	Insertion - In frame(1)	prostate(1)	c.G1602A						scavenged	.						4.0	5.0	5.0					22																	28194930		1760	3656	5416	SO:0001819	synonymous_variant	4330	exon1			CTGCTGCTGTTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1602G>A	22.37:g.28194930C>T		65.0	1.0	0.0153846		52.0	8.0	0.153846	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			C|0.958;T|0.042	0.042	strong		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
HIST4H4	121504	hgsc.bcm.edu	37	12	14923952	14923952	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:14923952G>T	ENST00000539745.1	-	1	113	c.67C>A	c.(67-69)Ctg>Atg	p.L23M	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	23					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						TTGTCCCGCAGCACCTTCCGG	0.597											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L23M		Atlas-SNP	.											.	HIST4H4	13	.	0			c.C67A						PASS	.						51.0	57.0	55.0					12																	14923952		2203	4300	6503	SO:0001583	missense	121504	exon1			CCCGCAGCACCTT	AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.67C>A	12.37:g.14923952G>T	ENSP00000443017:p.Leu23Met	63.0	0.0	0	698	59.0	12.0	0.20339	NM_175054	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000539745.1	37	CCDS8665.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418716	0.25552	.	.	ENSG00000197837	ENST00000539745	.	.	.	4.18	-7.5	0.01351	.	0.000000	0.45126	U	0.000396	T	0.60919	0.2306	.	.	.	0.23712	N	0.997046	.	.	.	.	.	.	T	0.65450	-0.6165	6	0.66056	D	0.02	.	21.8368	0.99962	0.1506:0.0:0.8494:0.0	.	.	.	.	M	23	.	ENSP00000350767:L23M	L	-	1	2	HIST4H4	14815219	0.797000	0.28877	0.000000	0.03702	0.002000	0.02628	1.140000	0.31516	-2.027000	0.00932	-1.847000	0.00572	CTG	.	.	none		0.597	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400844.1	NM_175054	
KLF2	10365	hgsc.bcm.edu	37	19	16436806	16436806	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:16436806G>C	ENST00000248071.5	+	2	962	c.855G>C	c.(853-855)aaG>aaC	p.K285N	CTD-2562J15.6_ENST00000588799.1_RNA|KLF2_ENST00000592003.1_Intron	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2	285					cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						CCTACACCAAGAGTTCGCATC	0.692																																					p.K285N		Atlas-SNP	.											.	KLF2	10	.	0			c.G855C						PASS	.						10.0	6.0	7.0					19																	16436806		2111	4164	6275	SO:0001583	missense	10365	exon2			CACCAAGAGTTCG	AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.855G>C	19.37:g.16436806G>C	ENSP00000248071:p.Lys285Asn	35.0	0.0	0		31.0	9.0	0.290323	NM_016270	Q6IPC4|Q9UJS5|Q9UKR6	Missense_Mutation	SNP	ENST00000248071.5	37	CCDS12343.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.944729	0.53079	.	.	ENSG00000127528	ENST00000248071	T	0.36157	1.27	3.44	3.44	0.39384	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.59542	0.2201	M	0.78049	2.395	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.67248	-0.5718	9	0.87932	D	0	.	14.2198	0.65818	0.0:0.0:1.0:0.0	.	285	Q9Y5W3	KLF2_HUMAN	N	285	ENSP00000248071:K285N	ENSP00000248071:K285N	K	+	3	2	KLF2	16297806	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	6.161000	0.71868	1.627000	0.50400	0.460000	0.39030	AAG	.	.	none		0.692	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460562.1		
OR10X1	128367	hgsc.bcm.edu	37	1	158549535	158549535	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:158549535A>G	ENST00000368150.1	-	1	154	c.155T>C	c.(154-156)cTt>cCt	p.L52P		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					AAGGGTGAGAAGGTAGAGACA	0.443																																					p.L52P		Atlas-SNP	.											.	OR10X1	96	.	0			c.T155C						PASS	.						126.0	124.0	125.0					1																	158549535		2203	4300	6503	SO:0001583	missense	128367	exon1			GTGAGAAGGTAGA	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.155T>C	1.37:g.158549535A>G	ENSP00000357132:p.Leu52Pro	89.0	0.0	0		89.0	8.0	0.0898876	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	37	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	A	19.93	3.918114	0.73098	.	.	ENSG00000186400	ENST00000368150	T	0.05786	3.39	5.13	5.13	0.70059	.	0.725423	0.11934	N	0.515453	T	0.14056	0.0340	M	0.87038	2.855	0.33910	D	0.639626	D	0.58620	0.983	P	0.52909	0.713	T	0.03463	-1.1034	10	0.87932	D	0	.	14.0613	0.64802	1.0:0.0:0.0:0.0	.	52	Q8NGY0	O10X1_HUMAN	P	52	ENSP00000357132:L52P	ENSP00000357132:L52P	L	-	2	0	OR10X1	156816159	0.487000	0.25988	0.233000	0.24025	0.993000	0.82548	5.407000	0.66363	2.139000	0.66308	0.528000	0.53228	CTT	.	.	none		0.443	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
HIST1H3I	8354	hgsc.bcm.edu	37	6	27839875	27839875	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:27839875C>T	ENST00000328488.2	-	1	224	c.219G>A	c.(217-219)cgG>cgA	p.R73R		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	73					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GTGCGATCTCCCGTACCAAGC	0.632																																					p.R73R		Atlas-SNP	.											.	HIST1H3I	28	.	0			c.G219A						PASS	.						82.0	87.0	85.0					6																	27839875		2203	4300	6503	SO:0001819	synonymous_variant	8354	exon1			GATCTCCCGTACC	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.219G>A	6.37:g.27839875C>T		151.0	0.0	0		154.0	60.0	0.38961	NM_003533	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000328488.2	37	CCDS4636.1																																																																																			.	.	none		0.632	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	NM_003533	
GADD45B	4616	hgsc.bcm.edu	37	19	2476602	2476602	+	Silent	SNP	G	G	A	rs544016078	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:2476602G>A	ENST00000215631.4	+	2	352	c.120G>A	c.(118-120)gtG>gtA	p.V40V	GADD45B_ENST00000587345.1_Silent_p.V40V	NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	40					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTGGGGGTGTACGAGTCGG	0.652											OREG0025141	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0008	0.0	5008	,	,		14231	0.001		0.0	False		,,,				2504	0.0				p.V40V		Atlas-SNP	.											.	GADD45B	6	.	0			c.G120A						PASS	.						76.0	65.0	69.0					19																	2476602		2203	4300	6503	SO:0001819	synonymous_variant	4616	exon2			GGGGGTGTACGAG	AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.120G>A	19.37:g.2476602G>A		76.0	0.0	0	603	66.0	12.0	0.181818	NM_015675	A8KAM2|O75960|Q17R46	Silent	SNP	ENST00000215631.4	37	CCDS32868.1																																																																																			.	.	none		0.652	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451337.1	NM_015675	
HIST1H2BN	8341	hgsc.bcm.edu	37	6	27806574	27806574	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:27806574G>A	ENST00000396980.3	+	1	135	c.135G>A	c.(133-135)gtG>gtA	p.V45V	HIST1H2AK_ENST00000330180.2_5'Flank|HIST1H2BN_ENST00000606613.1_Silent_p.V45V	NM_003520.3	NP_003511.1	Q99877	H2B1N_HUMAN	histone cluster 1, H2bn	45					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(3)|lung(3)|prostate(1)	8						TGTACAAGGTGCTGAAGCAGG	0.577																																					p.V45V		Atlas-SNP	.											.	HIST1H2BN	11	.	0			c.G135A						PASS	.						227.0	205.0	212.0					6																	27806574		2203	4298	6501	SO:0001819	synonymous_variant	8341	exon1			CAAGGTGCTGAAG	Z83336	CCDS4633.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000233822	ENSG00000233822		"""Histones / Replication-dependent"""	4749	protein-coding gene	gene with protein product		602801	"""H2B histone family, member D"", ""histone 1, H2bn"""	H2BFD		9439656, 12408966	Standard	NM_003520		Approved	H2B/d	uc003njv.3	Q99877	OTTHUMG00000016397	ENST00000396980.3:c.135G>A	6.37:g.27806574G>A		108.0	0.0	0		113.0	22.0	0.19469	NM_003520	B2R5L4|Q494S8|Q96FB7	Silent	SNP	ENST00000396980.3	37	CCDS4633.1																																																																																			.	.	none		0.577	HIST1H2BN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043840.2	NM_003520	
PTPN6	5777	hgsc.bcm.edu	37	12	7061240	7061240	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:7061240G>C	ENST00000318974.9	+	3	470	c.226G>C	c.(226-228)Gtg>Ctg	p.V76L	PTPN6_ENST00000456013.1_Missense_Mutation_p.V76L|PTPN6_ENST00000399448.1_Missense_Mutation_p.V78L|PTPN6_ENST00000447931.2_Missense_Mutation_p.V37L	NM_002831.5	NP_002822.2	P29350	PTN6_HUMAN	protein tyrosine phosphatase, non-receptor type 6	76	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|apoptotic process (GO:0006915)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|G-protein coupled receptor signaling pathway (GO:0007186)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|natural killer cell mediated cytotoxicity (GO:0042267)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell proliferation (GO:0008285)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein dephosphorylation (GO:0006470)|regulation of B cell differentiation (GO:0045577)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|type I interferon signaling pathway (GO:0060337)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|prostate(3)	18						GACAGAGCTGGTGGAGTACTA	0.567																																					p.V78L		Atlas-SNP	.											.	PTPN6	42	.	0			c.G232C						PASS	.						106.0	124.0	118.0					12																	7061240		2201	4298	6499	SO:0001583	missense	5777	exon3			GAGCTGGTGGAGT		CCDS41744.1, CCDS44820.1, CCDS44821.1	12p13.31	2013-02-14			ENSG00000111679	ENSG00000111679		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9658	protein-coding gene	gene with protein product		176883				1639416	Standard	NM_080548		Approved	HCP, HCPH, PTP-1C, SHP-1, SHP1	uc001qsa.1	P29350	OTTHUMG00000168518	ENST00000318974.9:c.226G>C	12.37:g.7061240G>C	ENSP00000326010:p.Val76Leu	112.0	0.0	0		83.0	11.0	0.13253	NM_080548	A8K306|G3V0F8|Q969V8|Q9UK67	Missense_Mutation	SNP	ENST00000318974.9	37	CCDS44820.1	.	.	.	.	.	.	.	.	.	.	G	34	5.389101	0.95988	.	.	ENSG00000111679	ENST00000543115;ENST00000399448;ENST00000447931;ENST00000538715;ENST00000318974;ENST00000456013;ENST00000536521;ENST00000541698;ENST00000542462	D;D;D;D;D;D;D;D;D	0.97752	-4.52;-4.52;-4.52;-4.52;-4.52;-4.52;-4.52;-4.52;-4.52	4.86	4.86	0.63082	SH2 motif (5);	0.000000	0.64402	D	0.000001	D	0.98457	0.9486	M	0.82323	2.585	0.80722	D	1	D;P;P;P;D	0.63880	0.993;0.94;0.885;0.906;0.957	P;P;P;P;P	0.59056	0.755;0.65;0.67;0.778;0.851	D	0.99133	1.0853	10	0.54805	T	0.06	.	18.0136	0.89232	0.0:0.0:1.0:0.0	.	64;37;76;76;78	B4DPS0;P29350-2;G3V0F8;P29350;Q53XS4	.;.;.;PTN6_HUMAN;.	L	97;78;37;76;76;76;76;76;35	ENSP00000443393:V97L;ENSP00000382376:V78L;ENSP00000415979:V37L;ENSP00000438740:V76L;ENSP00000326010:V76L;ENSP00000391592:V76L;ENSP00000444337:V76L;ENSP00000445646:V76L;ENSP00000440114:V35L	ENSP00000326010:V76L	V	+	1	0	PTPN6	6931501	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.869000	0.99810	2.253000	0.74438	0.561000	0.74099	GTG	.	.	none		0.567	PTPN6-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400023.1	NM_002831	
ANK2	287	hgsc.bcm.edu	37	4	114290944	114290944	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr4:114290944G>A	ENST00000357077.4	+	43	11646	c.11593G>A	c.(11593-11595)Gat>Aat	p.D3865N	ANK2_ENST00000394537.3_Missense_Mutation_p.D1780N|ANK2_ENST00000506722.1_Missense_Mutation_p.D1771N|ANK2_ENST00000264366.6_Missense_Mutation_p.D3832N|ANK2_ENST00000509550.1_Missense_Mutation_p.D956N|ANK2_ENST00000510275.2_Missense_Mutation_p.D432N	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3865					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACTCGATGAAGATGCAGCTTT	0.468																																					p.D3865N		Atlas-SNP	.											.	ANK2	576	.	0			c.G11593A						PASS	.						91.0	83.0	86.0					4																	114290944		2203	4300	6503	SO:0001583	missense	287	exon43			GATGAAGATGCAG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.11593G>A	4.37:g.114290944G>A	ENSP00000349588:p.Asp3865Asn	90.0	0.0	0		84.0	15.0	0.178571	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.40|16.40	3.114027|3.114027	0.56398|0.56398	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342|ENST00000514960	T;T;T;T;T;D;D|.	0.96300|.	-0.27;-0.25;-0.32;-0.33;-1.04;-2.0;-3.97|.	5.63|5.63	4.79|4.79	0.61399|0.61399	.|.	0.328121|.	0.25631|.	N|.	0.029352|.	T|T	0.53965|0.53965	0.1829|0.1829	L|L	0.54323|0.54323	1.7|1.7	0.25795|0.25795	N|N	0.984572|0.984572	B;B;B;B;P;B|.	0.48503|.	0.321;0.01;0.094;0.0;0.911;0.016|.	B;B;B;B;P;B|.	0.52646|.	0.101;0.01;0.054;0.001;0.705;0.04|.	T|T	0.48559|0.48559	-0.9025|-0.9025	10|5	0.44086|.	T|.	0.13|.	.|.	15.041|15.041	0.71791|0.71791	0.0689:0.0:0.9311:0.0|0.0689:0.0:0.9311:0.0	.|.	956;815;781;1780;3865;1771|.	E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;.;.;.;.;.|.	N|K	1771;815;1780;3865;3832;1771;956;432;875|781	ENSP00000421067:D1771N;ENSP00000378044:D1780N;ENSP00000349588:D3865N;ENSP00000264366:D3832N;ENSP00000426944:D956N;ENSP00000421023:D432N;ENSP00000422498:D875N|.	ENSP00000264366:D3832N|.	D|R	+|+	1|2	0|0	ANK2|ANK2	114510393|114510393	1.000000|1.000000	0.71417|0.71417	0.042000|0.042000	0.18584|0.18584	0.149000|0.149000	0.21700|0.21700	4.966000|4.966000	0.63715|0.63715	1.517000|1.517000	0.48917|0.48917	-0.157000|-0.157000	0.13467|0.13467	GAT|AGA	.	.	none		0.468	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
RIMS2	9699	hgsc.bcm.edu	37	8	105263908	105263908	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr8:105263908G>C	ENST00000436393.2	+	28	4205	c.3964G>C	c.(3964-3966)Gag>Cag	p.E1322Q	RIMS2_ENST00000339750.2_Missense_Mutation_p.E240Q|RIMS2_ENST00000507740.1_Missense_Mutation_p.E1118Q|RIMS2_ENST00000406091.3_Missense_Mutation_p.E1304Q|RIMS2_ENST00000262231.10_Missense_Mutation_p.E1143Q			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1366	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGATGAACTAGAGCTATCCAA	0.448										HNSCC(12;0.0054)																											p.E1304Q		Atlas-SNP	.											.	RIMS2	1357	.	0			c.G3910C						PASS	.						166.0	164.0	165.0					8																	105263908		1887	4136	6023	SO:0001583	missense	9699	exon24			GAACTAGAGCTAT	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3964G>C	8.37:g.105263908G>C	ENSP00000390665:p.Glu1322Gln	125.0	0.0	0		130.0	23.0	0.176923	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	37		.	.	.	.	.	.	.	.	.	.	G	15.52	2.857994	0.51376	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.64	5.64	0.86602	.	.	.	.	.	T	0.65502	0.2697	N	0.14661	0.345	0.58432	D	0.999992	P;B;B;P	0.39480	0.534;0.241;0.241;0.675	B;B;B;B	0.37888	0.107;0.192;0.192;0.26	T	0.64257	-0.6450	9	0.23302	T	0.38	.	19.6939	0.96016	0.0:0.0:1.0:0.0	.	1322;1143;1118;1304	D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	.;.;.;.	Q	1341;1304;1366;1143;1118;1322;240;240	ENSP00000384892:E1304Q;ENSP00000262231:E1143Q;ENSP00000423559:E1118Q;ENSP00000390665:E1322Q;ENSP00000428478:E240Q;ENSP00000342051:E240Q	ENSP00000262231:E1143Q	E	+	1	0	RIMS2	105333084	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.857000	0.99534	2.660000	0.90430	0.655000	0.94253	GAG	.	.	none		0.448	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
IRF4	3662	hgsc.bcm.edu	37	6	393348	393348	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:393348G>A	ENST00000380956.4	+	2	322	c.196G>A	c.(196-198)Gag>Aag	p.E66K	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	66					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CAACCGCGAGGAGGACGCCGC	0.721			T	IGH@	MM																																p.E66K		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.G196A						PASS	.						22.0	20.0	21.0					6																	393348		2199	4300	6499	SO:0001583	missense	3662	exon2			CGCGAGGAGGACG	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.196G>A	6.37:g.393348G>A	ENSP00000370343:p.Glu66Lys	96.0	0.0	0		117.0	49.0	0.418803	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	37	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466289	0.84425	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.97731	-4.51	4.58	4.58	0.56647	Interferon regulatory factor, conserved site (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (3);	0.099647	0.64402	D	0.000002	D	0.96870	0.8978	L	0.33189	0.99	0.80722	D	1	P;B;D	0.65815	0.798;0.379;0.995	P;P;D	0.74348	0.889;0.612;0.983	D	0.95508	0.8583	10	0.20046	T	0.44	-25.9593	17.6301	0.88104	0.0:0.0:1.0:0.0	.	66;66;66	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	K	66;96	ENSP00000370343:E66K	ENSP00000370343:E66K	E	+	1	0	IRF4	338348	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.728000	0.91484	2.399000	0.81585	0.306000	0.20318	GAG	.	.	none		0.721	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
HIST1H4H	8365	hgsc.bcm.edu	37	6	26285420	26285420	+	Missense_Mutation	SNP	C	C	T	rs377418572		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26285420C>T	ENST00000377727.1	-	1	317	c.308G>A	c.(307-309)gGc>gAc	p.G103D	HIST1H4H_ENST00000289352.1_Missense_Mutation_p.G103D	NM_003543.3	NP_003534.1	P62805	H4_HUMAN	histone cluster 1, H4h	103					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(2)|ovary(2)|upper_aerodigestive_tract(3)	7						GGAGCCTTAGCCACCGAAGCC	0.507										HNSCC(76;0.23)																											p.G103D		Atlas-SNP	.											.	HIST1H4H	16	.	0			c.G308A						PASS	.						118.0	103.0	108.0					6																	26285420		2203	4300	6503	SO:0001583	missense	8365	exon1			CCTTAGCCACCGA	X60487	CCDS4604.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158406	ENSG00000158406		"""Histones / Replication-dependent"""	4788	protein-coding gene	gene with protein product		602828	"""H4 histone family, member H"", ""histone 1, H4h"""	H4FH		9119399, 12408966	Standard	NM_003543		Approved	H4/h	uc003nhm.2	P62805	OTTHUMG00000014454	ENST00000377727.1:c.308G>A	6.37:g.26285420C>T	ENSP00000366956:p.Gly103Asp	89.0	0.0	0		95.0	38.0	0.4	NM_003543	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377727.1	37	CCDS4604.1	.	.	.	.	.	.	.	.	.	.	.	17.75	3.466993	0.63625	.	.	ENSG00000158406	ENST00000289352;ENST00000377727	.	.	.	4.13	4.13	0.48395	.	0.000000	0.52532	U	0.000072	T	0.67173	0.2865	.	.	.	0.39431	D	0.967073	.	.	.	.	.	.	T	0.73436	-0.3983	6	0.87932	D	0	.	14.2671	0.66126	0.0:1.0:0.0:0.0	.	.	.	.	D	103	.	ENSP00000289352:G103D	G	-	2	0	HIST1H4H	26393399	1.000000	0.71417	0.878000	0.34440	0.015000	0.08874	7.702000	0.84576	2.034000	0.60081	0.313000	0.20887	GGC	.	.	alt		0.507	HIST1H4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040119.1	NM_003543	
KLF2	10365	hgsc.bcm.edu	37	19	16436833	16436833	+	Silent	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:16436833C>G	ENST00000248071.5	+	2	989	c.882C>G	c.(880-882)cgC>cgG	p.R294R	CTD-2562J15.6_ENST00000588799.1_RNA|KLF2_ENST00000592003.1_Intron	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2	294					cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						CGCATCTGCGCACGCACACAG	0.662																																					p.R294R		Atlas-SNP	.											.	KLF2	10	.	0			c.C882G						PASS	.						8.0	5.0	6.0					19																	16436833		2066	4108	6174	SO:0001819	synonymous_variant	10365	exon2			TCTGCGCACGCAC	AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.882C>G	19.37:g.16436833C>G		33.0	0.0	0		28.0	9.0	0.321429	NM_016270	Q6IPC4|Q9UJS5|Q9UKR6	Silent	SNP	ENST00000248071.5	37	CCDS12343.1																																																																																			.	.	none		0.662	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460562.1		
IFT88	8100	hgsc.bcm.edu	37	13	21237643	21237643	+	Missense_Mutation	SNP	G	G	A	rs143840290	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr13:21237643G>A	ENST00000319980.6	+	25	2429	c.2102G>A	c.(2101-2103)cGt>cAt	p.R701H	IFT88_ENST00000382778.4_Silent_p.A742A|IFT88_ENST00000351808.5_Missense_Mutation_p.R692H|IFT88_ENST00000537103.1_Missense_Mutation_p.R673H	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	701					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)		p.R701H(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		TTAGGTCTGCGTTTCTTAGTT	0.338													G|||	6	0.00119808	0.0	0.0058	5008	,	,		18602	0.002		0.0	False		,,,				2504	0.0				p.R701H		Atlas-SNP	.											IFT88,caecum,carcinoma,0,1	IFT88	83	1	1	Substitution - Missense(1)	large_intestine(1)	c.G2102A						scavenged	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	105.0	99.0	101.0		2075,2102	5.8	1.0	13	dbSNP_134	101	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IFT88	NM_006531.3,NM_175605.3	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	692/825,701/834	21237643	1,13005	2203	4300	6503	SO:0001583	missense	8100	exon25			GTCTGCGTTTCTT	AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2102G>A	13.37:g.21237643G>A	ENSP00000323580:p.Arg701His	51.0	1.0	0.0196078		31.0	6.0	0.193548	NM_175605	A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	ENST00000319980.6	37	CCDS31944.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701816	0.88924	0.0	1.16E-4	ENSG00000032742	ENST00000351808;ENST00000319980;ENST00000537103	T;T;T	0.53206	0.63;0.63;0.63	5.84	5.84	0.93424	.	0.106704	0.64402	D	0.000004	T	0.72036	0.3411	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.78314	0.855;0.991	T	0.74090	-0.3777	10	0.66056	D	0.02	-12.7827	18.9266	0.92548	0.0:0.0:1.0:0.0	.	673;701	F5H6C2;Q13099	.;IFT88_HUMAN	H	692;701;673	ENSP00000261632:R692H;ENSP00000323580:R701H;ENSP00000437719:R673H	ENSP00000323580:R701H	R	+	2	0	IFT88	20135643	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.539000	0.82063	2.760000	0.94817	0.655000	0.94253	CGT	G|1.000;A|0.000	0.000	weak		0.338	IFT88-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044075.3	NM_006531	
HMCN1	83872	hgsc.bcm.edu	37	1	186039858	186039858	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:186039858C>A	ENST00000271588.4	+	52	8337	c.8108C>A	c.(8107-8109)tCt>tAt	p.S2703Y	HMCN1_ENST00000367492.2_Missense_Mutation_p.S2703Y	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2703	Ig-like C2-type 25.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCAATTCCTTCTGCCTCCCTC	0.413																																					p.S2703Y		Atlas-SNP	.											.	HMCN1	797	.	0			c.C8108A						PASS	.						125.0	118.0	121.0					1																	186039858		2203	4300	6503	SO:0001583	missense	83872	exon52			TTCCTTCTGCCTC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8108C>A	1.37:g.186039858C>A	ENSP00000271588:p.Ser2703Tyr	126.0	0.0	0		131.0	23.0	0.175573	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283237	0.59867	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68025	-0.3;-0.3	5.71	4.8	0.61643	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.394599	0.30879	N	0.008695	T	0.72859	0.3513	L	0.42686	1.345	0.29164	N	0.877576	D	0.76494	0.999	D	0.85130	0.997	T	0.67476	-0.5661	10	0.46703	T	0.11	.	8.9824	0.35972	0.0:0.7805:0.0:0.2195	.	2703	Q96RW7	HMCN1_HUMAN	Y	2703	ENSP00000271588:S2703Y;ENSP00000356462:S2703Y	ENSP00000271588:S2703Y	S	+	2	0	HMCN1	184306481	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.172000	0.50832	1.410000	0.46936	0.655000	0.94253	TCT	.	.	none		0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HIST1H1D	3007	hgsc.bcm.edu	37	6	26234570	26234570	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26234570G>A	ENST00000244534.5	-	1	646	c.592C>T	c.(592-594)Ccc>Tcc	p.P198S		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	198					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GCCGCCTTGGGCTTAGGGGCT	0.532																																					p.P198S		Atlas-SNP	.											.	HIST1H1D	40	.	0			c.C592T						PASS	.						82.0	89.0	86.0					6																	26234570		2203	4300	6503	SO:0001583	missense	3007	exon1			CCTTGGGCTTAGG	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.592C>T	6.37:g.26234570G>A	ENSP00000244534:p.Pro198Ser	98.0	0.0	0		117.0	35.0	0.299145	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	6.207	0.406380	0.11754	.	.	ENSG00000124575	ENST00000244534	T	0.23147	1.92	5.12	2.17	0.27698	.	0.556195	0.18052	N	0.153226	T	0.05823	0.0152	N	0.08118	0	0.40794	D	0.98328	B	0.27853	0.191	B	0.30943	0.122	T	0.24905	-1.0147	10	0.21014	T	0.42	-9.1084	15.3281	0.74182	0.0:0.399:0.601:0.0	.	198	P16402	H13_HUMAN	S	198	ENSP00000244534:P198S	ENSP00000244534:P198S	P	-	1	0	HIST1H1D	26342549	1.000000	0.71417	0.919000	0.36401	0.065000	0.16274	3.426000	0.52778	0.213000	0.20722	0.650000	0.86243	CCC	.	.	none		0.532	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
RHBG	57127	hgsc.bcm.edu	37	1	156347192	156347192	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:156347192G>A	ENST00000368249.1	+	2	326	c.288G>A	c.(286-288)ctG>ctA	p.L96L	RHBG_ENST00000537040.1_Intron|RHBG_ENST00000400992.2_Silent_p.L27L|RHBG_ENST00000368246.2_Silent_p.L96L|RHBG_ENST00000255013.3_Silent_p.L27L|RHBG_ENST00000451864.2_Silent_p.L27L	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	96					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CCTTCCTCCTGGCCGCCTTTG	0.622																																					p.L96L		Atlas-SNP	.											.	RHBG	133	.	0			c.G288A						PASS	.						113.0	117.0	116.0					1																	156347192		2200	4300	6500	SO:0001819	synonymous_variant	57127	exon2			CCTCCTGGCCGCC	AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.288G>A	1.37:g.156347192G>A		90.0	0.0	0		76.0	12.0	0.157895	NM_020407	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Silent	SNP	ENST00000368249.1	37																																																																																				.	.	none		0.622	RHBG-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000060589.2	NM_001256395	
SEMA3D	223117	hgsc.bcm.edu	37	7	84629120	84629120	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr7:84629120T>C	ENST00000284136.6	-	17	2013	c.1970A>G	c.(1969-1971)aAg>aGg	p.K657R	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	657	Ig-like C2-type.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						AGAATCCTTCTTCTGCAAACT	0.393																																					p.K657R	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											.	SEMA3D	177	.	0			c.A1970G						PASS	.						67.0	60.0	62.0					7																	84629120		2203	4300	6503	SO:0001583	missense	223117	exon17			TCCTTCTTCTGCA	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1970A>G	7.37:g.84629120T>C	ENSP00000284136:p.Lys657Arg	89.0	0.0	0		62.0	12.0	0.193548	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	37	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	T	1.767	-0.485356	0.04352	.	.	ENSG00000153993	ENST00000284136	T	0.64438	-0.1	5.83	4.68	0.58851	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.467996	0.26895	N	0.021959	T	0.30854	0.0778	N	0.03238	-0.38	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22277	-1.0221	10	0.02654	T	1	.	7.8504	0.29451	0.0:0.2012:0.0:0.7988	.	657	O95025	SEM3D_HUMAN	R	657	ENSP00000284136:K657R	ENSP00000284136:K657R	K	-	2	0	SEMA3D	84467056	0.430000	0.25538	1.000000	0.80357	0.991000	0.79684	0.597000	0.24059	1.043000	0.40175	0.533000	0.62120	AAG	.	.	none		0.393	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
TAGAP	117289	hgsc.bcm.edu	37	6	159463199	159463199	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:159463199C>T	ENST00000367066.3	-	5	557	c.226G>A	c.(226-228)Gct>Act	p.A76T	RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA|TAGAP_ENST00000326965.6_Intron|RP1-111C20.4_ENST00000607796.1_RNA|TAGAP_ENST00000338313.5_Missense_Mutation_p.A76T	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	76					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GTCTCCAAAGCCCCAGAAAAA	0.493																																					p.A76T		Atlas-SNP	.											TAGAP,NS,carcinoma,+1,1	TAGAP	75	1	0			c.G226A						scavenged	.						175.0	184.0	181.0					6																	159463199		2203	4300	6503	SO:0001583	missense	117289	exon5			CCAAAGCCCCAGA	AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.226G>A	6.37:g.159463199C>T	ENSP00000356033:p.Ala76Thr	89.0	1.0	0.011236		78.0	11.0	0.141026	NM_138810	Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	ENST00000367066.3	37	CCDS5261.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357352	0.24598	.	.	ENSG00000164691	ENST00000367066;ENST00000338313	T;T	0.20598	2.24;2.06	6.08	-1.9	0.07665	.	0.809387	0.11245	N	0.584227	T	0.04724	0.0128	L	0.51422	1.61	0.09310	N	1	B;B	0.14805	0.002;0.011	B;B	0.12837	0.003;0.008	T	0.39901	-0.9591	10	0.28530	T	0.3	-5.3104	1.843	0.03153	0.3909:0.1811:0.2861:0.142	.	76;76	Q8N103-4;Q8N103	.;TAGAP_HUMAN	T	76	ENSP00000356033:A76T;ENSP00000340217:A76T	ENSP00000340217:A76T	A	-	1	0	TAGAP	159383187	0.000000	0.05858	0.003000	0.11579	0.528000	0.34623	-0.055000	0.11807	-0.195000	0.10382	0.591000	0.81541	GCT	.	.	none		0.493	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042890.1	NM_054114	
ESPN	83715	hgsc.bcm.edu	37	1	6504644	6504644	+	Missense_Mutation	SNP	C	C	T	rs201251427		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:6504644C>T	ENST00000377828.1	+	6	1262	c.1094C>T	c.(1093-1095)cCg>cTg	p.P365L	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	365					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		TCGGTCCAGCCGCTGAACTTT	0.617																																					p.P365L		Atlas-SNP	.											ESPN,NS,carcinoma,+1,1	ESPN	32	1	0			c.C1094T						PASS	.						134.0	98.0	110.0					1																	6504644		2203	4300	6503	SO:0001583	missense	83715	exon6			TCCAGCCGCTGAA	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1094C>T	1.37:g.6504644C>T	ENSP00000367059:p.Pro365Leu	125.0	0.0	0		113.0	26.0	0.230089	NM_031475	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	ENST00000377828.1	37	CCDS70.1	.	.	.	.	.	.	.	.	.	.	c	9.903	1.207541	0.22205	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	D;D	0.86562	-2.14;-2.14	3.77	1.77	0.24775	.	0.374614	0.20905	U	0.083577	T	0.74329	0.3702	L	0.29908	0.895	0.35234	D	0.777217	P	0.52061	0.95	B	0.35413	0.202	T	0.75542	-0.3281	10	0.59425	D	0.04	-2.8623	8.1598	0.31192	0.1648:0.5137:0.3215:0.0	.	365	B1AK53	ESPN_HUMAN	L	365;150	ENSP00000367059:P365L;ENSP00000401793:P150L	ENSP00000367059:P365L	P	+	2	0	ESPN	6427231	0.993000	0.37304	0.369000	0.25952	0.221000	0.24807	2.040000	0.41203	0.246000	0.21394	0.486000	0.48141	CCG	C|0.999;T|0.001	0.001	weak		0.617	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001887.3	NM_031475	
PDE4D	5144	hgsc.bcm.edu	37	5	58334737	58334737	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:58334737C>T	ENST00000340635.6	-	6	1045	c.870G>A	c.(868-870)caG>caA	p.Q290Q	PDE4D_ENST00000358923.6_5'UTR|PDE4D_ENST00000405755.2_Silent_p.Q168Q|PDE4D_ENST00000360047.5_Silent_p.Q154Q|PDE4D_ENST00000546160.1_Silent_p.Q229Q|PDE4D_ENST00000503258.1_Silent_p.Q160Q|PDE4D_ENST00000507116.1_Silent_p.Q226Q|RP11-266N13.2_ENST00000500224.2_RNA|PDE4D_ENST00000502484.2_Silent_p.Q229Q	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	290					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGGTCTCTAGCTGGTCCAGAC	0.602																																					p.Q290Q		Atlas-SNP	.											.	PDE4D	345	.	0			c.G870A						PASS	.						48.0	54.0	52.0					5																	58334737		2043	4208	6251	SO:0001819	synonymous_variant	5144	exon6			CTCTAGCTGGTCC		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.870G>A	5.37:g.58334737C>T		87.0	0.0	0		72.0	13.0	0.180556	NM_001104631	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Silent	SNP	ENST00000340635.6	37	CCDS47213.1																																																																																			.	.	none		0.602	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
NOX4	50507	hgsc.bcm.edu	37	11	89069055	89069055	+	Missense_Mutation	SNP	C	C	A	rs147166939		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:89069055C>A	ENST00000263317.4	-	17	1812	c.1574G>T	c.(1573-1575)cGg>cTg	p.R525L	NOX4_ENST00000527626.1_Missense_Mutation_p.R338L|NOX4_ENST00000413594.2_Missense_Mutation_p.R546L|NOX4_ENST00000375979.3_Missense_Mutation_p.R218L|NOX4_ENST00000532825.1_Missense_Mutation_p.R461L|NOX4_ENST00000424319.1_Missense_Mutation_p.R501L|NOX4_ENST00000531342.1_Missense_Mutation_p.R178L|NOX4_ENST00000527956.1_Missense_Mutation_p.R501L|NOX4_ENST00000343727.5_Missense_Mutation_p.R501L|NOX4_ENST00000542487.1_Missense_Mutation_p.R501L|NOX4_ENST00000535633.1_Missense_Mutation_p.R501L|NOX4_ENST00000534731.1_Missense_Mutation_p.R485L|NOX4_ENST00000525196.1_Missense_Mutation_p.R289L|NOX4_ENST00000528341.1_Missense_Mutation_p.R500L			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	525	Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AAGTTTCCACCGAGGACGTCC	0.294																																					p.R525L		Atlas-SNP	.											NOX4,colon,carcinoma,0,1	NOX4	101	1	0			c.G1574T						PASS	.						71.0	72.0	72.0					11																	89069055		2201	4296	6497	SO:0001583	missense	50507	exon17			TTCCACCGAGGAC	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1574G>T	11.37:g.89069055C>A	ENSP00000263317:p.Arg525Leu	523.0	0.0	0		445.0	92.0	0.206742	NM_016931	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156311	0.57259	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56;-3.56	4.33	1.36	0.22044	Ferric reductase, NAD binding (1);	0.394426	0.27323	N	0.019884	D	0.92688	0.7676	L	0.33485	1.01	0.35831	D	0.825349	B;P;P;D;B;P;B;B	0.63880	0.091;0.51;0.655;0.993;0.065;0.807;0.186;0.16	B;B;P;P;B;B;B;B	0.58820	0.112;0.319;0.559;0.846;0.045;0.242;0.127;0.112	D	0.90439	0.4430	9	.	.	.	-2.1831	7.9501	0.30010	0.0:0.6701:0.0:0.3299	.	461;338;500;289;178;218;485;525	E9PMY6;E9PR43;E9PPP2;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;.;NOX4_HUMAN	L	501;501;501;485;289;525;461;501;501;338;500;546;178;218	ENSP00000412446:R501L;ENSP00000440172:R501L;ENSP00000344747:R501L;ENSP00000436892:R485L;ENSP00000436716:R289L;ENSP00000263317:R525L;ENSP00000434924:R461L;ENSP00000433797:R501L;ENSP00000439373:R501L;ENSP00000436093:R338L;ENSP00000436970:R500L;ENSP00000405705:R546L;ENSP00000435039:R178L;ENSP00000365146:R218L	.	R	-	2	0	NOX4	88708703	0.001000	0.12720	0.994000	0.49952	0.974000	0.67602	-0.169000	0.09911	0.067000	0.16545	0.563000	0.77884	CGG	C|1.000;T|0.000	.	alt		0.294	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
SUV420H2	84787	hgsc.bcm.edu	37	19	55853653	55853653	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:55853653C>A	ENST00000255613.3	+	3	429	c.181C>A	c.(181-183)Ctg>Atg	p.L61M	AC020922.1_ENST00000539076.1_Intron|SUV420H2_ENST00000402499.4_Intron	NM_032701.3	NP_116090.2	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2 (Drosophila)	61					histone H4-K20 trimethylation (GO:0034773)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	4	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GCAGCGGGACCTGGAGGCTGC	0.721																																					p.L61M		Atlas-SNP	.											.	SUV420H2	20	.	0			c.C181A						PASS	.						8.0	9.0	9.0					19																	55853653		2173	4274	6447	SO:0001583	missense	84787	exon3			CGGGACCTGGAGG	BC005842	CCDS12922.1	19q13.42	2011-07-01			ENSG00000133247	ENSG00000133247		"""Chromatin-modifying enzymes / K-methyltransferases"""	28405	protein-coding gene	gene with protein product		613198				12477932	Standard	NM_032701		Approved	MGC2705, KMT5C	uc002qkj.4	Q86Y97	OTTHUMG00000150483	ENST00000255613.3:c.181C>A	19.37:g.55853653C>A	ENSP00000255613:p.Leu61Met	100.0	0.0	0		91.0	5.0	0.0549451	NM_032701	Q8WZ10|Q9BRZ6	Missense_Mutation	SNP	ENST00000255613.3	37	CCDS12922.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559480	0.65538	.	.	ENSG00000133247	ENST00000255613	.	.	.	4.41	3.34	0.38264	.	0.183772	0.36066	N	0.002806	T	0.68906	0.3052	L	0.54323	1.7	0.40803	D	0.983356	D	0.76494	0.999	D	0.70227	0.968	T	0.71504	-0.4573	9	0.59425	D	0.04	-28.7158	12.7082	0.57073	0.1667:0.8333:0.0:0.0	.	61	Q86Y97	SV422_HUMAN	M	61	.	ENSP00000255613:L61M	L	+	1	2	SUV420H2	60545465	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.898000	0.28404	0.938000	0.37419	0.561000	0.74099	CTG	.	.	none		0.721	SUV420H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318309.2	NM_032701	
ADAM9	8754	hgsc.bcm.edu	37	8	38899582	38899582	+	Silent	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr8:38899582C>A	ENST00000487273.2	+	12	1326	c.1248C>A	c.(1246-1248)tcC>tcA	p.S416S		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	416	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			GTGCTCCCTCCTGTGGTAATA	0.413																																					p.S416S		Atlas-SNP	.											.	ADAM9	66	.	0			c.C1248A						PASS	.						96.0	95.0	95.0					8																	38899582		2203	4300	6503	SO:0001819	synonymous_variant	8754	exon12			TCCCTCCTGTGGT	U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.1248C>A	8.37:g.38899582C>A		212.0	0.0	0		194.0	45.0	0.231959	NM_003816	B7ZLN7|Q10718|Q8NFM6	Silent	SNP	ENST00000487273.2	37	CCDS6112.1																																																																																			.	.	none		0.413	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357291.2		
C5orf46	389336	hgsc.bcm.edu	37	5	147286021	147286021	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:147286021A>C	ENST00000318315.4	-	1	44	c.44T>G	c.(43-45)cTt>cGt	p.L15R	C5orf46_ENST00000510432.1_5'UTR|C5orf46_ENST00000515291.1_Missense_Mutation_p.L15R	NM_206966.2	NP_996849.2	Q6UWT4	CE046_HUMAN	chromosome 5 open reading frame 46	15						extracellular vesicular exosome (GO:0070062)				NS(1)|lung(1)|prostate(1)	3						GAATAAGACAAGCAGTCCCAG	0.458																																					p.L15R		Atlas-SNP	.											.	C5orf46	8	.	0			c.T44G						PASS	.						103.0	89.0	94.0					5																	147286021		2203	4300	6503	SO:0001583	missense	389336	exon1			AAGACAAGCAGTC		CCDS34267.1	5q33.1	2013-12-13			ENSG00000178776	ENSG00000178776			33768	protein-coding gene	gene with protein product	"""skin and saliva secreted protein 1"""						Standard	NM_206966		Approved	MGC23985, SSSP1	uc003lou.3	Q6UWT4	OTTHUMG00000163420	ENST00000318315.4:c.44T>G	5.37:g.147286021A>C	ENSP00000315370:p.Leu15Arg	293.0	0.0	0		281.0	42.0	0.149466	NM_206966	A8K038|Q8WU04	Missense_Mutation	SNP	ENST00000318315.4	37	CCDS34267.1	.	.	.	.	.	.	.	.	.	.	A	12.94	2.087544	0.36855	.	.	ENSG00000178776	ENST00000318315;ENST00000515291	T;T	0.52057	0.68;0.68	4.88	2.47	0.30058	.	0.338031	0.21758	N	0.069580	T	0.54679	0.1873	.	.	.	0.20307	N	0.999918	D	0.57257	0.979	P	0.59487	0.858	T	0.44406	-0.9330	9	0.59425	D	0.04	-2.2362	4.8194	0.13383	0.7:0.2008:0.0991:0.0	.	15	Q6UWT4	CE046_HUMAN	R	15	ENSP00000315370:L15R;ENSP00000425984:L15R	ENSP00000315370:L15R	L	-	2	0	C5orf46	147266214	0.078000	0.21339	0.294000	0.24946	0.995000	0.86356	1.064000	0.30579	0.449000	0.26747	0.533000	0.62120	CTT	.	.	none		0.458	C5orf46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373314.1	NM_206966	
SLC23A3	151295	hgsc.bcm.edu	37	2	220033469	220033469	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:220033469C>T	ENST00000409878.3	-	5	611	c.579G>A	c.(577-579)ggG>ggA	p.G193G	SLC23A3_ENST00000295738.7_Silent_p.G193G|SLC23A3_ENST00000455516.2_Silent_p.G201G|SLC23A3_ENST00000396775.3_Intron	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	193					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCACCAGGGGCCCACAGTGGG	0.652																																					p.G201G		Atlas-SNP	.											.	SLC23A3	60	.	0			c.G603A						PASS	.						26.0	30.0	29.0					2																	220033469		1952	4138	6090	SO:0001819	synonymous_variant	151295	exon5			CAGGGGCCCACAG	BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.579G>A	2.37:g.220033469C>T		112.0	0.0	0		73.0	14.0	0.191781	NM_001144890	B7Z512|Q2PYN6|Q96NA6	Silent	SNP	ENST00000409878.3	37	CCDS46518.1																																																																																			.	.	none		0.652	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712	
ALG9	79796	hgsc.bcm.edu	37	11	111657183	111657183	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:111657183C>T	ENST00000531154.1	-	15	1754	c.1282G>A	c.(1282-1284)Gta>Ata	p.V428I	ALG9_ENST00000527228.1_5'UTR|ALG9_ENST00000398006.2_Missense_Mutation_p.V421I|ALG9_ENST00000524880.1_3'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	592					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		GTGTAGTTTACGTACACTGTA	0.428																																					p.V599I		Atlas-SNP	.											.	ALG9	77	.	0			c.G1795A						PASS	.						255.0	237.0	243.0					11																	111657183		1907	4122	6029	SO:0001583	missense	79796	exon16			AGTTTACGTACAC		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.1282G>A	11.37:g.111657183C>T	ENSP00000435517:p.Val428Ile	110.0	0.0	0		120.0	5.0	0.0416667	NM_024740	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Missense_Mutation	SNP	ENST00000531154.1	37	CCDS41714.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.067398	0.36470	.	.	ENSG00000086848	ENST00000531154;ENST00000398006;ENST00000428306	T;T	0.14022	2.54;2.54	5.76	4.84	0.62591	.	0.396088	0.27754	N	0.017992	T	0.08582	0.0213	N	0.20986	0.625	0.24575	N	0.9939	B;B	0.13145	0.007;0.004	B;B	0.12837	0.008;0.003	T	0.18745	-1.0327	10	0.27785	T	0.31	-2.7151	7.7102	0.28673	0.0:0.7489:0.166:0.0851	.	599;592	Q9H6U8-3;Q9H6U8	.;ALG9_HUMAN	I	428;421;825	ENSP00000435517:V428I;ENSP00000381090:V421I	ENSP00000381090:V421I	V	-	1	0	ALG9	111162393	0.947000	0.32204	1.000000	0.80357	0.433000	0.31745	0.805000	0.27112	2.882000	0.98803	0.655000	0.94253	GTA	.	.	none		0.428	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391485.1	NM_024740	
KCNC2	3747	hgsc.bcm.edu	37	12	75436936	75436936	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:75436936G>A	ENST00000549446.1	-	5	2546	c.1866C>T	c.(1864-1866)aaC>aaT	p.N622N	KCNC2_ENST00000550433.1_Intron|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000341669.3_Intron|KCNC2_ENST00000540018.1_Silent_p.N567N|RP11-81K13.1_ENST00000550049.1_RNA|RP11-81K13.1_ENST00000547040.1_RNA|RP11-81K13.1_ENST00000549762.1_RNA	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	622					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	GACAAGGAGAGTTGTAGGGTG	0.433																																					p.N622N		Atlas-SNP	.											.	KCNC2	239	.	0			c.C1866T						PASS	.						167.0	151.0	156.0					12																	75436936		2203	4300	6503	SO:0001819	synonymous_variant	3747	exon5			AGGAGAGTTGTAG	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1866C>T	12.37:g.75436936G>A		148.0	0.0	0		102.0	19.0	0.186275	NM_139137	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Silent	SNP	ENST00000549446.1	37	CCDS9007.1																																																																																			.	.	none		0.433	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405581.2	NM_153748	
CUX2	23316	hgsc.bcm.edu	37	12	111744875	111744875	+	Missense_Mutation	SNP	G	G	A	rs201601231	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:111744875G>A	ENST00000261726.6	+	11	1163	c.1009G>A	c.(1009-1011)Gac>Aac	p.D337N		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	337					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCAGATCGCCGACCTGGAGCG	0.667													G|||	2	0.000399361	0.0	0.0	5008	,	,		17073	0.002		0.0	False		,,,				2504	0.0				p.D337N		Atlas-SNP	.											.	CUX2	145	.	0			c.G1009A						PASS	.	G	ASN/ASP	0,4020		0,0,2010	20.0	25.0	23.0		1009	5.3	0.9	12		23	1,8323		0,1,4161	no	missense	CUX2	NM_015267.3	23	0,1,6171	AA,AG,GG		0.012,0.0,0.0081	possibly-damaging	337/1487	111744875	1,12343	2010	4162	6172	SO:0001583	missense	23316	exon11			ATCGCCGACCTGG	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1009G>A	12.37:g.111744875G>A	ENSP00000261726:p.Asp337Asn	57.0	0.0	0		49.0	10.0	0.204082	NM_015267	A7E2Y4	Missense_Mutation	SNP	ENST00000261726.6	37	CCDS41837.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	35	5.535085	0.96460	0.0	1.2E-4	ENSG00000111249	ENST00000261726	T	0.43294	0.95	5.3	5.3	0.74995	.	0.102642	0.64402	D	0.000005	T	0.39733	0.1089	L	0.44542	1.39	0.49130	D	0.999751	D	0.59357	0.985	B	0.43155	0.41	T	0.15665	-1.0429	10	0.26408	T	0.33	-36.3562	18.5534	0.91073	0.0:0.0:1.0:0.0	.	337	O14529	CUX2_HUMAN	N	337	ENSP00000261726:D337N	ENSP00000261726:D337N	D	+	1	0	CUX2	110229258	1.000000	0.71417	0.938000	0.37757	0.742000	0.42306	6.315000	0.72853	2.483000	0.83821	0.643000	0.83706	GAC	G|1.000;A|0.000	0.000	strong		0.667	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
EHMT2	10919	hgsc.bcm.edu	37	6	31856190	31856190	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:31856190G>T	ENST00000375537.4	-	12	1465	c.1459C>A	c.(1459-1461)Cgc>Agc	p.R487S	EHMT2_ENST00000395728.3_Missense_Mutation_p.R544S|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Missense_Mutation_p.R510S|EHMT2_ENST00000375530.4_Missense_Mutation_p.R453S	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	487					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TTGACCATGCGGGCGCGGTGG	0.662																																					p.R487S		Atlas-SNP	.											.	EHMT2	45	.	0			c.C1459A						PASS	.						30.0	29.0	29.0					6																	31856190		1511	2708	4219	SO:0001583	missense	10919	exon12			CCATGCGGGCGCG	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1459C>A	6.37:g.31856190G>T	ENSP00000364687:p.Arg487Ser	66.0	0.0	0		83.0	5.0	0.060241	NM_006709	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567273	0.65651	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.72282	-0.64;-0.52;-0.47;-0.64	4.62	4.62	0.57501	.	0.074232	0.56097	D	0.000039	T	0.64897	0.2640	L	0.43152	1.355	0.36772	D	0.883846	D;D;D;D	0.64830	0.975;0.994;0.989;0.978	P;P;P;P	0.60473	0.735;0.875;0.753;0.753	T	0.72104	-0.4391	10	0.87932	D	0	.	5.8076	0.18448	0.0967:0.0:0.7103:0.1931	.	510;453;487;301	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	S	544;510;453;487;301	ENSP00000379078:R544S;ENSP00000364678:R510S;ENSP00000364680:R453S;ENSP00000364687:R487S	ENSP00000364678:R510S	R	-	1	0	EHMT2	31964169	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.094000	0.41719	2.394000	0.81467	0.555000	0.69702	CGC	.	.	none		0.662	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
PARD3	56288	hgsc.bcm.edu	37	10	34626206	34626206	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:34626206C>T	ENST00000374789.3	-	17	2891	c.2566G>A	c.(2566-2568)Ggt>Agt	p.G856S	PARD3_ENST00000374776.1_Intron|PARD3_ENST00000374790.3_Missense_Mutation_p.G796S|PARD3_ENST00000545693.1_Missense_Mutation_p.G840S|PARD3_ENST00000340077.5_Missense_Mutation_p.G853S|PARD3_ENST00000466092.1_5'Flank|PARD3_ENST00000374788.3_Missense_Mutation_p.G853S|PARD3_ENST00000545260.1_Intron|PARD3_ENST00000544292.1_Splice_Site_p.V570I|PARD3_ENST00000350537.4_Intron|PARD3_ENST00000346874.4_Missense_Mutation_p.G856S|PARD3_ENST00000374794.3_Missense_Mutation_p.G796S|PARD3_ENST00000374773.1_Intron	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	856	Interacts with PRKCI and PRKCZ. {ECO:0000250}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				TACTCACTACCTAAATCCATG	0.343																																					p.G856S		Atlas-SNP	.											.	PARD3	131	.	0			c.G2566A						PASS	.						96.0	87.0	90.0					10																	34626206		2203	4298	6501	SO:0001583	missense	56288	exon17			CACTACCTAAATC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2566G>A	10.37:g.34626206C>T	ENSP00000363921:p.Gly856Ser	78.0	0.0	0		62.0	10.0	0.16129	NM_001184787	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	37	CCDS7178.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.4|23.4	4.415053|4.415053	0.83449|0.83449	.|.	.|.	ENSG00000148498|ENSG00000148498	ENST00000545693;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000374790;ENST00000340077|ENST00000544292	T;T;T;T;T;T;T|T	0.28666|0.29917	1.73;1.73;1.73;1.73;1.6;1.73;1.73|1.55	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.130941|.	0.49305|.	D|.	0.000158|.	T|T	0.26376|0.26376	0.0644|0.0644	L|L	0.29908|0.29908	0.895|0.895	0.32905|0.32905	D|D	0.513695|0.513695	D;D;P;D;D;P;D|B	0.89917|0.02656	0.982;1.0;0.847;0.995;0.973;0.833;0.98|0.0	P;D;B;P;P;B;P|B	0.85130|0.06405	0.676;0.997;0.36;0.853;0.576;0.267;0.758|0.002	T|T	0.16600|0.16600	-1.0397|-1.0397	10|9	0.27082|0.15066	T|T	0.32|0.55	.|.	20.1237|20.1237	0.97972|0.97972	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	796;840;856;853;856;840;853|570	Q8TEW0-5;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q6IQ47;Q8TEW0-8|F5GZI3	.;.;.;.;PARD3_HUMAN;.;.|.	S|I	840;856;853;856;796;796;853|570	ENSP00000443147:G840S;ENSP00000363921:G856S;ENSP00000363920:G853S;ENSP00000340591:G856S;ENSP00000363926:G796S;ENSP00000363922:G796S;ENSP00000341844:G853S|ENSP00000444429:V570I	ENSP00000341844:G853S|ENSP00000444429:V570I	G|V	-|-	1|1	0|0	PARD3|PARD3	34666212|34666212	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.089000|6.089000	0.71384|0.71384	2.759000|2.759000	0.94783|0.94783	0.561000|0.561000	0.74099|0.74099	GGT|GTA	.	.	none		0.343	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
OR51G2	81282	hgsc.bcm.edu	37	11	4936072	4936072	+	Silent	SNP	G	G	A	rs199760109		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:4936072G>A	ENST00000322013.3	-	1	850	c.822C>T	c.(820-822)ccC>ccT	p.P274P	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGACCAGGTGGGGTGCCTGCT	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		21041	0.001		0.0	False		,,,				2504	0.0				p.P274P		Atlas-SNP	.											.	OR51G2	70	.	0			c.C822T						PASS	.						111.0	100.0	104.0					11																	4936072		2201	4298	6499	SO:0001819	synonymous_variant	81282	exon1			CAGGTGGGGTGCC	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.822C>T	11.37:g.4936072G>A		83.0	0.0	0		79.0	22.0	0.278481	NM_001005238	Q6IFH7	Silent	SNP	ENST00000322013.3	37	CCDS31365.1																																																																																			G|1.000;A|0.000	0.000	strong		0.512	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
ARHGAP8	23779	hgsc.bcm.edu	37	22	45241156	45241156	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr22:45241156G>C	ENST00000389774.2	+	9	838	c.697G>C	c.(697-699)Gac>Cac	p.D233H	ARHGAP8_ENST00000356099.6_Missense_Mutation_p.D202H|ARHGAP8_ENST00000336963.4_Missense_Mutation_p.D202H|ARHGAP8_ENST00000389773.5_Missense_Mutation_p.D324H|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.D333H|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.D412H|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.D412H	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	233	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		CAGCCTCAAAGACAAAAATCA	0.522																																					p.D324H		Atlas-SNP	.											.	PRR5-ARHGAP8	53	.	0			c.G970C						PASS	.						71.0	69.0	69.0					22																	45241156		2203	4300	6503	SO:0001583	missense	553158	exon11			CTCAAAGACAAAA	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.697G>C	22.37:g.45241156G>C	ENSP00000374424:p.Asp233His	47.0	0.0	0		54.0	14.0	0.259259	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000389774.2	37	CCDS33664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.42|15.42	2.827083|2.827083	0.50739|0.50739	.|.	.|.	ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484;ENSG00000241484|ENSG00000248405	ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773;ENST00000389774;ENST00000336963;ENST00000356099|ENST00000515632	T;T;T;T;T;T;T|T	0.42131|0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98|0.98	3.95|3.95	3.95|3.95	0.45737|0.45737	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);|.	0.513253|.	0.14386|.	U|.	0.322816|.	T|T	0.37376|0.37376	0.1001|0.1001	L|L	0.38531|0.38531	1.155|1.155	0.36768|0.36768	D|D	0.883623|0.883623	B;B;P;B;B;D;B|.	0.52996|.	0.086;0.012;0.93;0.026;0.086;0.957;0.167|.	B;B;P;B;B;P;B|.	0.48030|.	0.025;0.009;0.564;0.014;0.035;0.525;0.042|.	T|T	0.30297|0.30297	-0.9983|-0.9983	10|7	0.46703|0.19590	T|T	0.11|0.45	.|.	9.5957|9.5957	0.39573|0.39573	0.0:0.2139:0.7861:0.0|0.0:0.2139:0.7861:0.0	.|.	238;202;238;233;243;412;333|.	B7ZMA4;A6ZJ79;A2RU51;P85298;Q6PCC7;B1AHC4;B1AHC3|.	.;.;.;RHG08_HUMAN;.;.;.|.	H|N	333;412;412;324;233;202;202|255	ENSP00000354732:D333H;ENSP00000262731:D412H;ENSP00000429240:D412H;ENSP00000374423:D324H;ENSP00000374424:D233H;ENSP00000337287:D202H;ENSP00000348407:D202H|ENSP00000425026:K255N	ENSP00000337287:D202H|ENSP00000425026:K255N	D|K	+|+	1|3	0|2	PRR5-ARHGAP8;ARHGAP8|PRR5-ARHGAP8	43619820|43619820	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.745000|0.745000	0.42441|0.42441	4.689000|4.689000	0.61723|0.61723	2.036000|2.036000	0.60181|0.60181	0.655000|0.655000	0.94253|0.94253	GAC|AAG	.	.	none		0.522	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
AKAP17A	8227	hgsc.bcm.edu	37	X	1718203	1718203	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:1718203C>G	ENST00000313871.3	+	4	1226	c.1030C>G	c.(1030-1032)Ctg>Gtg	p.L344V	AKAP17A_ENST00000381261.3_Missense_Mutation_p.L344V	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	344					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GCTGGAGAAGCTGCAGGCGGA	0.597																																					p.L344V		Atlas-SNP	.											.	AKAP17A	46	.	0			c.C1030G						PASS	.						74.0	78.0	76.0					X																	1718203		2203	4296	6499	SO:0001583	missense	8227	exon4			GAGAAGCTGCAGG	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1030C>G	X.37:g.1718203C>G	ENSP00000324827:p.Leu344Val	93.0	0.0	0		113.0	20.0	0.176991	NM_005088	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	ENST00000313871.3	37	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	c	0.213	-1.034755	0.02029	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.34667	1.44;1.35	1.74	-3.48	0.04739	.	0.366735	0.22112	U	0.064477	T	0.14960	0.0361	.	.	.	0.09310	N	1	B;B	0.16166	0.016;0.003	B;B	0.21708	0.036;0.015	T	0.20706	-1.0267	9	0.15952	T	0.53	.	4.6949	0.12799	0.4003:0.4443:0.0:0.1555	.	344;344	Q02040-3;Q02040	.;AK17A_HUMAN	V	344	ENSP00000324827:L344V;ENSP00000370660:L344V	ENSP00000324827:L344V	L	+	1	2	AKAP17A	1678203	1.000000	0.71417	0.039000	0.18376	0.497000	0.33675	0.985000	0.29578	-0.165000	0.10908	0.100000	0.15512	CTG	.	.	none		0.597	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
PPFIA2	8499	hgsc.bcm.edu	37	12	81769580	81769580	+	Missense_Mutation	SNP	G	G	A	rs370246827		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:81769580G>A	ENST00000549396.1	-	10	1286	c.1126C>T	c.(1126-1128)Cgg>Tgg	p.R376W	PPFIA2_ENST00000552948.1_Missense_Mutation_p.R376W|PPFIA2_ENST00000548586.1_Missense_Mutation_p.R376W|RP11-315E17.1_ENST00000546936.1_RNA|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R302W|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R358W|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R376W|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R277W|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R358W|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R223W	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	376	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TGAACCTGCCGCAGGATAGCT	0.398																																					p.R376W		Atlas-SNP	.											.	PPFIA2	207	.	0			c.C1126T						PASS	.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,3796		0,0,1898	150.0	146.0	147.0		1126,1072,1126,1126,904,829,1126	5.4	1.0	12		147	1,8205		0,1,4102	no	missense,missense,missense,missense,missense,missense,missense	PPFIA2	NM_001220473.1,NM_001220474.1,NM_001220475.1,NM_001220476.1,NM_001220477.1,NM_001220478.1,NM_003625.3	101,101,101,101,101,101,101	0,1,6000	AA,AG,GG		0.0122,0.0,0.0083	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	376/1248,358/1233,376/1237,376/1252,302/1157,277/1153,376/1258	81769580	1,12001	1898	4103	6001	SO:0001583	missense	8499	exon9			CCTGCCGCAGGAT	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1126C>T	12.37:g.81769580G>A	ENSP00000450337:p.Arg376Trp	105.0	0.0	0		81.0	12.0	0.148148	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.411904	0.62511	0.0	1.22E-4	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T	0.79033	1.19;1.19;1.19;-1.23;1.19;1.19;1.19	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.88020	0.6325	M	0.87682	2.9	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.60609	0.736;0.877	D	0.89787	0.3965	10	0.87932	D	0	-3.2321	15.3055	0.73990	0.0:0.0:0.8594:0.1406	.	276;376	B7Z4H8;O75334	.;LIPA2_HUMAN	W	376;358;302;387;358;376;277;376	ENSP00000450337:R376W;ENSP00000450298:R358W;ENSP00000385093:R302W;ENSP00000327416:R358W;ENSP00000449338:R376W;ENSP00000388373:R277W;ENSP00000447868:R376W	ENSP00000327416:R358W	R	-	1	2	PPFIA2	80293711	1.000000	0.71417	0.993000	0.49108	0.794000	0.44872	3.400000	0.52594	2.723000	0.93209	0.650000	0.86243	CGG	.	.	weak		0.398	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
SLC9A7	84679	hgsc.bcm.edu	37	X	46618168	46618168	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:46618168C>T	ENST00000328306.4	-	1	322	c.297G>A	c.(295-297)ctG>ctA	p.L99L		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	99					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						CGGTCTCGTGCAGAAAGCGCA	0.677																																					p.L99L	Pancreas(118;454 1696 1930 13865 39976)	Atlas-SNP	.											.	SLC9A7	73	.	0			c.G297A						PASS	.						47.0	34.0	38.0					X																	46618168		2203	4300	6503	SO:0001819	synonymous_variant	84679	exon1			CTCGTGCAGAAAG	AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.297G>A	X.37:g.46618168C>T		41.0	0.0	0		47.0	19.0	0.404255	NM_001257291	O75827|Q5JXP9	Silent	SNP	ENST00000328306.4	37	CCDS14269.1																																																																																			.	.	none		0.677	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056370.1	NM_032591	
TNFRSF8	943	hgsc.bcm.edu	37	1	12123708	12123708	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:12123708C>T	ENST00000263932.2	+	1	275	c.53C>T	c.(52-54)gCc>gTc	p.A18V	TNFRSF8_ENST00000417814.2_5'UTR	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	18					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	GCGCTACGAGCCTTCCCACAG	0.736																																					p.A18V		Atlas-SNP	.											.	TNFRSF8	70	.	0			c.C53T						PASS	.						5.0	5.0	5.0					1																	12123708		1864	3572	5436	SO:0001583	missense	943	exon1			TACGAGCCTTCCC	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.53C>T	1.37:g.12123708C>T	ENSP00000263932:p.Ala18Val	101.0	0.0	0		84.0	20.0	0.238095	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	ENST00000263932.2	37	CCDS144.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710987	0.30322	.	.	ENSG00000120949	ENST00000263932	T	0.27256	1.68	3.03	3.03	0.35002	.	1.573450	0.04122	N	0.316409	T	0.37237	0.0996	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.36504	-0.9745	10	0.28530	T	0.3	-10.4661	9.7885	0.40690	0.0:1.0:0.0:0.0	.	18	P28908	TNR8_HUMAN	V	18	ENSP00000263932:A18V	ENSP00000263932:A18V	A	+	2	0	TNFRSF8	12046295	1.000000	0.71417	0.956000	0.39512	0.581000	0.36288	3.147000	0.50639	2.000000	0.58554	0.555000	0.69702	GCC	.	.	none		0.736	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
MGA	23269	hgsc.bcm.edu	37	15	42003386	42003386	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr15:42003386C>T	ENST00000570161.1	+	7	2923	c.2923C>T	c.(2923-2925)Cag>Tag	p.Q975*	MGA_ENST00000545763.1_Nonsense_Mutation_p.Q975*|MGA_ENST00000389936.4_Nonsense_Mutation_p.Q975*|MGA_ENST00000219905.7_Nonsense_Mutation_p.Q975*|MGA_ENST00000566586.1_Nonsense_Mutation_p.Q975*			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	P-type 2. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCAGGCACAGCAGCAGCAGCA	0.463																																					p.Q975X		Atlas-SNP	.											.	MGA	264	.	0			c.C2923T						PASS	.						56.0	62.0	60.0					15																	42003386		2056	4224	6280	SO:0001587	stop_gained	23269	exon8			GCACAGCAGCAGC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2923C>T	15.37:g.42003386C>T	ENSP00000457035:p.Gln975*	55.0	0.0	0		65.0	9.0	0.138462	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000570161.1	37	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	38	7.045182	0.98025	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	.	.	.	4.88	3.92	0.45320	.	0.485631	0.18517	N	0.138876	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	14.8687	0.70437	0.1451:0.8549:0.0:0.0	.	.	.	.	X	975	.	ENSP00000219905:Q975X	Q	+	1	0	MGA	39790678	0.889000	0.30405	0.964000	0.40570	0.530000	0.34684	3.477000	0.53151	1.312000	0.45043	0.650000	0.86243	CAG	.	.	none		0.463	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
HIST1H2BC	8347	hgsc.bcm.edu	37	6	26123770	26123770	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26123770C>T	ENST00000314332.5	-	1	368	c.363G>A	c.(361-363)aaG>aaA	p.K121K	HIST1H2BC_ENST00000396984.1_Silent_p.K121K|HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2AC_ENST00000377791.2_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	121					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						AGCTGGTGTACTTGGTGACGG	0.577																																					p.K121K		Atlas-SNP	.											.	HIST1H2BC	35	.	0			c.G363A						PASS	.						85.0	88.0	87.0					6																	26123770		2203	4300	6503	SO:0001819	synonymous_variant	8347	exon1			GGTGTACTTGGTG	Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.363G>A	6.37:g.26123770C>T		106.0	0.0	0		107.0	20.0	0.186916	NM_003526	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000314332.5	37	CCDS4584.1																																																																																			.	.	none		0.577	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468022.1	NM_003526	
BRS3	680	hgsc.bcm.edu	37	X	135574270	135574270	+	Silent	SNP	C	C	T	rs369993360		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:135574270C>T	ENST00000370648.3	+	3	1164	c.936C>T	c.(934-936)acC>acT	p.T312T		NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	312					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					TCATTTTCACCATTTTCTCTC	0.448																																					p.T312T		Atlas-SNP	.											.	BRS3	62	.	0			c.C936T						PASS	.						271.0	237.0	248.0					X																	135574270		2203	4300	6503	SO:0001819	synonymous_variant	680	exon3			TTTCACCATTTTC		CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.936C>T	X.37:g.135574270C>T		70.0	0.0	0		64.0	32.0	0.5	NM_001727		Silent	SNP	ENST00000370648.3	37	CCDS14656.1																																																																																			.	.	alt		0.448	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059005.1	NM_001727	
HIST1H4I	8294	hgsc.bcm.edu	37	6	27107282	27107282	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:27107282C>T	ENST00000354348.2	+	1	207	c.195C>T	c.(193-195)aaC>aaT	p.N65N	HIST1H2BK_ENST00000396891.4_Intron	NM_003495.2	NP_003486.1	P62805	H4_HUMAN	histone cluster 1, H4i	65					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			lung(1)	1						TCCTGGAGAACGTGATCCGGG	0.652			T	BCL6	NHL																																p.N65N		Atlas-SNP	.		Dom	yes		6	6p21.3	8294	"""histone 1, H4i (H4FM)"""		L	.	HIST1H4I	26	.	0			c.C195T						PASS	.						81.0	74.0	76.0					6																	27107282		2203	4300	6503	SO:0001819	synonymous_variant	8294	exon1			GGAGAACGTGATC	AB000905	CCDS4620.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198339	ENSG00000276180		"""Histones / Replication-dependent"""	4793	protein-coding gene	gene with protein product		602833	"""H4 histone family, member M"", ""histone 1, H4i"""	H4FM		8988030, 9439656, 12408966	Standard	NM_003495		Approved	H4/m	uc003niy.1	P62805	OTTHUMG00000014471	ENST00000354348.2:c.195C>T	6.37:g.27107282C>T		132.0	0.0	0		140.0	49.0	0.35	NM_003495	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	ENST00000354348.2	37	CCDS4620.1																																																																																			.	.	none		0.652	HIST1H4I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040139.1	NM_003495	
PLA2G4B	100137049	hgsc.bcm.edu	37	15	42139859	42139859	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr15:42139859C>A	ENST00000452633.1	+	21	2499	c.2147C>A	c.(2146-2148)aCa>aAa	p.T716K	PLA2G4B_ENST00000542534.2_Missense_Mutation_p.T947K|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.H885N|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.T716K|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.T947K			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	716	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		GTCCGGCGGACACCCGAGGAG	0.632																																					p.T947K		Atlas-SNP	.											.	JMJD7-PLA2G4B	90	.	0			c.C2840A						PASS	.						56.0	54.0	55.0					15																	42139859		2203	4300	6503	SO:0001583	missense	8681	exon25			GGCGGACACCCGA	AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.2147C>A	15.37:g.42139859C>A	ENSP00000396045:p.Thr716Lys	87.0	0.0	0		67.0	19.0	0.283582	NM_005090	B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	ENST00000452633.1	37	CCDS45241.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	13.47|13.47	2.246633|2.246633	0.39697|0.39697	.|.	.|.	ENSG00000168970|ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000342159|ENST00000382448;ENST00000458483;ENST00000452633	T|T;T;T	0.01474|0.03951	4.85|3.75;3.75;3.75	4.77|4.77	1.66|1.66	0.24008|0.24008	.|Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	.|0.389650	.|0.24757	.|N	.|0.035848	T|T	0.03390|0.03390	0.0098|0.0098	.|.	.|.	.|.	0.19775|0.19775	N|N	0.99996|0.99996	B|B;B	0.19817|0.24258	0.039|0.047;0.1	B|B;B	0.13407|0.25506	0.009|0.012;0.061	T|T	0.36890|0.36890	-0.9729|-0.9729	8|9	0.87932|0.59425	D|D	0|0.04	-9.1587|-9.1587	2.3448|2.3448	0.04269|0.04269	0.2463:0.3812:0.2733:0.0992|0.2463:0.3812:0.2733:0.0992	.|.	885|716;947	P0C869-7|P0C869;P0C869-6	.|PA24B_HUMAN;.	N|K	885|947;716;716	ENSP00000342785:H885N|ENSP00000371886:T947K;ENSP00000416610:T716K;ENSP00000396045:T716K	ENSP00000342785:H885N|ENSP00000371886:T947K	H|T	+|+	1|2	0|0	JMJD7-PLA2G4B|JMJD7-PLA2G4B;PLA2G4B	39927151|39927151	0.000000|0.000000	0.05858|0.05858	0.286000|0.286000	0.24833|0.24833	0.347000|0.347000	0.29111|0.29111	-0.089000|-0.089000	0.11180|0.11180	1.155000|1.155000	0.42497|0.42497	0.491000|0.491000	0.48974|0.48974	CAC|ACA	.	.	none		0.632	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345969.1	NM_001114633	
HIST1H2AC	8334	hgsc.bcm.edu	37	6	26124565	26124565	+	Silent	SNP	C	C	A	rs531071869		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26124565C>A	ENST00000602637.1	+	1	135	c.105C>A	c.(103-105)ctC>ctA	p.L35L	HIST1H2BC_ENST00000314332.5_5'Flank|HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2AC_ENST00000377791.2_Silent_p.L35L			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	35						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						ACCGCCTGCTCCGTAAAGGCA	0.657																																					p.L35L		Atlas-SNP	.											.	HIST1H2AC	29	.	0			c.C105A						PASS	.						43.0	45.0	44.0					6																	26124565		2203	4300	6503	SO:0001819	synonymous_variant	8334	exon1			CCTGCTCCGTAAA	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.105C>A	6.37:g.26124565C>A		121.0	0.0	0		81.0	12.0	0.148148	NM_003512	B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Silent	SNP	ENST00000602637.1	37	CCDS4585.1																																																																																			.	.	none		0.657	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512	
ATAD3B	83858	hgsc.bcm.edu	37	1	1431048	1431048	+	Missense_Mutation	SNP	A	A	G	rs201429000		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:1431048A>G	ENST00000308647.7	+	16	1914	c.1798A>G	c.(1798-1800)Acg>Gcg	p.T600A		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	600						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GAGCCTGGCCACGGACCCCTC	0.672																																					p.T600A		Atlas-SNP	.											ATAD3B,NS,neuroblastoma,0,1	ATAD3B	68	1	0			c.A1798G						scavenged	.																																			SO:0001583	missense	83858	exon16			CTGGCCACGGACC	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1798A>G	1.37:g.1431048A>G	ENSP00000311766:p.Thr600Ala	69.0	1.0	0.0144928		56.0	4.0	0.0714286	NM_031921	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	ENST00000308647.7	37	CCDS30.1	.	.	.	.	.	.	.	.	.	.	g	0.005	-2.129716	0.00338	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.93189	-3.18	1.2	-1.67	0.08238	.	0.186138	0.20546	N	0.090207	T	0.78220	0.4249	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.65792	-0.6082	10	0.12766	T	0.61	.	2.0444	0.03557	0.4037:0.0:0.3428:0.2535	.	554;600	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	A	434;600	ENSP00000311766:T600A	ENSP00000311766:T600A	T	+	1	0	ATAD3B	1420911	0.007000	0.16637	0.000000	0.03702	0.003000	0.03518	0.259000	0.18405	-1.264000	0.02452	-1.032000	0.02404	ACG	.	.	weak		0.672	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	
NINJ1	4814	hgsc.bcm.edu	37	9	95887259	95887259	+	Silent	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr9:95887259C>A	ENST00000375446.4	-	3	460	c.390G>T	c.(388-390)gtG>gtT	p.V130V	NINJ1_ENST00000489274.1_5'UTR	NM_004148.3	NP_004139.2	Q92982	NINJ1_HUMAN	ninjurin 1	130					cell adhesion (GO:0007155)|hyaloid vascular plexus regression (GO:1990384)|nervous system development (GO:0007399)|positive regulation of cell-matrix adhesion (GO:0001954)|tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|upper_aerodigestive_tract(1)	4						TGTTGACTACCACGATGATGA	0.597																																					p.V130V		Atlas-SNP	.											.	NINJ1	7	.	0			c.G390T						PASS	.						158.0	130.0	139.0					9																	95887259		2203	4300	6503	SO:0001819	synonymous_variant	4814	exon3			GACTACCACGATG	U91512	CCDS6703.1	9q22	2008-07-21			ENSG00000131669	ENSG00000131669			7824	protein-coding gene	gene with protein product	"""nerve injury-induced protein-1"""	602062				8780658	Standard	NM_004148		Approved	NIN1	uc004atg.4	Q92982	OTTHUMG00000020242	ENST00000375446.4:c.390G>T	9.37:g.95887259C>A		65.0	0.0	0		54.0	10.0	0.185185	NM_004148	Q6GU89|Q8WUV5|Q9BT07	Silent	SNP	ENST00000375446.4	37	CCDS6703.1																																																																																			.	.	none		0.597	NINJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053123.2	NM_004148	
KLF2	10365	hgsc.bcm.edu	37	19	16436027	16436027	+	Splice_Site	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:16436027C>T	ENST00000248071.5	+	2	183	c.76C>T	c.(76-78)Cgc>Tgc	p.R26C	CTD-2562J15.6_ENST00000588799.1_RNA|KLF2_ENST00000592003.1_Intron	NM_016270.2	NP_057354.1	Q9Y5W3	KLF2_HUMAN	Kruppel-like factor 2	26					cell morphogenesis (GO:0000902)|cellular response to cycloheximide (GO:0071409)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to peptide (GO:1901653)|cellular response to tumor necrosis factor (GO:0071356)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(3)|lung(1)|skin(1)	5						TCGCCCGCAGCGCTGGCCGCG	0.721																																					p.R26C		Atlas-SNP	.											.	KLF2	10	.	0			c.C76T						PASS	.						2.0	2.0	2.0					19																	16436027		1269	2632	3901	SO:0001630	splice_region_variant	10365	exon2			CCGCAGCGCTGGC	AF123344	CCDS12343.1	19p13.11	2013-10-15	2013-10-15		ENSG00000127528	ENSG00000127528		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6347	protein-coding gene	gene with protein product		602016	"""Kruppel-like factor 2 (lung)"""			10217429, 10458913	Standard	NM_016270		Approved	LKLF	uc002ndw.3	Q9Y5W3	OTTHUMG00000182330	ENST00000248071.5:c.76-1C>T	19.37:g.16436027C>T		17.0	0.0	0		35.0	6.0	0.171429	NM_016270	Q6IPC4|Q9UJS5|Q9UKR6	Missense_Mutation	SNP	ENST00000248071.5	37	CCDS12343.1	.	.	.	.	.	.	.	.	.	.	C	7.506	0.653605	0.14580	.	.	ENSG00000127528	ENST00000248071	T	0.18016	2.24	2.41	1.31	0.21738	.	.	.	.	.	T	0.15609	0.0376	M	0.64404	1.975	0.20403	N	0.99991	B	0.15473	0.013	B	0.08055	0.003	T	0.28364	-1.0046	8	.	.	.	.	4.9114	0.13823	0.0:0.6813:0.0:0.3187	.	26	Q9Y5W3	KLF2_HUMAN	C	26	ENSP00000248071:R26C	.	R	+	1	0	KLF2	16297027	1.000000	0.71417	0.987000	0.45799	0.016000	0.09150	0.844000	0.27654	0.221000	0.20879	-1.492000	0.00969	CGC	.	.	none		0.721	KLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460562.1		Missense_Mutation
EIF2B5	8893	hgsc.bcm.edu	37	3	183855505	183855505	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:183855505G>T	ENST00000273783.3	+	3	540	c.418G>T	c.(418-420)Gcc>Tcc	p.A140S	EIF2B5_ENST00000444495.1_Missense_Mutation_p.A140S|EIF2B5_ENST00000498831.1_3'UTR|RP11-778D9.12_ENST00000608135.1_RNA|RP11-778D9.12_ENST00000608232.1_RNA	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	140					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			TGATGTTGATGCCAAGGCTTT	0.483																																					p.A140S		Atlas-SNP	.											.	EIF2B5	62	.	0			c.G418T						PASS	.						195.0	163.0	174.0					3																	183855505		2203	4300	6503	SO:0001583	missense	8893	exon3			GTTGATGCCAAGG	U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.418G>T	3.37:g.183855505G>T	ENSP00000273783:p.Ala140Ser	117.0	0.0	0		88.0	25.0	0.284091	NM_003907	Q541Z1|Q96D04	Missense_Mutation	SNP	ENST00000273783.3	37	CCDS3252.1	.	.	.	.	.	.	.	.	.	.	g	17.74	3.463615	0.63513	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	D;D	0.93763	-3.28;-3.28	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.94555	0.8246	L	0.38733	1.17	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.91422	0.5159	10	0.14252	T	0.57	-19.8346	20.051	0.97627	0.0:0.0:1.0:0.0	.	140	Q13144	EI2BE_HUMAN	S	140	ENSP00000273783:A140S;ENSP00000409142:A140S	ENSP00000273783:A140S	A	+	1	0	EIF2B5	185338199	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.740000	0.93945	0.650000	0.86243	GCC	.	.	none		0.483	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346168.1		
RGS7	6000	hgsc.bcm.edu	37	1	241032080	241032080	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:241032080C>T	ENST00000407727.1	-	7	522	c.523G>A	c.(523-525)Gca>Aca	p.A175T	RGS7_ENST00000331110.7_Missense_Mutation_p.A149T|RGS7_ENST00000446183.2_Missense_Mutation_p.A91T|RGS7_ENST00000366563.1_Missense_Mutation_p.A175T|RGS7_ENST00000348120.2_Missense_Mutation_p.A122T|RGS7_ENST00000366564.1_Missense_Mutation_p.A175T|RGS7_ENST00000366562.4_Missense_Mutation_p.A175T|RGS7_ENST00000366565.1_Missense_Mutation_p.A175T|RGS7_ENST00000401882.1_Missense_Mutation_p.A122T			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	175					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			ACTCACTTTGCTTGTGCTTCT	0.443																																					p.A175T		Atlas-SNP	.											.	RGS7	308	.	0			c.G523A						PASS	.						168.0	169.0	168.0					1																	241032080		2203	4300	6503	SO:0001583	missense	6000	exon8			ACTTTGCTTGTGC	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.523G>A	1.37:g.241032080C>T	ENSP00000384428:p.Ala175Thr	100.0	0.0	0		88.0	14.0	0.159091	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		.	.	.	.	.	.	.	.	.	.	C	23.6	4.436438	0.83885	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.35605	1.47;1.47;1.48;1.46;1.3;1.47;1.47;1.48;1.46;1.47	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	L	0.42245	1.32	0.80722	D	1	B;P;P;P;P;P;P	0.44521	0.417;0.749;0.837;0.553;0.837;0.529;0.749	B;B;P;B;B;B;B	0.47134	0.146;0.338;0.539;0.373;0.356;0.205;0.194	T	0.10636	-1.0621	10	0.44086	T	0.13	.	19.1613	0.93533	0.0:1.0:0.0:0.0	.	91;149;122;175;175;175;175	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	T	149;175;175;175;6;122;91;175;175;122	ENSP00000331485:A149T;ENSP00000355523:A175T;ENSP00000355522:A175T;ENSP00000355521:A175T;ENSP00000404399:A6T;ENSP00000341242:A122T;ENSP00000390138:A91T;ENSP00000355520:A175T;ENSP00000384428:A175T;ENSP00000385508:A122T	ENSP00000331485:A149T	A	-	1	0	RGS7	239098703	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.734000	0.84928	2.768000	0.95171	0.655000	0.94253	GCA	.	.	none		0.443	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
TMSB4X	7114	hgsc.bcm.edu	37	X	12994468	12994468	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:12994468C>A	ENST00000380635.1	+	2	304	c.88C>A	c.(88-90)Cct>Act	p.P30T	TMSB4X_ENST00000380636.1_Missense_Mutation_p.P30T|TMSB4X_ENST00000451311.2_Missense_Mutation_p.P30T|TMSB4X_ENST00000380633.1_Missense_Mutation_p.P30T			P62328	TYB4_HUMAN	thymosin beta 4, X-linked	30					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						AAATCCACTGCCTTCCAAAGA	0.557																																					p.P30T		Atlas-SNP	.											.	TMSB4X	3	.	0			c.C88A						PASS	.						49.0	46.0	47.0					X																	12994468		2203	4300	6503	SO:0001583	missense	7114	exon2			CCACTGCCTTCCA		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.88C>A	X.37:g.12994468C>A	ENSP00000370009:p.Pro30Thr	170.0	0.0	0		146.0	55.0	0.376712	NM_021109	P01253|P01254|Q546P5|Q63576|Q9UE55	Missense_Mutation	SNP	ENST00000380635.1	37	CCDS35202.1	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676205	0.67928	.	.	ENSG00000205542	ENST00000451311;ENST00000380636;ENST00000380635;ENST00000380633	D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83	4.53	4.53	0.55603	.	0.000000	0.64402	U	0.000010	D	0.93719	0.7993	.	.	.	0.53688	D	0.999977	P	0.41597	0.756	P	0.52909	0.713	D	0.94659	0.7846	9	0.72032	D	0.01	-19.0029	16.916	0.86152	0.0:1.0:0.0:0.0	.	30	P62328	TYB4_HUMAN	T	30	ENSP00000414376:P30T;ENSP00000370010:P30T;ENSP00000370009:P30T;ENSP00000370007:P30T	ENSP00000370007:P30T	P	+	1	0	TMSB4X	12904389	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.858000	0.75461	1.999000	0.58509	0.513000	0.50165	CCT	.	.	none		0.557	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	
BMP15	9210	hgsc.bcm.edu	37	X	50659592	50659592	+	Silent	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:50659592T>C	ENST00000252677.3	+	2	1164	c.1164T>C	c.(1162-1164)tcT>tcC	p.S388S		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	388					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					TTGCTGAGTCTTGTACATGCA	0.418																																					p.S388S		Atlas-SNP	.											.	BMP15	62	.	0			c.T1164C						PASS	.						106.0	97.0	100.0					X																	50659592		2203	4299	6502	SO:0001819	synonymous_variant	9210	exon2			TGAGTCTTGTACA	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.1164T>C	X.37:g.50659592T>C		72.0	0.0	0		64.0	33.0	0.515625	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Silent	SNP	ENST00000252677.3	37	CCDS14334.1																																																																																			.	.	none		0.418	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
SIGLEC5	8778	hgsc.bcm.edu	37	19	52131127	52131127	+	Silent	SNP	C	C	T	rs528680868		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:52131127C>T	ENST00000534261.2	-	6	1356	c.957G>A	c.(955-957)ccG>ccA	p.P319P	SIGLEC5_ENST00000222107.4_Silent_p.P319P|SIGLEC5_ENST00000429354.3_Silent_p.P319P|SIGLEC5_ENST00000599649.1_Silent_p.P319P|SIGLEC5_ENST00000570106.2_Silent_p.P319P			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	319	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.P319P(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GGAAGCCCAGCGGGTGCTGAG	0.557													C|||	1	0.000199681	0.0	0.0	5008	,	,		17624	0.0		0.0	False		,,,				2504	0.001				p.P319P		Atlas-SNP	.											SIGLEC5,NS,carcinoma,0,2	SIGLEC5	67	2	1	Substitution - coding silent(1)	endometrium(1)	c.G957A						PASS	.						34.0	39.0	37.0					19																	52131127		2203	4300	6503	SO:0001819	synonymous_variant	8778	exon5			GCCCAGCGGGTGC	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.957G>A	19.37:g.52131127C>T		128.0	0.0	0		110.0	20.0	0.181818	NM_003830		Silent	SNP	ENST00000534261.2	37	CCDS33088.1																																																																																			.	.	none		0.557	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
ZNF530	348327	hgsc.bcm.edu	37	19	58117726	58117726	+	Missense_Mutation	SNP	G	G	A	rs201516823		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:58117726G>A	ENST00000332854.6	+	3	1053	c.833G>A	c.(832-834)cGc>cAc	p.R278H	ZNF530_ENST00000597864.1_Intron	NM_020880.3	NP_065931.3	Q6P9A1	ZN530_HUMAN	zinc finger protein 530	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(6)|skin(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0443)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TCATTTAGTCGCAAAACTCAC	0.438																																					p.R278H		Atlas-SNP	.											.	ZNF530	71	.	0			c.G833A						PASS	.						94.0	81.0	85.0					19																	58117726		2203	4300	6503	SO:0001583	missense	348327	exon3			TTAGTCGCAAAAC	AK096831	CCDS12955.1	19q13.43	2013-01-08				ENSG00000183647		"""Zinc fingers, C2H2-type"", ""-"""	29297	protein-coding gene	gene with protein product						10819331	Standard	NM_020880		Approved	KIAA1508	uc002qpk.2	Q6P9A1		ENST00000332854.6:c.833G>A	19.37:g.58117726G>A	ENSP00000332861:p.Arg278His	108.0	0.0	0		62.0	10.0	0.16129	NM_020880	O43340|Q9P220	Missense_Mutation	SNP	ENST00000332854.6	37	CCDS12955.1	.	.	.	.	.	.	.	.	.	.	G	5.242	0.230126	0.09969	.	.	ENSG00000183647	ENST00000332854	T	0.07327	3.2	1.51	-3.03	0.05429	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05868	0.0153	L	0.52266	1.64	0.09310	N	1	B	0.15930	0.015	B	0.04013	0.001	T	0.47262	-0.9131	9	0.11485	T	0.65	.	3.3452	0.07132	0.2697:0.0:0.4615:0.2688	.	278	Q6P9A1	ZN530_HUMAN	H	278	ENSP00000332861:R278H	ENSP00000332861:R278H	R	+	2	0	ZNF530	62809538	0.000000	0.05858	0.002000	0.10522	0.199000	0.23934	-1.220000	0.02971	-0.684000	0.05183	0.537000	0.68136	CGC	G|0.999;A|0.001	0.001	weak		0.438	ZNF530-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466797.1	NM_020880	
LRP1B	53353	hgsc.bcm.edu	37	2	141819821	141819821	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:141819821G>A	ENST00000389484.3	-	8	2006	c.1035C>T	c.(1033-1035)taC>taT	p.Y345Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	345					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGACATTCCCGTAGTCAGTAA	0.448										TSP Lung(27;0.18)																											p.Y345Y	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.C1035T						PASS	.						92.0	85.0	87.0					2																	141819821		2203	4299	6502	SO:0001819	synonymous_variant	53353	exon8			ATTCCCGTAGTCA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1035C>T	2.37:g.141819821G>A		59.0	0.0	0		56.0	13.0	0.232143	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	37	CCDS2182.1																																																																																			.	.	none		0.448	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
PAX5	5079	hgsc.bcm.edu	37	9	37002696	37002696	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr9:37002696G>C	ENST00000358127.4	-	5	627	c.553C>G	c.(553-555)Ctg>Gtg	p.L185V	PAX5_ENST00000377853.2_Missense_Mutation_p.L185V|RP11-297B17.3_ENST00000509911.2_RNA|PAX5_ENST00000446742.1_Missense_Mutation_p.L119V|PAX5_ENST00000523145.1_Missense_Mutation_p.L77V|PAX5_ENST00000523241.1_Missense_Mutation_p.L185V|PAX5_ENST00000520281.1_Intron|PAX5_ENST00000377852.2_Missense_Mutation_p.L185V|PAX5_ENST00000377847.2_Missense_Mutation_p.L185V|PAX5_ENST00000520154.1_Missense_Mutation_p.L185V|PAX5_ENST00000522003.1_Missense_Mutation_p.L77V|PAX5_ENST00000414447.1_Intron	NM_001280554.1|NM_001280556.1|NM_016734.1	NP_001267483.1|NP_001267485.1|NP_057953.1	Q02548	PAX5_HUMAN	paired box 5	185					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.?(40)	PAX5/JAK2(18)	NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(151)|kidney(1)|lung(10)|prostate(1)|skin(1)	171		all_cancers(2;3.46e-10)|Acute lymphoblastic leukemia(2;7.09e-56)|all_hematologic(2;6.65e-44)		GBM - Glioblastoma multiforme(29;0.0108)		GTGATGCCCAGGATGCCGCTG	0.672			"""T, Mis, D, F, S"""	"""IGH@, ETV6, PML, FOXP1, ZNF521, ELN"""	"""NHL, ALL, B-ALL"""																																p.L185V		Atlas-SNP	.		Dom	yes		9	9p13	5079	paired box gene 5 (B-cell lineage specific activator protein)		L	.	PAX5	250	.	40	Unknown(40)	haematopoietic_and_lymphoid_tissue(40)	c.C553G						PASS	.						48.0	37.0	41.0					9																	37002696		2201	4296	6497	SO:0001583	missense	5079	exon5			TGCCCAGGATGCC		CCDS6607.1, CCDS65039.1, CCDS65040.1, CCDS65041.1, CCDS65042.1, CCDS65043.1, CCDS65044.1, CCDS65045.1, CCDS65046.1, CCDS65047.1, CCDS65048.1	9p13.2	2011-06-20	2007-07-12		ENSG00000196092	ENSG00000196092		"""Paired boxes"", ""Homeoboxes / PRD class"""	8619	protein-coding gene	gene with protein product	"""B-cell lineage specific activator"""	167414	"""paired box gene 5 (B-cell lineage specific activator protein)"", ""paired box gene 5 (B-cell lineage specific activator)"""			1516825, 8431641	Standard	NM_016734		Approved	BSAP	uc003zzo.1	Q02548	OTTHUMG00000019907	ENST00000358127.4:c.553C>G	9.37:g.37002696G>C	ENSP00000350844:p.Leu185Val	169.0	0.0	0		159.0	32.0	0.201258	NM_016734	A3QVP6|A3QVP7|A3QVP8|C0KTF6|C0KTF7|C0KTF8|C0KTF9|C0KTG0|O75933|Q5SFM2|Q6S728|Q6S729|Q6S730|Q6S731|Q6S732	Missense_Mutation	SNP	ENST00000358127.4	37	CCDS6607.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077844	0.55753	.	.	ENSG00000196092	ENST00000358127;ENST00000377849;ENST00000377853;ENST00000377852;ENST00000523241;ENST00000520154;ENST00000446742;ENST00000522003;ENST00000523145;ENST00000377847	D;D;D;D;D;D;D;D;D	0.98164	-4.26;-4.27;-4.26;-4.76;-4.73;-4.37;-2.1;-2.68;-4.75	5.15	5.15	0.70609	.	0.369945	0.24325	N	0.039514	D	0.98767	0.9585	M	0.83012	2.62	0.50313	D	0.999869	D;P;B;D;D;P;P	0.65815	0.989;0.956;0.213;0.995;0.993;0.956;0.956	D;P;B;P;D;P;P	0.72338	0.977;0.899;0.222;0.885;0.952;0.899;0.899	D	0.98703	1.0701	10	0.44086	T	0.13	.	13.3201	0.60428	0.0769:0.0:0.9231:0.0	.	119;185;185;185;185;185;185	C0KTF9;C0KTF6;E7ERW5;E7EQT0;Q6S730;Q6S731;Q02548	.;.;.;.;.;.;PAX5_HUMAN	V	185;77;185;185;185;185;119;77;77;185	ENSP00000350844:L185V;ENSP00000367084:L185V;ENSP00000367083:L185V;ENSP00000429637:L185V;ENSP00000429291:L185V;ENSP00000404687:L119V;ENSP00000429359:L77V;ENSP00000429197:L77V;ENSP00000367078:L185V	ENSP00000350844:L185V	L	-	1	2	PAX5	36992696	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.768000	0.68858	2.553000	0.86117	0.555000	0.69702	CTG	.	.	none		0.672	PAX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052433.1		
SSTR4	6754	hgsc.bcm.edu	37	20	23016253	23016253	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr20:23016253G>A	ENST00000255008.3	+	1	197	c.133G>A	c.(133-135)Gcg>Acg	p.A45T	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	45					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					cgcgcgggcggcgggcATGGT	0.706																																					p.A45T	Esophageal Squamous(15;850 1104 16640)	Atlas-SNP	.											SSTR4,NS,carcinoma,-1,1	SSTR4	83	1	0			c.G133A						scavenged	.						34.0	44.0	40.0					20																	23016253		2158	4263	6421	SO:0001583	missense	6754	exon1			CGGGCGGCGGGCA		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.133G>A	20.37:g.23016253G>A	ENSP00000255008:p.Ala45Thr	59.0	1.0	0.0169492		66.0	20.0	0.30303	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170408	0.57584	.	.	ENSG00000132671	ENST00000255008	T	0.19806	2.12	3.57	3.57	0.40892	.	0.492039	0.15989	N	0.234938	T	0.14313	0.0346	L	0.27053	0.805	0.34943	D	0.750537	B	0.14805	0.011	B	0.12837	0.008	T	0.13495	-1.0507	10	0.15066	T	0.55	.	12.452	0.55682	0.0:0.0:1.0:0.0	.	45	P31391	SSR4_HUMAN	T	45	ENSP00000255008:A45T	ENSP00000255008:A45T	A	+	1	0	SSTR4	22964253	0.002000	0.14202	0.009000	0.14445	0.327000	0.28475	1.133000	0.31430	1.806000	0.52798	0.555000	0.69702	GCG	.	.	none		0.706	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
KCNK3	3777	hgsc.bcm.edu	37	2	26951314	26951314	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:26951314G>A	ENST00000302909.3	+	2	1188	c.1063G>A	c.(1063-1065)Gac>Aac	p.D355N		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	355					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	CCGCTACAGCGACACGCCCTC	0.701																																					p.D355N	GBM(80;1457 1631 27100 45946)	Atlas-SNP	.											.	KCNK3	43	.	0			c.G1063A						PASS	.						11.0	11.0	11.0					2																	26951314		2174	4258	6432	SO:0001583	missense	3777	exon2			TACAGCGACACGC	AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.1063G>A	2.37:g.26951314G>A	ENSP00000306275:p.Asp355Asn	48.0	0.0	0		44.0	9.0	0.204545	NM_002246	Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	37	CCDS1727.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894703	0.52121	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.20069	2.1	5.22	4.31	0.51392	.	1.496640	0.03451	N	0.210632	T	0.15003	0.0362	L	0.29908	0.895	0.25099	N	0.990794	P	0.42993	0.797	B	0.30572	0.117	T	0.21724	-1.0237	10	0.52906	T	0.07	.	6.4844	0.22081	0.0913:0.0:0.7263:0.1824	.	355	O14649	KCNK3_HUMAN	N	232;355	ENSP00000306275:D355N	ENSP00000306275:D355N	D	+	1	0	KCNK3	26804818	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.918000	0.40006	1.155000	0.42497	0.555000	0.69702	GAC	.	.	none		0.701	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
ATF4	468	hgsc.bcm.edu	37	22	39917610	39917610	+	Missense_Mutation	SNP	G	G	A	rs148038848		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr22:39917610G>A	ENST00000337304.2	+	1	1042	c.160G>A	c.(160-162)Gct>Act	p.A54T	ATF4_ENST00000404241.2_Missense_Mutation_p.A54T|ATF4_ENST00000396680.1_Missense_Mutation_p.A54T	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	54					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	CAGCGACAAGGCTAAGGCGGG	0.582																																					p.A54T		Atlas-SNP	.											.	ATF4	27	.	0			c.G160A						PASS	.	G	THR/ALA,THR/ALA	1,4405		0,1,2202	50.0	52.0	51.0		160,160	4.2	1.0	22	dbSNP_134	51	0,8600		0,0,4300	no	missense,missense	ATF4	NM_001675.2,NM_182810.1	58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	54/352,54/352	39917610	1,13005	2203	4300	6503	SO:0001583	missense	468	exon1			GACAAGGCTAAGG	D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.160G>A	22.37:g.39917610G>A	ENSP00000336790:p.Ala54Thr	118.0	0.0	0		99.0	23.0	0.232323	NM_001675	Q9UH31	Missense_Mutation	SNP	ENST00000337304.2	37	CCDS13996.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494153	0.85069	2.27E-4	0.0	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	T;T;T	0.46819	0.86;0.86;0.86	4.15	4.15	0.48705	.	0.257440	0.37669	N	0.001990	T	0.68751	0.3035	M	0.75264	2.295	0.52501	D	0.999956	D	0.89917	1.0	D	0.83275	0.996	T	0.74970	-0.3482	10	0.87932	D	0	-16.9756	16.4315	0.83847	0.0:0.0:1.0:0.0	.	54	P18848	ATF4_HUMAN	T	54	ENSP00000384587:A54T;ENSP00000336790:A54T;ENSP00000379912:A54T	ENSP00000336790:A54T	A	+	1	0	ATF4	38247556	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.442000	0.73443	1.863000	0.54032	0.561000	0.74099	GCT	G|1.000;A|0.000	0.000	weak		0.582	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321305.1	NM_001675	
FUT4	2526	hgsc.bcm.edu	37	11	94278849	94278849	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:94278849G>A	ENST00000358752.2	+	1	1833	c.1550G>A	c.(1549-1551)cGg>cAg	p.R517Q	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_002033.3	NP_002024.1	P22083	FUT4_HUMAN	fucosyltransferase 4 (alpha (1,3) fucosyltransferase, myeloid-specific)	517					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	cell periphery (GO:0071944)|cell surface (GO:0009986)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(2)|endometrium(2)|lung(1)|skin(2)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCTGGGGACCGGCCCAAGAGC	0.637																																					p.R517Q		Atlas-SNP	.											.	FUT4	17	.	0			c.G1550A						PASS	.						21.0	22.0	21.0					11																	94278849		2201	4298	6499	SO:0001583	missense	2526	exon1			GGGACCGGCCCAA		CCDS8301.1	11q21	2013-02-26			ENSG00000196371	ENSG00000196371		"""CD molecules"", ""Fucosyltransferases"""	4015	protein-coding gene	gene with protein product	"""ELAM ligand fucosyltransferase"", ""galactoside 3-L-fucosyltransferase"""	104230		CD15, FCT3A, ELFT		1702034	Standard	NM_002033		Approved	FUC-TIV	uc001pez.3	P22083	OTTHUMG00000167795	ENST00000358752.2:c.1550G>A	11.37:g.94278849G>A	ENSP00000351602:p.Arg517Gln	39.0	0.0	0		32.0	7.0	0.21875	NM_002033	B2RMS0	Missense_Mutation	SNP	ENST00000358752.2	37	CCDS8301.1	.	.	.	.	.	.	.	.	.	.	g	11.46	1.646077	0.29246	.	.	ENSG00000196371	ENST00000358752	T	0.23552	1.9	5.18	-4.55	0.03441	.	0.420286	0.20265	N	0.095800	T	0.08447	0.0210	N	0.05230	-0.09	0.09310	N	1	B	0.14438	0.01	B	0.15052	0.012	T	0.35699	-0.9778	10	0.06891	T	0.86	.	10.9392	0.47264	0.7511:0.0:0.1487:0.1002	.	517	P22083	FUT4_HUMAN	Q	517	ENSP00000351602:R517Q	ENSP00000351602:R517Q	R	+	2	0	FUT4	93918497	0.000000	0.05858	0.000000	0.03702	0.909000	0.53808	0.063000	0.14410	-0.920000	0.03799	-0.254000	0.11334	CGG	.	.	none		0.637	FUT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396327.2	NM_002033	
UACA	55075	hgsc.bcm.edu	37	15	70960860	70960860	+	Silent	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr15:70960860T>C	ENST00000322954.6	-	16	2348	c.2163A>G	c.(2161-2163)aaA>aaG	p.K721K	UACA_ENST00000560441.1_Silent_p.K706K|UACA_ENST00000539319.1_Silent_p.K612K|UACA_ENST00000379983.2_Silent_p.K708K	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	721					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						CCAAATAAACTTTTTCAATTT	0.313																																					p.K721K		Atlas-SNP	.											.	UACA	235	.	0			c.A2163G						PASS	.						97.0	98.0	97.0					15																	70960860		2199	4296	6495	SO:0001819	synonymous_variant	55075	exon16			ATAAACTTTTTCA	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.2163A>G	15.37:g.70960860T>C		75.0	0.0	0		55.0	10.0	0.181818	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Silent	SNP	ENST00000322954.6	37	CCDS10235.1																																																																																			.	.	none		0.313	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
MBTD1	54799	hgsc.bcm.edu	37	17	49281177	49281177	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:49281177G>A	ENST00000586178.1	-	8	1057	c.714C>T	c.(712-714)agC>agT	p.S238S	MBTD1_ENST00000415868.1_Silent_p.S238S|MBTD1_ENST00000376381.2_Silent_p.S238S	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	238					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			GAGGTTTTCCGCTGGCTGCAC	0.363																																					p.S238S		Atlas-SNP	.											.	MBTD1	44	.	0			c.C714T						PASS	.						130.0	130.0	130.0					17																	49281177		2203	4300	6503	SO:0001819	synonymous_variant	54799	exon8			TTTTCCGCTGGCT	AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.714C>T	17.37:g.49281177G>A		197.0	0.0	0		197.0	47.0	0.238579	NM_017643	Q6ZVU7|Q9NXU1	Silent	SNP	ENST00000586178.1	37	CCDS11581.2																																																																																			.	.	none		0.363	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318124.1		
CORO1A	11151	hgsc.bcm.edu	37	16	30198463	30198463	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr16:30198463C>T	ENST00000219150.5	+	5	860	c.555C>T	c.(553-555)agC>agT	p.S185S	RP11-455F5.5_ENST00000568506.1_RNA|CORO1A_ENST00000565497.1_Silent_p.S185S|RP11-455F5.5_ENST00000567153.1_RNA|CORO1A_ENST00000570045.1_Silent_p.S185S|RP11-455F5.5_ENST00000566144.1_RNA	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	185					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						TGGACTGGAGCCGAGATGGAG	0.612																																					p.S185S		Atlas-SNP	.											.	CORO1A	36	.	0			c.C555T						PASS	.						89.0	77.0	81.0					16																	30198463		2197	4300	6497	SO:0001819	synonymous_variant	11151	exon6			CTGGAGCCGAGAT	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.555C>T	16.37:g.30198463C>T		52.0	0.0	0		46.0	10.0	0.217391	NM_001193333	B2RBL1|Q2YD73	Silent	SNP	ENST00000219150.5	37	CCDS10673.1																																																																																			.	.	none		0.612	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074	
AIFM2	84883	hgsc.bcm.edu	37	10	71880315	71880315	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:71880315G>A	ENST00000307864.1	-	5	668	c.455C>T	c.(454-456)tCg>tTg	p.S152L	AIFM2_ENST00000482166.1_5'Flank|AIFM2_ENST00000373248.1_Missense_Mutation_p.S152L	NM_001198696.1|NM_032797.5	NP_001185625.1|NP_116186.1	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 2	152					apoptotic mitochondrial changes (GO:0008637)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|urinary_tract(2)	16						CACTCCAGCCGAGCCTCCTCC	0.522																																					p.S152L		Atlas-SNP	.											.	AIFM2	33	.	0			c.C455T						PASS	.						155.0	144.0	148.0					10																	71880315		2203	4300	6503	SO:0001583	missense	84883	exon5			CCAGCCGAGCCTC	AK027403	CCDS7297.1	10q22.2	2006-11-16	2006-11-16	2006-11-16	ENSG00000042286	ENSG00000042286			21411	protein-coding gene	gene with protein product		605159	"""apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of death"""	AMID		12135761, 11980907, 15958387	Standard	NM_001198696		Approved	FLJ14497, PRG3	uc001jqp.2	Q9BRQ8	OTTHUMG00000018398	ENST00000307864.1:c.455C>T	10.37:g.71880315G>A	ENSP00000312370:p.Ser152Leu	63.0	0.0	0		50.0	7.0	0.14	NM_001198696	B3KXI0|Q63Z39	Missense_Mutation	SNP	ENST00000307864.1	37	CCDS7297.1	.	.	.	.	.	.	.	.	.	.	G	35	5.425664	0.96131	.	.	ENSG00000042286	ENST00000373248;ENST00000307864;ENST00000395039	T;T	0.54675	0.56;0.56	5.05	5.05	0.67936	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.056297	0.64402	D	0.000001	T	0.39655	0.1086	N	0.10837	0.055	0.53688	D	0.99997	P	0.51653	0.947	P	0.44561	0.453	T	0.38415	-0.9662	10	0.38643	T	0.18	-14.083	18.2036	0.89847	0.0:0.0:1.0:0.0	.	152	Q9BRQ8	AIFM2_HUMAN	L	152;152;112	ENSP00000362345:S152L;ENSP00000312370:S152L	ENSP00000312370:S152L	S	-	2	0	AIFM2	71550321	1.000000	0.71417	0.969000	0.41365	0.996000	0.88848	8.832000	0.92079	2.645000	0.89757	0.655000	0.94253	TCG	.	.	none		0.522	AIFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048487.1	NM_032797	
PLD2	5338	hgsc.bcm.edu	37	17	4711711	4711711	+	Splice_Site	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:4711711G>A	ENST00000263088.6	+	4	514	c.383G>A	c.(382-384)cGa>cAa	p.R128Q	RP11-81A22.5_ENST00000571067.1_lincRNA|PLD2_ENST00000572940.1_Splice_Site_p.R128Q	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	128	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	CCTCTGGCTCGGTGAGGGCGA	0.567																																					p.R128Q		Atlas-SNP	.											.	PLD2	138	.	0			c.G383A						PASS	.						131.0	132.0	132.0					17																	4711711		2203	4300	6503	SO:0001630	splice_region_variant	5338	exon4			TGGCTCGGTGAGG	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.383+1G>A	17.37:g.4711711G>A		62.0	0.0	0		45.0	13.0	0.288889	NM_001243108	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	ENST00000263088.6	37	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665808	0.88251	.	.	ENSG00000129219	ENST00000263088	T	0.08807	3.05	5.51	5.51	0.81932	Phox homologous domain (5);	0.110266	0.64402	D	0.000015	T	0.14056	0.0340	M	0.77103	2.36	0.80722	D	1	B;P	0.42248	0.26;0.774	B;B	0.36567	0.095;0.228	T	0.02313	-1.1178	10	0.41790	T	0.15	-22.7426	16.9089	0.86135	0.0:0.0:1.0:0.0	.	128;128	O14939-2;O14939	.;PLD2_HUMAN	Q	128	ENSP00000263088:R128Q	ENSP00000263088:R128Q	R	+	2	0	PLD2	4658675	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.337000	0.79256	2.578000	0.87016	0.561000	0.74099	CGA	.	.	none		0.567	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	Missense_Mutation
STAT3	6774	hgsc.bcm.edu	37	17	40474419	40474419	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:40474419T>A	ENST00000264657.5	-	21	2294	c.1982A>T	c.(1981-1983)gAt>gTt	p.D661V	STAT3_ENST00000588969.1_Missense_Mutation_p.D661V|STAT3_ENST00000389272.3_Missense_Mutation_p.D563V|STAT3_ENST00000585517.1_Missense_Mutation_p.D661V|STAT3_ENST00000404395.3_Missense_Mutation_p.D661V	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	661	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		ATTGGTAGCATCCATGATCTT	0.483									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.D661V		Atlas-SNP	.											STAT3,skin,lymphoid_neoplasm,-1,42	STAT3	268	42	0			c.A1982T						PASS	.						244.0	212.0	223.0					17																	40474419		2203	4300	6503	SO:0001583	missense	6774	exon21	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	GTAGCATCCATGA	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1982A>T	17.37:g.40474419T>A	ENSP00000264657:p.Asp661Val	154.0	0.0	0		93.0	14.0	0.150538	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.187509	0.57909	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.89270	-2.49;-2.49;-2.49	4.47	4.47	0.54385	SH2 motif (4);	0.131223	0.56097	D	0.000040	D	0.89424	0.6711	N	0.24115	0.695	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.996;0.998;0.998	D	0.88197	0.2881	10	0.30854	T	0.27	-36.2816	13.9124	0.63876	0.0:0.0:0.0:1.0	.	661;661;661	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	V	661;563;661	ENSP00000264657:D661V;ENSP00000373923:D563V;ENSP00000384943:D661V	ENSP00000264657:D661V	D	-	2	0	STAT3	37727945	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	4.904000	0.63279	1.882000	0.54519	0.533000	0.62120	GAT	.	.	none		0.483	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
PLG	5340	hgsc.bcm.edu	37	6	161173935	161173935	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:161173935G>A	ENST00000308192.9	+	19	2338	c.2275G>A	c.(2275-2277)Gac>Aac	p.D759N		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	759	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TGTATAGGGTGACAGTGGAGG	0.468																																					p.D759N		Atlas-SNP	.											.	PLG	150	.	0			c.G2275A						PASS	.						95.0	89.0	91.0					6																	161173935		2203	4300	6503	SO:0001583	missense	5340	exon19			TAGGGTGACAGTG	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.2275G>A	6.37:g.161173935G>A	ENSP00000308938:p.Asp759Asn	352.0	0.0	0		283.0	58.0	0.204947	NM_000301	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	.	20.6	4.023041	0.75275	.	.	ENSG00000122194	ENST00000308192;ENST00000316325	D	0.94457	-3.43	3.44	3.44	0.39384	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.41097	U	0.000956	D	0.97676	0.9238	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98936	1.0789	10	0.87932	D	0	.	14.7974	0.69886	0.0:0.0:1.0:0.0	.	759	P00747	PLMN_HUMAN	N	759;159	ENSP00000308938:D759N	ENSP00000308938:D759N	D	+	1	0	PLG	161093925	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	8.934000	0.92915	1.614000	0.50241	0.460000	0.39030	GAC	.	.	none		0.468	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
BRAP	8315	hgsc.bcm.edu	37	12	112082105	112082105	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:112082105C>T	ENST00000327551.6	-	12	1727	c.1587G>A	c.(1585-1587)gaG>gaA	p.E529E	BRAP_ENST00000539060.1_Silent_p.E380E|BRAP_ENST00000419234.4_Silent_p.E559E			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						TGATCTGTCCCTCCTGGATTT	0.617																																					p.E559E	Pancreas(146;846 1904 7830 25130 26065)	Atlas-SNP	.											.	BRAP	42	.	0			c.G1677A						PASS	.						146.0	119.0	128.0					12																	112082105		2203	4300	6503	SO:0001819	synonymous_variant	8315	exon12			CTGTCCCTCCTGG	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1587G>A	12.37:g.112082105C>T		79.0	0.0	0		47.0	12.0	0.255319	NM_006768	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Silent	SNP	ENST00000327551.6	37																																																																																				.	.	none		0.617	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
FPGT	8790	hgsc.bcm.edu	37	1	74670119	74670119	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:74670119A>C	ENST00000609362.1	+	4	425	c.388A>C	c.(388-390)Att>Ctt	p.I130L	FPGT_ENST00000534056.1_Missense_Mutation_p.I130L|FPGT-TNNI3K_ENST00000370893.1_Intron|FPGT-TNNI3K_ENST00000533006.1_Intron|FPGT_ENST00000370894.5_Intron|FPGT_ENST00000524915.1_3'UTR|FPGT_ENST00000370898.3_Missense_Mutation_p.I143L|FPGT-TNNI3K_ENST00000557284.2_Intron|FPGT-TNNI3K_ENST00000370899.3_Intron|FPGT_ENST00000467578.2_3'UTR|TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000370895.1_Intron|FPGT_ENST00000482102.2_3'UTR	NM_003838.4	NP_003829.3	O14772	FPGT_HUMAN	fucose-1-phosphate guanylyltransferase	130					fucose metabolic process (GO:0006004)	cytoplasm (GO:0005737)	catalytic activity (GO:0003824)|fucose-1-phosphate guanylyltransferase activity (GO:0047341)|GTP binding (GO:0005525)	p.I130F(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	39						TCTGGGAAAAATTTTCACTGC	0.318																																					p.I130L		Atlas-SNP	.											FPGT,NS,carcinoma,0,1	FPGT	77	1	1	Substitution - Missense(1)	ovary(1)	c.A388C						PASS	.						102.0	115.0	111.0					1																	74670119		2203	4300	6503	SO:0001583	missense	8790	exon4			GGAAAAATTTTCA	AF017445	CCDS663.1, CCDS663.2	1p31.1	2013-09-24			ENSG00000254685	ENSG00000254685	2.7.7.30		3825	protein-coding gene	gene with protein product		603609				9804772	Standard	NM_003838		Approved	GFPP		O14772	OTTHUMG00000009571	ENST00000609362.1:c.388A>C	1.37:g.74670119A>C	ENSP00000476680:p.Ile130Leu	112.0	0.0	0		86.0	11.0	0.127907	NM_001199328	A6NMH3|B4DRX2|B4E2Y7|E9PNQ2|Q8N5J7	Missense_Mutation	SNP	ENST00000609362.1	37	CCDS663.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.488872	0.44249	.	.	ENSG00000254685	ENST00000524915;ENST00000370898;ENST00000534056;ENST00000472069	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.57	5.57	0.84162	L-fucokinase (1);	.	.	.	.	T	0.46521	0.1397	L	0.60845	1.875	0.80722	D	1	D;D;P	0.71674	0.998;0.99;0.56	D;D;B	0.74348	0.983;0.912;0.388	T	0.38478	-0.9659	9	0.38643	T	0.18	.	15.7348	0.77834	1.0:0.0:0.0:0.0	.	130;130;130	B4DH62;E9PNQ2;O14772	.;.;FPGT_HUMAN	L	130;130;130;128	ENSP00000434802:I130L;ENSP00000359935:I130L;ENSP00000432819:I130L;ENSP00000433499:I128L	ENSP00000359935:I130L	I	+	1	0	TNNI3K	74442707	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.944000	0.70219	2.116000	0.64780	0.482000	0.46254	ATT	.	.	none		0.318	FPGT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SOWAHD	347454	hgsc.bcm.edu	37	X	118893023	118893023	+	Missense_Mutation	SNP	G	G	C	rs373940647		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:118893023G>C	ENST00000343905.3	+	1	448	c.393G>C	c.(391-393)gaG>gaC	p.E131D		NM_001105576.2	NP_001099046.1	A6NJG2	SWAHD_HUMAN	sosondowah ankyrin repeat domain family member D	131																	TGCTGCGGGAGCTGCTGGAGG	0.721																																					p.E131D		Atlas-SNP	.											.	.	.	.	0			c.G393C						PASS	.		ASP/GLU	0,3633		0,0,0,1549,535	5.0	7.0	6.0		393	3.8	1.0	X		6	1,6518		0,0,1,2390,1738	no	missense	ANKRD58	NM_001105576.2	45	0,0,1,3939,2273	CC,CG,C,GG,G		0.0153,0.0,0.0099	probably-damaging	131/316	118893023	1,10151	2084	4129	6213	SO:0001583	missense	347454	exon1			GCGGGAGCTGCTG		CCDS43984.1	Xq24	2013-01-10	2012-01-12	2012-01-12	ENSG00000187808	ENSG00000187808		"""Ankyrin repeat domain containing"""	32960	protein-coding gene	gene with protein product			"""ankyrin repeat domain 58"""	ANKRD58		22234889	Standard	NM_001105576		Approved		uc010nql.3	A6NJG2	OTTHUMG00000159606	ENST00000343905.3:c.393G>C	X.37:g.118893023G>C	ENSP00000340975:p.Glu131Asp	25.0	0.0	0		26.0	5.0	0.192308	NM_001105576		Missense_Mutation	SNP	ENST00000343905.3	37	CCDS43984.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708542	0.48517	0.0	1.53E-4	ENSG00000187808	ENST00000343905	T	0.64803	-0.12	3.84	3.84	0.44239	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.68879	0.3049	L	0.52206	1.635	0.31372	N	0.680013	D	0.61697	0.99	P	0.60286	0.872	T	0.67620	-0.5624	9	0.23302	T	0.38	-10.3977	13.7024	0.62618	0.0:0.0:1.0:0.0	.	131	A6NJG2	ANR58_HUMAN	D	131	ENSP00000340975:E131D	ENSP00000340975:E131D	E	+	3	2	ANKRD58	118777051	0.998000	0.40836	0.998000	0.56505	0.898000	0.52572	1.055000	0.30467	1.767000	0.52121	0.183000	0.17082	GAG	.	.	weak		0.721	SOWAHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356469.1	NM_001105576	
ICOSLG	23308	hgsc.bcm.edu	37	21	45656994	45656994	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr21:45656994C>T	ENST00000407780.3	-	3	289	c.162G>A	c.(160-162)tgG>tgA	p.W54*	ICOSLG_ENST00000400377.3_Intron|ICOSLG_ENST00000400379.3_Nonsense_Mutation_p.W54*|ICOSLG_ENST00000344330.4_Nonsense_Mutation_p.W54*	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand	54	Ig-like V-type.				B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		CACTGGTTTGCCAATATACGT	0.527																																					p.W54X		Atlas-SNP	.											.	ICOSLG	20	.	0			c.G162A						PASS	.						92.0	108.0	102.0					21																	45656994		2125	4233	6358	SO:0001587	stop_gained	23308	exon3			GGTTTGCCAATAT	AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.162G>A	21.37:g.45656994C>T	ENSP00000384432:p.Trp54*	102.0	0.0	0		95.0	4.0	0.0421053	NM_015259	A8MUZ1|Q9HD18|Q9NRQ1	Nonsense_Mutation	SNP	ENST00000407780.3	37	CCDS42952.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453793	0.84209	.	.	ENSG00000160223	ENST00000344330;ENST00000407780;ENST00000400379	.	.	.	5.01	5.01	0.66863	.	0.000000	0.51477	D	0.000093	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.5671	14.542	0.68002	0.0:1.0:0.0:0.0	.	.	.	.	X	54	.	ENSP00000339477:W54X	W	-	3	0	ICOSLG	44481422	1.000000	0.71417	1.000000	0.80357	0.253000	0.25986	3.355000	0.52262	2.713000	0.92767	0.655000	0.94253	TGG	.	.	none		0.527	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000195838.1	NM_015259	
SMC4	10051	hgsc.bcm.edu	37	3	160130162	160130162	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:160130162G>A	ENST00000357388.3	+	7	1352	c.901G>A	c.(901-903)Gag>Aag	p.E301K	SMC4_ENST00000462787.1_Missense_Mutation_p.E301K|SMC4_ENST00000469762.1_Missense_Mutation_p.E276K|SMC4_ENST00000360111.2_Missense_Mutation_p.E301K|SMC4_ENST00000344722.5_Missense_Mutation_p.E301K|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000470240.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	301					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.E301K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTTAGAAGGAGAGAAAAACAT	0.289																																					p.E301K		Atlas-SNP	.											SMC4,mouth,carcinoma,0,1	SMC4	135	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G901A						PASS	.						54.0	56.0	56.0					3																	160130162		2202	4292	6494	SO:0001583	missense	10051	exon6			GAAGGAGAGAAAA	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.901G>A	3.37:g.160130162G>A	ENSP00000349961:p.Glu301Lys	294.0	0.0	0		312.0	118.0	0.378205	NM_005496	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	G	35	5.413422	0.96072	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000392788;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000344722	T;T;T;T;T;T	0.78003	-1.12;-1.14;-1.11;0.07;-1.14;-1.12	5.57	5.57	0.84162	RecF/RecN/SMC (1);	0.046370	0.85682	D	0.000000	T	0.77232	0.4100	N	0.20986	0.625	0.80722	D	1	P;D;P	0.56746	0.692;0.977;0.737	B;P;P	0.55011	0.295;0.766;0.524	T	0.74595	-0.3613	10	0.27082	T	0.32	-18.5462	19.1507	0.93487	0.0:0.0:1.0:0.0	.	301;276;301	Q9NTJ3-2;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	K	301;301;301;276;301;301;301	ENSP00000349961:E301K;ENSP00000353225:E301K;ENSP00000417964:E276K;ENSP00000420121:E301K;ENSP00000420734:E301K;ENSP00000341382:E301K	ENSP00000341382:E301K	E	+	1	0	SMC4	161612856	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.247000	0.95444	2.628000	0.89032	0.585000	0.79938	GAG	.	.	none		0.289	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
LINGO4	339398	hgsc.bcm.edu	37	1	151774688	151774688	+	Missense_Mutation	SNP	C	C	A	rs532798041	byFrequency	TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:151774688C>A	ENST00000368820.3	-	2	1430	c.493G>T	c.(493-495)Gac>Tac	p.D165Y		NM_001004432.2	NP_001004432.1	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	165						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGGTGGTTGTCCCCAACCTCC	0.602																																					p.D165Y		Atlas-SNP	.											.	LINGO4	51	.	0			c.G493T						PASS	.						52.0	59.0	57.0					1																	151774688		2203	4300	6503	SO:0001583	missense	339398	exon2			GGTTGTCCCCAAC		CCDS30855.1	1q21.3	2013-01-11	2007-02-01	2007-02-01	ENSG00000213171	ENSG00000213171		"""Immunoglobulin superfamily / I-set domain containing"""	31814	protein-coding gene	gene with protein product		609794	"""leucine rich repeat neuronal 6D"""	LRRN6D			Standard	NM_001004432		Approved		uc001ezf.1	Q6UY18	OTTHUMG00000013059	ENST00000368820.3:c.493G>T	1.37:g.151774688C>A	ENSP00000357810:p.Asp165Tyr	64.0	0.0	0		57.0	9.0	0.157895	NM_001004432		Missense_Mutation	SNP	ENST00000368820.3	37	CCDS30855.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132137	0.77662	.	.	ENSG00000213171	ENST00000368820	T	0.58060	0.36	5.29	5.29	0.74685	.	0.000000	0.51477	D	0.000100	T	0.54532	0.1864	L	0.31476	0.935	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.55749	-0.8092	10	0.51188	T	0.08	.	16.4618	0.84059	0.0:1.0:0.0:0.0	.	165	Q6UY18	LIGO4_HUMAN	Y	165	ENSP00000357810:D165Y	ENSP00000357810:D165Y	D	-	1	0	LINGO4	150041312	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.825000	0.62708	2.757000	0.94681	0.462000	0.41574	GAC	.	.	none		0.602	LINGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036639.1	XM_291387	
EPHB1	2047	hgsc.bcm.edu	37	3	134670283	134670283	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:134670283A>G	ENST00000398015.3	+	3	564	c.194A>G	c.(193-195)gAg>gGg	p.E65G	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	65	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						AATGTCTTCGAGCCCAACCAG	0.552																																					p.E65G		Atlas-SNP	.											.	EPHB1	519	.	0			c.A194G						PASS	.						39.0	43.0	42.0					3																	134670283		2143	4268	6411	SO:0001583	missense	2047	exon3			TCTTCGAGCCCAA	L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.194A>G	3.37:g.134670283A>G	ENSP00000381097:p.Glu65Gly	114.0	0.0	0		84.0	31.0	0.369048	NM_004441	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	ENST00000398015.3	37	CCDS46921.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096720	0.56075	.	.	ENSG00000154928	ENST00000460895;ENST00000398015;ENST00000473867;ENST00000474732	T;T;T;T	0.03920	3.76;3.76;3.76;3.76	5.55	5.55	0.83447	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.07098	0.0180	L	0.55213	1.73	0.80722	D	1	B;B	0.18461	0.028;0.002	B;B	0.24541	0.054;0.003	T	0.12066	-1.0562	10	0.51188	T	0.08	.	10.1025	0.42513	0.9253:0.0:0.0747:0.0	.	65;65	B5A969;P54762	.;EPHB1_HUMAN	G	43;65;43;43	ENSP00000417435:E43G;ENSP00000381097:E65G;ENSP00000417216:E43G;ENSP00000418352:E43G	ENSP00000381097:E65G	E	+	2	0	EPHB1	136152973	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.574000	0.82434	2.105000	0.64084	0.528000	0.53228	GAG	.	.	none		0.552	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357671.1	NM_004441	
LGALS8	3964	hgsc.bcm.edu	37	1	236703874	236703874	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:236703874A>G	ENST00000366584.4	+	5	922	c.356A>G	c.(355-357)aAt>aGt	p.N119S	LGALS8_ENST00000526589.1_Missense_Mutation_p.N119S|LGALS8_ENST00000450372.2_Missense_Mutation_p.N119S|LGALS8_ENST00000352231.2_Missense_Mutation_p.N119S|LGALS8_ENST00000416919.2_Intron|RP11-385F5.4_ENST00000433131.1_RNA|LGALS8_ENST00000527974.1_Missense_Mutation_p.N119S|LGALS8_ENST00000525042.1_Intron|LGALS8_ENST00000323938.6_Missense_Mutation_p.N92S|LGALS8_ENST00000526634.1_Missense_Mutation_p.N119S|LGALS8_ENST00000341872.6_Missense_Mutation_p.N119S	NM_201544.2	NP_963838.1	O00214	LEG8_HUMAN	lectin, galactoside-binding, soluble, 8	119	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				plasma cell differentiation (GO:0002317)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(5)	20	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GTGGCTGTAAATGGAAAACAT	0.398																																					p.N119S		Atlas-SNP	.											.	LGALS8	42	.	0			c.A356G						PASS	.						98.0	107.0	104.0					1																	236703874		2203	4300	6503	SO:0001583	missense	3964	exon6			CTGTAAATGGAAA	X91790	CCDS1611.1, CCDS1612.1	1q43	2011-08-04	2008-07-25		ENSG00000116977	ENSG00000116977		"""Lectins, galactoside-binding"""	6569	protein-coding gene	gene with protein product	"""galectin 8"""	606099				7852431, 8692978	Standard	NM_201545		Approved	PCTA-1	uc001hxy.2	O00214	OTTHUMG00000039953	ENST00000366584.4:c.356A>G	1.37:g.236703874A>G	ENSP00000355543:p.Asn119Ser	41.0	0.0	0		53.0	9.0	0.169811	NM_006499	O15215|Q5T3P5|Q5T3Q4|Q8TEV1|Q96B92|Q9BXC8|Q9H584|Q9H585|Q9UEZ6|Q9UP32|Q9UP33|Q9UP34	Missense_Mutation	SNP	ENST00000366584.4	37	CCDS1612.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121846	0.77436	.	.	ENSG00000116977	ENST00000454943;ENST00000527974;ENST00000352231;ENST00000406509;ENST00000526589;ENST00000341872;ENST00000450372;ENST00000366584;ENST00000356238;ENST00000323938;ENST00000526634	T;T;T;T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19;2.19	5.46	5.46	0.80206	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.046652	0.85682	D	0.000000	T	0.44265	0.1285	M	0.91663	3.23	0.80722	D	1	D;P	0.56746	0.977;0.67	P;B	0.49528	0.614;0.173	T	0.58618	-0.7605	10	0.62326	D	0.03	-8.8691	15.7119	0.77635	1.0:0.0:0.0:0.0	.	119;119	O00214;O00214-2	LEG8_HUMAN;.	S	119;119;119;119;119;119;119;119;119;92;119	ENSP00000405504:N119S;ENSP00000431398:N119S;ENSP00000309576:N119S;ENSP00000385999:N119S;ENSP00000435460:N119S;ENSP00000342139:N119S;ENSP00000408657:N119S;ENSP00000355543:N119S;ENSP00000434860:N92S;ENSP00000437040:N119S	ENSP00000434860:N92S	N	+	2	0	LGALS8	234770497	1.000000	0.71417	0.985000	0.45067	0.752000	0.42762	8.536000	0.90627	2.291000	0.77112	0.533000	0.62120	AAT	.	.	none		0.398	LGALS8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000096365.2	NM_006499	
CFB	629	hgsc.bcm.edu	37	6	31918104	31918104	+	Silent	SNP	G	G	A	rs553118090		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:31918104G>A	ENST00000425368.2	+	12	2061	c.1548G>A	c.(1546-1548)gtG>gtA	p.V516V	CFB_ENST00000477310.1_Silent_p.V867V|CFB_ENST00000556679.1_Silent_p.V1018V|CFB_ENST00000456570.1_Silent_p.V1018V	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	516	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						GGGCTGTGGTGTCTGAGTACT	0.502													G|||	1	0.000199681	0.0	0.0014	5008	,	,		24111	0.0		0.0	False		,,,				2504	0.0				p.V516V		Atlas-SNP	.											.	CFB	33	.	0			c.G1548A						PASS	.						128.0	90.0	104.0					6																	31918104		1511	2709	4220	SO:0001819	synonymous_variant	629	exon12			TGTGGTGTCTGAG	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.1548G>A	6.37:g.31918104G>A		66.0	0.0	0		67.0	5.0	0.0746269	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Silent	SNP	ENST00000425368.2	37	CCDS4729.1																																																																																			.	.	none		0.502	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
PHIP	55023	hgsc.bcm.edu	37	6	79671508	79671508	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:79671508C>T	ENST00000275034.4	-	31	3722	c.3555G>A	c.(3553-3555)gtG>gtA	p.V1185V	PHIP_ENST00000479165.1_5'UTR|AL356776.1_ENST00000516160.2_RNA	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1185	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CCACGGGGGCCACAAATGCTG	0.343																																					p.V1185V		Atlas-SNP	.											.	PHIP	177	.	0			c.G3555A						PASS	.						71.0	66.0	68.0					6																	79671508		2203	4300	6503	SO:0001819	synonymous_variant	55023	exon31			GGGGGCCACAAAT	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3555G>A	6.37:g.79671508C>T		271.0	0.0	0		245.0	11.0	0.044898	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Silent	SNP	ENST00000275034.4	37	CCDS4987.1																																																																																			.	.	none		0.343	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
OR51M1	390059	hgsc.bcm.edu	37	11	5410941	5410941	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:5410941T>C	ENST00000328611.3	+	1	335	c.313T>C	c.(313-315)Tac>Cac	p.Y105H	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	105					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCATAGTATCTACTTTGGAGC	0.502																																					p.Y105H		Atlas-SNP	.											.	OR51M1	60	.	0			c.T313C						PASS	.						195.0	184.0	188.0					11																	5410941		2001	4189	6190	SO:0001583	missense	390059	exon1			AGTATCTACTTTG	BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.313T>C	11.37:g.5410941T>C	ENSP00000333196:p.Tyr105His	53.0	0.0	0		41.0	8.0	0.195122	NM_001004756	Q6IF80	Missense_Mutation	SNP	ENST00000328611.3	37	CCDS53596.1	.	.	.	.	.	.	.	.	.	.	T	5.448	0.267790	0.10349	.	.	ENSG00000184698	ENST00000328611	T	0.37411	1.2	5.15	2.72	0.32119	GPCR, rhodopsin-like superfamily (1);	0.269998	0.19621	U	0.109920	T	0.24236	0.0587	L	0.35542	1.07	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18366	-1.0339	10	0.66056	D	0.02	.	5.5623	0.17150	0.1898:0.0899:0.0:0.7204	.	94	Q9H341	O51M1_HUMAN	H	105	ENSP00000333196:Y105H	ENSP00000333196:Y105H	Y	+	1	0	OR51M1	5367517	0.000000	0.05858	0.767000	0.31495	0.054000	0.15201	-0.695000	0.05109	0.995000	0.38917	0.528000	0.53228	TAC	.	.	none		0.502	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142981.1	NM_001004756	
KAT2A	2648	hgsc.bcm.edu	37	17	40267789	40267789	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:40267789G>A	ENST00000225916.5	-	12	1880	c.1827C>T	c.(1825-1827)taC>taT	p.Y609Y		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	609	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						AGGTGAGGAAGTAGAGAATGT	0.572																																					p.Y609Y		Atlas-SNP	.											.	KAT2A	54	.	0			c.C1827T						PASS	.						251.0	228.0	235.0					17																	40267789		2203	4300	6503	SO:0001819	synonymous_variant	2648	exon12			GAGGAAGTAGAGA	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1827C>T	17.37:g.40267789G>A		70.0	0.0	0		52.0	8.0	0.153846	NM_021078	Q8N1A2|Q9UCW1	Silent	SNP	ENST00000225916.5	37	CCDS11417.1																																																																																			.	.	none		0.572	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
ACTB	60	hgsc.bcm.edu	37	7	5568064	5568064	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr7:5568064C>T	ENST00000331789.5	-	4	841	c.650G>A	c.(649-651)tGc>tAc	p.C217Y	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	217					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		GGCGACGTAGCACAGCTTCTC	0.592																																					p.C217Y		Atlas-SNP	.											.	ACTB	45	.	0			c.G650A						PASS	.						68.0	69.0	69.0					7																	5568064		2203	4300	6503	SO:0001583	missense	60	exon4			ACGTAGCACAGCT	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.650G>A	7.37:g.5568064C>T	ENSP00000349960:p.Cys217Tyr	99.0	0.0	0		69.0	14.0	0.202899	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.460810	0.63513	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.95788	-3.81	5.55	5.55	0.83447	.	0.086725	0.49916	D	0.000140	D	0.99052	0.9675	H	0.99689	4.705	0.58432	D	0.999999	P	0.44044	0.825	D	0.72338	0.977	D	0.98548	1.0635	10	0.87932	D	0	.	18.1418	0.89642	0.0:1.0:0.0:0.0	.	217	P60709	ACTB_HUMAN	Y	217;193;189;136	ENSP00000349960:C217Y	ENSP00000440549:C136Y	C	-	2	0	ACTB	5534590	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.533000	0.81994	2.617000	0.88574	0.650000	0.86243	TGC	.	.	none		0.592	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
CLK1	1195	hgsc.bcm.edu	37	2	201721689	201721689	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:201721689C>T	ENST00000321356.4	-	8	987	c.852G>A	c.(850-852)ttG>ttA	p.L284L	CLK1_ENST00000409769.2_Silent_p.L107L|CLK1_ENST00000434813.2_Silent_p.L326L	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	284	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CTGTGTGAGTCAACTTATTAC	0.378																																					p.L326L		Atlas-SNP	.											.	CLK1	103	.	0			c.G978A						PASS	.						85.0	86.0	86.0					2																	201721689		2203	4300	6503	SO:0001819	synonymous_variant	1195	exon8			GTGAGTCAACTTA	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.852G>A	2.37:g.201721689C>T		64.0	0.0	0		56.0	16.0	0.285714	NM_001162407	B4DFW7|Q0P694|Q8N5V8	Silent	SNP	ENST00000321356.4	37	CCDS2331.1																																																																																			.	.	none		0.378	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
PCDHA9	9752	hgsc.bcm.edu	37	5	140229745	140229745	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:140229745G>A	ENST00000532602.1	+	1	2698	c.1665G>A	c.(1663-1665)gtG>gtA	p.V555V	PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.V555V|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	555	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGTTCGTGCTGGACGAGA	0.692																																					p.V555V	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											.	PCDHA9	373	.	0			c.G1665A						PASS	.						63.0	68.0	66.0					5																	140229745		2196	4270	6466	SO:0001819	synonymous_variant	9752	exon1			GTTCGTGCTGGAC	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1665G>A	5.37:g.140229745G>A		122.0	0.0	0		92.0	15.0	0.163043	NM_031857	O15053|Q2M3S5	Silent	SNP	ENST00000532602.1	37	CCDS54920.1																																																																																			.	.	none		0.692	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
C5orf46	389336	hgsc.bcm.edu	37	5	147286047	147286047	+	Silent	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:147286047A>G	ENST00000318315.4	-	1	18	c.18T>C	c.(16-18)ctT>ctC	p.L6L	C5orf46_ENST00000510432.1_5'UTR|C5orf46_ENST00000515291.1_Silent_p.L6L	NM_206966.2	NP_996849.2	Q6UWT4	CE046_HUMAN	chromosome 5 open reading frame 46	6						extracellular vesicular exosome (GO:0070062)				NS(1)|lung(1)|prostate(1)	3						CTGTCAGGCGAAGTACTGAGA	0.453																																					p.L6L		Atlas-SNP	.											.	C5orf46	8	.	0			c.T18C						PASS	.						102.0	88.0	93.0					5																	147286047		2203	4300	6503	SO:0001819	synonymous_variant	389336	exon1			CAGGCGAAGTACT		CCDS34267.1	5q33.1	2013-12-13			ENSG00000178776	ENSG00000178776			33768	protein-coding gene	gene with protein product	"""skin and saliva secreted protein 1"""						Standard	NM_206966		Approved	MGC23985, SSSP1	uc003lou.3	Q6UWT4	OTTHUMG00000163420	ENST00000318315.4:c.18T>C	5.37:g.147286047A>G		284.0	0.0	0		271.0	39.0	0.143911	NM_206966	A8K038|Q8WU04	Silent	SNP	ENST00000318315.4	37	CCDS34267.1																																																																																			.	.	none		0.453	C5orf46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373314.1	NM_206966	
TMEM135	65084	hgsc.bcm.edu	37	11	87024503	87024503	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:87024503G>A	ENST00000305494.5	+	11	1012	c.973G>A	c.(973-975)Gat>Aat	p.D325N	TMEM135_ENST00000532959.1_Missense_Mutation_p.D196N|TMEM135_ENST00000535167.1_Missense_Mutation_p.D186N|TMEM135_ENST00000340353.7_Missense_Mutation_p.D303N	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	325					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CAGAAACTTAGATGATGAACT	0.308																																					p.D325N		Atlas-SNP	.											.	TMEM135	40	.	0			c.G973A						PASS	.						91.0	96.0	94.0					11																	87024503		2201	4297	6498	SO:0001583	missense	65084	exon11			AACTTAGATGATG	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.973G>A	11.37:g.87024503G>A	ENSP00000306344:p.Asp325Asn	265.0	0.0	0		231.0	41.0	0.177489	NM_022918	Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	37	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	G	33	5.224353	0.95139	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.72795	0.3505	M	0.73598	2.24	0.80722	D	1	P;D	0.76494	0.663;0.999	B;D	0.73380	0.321;0.98	T	0.72769	-0.4193	9	.	.	.	-30.6207	18.3398	0.90302	0.0:0.0:1.0:0.0	.	303;325	Q86UB9-2;Q86UB9	.;TM135_HUMAN	N	303;162;196;325;186	ENSP00000345513:D303N;ENSP00000436179:D196N;ENSP00000306344:D325N;ENSP00000439525:D186N	.	D	+	1	0	TMEM135	86702151	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.066000	0.93949	2.579000	0.87056	0.655000	0.94253	GAT	.	.	none		0.308	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
LINC01205	401082	hgsc.bcm.edu	37	3	109195589	109195589	+	lincRNA	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:109195589A>G	ENST00000497996.1	+	0	444																											taaagcctcaagaacagtgtg	0.323																																					p.Q89Q		Atlas-SNP	.											.	.	.	.	0			c.A267G						PASS	.						187.0	172.0	176.0					3																	109195589		692	1591	2283			0	exon4			GCCTCAAGAACAG																													3.37:g.109195589A>G		84.0	0.0	0		62.0	16.0	0.258065	NM_001145553		Silent	SNP	ENST00000497996.1	37																																																																																				.	.	none		0.323	RP11-702L6.4-002	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000353892.1		
ZNF208	7757	hgsc.bcm.edu	37	19	22157028	22157028	+	Missense_Mutation	SNP	C	C	A	rs202182420		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:22157028C>A	ENST00000397126.4	-	4	956	c.808G>T	c.(808-810)Gca>Tca	p.A270S	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GTAAGGATTGCAGATTGGTTA	0.363																																					p.A270S		Atlas-SNP	.											.	ZNF208	817	.	0			c.G808T						PASS	.						33.0	36.0	35.0					19																	22157028		2135	4261	6396	SO:0001583	missense	7757	exon4			GGATTGCAGATTG	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.808G>T	19.37:g.22157028C>A	ENSP00000380315:p.Ala270Ser	40.0	0.0	0		42.0	6.0	0.142857	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.619833	0.00118	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.12465	2.68	2.89	-5.78	0.02362	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03959	0.0111	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35773	-0.9775	8	0.02654	T	1	.	5.8775	0.18836	0.3922:0.3729:0.0:0.2349	.	270	O43345	ZN208_HUMAN	S	270	ENSP00000380315:A270S	ENSP00000380315:A270S	A	-	1	0	ZNF208	21948868	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.978000	0.01494	-2.348000	0.00619	-2.562000	0.00173	GCA	C|0.996;A|0.004	0.004	weak		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
DGKI	9162	hgsc.bcm.edu	37	7	137080402	137080402	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr7:137080402C>A	ENST00000288490.5	-	33	3023	c.3023G>T	c.(3022-3024)cGg>cTg	p.R1008L	DGKI_ENST00000424189.2_Missense_Mutation_p.R1021L|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000446122.1_Missense_Mutation_p.R990L|DGKI_ENST00000453654.2_Missense_Mutation_p.R677L	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1008					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GCACACAGCCCGGTTCCGCTG	0.562																																					p.R1008L		Atlas-SNP	.											DGKI_ENST00000288490,NS,carcinoma,-1,2	DGKI	335	2	0			c.G3023T						PASS	.						76.0	67.0	70.0					7																	137080402		2203	4300	6503	SO:0001583	missense	9162	exon33			ACAGCCCGGTTCC	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3023G>T	7.37:g.137080402C>A	ENSP00000288490:p.Arg1008Leu	55.0	0.0	0		62.0	9.0	0.145161	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613227	0.87359	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.60424	0.19;0.19;0.19	5.35	5.35	0.76521	Ankyrin repeat-containing domain (3);	0.061139	0.64402	D	0.000002	T	0.48750	0.1517	N	0.01640	-0.785	0.58432	D	0.999999	P;P	0.44986	0.659;0.847	P;P	0.54706	0.494;0.759	T	0.67845	-0.5565	10	0.87932	D	0	.	19.4396	0.94813	0.0:1.0:0.0:0.0	.	677;1008	E9PFX6;O75912	.;DGKI_HUMAN	L	677;925;1011;1008;990	ENSP00000392161:R677L;ENSP00000288490:R1008L;ENSP00000399131:R990L	ENSP00000288490:R1008L	R	-	2	0	DGKI	136730942	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	5.491000	0.66887	2.652000	0.90054	0.650000	0.86243	CGG	.	.	none		0.562	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
GAS6	2621	hgsc.bcm.edu	37	13	114530106	114530106	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr13:114530106C>T	ENST00000327773.6	-	12	1486	c.1340G>A	c.(1339-1341)aGc>aAc	p.S447N	GAS6_ENST00000355761.4_Missense_Mutation_p.S393N|GAS6_ENST00000450766.1_Missense_Mutation_p.S174N|GAS6_ENST00000357389.3_Missense_Mutation_p.S490N|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000418959.3_Missense_Mutation_p.S148N	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	490	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CCAGTTCCAGCTCCTCATGCA	0.567																																					p.S447N		Atlas-SNP	.											GAS6_ENST00000327773,colon,carcinoma,-1,2	GAS6	75	2	0			c.G1340A						PASS	.						142.0	115.0	124.0					13																	114530106		2203	4300	6503	SO:0001583	missense	2621	exon12			TTCCAGCTCCTCA		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1340G>A	13.37:g.114530106C>T	ENSP00000331831:p.Ser447Asn	90.0	0.0	0		62.0	9.0	0.145161	NM_000820	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	C	6.825	0.521409	0.13005	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000418959;ENST00000327773	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	4.55	3.7	0.42460	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	.	.	.	.	T	0.64057	0.2564	N	0.16903	0.455	0.29004	N	0.887312	P;B;B	0.48503	0.911;0.001;0.001	P;B;B	0.47402	0.546;0.002;0.002	T	0.54330	-0.8310	9	0.16896	T	0.51	-32.5518	6.1848	0.20491	0.0:0.6573:0.1674:0.1753	.	490;174;447	Q14393;B3KVL4;Q14393-2	GAS6_HUMAN;.;.	N	490;393;174;148;447	ENSP00000349962:S490N;ENSP00000348003:S393N;ENSP00000416498:S174N;ENSP00000400117:S148N;ENSP00000331831:S447N	ENSP00000331831:S447N	S	-	2	0	GAS6	113583837	1.000000	0.71417	0.889000	0.34880	0.462000	0.32619	3.448000	0.52943	0.901000	0.36495	0.462000	0.41574	AGC	.	.	none		0.567	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045946.2	NM_000820	
TNRC6C	57690	hgsc.bcm.edu	37	17	76045908	76045908	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:76045908C>T	ENST00000588061.1	+	5	1492	c.765C>T	c.(763-765)aaC>aaT	p.N255N	TNRC6C_ENST00000588847.1_Silent_p.N255N|TNRC6C_ENST00000544502.1_Silent_p.N255N|TNRC6C_ENST00000301624.4_Silent_p.N255N|TNRC6C_ENST00000335749.4_Silent_p.N255N|TNRC6C_ENST00000541771.1_Silent_p.N255N			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	255	Gly-rich.|Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CCCCAGGTAACCCTGCCACAG	0.498																																					p.N255N		Atlas-SNP	.											TNRC6C,NS,carcinoma,+1,1	TNRC6C	173	1	0			c.C765T						PASS	.						70.0	72.0	71.0					17																	76045908		1950	4151	6101	SO:0001819	synonymous_variant	57690	exon4			AGGTAACCCTGCC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.765C>T	17.37:g.76045908C>T		63.0	0.0	0		61.0	25.0	0.409836	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	37	CCDS45798.1																																																																																			.	.	none		0.498	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
ZNF570	148268	hgsc.bcm.edu	37	19	37975034	37975034	+	Silent	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:37975034T>C	ENST00000330173.1	+	5	1039	c.510T>C	c.(508-510)agT>agC	p.S170S	ZNF570_ENST00000388801.3_5'UTR|ZNF570_ENST00000586475.1_Silent_p.S226S	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTGGGGAAGTTTTCATCAGA	0.363																																					p.S170S		Atlas-SNP	.											.	ZNF570	58	.	0			c.T510C						PASS	.						118.0	129.0	125.0					19																	37975034		2203	4300	6503	SO:0001819	synonymous_variant	148268	exon5			GGGAAGTTTTCAT	AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.510T>C	19.37:g.37975034T>C		79.0	0.0	0		81.0	18.0	0.222222	NM_144694	A1L472|B4DMP1	Silent	SNP	ENST00000330173.1	37	CCDS12504.1																																																																																			.	.	none		0.363	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1	NM_144694	
HIF3A	64344	hgsc.bcm.edu	37	19	46832549	46832549	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:46832549C>T	ENST00000377670.4	+	12	1557	c.1526C>T	c.(1525-1527)cCc>cTc	p.P509L	HIF3A_ENST00000244303.6_Missense_Mutation_p.P440L|HIF3A_ENST00000420102.2_Missense_Mutation_p.P458L|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000339613.2_Missense_Mutation_p.P453L|HIF3A_ENST00000600383.1_Missense_Mutation_p.P440L|HIF3A_ENST00000300862.3_Missense_Mutation_p.P507L	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	509	ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GAGCAGCTACCCAGGGCCTAC	0.647																																					p.P509L		Atlas-SNP	.											.	HIF3A	154	.	0			c.C1526T						PASS	.						58.0	58.0	58.0					19																	46832549		2203	4300	6503	SO:0001583	missense	64344	exon12			AGCTACCCAGGGC	AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1526C>T	19.37:g.46832549C>T	ENSP00000366898:p.Pro509Leu	109.0	0.0	0		90.0	18.0	0.2	NM_152795	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	ENST00000377670.4	37	CCDS12681.2	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574652	0.45902	.	.	ENSG00000124440	ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	D;D;D;D;D	0.86694	-2.16;-2.16;-2.16;-2.16;-2.16	4.82	3.72	0.42706	.	0.243027	0.21541	N	0.072885	T	0.82263	0.4999	N	0.22421	0.69	0.39731	D	0.971608	P;P;P;P;P;P	0.48089	0.782;0.905;0.573;0.77;0.626;0.626	B;B;B;P;B;B	0.48598	0.423;0.419;0.294;0.583;0.419;0.419	D	0.84495	0.0613	10	0.72032	D	0.01	.	10.954	0.47347	0.1862:0.8138:0.0:0.0	.	458;440;507;453;509;509	F5H884;B4DNA2;Q9Y2N7-2;A8MPQ1;Q9Y2N7;B0M185	.;.;.;.;HIF3A_HUMAN;.	L	509;509;440;453;453;507;458	ENSP00000366898:P509L;ENSP00000244303:P440L;ENSP00000341877:P453L;ENSP00000300862:P507L;ENSP00000407771:P458L	ENSP00000244302:P509L	P	+	2	0	HIF3A	51524389	0.975000	0.34042	0.999000	0.59377	0.999000	0.98932	2.401000	0.44513	2.394000	0.81467	0.655000	0.94253	CCC	.	.	none		0.647	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280556.3		
HIST1H2AK	8330	hgsc.bcm.edu	37	6	27805883	27805883	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:27805883T>C	ENST00000330180.2	-	1	234	c.235A>G	c.(235-237)Atc>Gtc	p.I79V	HIST1H2BN_ENST00000606613.1_5'Flank|HIST1H2BN_ENST00000396980.3_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	79						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)	p.I79L(1)		breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						CGCGGGATGATGCGGGTCTTC	0.627																																					p.I79V		Atlas-SNP	.											HIST1H2AK,NS,carcinoma,0,1	HIST1H2AK	28	1	1	Substitution - Missense(1)	kidney(1)	c.A235G						PASS	.						108.0	110.0	109.0					6																	27805883		2203	4300	6503	SO:0001583	missense	8330	exon1			GGATGATGCGGGT	Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.235A>G	6.37:g.27805883T>C	ENSP00000330307:p.Ile79Val	148.0	0.0	0		149.0	22.0	0.147651	NM_003510	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000330180.2	37	CCDS4632.1	.	.	.	.	.	.	.	.	.	.	.	19.08	3.757723	0.69648	.	.	ENSG00000184348	ENST00000330180	T	0.73897	-0.79	4.28	4.28	0.50868	.	0.000000	0.31507	U	0.007535	T	0.73644	0.3613	.	.	.	0.32741	N	0.507672	.	.	.	.	.	.	T	0.77308	-0.2636	7	0.87932	D	0	.	13.277	0.60191	0.0:0.0:0.0:1.0	.	.	.	.	V	79	ENSP00000330307:I79V	ENSP00000330307:I79V	I	-	1	0	HIST1H2AK	27913862	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.949000	0.70257	1.860000	0.53959	0.454000	0.30748	ATC	.	.	none		0.627	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043814.1	NM_003510	
KCNU1	157855	hgsc.bcm.edu	37	8	36694417	36694417	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr8:36694417G>A	ENST00000399881.3	+	14	1509	c.1472G>A	c.(1471-1473)gGc>gAc	p.G491D		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	491	Segment S7.				multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		TTGGTGCCAGGCTTGTGTACC	0.428																																					p.G491D		Atlas-SNP	.											.	KCNU1	359	.	0			c.G1472A						PASS	.						188.0	187.0	188.0					8																	36694417		1879	4107	5986	SO:0001583	missense	157855	exon14			TGCCAGGCTTGTG	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.1472G>A	8.37:g.36694417G>A	ENSP00000382770:p.Gly491Asp	88.0	0.0	0		86.0	16.0	0.186047	NM_001031836		Missense_Mutation	SNP	ENST00000399881.3	37	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.985327	0.93044	.	.	ENSG00000215262	ENST00000399881	T	0.66995	-0.24	5.34	5.34	0.76211	Potassium channel, calcium-activated, BK, alpha subunit (2);NAD(P)-binding domain (1);	0.000000	0.38837	U	0.001555	D	0.83746	0.5321	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.85851	0.1404	10	0.87932	D	0	-7.8102	18.9859	0.92769	0.0:0.0:1.0:0.0	.	491	A8MYU2	KCNU1_HUMAN	D	491	ENSP00000382770:G491D	ENSP00000382770:G491D	G	+	2	0	KCNU1	36813575	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.234000	0.95347	2.657000	0.90304	0.585000	0.79938	GGC	.	.	none		0.428	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
CHD5	26038	hgsc.bcm.edu	37	1	6189098	6189098	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:6189098T>A	ENST00000262450.3	-	23	3518	c.3419A>T	c.(3418-3420)aAc>aTc	p.N1140I	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CACCTTCTTGTTCTGGCCGAT	0.642																																					p.N1140I		Atlas-SNP	.											.	CHD5	267	.	0			c.A3419T						PASS	.						53.0	49.0	50.0					1																	6189098		2203	4300	6503	SO:0001583	missense	26038	exon23			TTCTTGTTCTGGC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.3419A>T	1.37:g.6189098T>A	ENSP00000262450:p.Asn1140Ile	52.0	0.0	0		43.0	7.0	0.162791	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	T	19.74	3.883183	0.72410	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	T	0.75938	-0.98	4.62	4.62	0.57501	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.62060	0.2397	N	0.16201	0.385	0.80722	D	1	P	0.46512	0.879	B	0.43575	0.424	T	0.68584	-0.5370	10	0.56958	D	0.05	-42.1979	14.314	0.66434	0.0:0.0:0.0:1.0	.	1140	Q8TDI0	CHD5_HUMAN	I	1140;656;548;548	ENSP00000262450:N1140I	ENSP00000262450:N1140I	N	-	2	0	CHD5	6111685	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.606000	0.61126	1.839000	0.53478	0.459000	0.35465	AAC	.	.	none		0.642	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
SMARCA5	8467	hgsc.bcm.edu	37	4	144467950	144467950	+	Silent	SNP	A	A	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr4:144467950A>C	ENST00000283131.3	+	20	3004	c.2542A>C	c.(2542-2544)Aga>Cga	p.R848R		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	848	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TTGGAATAAGAGAGATTTTAA	0.333																																					p.R848R		Atlas-SNP	.											SMARCA5,rectum,carcinoma,-1,1	SMARCA5	73	1	0			c.A2542C						PASS	.						82.0	85.0	84.0					4																	144467950		2203	4299	6502	SO:0001819	synonymous_variant	8467	exon20			AATAAGAGAGATT	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.2542A>C	4.37:g.144467950A>C		141.0	0.0	0		101.0	27.0	0.267327	NM_003601		Silent	SNP	ENST00000283131.3	37	CCDS3761.1																																																																																			.	.	none		0.333	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
PATZ1	23598	hgsc.bcm.edu	37	22	31741415	31741415	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr22:31741415C>T	ENST00000266269.5	-	1	803	c.174G>A	c.(172-174)gtG>gtA	p.V58V	PATZ1_ENST00000215919.3_Silent_p.V58V|PATZ1_ENST00000351933.4_Silent_p.V58V|PATZ1_ENST00000405309.3_Silent_p.V58V|AC005003.1_ENST00000504184.2_5'Flank	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	58	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						AGGCGGCCAGCACGGCGCGGT	0.682																																					p.V58V		Atlas-SNP	.											.	PATZ1	24	.	0			c.G174A						PASS	.						22.0	22.0	22.0					22																	31741415		2203	4296	6499	SO:0001819	synonymous_variant	23598	exon1			GGCCAGCACGGCG	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.174G>A	22.37:g.31741415C>T		114.0	0.0	0		70.0	9.0	0.128571	NM_032050	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Silent	SNP	ENST00000266269.5	37	CCDS13894.1																																																																																			.	.	none		0.682	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	NM_032052	
TMSB4X	7114	hgsc.bcm.edu	37	X	12994364	12994364	+	Splice_Site	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:12994364G>A	ENST00000380635.1	+	2	200		c.e2-1		TMSB4X_ENST00000380636.1_5'UTR|TMSB4X_ENST00000451311.2_Splice_Site|TMSB4X_ENST00000380633.1_Splice_Site			P62328	TYB4_HUMAN	thymosin beta 4, X-linked						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						GCTCCCTGCAGCTTTTCCTCC	0.547																																					.		Atlas-SNP	.											.	TMSB4X	3	.	0			.						PASS	.						55.0	53.0	54.0					X																	12994364		2203	4300	6503	SO:0001630	splice_region_variant	7114	.			CCTGCAGCTTTTC		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.-16-1G>A	X.37:g.12994364G>A		123.0	0.0	0		90.0	26.0	0.288889	.	P01253|P01254|Q546P5|Q63576|Q9UE55	Splice_Site	SNP	ENST00000380635.1	37	CCDS35202.1																																																																																			.	.	none		0.547	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	Intron
ANKS1A	23294	hgsc.bcm.edu	37	6	34857324	34857324	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:34857324G>A	ENST00000360359.3	+	1	283	c.145G>A	c.(145-147)Ggc>Agc	p.G49S	TAF11_ENST00000420584.2_5'Flank|ANKS1A_ENST00000535627.1_Missense_Mutation_p.G49S|TAF11_ENST00000361288.4_5'Flank	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	49	Gly-rich.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						cggcagcggcggcggcggcgg	0.771																																					p.G49S		Atlas-SNP	.											ANKS1A,NS,carcinoma,0,1	ANKS1A	123	1	0			c.G145A						scavenged	.						2.0	2.0	2.0					6																	34857324		382	1194	1576	SO:0001583	missense	23294	exon1			AGCGGCGGCGGCG	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.145G>A	6.37:g.34857324G>A	ENSP00000353518:p.Gly49Ser	4.0	0.0	0		10.0	7.0	0.7	NM_015245	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008376	0.54361	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;D	0.98649	1.19;-5.05	4.58	1.53	0.23141	Ankyrin repeat-containing domain (1);	1.264600	0.06451	N	0.727796	D	0.90783	0.7106	N	0.19112	0.55	0.25322	N	0.989108	P;B	0.49090	0.919;0.003	B;B	0.38655	0.278;0.002	D	0.88474	0.3064	10	0.17832	T	0.49	-4.009	8.7007	0.34323	0.0795:0.0:0.6816:0.2389	.	49;49	B4DQW8;Q92625	.;ANS1A_HUMAN	S	49	ENSP00000353518:G49S;ENSP00000438752:G49S	ENSP00000353518:G49S	G	+	1	0	ANKS1A	34965302	1.000000	0.71417	0.794000	0.32065	0.327000	0.28475	2.586000	0.46119	0.389000	0.25086	0.471000	0.43371	GGC	.	.	none		0.771	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
SYNPR	132204	hgsc.bcm.edu	37	3	63466620	63466620	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:63466620C>T	ENST00000295894.5	+	2	506	c.137C>T	c.(136-138)gCc>gTc	p.A46V	SYNPR_ENST00000478744.1_3'UTR|SYNPR-AS1_ENST00000488201.1_RNA|SYNPR_ENST00000478300.1_Missense_Mutation_p.A66V|SYNPR_ENST00000479198.1_Missense_Mutation_p.A46V|SYNPR_ENST00000465156.1_Missense_Mutation_p.A46V|SYNPR_ENST00000460711.1_Missense_Mutation_p.A57V	NM_144642.4	NP_653243.1	Q8TBG9	SYNPR_HUMAN	synaptoporin	46	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cell junction (GO:0030054)|integral component of synaptic vesicle membrane (GO:0030285)|neuron projection (GO:0043005)	transporter activity (GO:0005215)	p.A66V(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8				BRCA - Breast invasive adenocarcinoma(55;0.000918)|KIRC - Kidney renal clear cell carcinoma(15;0.0658)|Kidney(15;0.0904)		ATAGCGTTTGCCTACCCATTC	0.483																																					p.A66V	NSCLC(29;1052 1116 20025 32519)	Atlas-SNP	.											SYNPR,NS,carcinoma,+1,4	SYNPR	38	4	1	Substitution - Missense(1)	NS(1)	c.C197T						PASS	.						152.0	154.0	153.0					3																	63466620		1998	4164	6162	SO:0001583	missense	132204	exon3			CGTTTGCCTACCC	AF411860	CCDS46859.1, CCDS46860.1	3p14.3	2011-07-28			ENSG00000163630	ENSG00000163630			16507	protein-coding gene	gene with protein product						8034131, 12974474	Standard	NM_144642		Approved	MGC26651, SPO	uc003dlp.3	Q8TBG9	OTTHUMG00000158699	ENST00000295894.5:c.137C>T	3.37:g.63466620C>T	ENSP00000295894:p.Ala46Val	47.0	0.0	0		41.0	8.0	0.195122	NM_001130003	B2R675|G5E9W4	Missense_Mutation	SNP	ENST00000295894.5	37	CCDS46860.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000995	0.74818	.	.	ENSG00000163630	ENST00000478300;ENST00000295894;ENST00000479198;ENST00000460711;ENST00000465156	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	5.04	5.04	0.67666	Marvel (1);MARVEL-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72479	0.3465	M	0.75264	2.295	0.80722	D	1	P;P;D	0.56521	0.939;0.856;0.976	P;P;P	0.53224	0.721;0.636;0.6	T	0.72347	-0.4321	10	0.31617	T	0.26	-21.964	17.382	0.87407	0.0:1.0:0.0:0.0	.	57;46;66	B3KVD8;Q8TBG9;G5E9W4	.;SYNPR_HUMAN;.	V	66;46;46;57;46	ENSP00000418994:A66V;ENSP00000295894:A46V;ENSP00000418929:A46V;ENSP00000418701:A57V;ENSP00000418123:A46V	ENSP00000295894:A46V	A	+	2	0	SYNPR	63441660	1.000000	0.71417	0.983000	0.44433	0.964000	0.63967	3.717000	0.54911	2.343000	0.79666	0.557000	0.71058	GCC	.	.	none		0.483	SYNPR-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351787.1		
SSTR4	6754	hgsc.bcm.edu	37	20	23016714	23016714	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr20:23016714C>A	ENST00000255008.3	+	1	658	c.594C>A	c.(592-594)tgC>tgA	p.C198*	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	198					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CCGTGGCCTGCAACCTGCAGT	0.657																																					p.C198X	Esophageal Squamous(15;850 1104 16640)	Atlas-SNP	.											.	SSTR4	83	.	0			c.C594A						PASS	.						30.0	38.0	35.0					20																	23016714		2135	4242	6377	SO:0001587	stop_gained	6754	exon1			GGCCTGCAACCTG		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.594C>A	20.37:g.23016714C>A	ENSP00000255008:p.Cys198*	11.0	0.0	0		16.0	5.0	0.3125	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Nonsense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810719	0.90707	.	.	ENSG00000132671	ENST00000255008	.	.	.	3.21	1.21	0.21127	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5942	0.28037	0.0:0.7766:0.0:0.2234	.	.	.	.	X	198	.	ENSP00000255008:C198X	C	+	3	2	SSTR4	22964714	1.000000	0.71417	0.967000	0.41034	0.983000	0.72400	2.053000	0.41326	0.091000	0.17302	0.655000	0.94253	TGC	.	.	none		0.657	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
HIST1H1D	3007	hgsc.bcm.edu	37	6	26234687	26234687	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26234687C>A	ENST00000244534.5	-	1	529	c.475G>T	c.(475-477)Gta>Tta	p.V159L		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	159					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.V159I(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GGCTTCTTTACCTTCTTAGGA	0.537																																					p.V159L		Atlas-SNP	.											HIST1H1D,NS,carcinoma,0,1	HIST1H1D	40	1	1	Substitution - Missense(1)	breast(1)	c.G475T						PASS	.						93.0	98.0	96.0					6																	26234687		2203	4300	6503	SO:0001583	missense	3007	exon1			TCTTTACCTTCTT	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.475G>T	6.37:g.26234687C>A	ENSP00000244534:p.Val159Leu	82.0	0.0	0		87.0	12.0	0.137931	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	10.31	1.315837	0.23908	.	.	ENSG00000124575	ENST00000244534	T	0.13901	2.55	5.22	3.42	0.39159	.	0.381500	0.28349	N	0.015665	T	0.02230	0.0069	N	0.08118	0	0.09310	N	0.999998	B	0.17038	0.02	B	0.14023	0.01	T	0.42498	-0.9448	10	0.41790	T	0.15	-0.0274	10.3773	0.44090	0.0:0.7912:0.1347:0.074	.	159	P16402	H13_HUMAN	L	159	ENSP00000244534:V159L	ENSP00000244534:V159L	V	-	1	0	HIST1H1D	26342666	0.543000	0.26434	0.026000	0.17262	0.002000	0.02628	3.715000	0.54897	0.691000	0.31592	0.650000	0.86243	GTA	.	.	none		0.537	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
HIST1H2AM	8336	hgsc.bcm.edu	37	6	27860749	27860749	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:27860749G>A	ENST00000359611.2	-	1	214	c.179C>T	c.(178-180)aCt>aTt	p.T60I	HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2BO_ENST00000303806.4_5'Flank|HIST1H3J_ENST00000479986.1_5'UTR	NM_003514.2	NP_003505.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	60						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)	14						GATCTCGGCAGTTAGGTACTC	0.672																																					p.T60I		Atlas-SNP	.											.	HIST1H2AM	27	.	0			c.C179T						PASS	.						66.0	72.0	70.0					6																	27860749		2202	4300	6502	SO:0001583	missense	8336	exon1			TCGGCAGTTAGGT	X57138	CCDS4639.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000233224	ENSG00000278677		"""Histones / Replication-dependent"""	4735	protein-coding gene	gene with protein product		602796	"""H2A histone family, member N"", ""histone 1, H2am"""	H2AFN		1768865, 9439656, 12408966	Standard	NM_003514		Approved	H2A/n, H2A.1	uc003nkb.1	P0C0S8	OTTHUMG00000014494	ENST00000359611.2:c.179C>T	6.37:g.27860749G>A	ENSP00000352627:p.Thr60Ile	135.0	0.0	0		161.0	32.0	0.198758	NM_003514	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359611.2	37	CCDS4639.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907441	0.72868	.	.	ENSG00000233224	ENST00000359611	T	0.66995	-0.24	4.06	4.06	0.47325	.	0.000000	0.30911	U	0.008621	T	0.76856	0.4046	M	0.83774	2.66	0.35595	D	0.807403	.	.	.	.	.	.	T	0.81680	-0.0823	8	0.87932	D	0	.	16.02	0.80473	0.0:0.0:1.0:0.0	.	.	.	.	I	60	ENSP00000352627:T60I	ENSP00000352627:T60I	T	-	2	0	HIST1H2AM	27968728	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	7.384000	0.79751	2.545000	0.85829	0.655000	0.94253	ACT	.	.	none		0.672	HIST1H2AM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040162.1	NM_003514	
TNNT1	7138	hgsc.bcm.edu	37	19	55645539	55645539	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:55645539G>A	ENST00000588981.1	-	12	849	c.645C>T	c.(643-645)ccC>ccT	p.P215P	TNNT1_ENST00000587758.1_Intron|TNNT1_ENST00000356783.5_Intron|TNNT1_ENST00000587465.2_Intron|TNNT1_ENST00000291901.8_Intron|TNNT1_ENST00000536926.1_Intron|TNNT1_ENST00000588426.1_Intron|TNNT1_ENST00000585321.2_Intron	NM_003283.4	NP_003274.3	P13805	TNNT1_HUMAN	troponin T type 1 (skeletal, slow)	215					muscle filament sliding (GO:0030049)|negative regulation of muscle contraction (GO:0045932)|skeletal muscle contraction (GO:0003009)|slow-twitch skeletal muscle fiber contraction (GO:0031444)	cytosol (GO:0005829)|troponin complex (GO:0005861)	tropomyosin binding (GO:0005523)			endometrium(2)|kidney(3)|lung(4)|ovary(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		CAGGGCAGGAGGGCTGTGATG	0.617																																					p.P215P		Atlas-SNP	.											.	TNNT1	28	.	0			c.C645T						PASS	.						23.0	21.0	22.0					19																	55645539		2199	4295	6494	SO:0001819	synonymous_variant	7138	exon12			GCAGGAGGGCTGT		CCDS12917.1, CCDS46185.1, CCDS59421.1	19q13.4	2014-09-17	2005-09-12			ENSG00000105048			11948	protein-coding gene	gene with protein product	"""slow skeletal muscle troponin T"", ""troponin T1, skeletal, slow"", ""nemaline myopathy type 5"""	191041	"""troponin T1, skeletal, slow"""			1505979	Standard	XM_006723343		Approved	ANM, STNT, TNT, TNTS, FLJ98147, MGC104241, NEM5	uc002qjb.4	P13805		ENST00000588981.1:c.645C>T	19.37:g.55645539G>A		61.0	0.0	0		40.0	7.0	0.175	NM_003283	O95472|Q16061|Q5U0E1	Silent	SNP	ENST00000588981.1	37	CCDS12917.1																																																																																			.	.	none		0.617	TNNT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451825.2	NM_003283	
HIST1H1D	3007	hgsc.bcm.edu	37	6	26234812	26234812	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26234812C>T	ENST00000244534.5	-	1	404	c.350G>A	c.(349-351)gGc>gAc	p.G117D		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	117					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				CTTGGGTTTGCCTTCCCCGGA	0.587																																					p.G117D		Atlas-SNP	.											.	HIST1H1D	40	.	0			c.G350A						PASS	.						61.0	68.0	65.0					6																	26234812		2203	4300	6503	SO:0001583	missense	3007	exon1			GGTTTGCCTTCCC	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.350G>A	6.37:g.26234812C>T	ENSP00000244534:p.Gly117Asp	70.0	0.0	0		80.0	20.0	0.25	NM_005320	B2R751|Q2M2I2	Missense_Mutation	SNP	ENST00000244534.5	37	CCDS4597.1	.	.	.	.	.	.	.	.	.	.	.	4.798	0.148320	0.09134	.	.	ENSG00000124575	ENST00000244534	T	0.10668	2.85	5.23	3.34	0.38264	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.673705	0.14516	N	0.314786	T	0.01287	0.0042	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.45760	-0.9239	10	0.07325	T	0.83	-14.8326	9.3036	0.37861	0.0824:0.3818:0.5358:0.0	.	117	P16402	H13_HUMAN	D	117	ENSP00000244534:G117D	ENSP00000244534:G117D	G	-	2	0	HIST1H1D	26342791	0.999000	0.42202	0.915000	0.36163	0.006000	0.05464	2.678000	0.46900	1.354000	0.45846	-0.147000	0.13772	GGC	.	.	none		0.587	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040095.1	NM_005320	
CXCR4	7852	hgsc.bcm.edu	37	2	136872627	136872627	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:136872627C>T	ENST00000241393.3	-	2	975	c.871G>A	c.(871-873)Gct>Act	p.A291T	CXCR4_ENST00000466288.1_5'UTR|CXCR4_ENST00000409817.1_Missense_Mutation_p.A295T	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4	291					activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	TGGAAGAAAGCTAGGGCCTCG	0.507																																					p.A295T		Atlas-SNP	.											.	CXCR4	51	.	0			c.G883A						PASS	.						457.0	435.0	443.0					2																	136872627		2203	4300	6503	SO:0001583	missense	7852	exon1			AGAAAGCTAGGGC	AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.871G>A	2.37:g.136872627C>T	ENSP00000241393:p.Ala291Thr	179.0	0.0	0		151.0	28.0	0.18543	NM_001008540	B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	Missense_Mutation	SNP	ENST00000241393.3	37	CCDS46420.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.744707	0.89663	.	.	ENSG00000121966	ENST00000409817;ENST00000241393;ENST00000537957	T;T	0.39229	1.09;1.09	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72301	0.3443	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.74668	-0.3588	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	291;295	P61073;P61073-2	CXCR4_HUMAN;.	T	295;291;161	ENSP00000386884:A295T;ENSP00000241393:A291T	ENSP00000241393:A291T	A	-	1	0	CXCR4	136589097	1.000000	0.71417	0.948000	0.38648	0.985000	0.73830	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	GCT	.	.	none		0.507	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000331732.1		
EIF4A2	1974	hgsc.bcm.edu	37	3	186502355	186502355	+	Missense_Mutation	SNP	C	C	G	rs371691662		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:186502355C>G	ENST00000323963.5	+	3	142	c.78C>G	c.(76-78)agC>agG	p.S26R	SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000356531.5_5'UTR|RP11-573D15.9_ENST00000577781.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.S27R|SNORA63_ENST00000363548.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363450.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	26					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		ACTTACAGAGCAACTGGAATG	0.398			T	BCL6	NHL																																p.S26R		Atlas-SNP	.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	55	.	0			c.C78G						PASS	.						184.0	188.0	187.0					3																	186502355		2203	4300	6503	SO:0001583	missense	1974	exon3			ACAGAGCAACTGG	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.78C>G	3.37:g.186502355C>G	ENSP00000326381:p.Ser26Arg	151.0	0.0	0		109.0	21.0	0.192661	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656454	0.67586	.	.	ENSG00000156976	ENST00000441007;ENST00000445596;ENST00000323963;ENST00000440191	T;T;T	0.32753	1.44;1.64;1.65	4.16	3.29	0.37713	.	0.043514	0.85682	D	0.000000	T	0.37237	0.0996	M	0.82517	2.595	0.80722	D	1	B;B	0.15473	0.013;0.005	B;B	0.19391	0.012;0.025	T	0.42666	-0.9438	10	0.87932	D	0	-14.8241	10.5715	0.45202	0.0:0.9034:0.0:0.0966	.	27;26	Q14240-2;Q14240	.;IF4A2_HUMAN	R	26;26;26;27	ENSP00000415878:S26R;ENSP00000326381:S26R;ENSP00000398370:S27R	ENSP00000326381:S26R	S	+	3	2	EIF4A2	187985049	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	2.929000	0.48916	1.345000	0.45676	0.585000	0.79938	AGC	.	.	alt		0.398	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
CFAP43	80217	hgsc.bcm.edu	37	10	105923874	105923874	+	Missense_Mutation	SNP	G	G	A	rs146455280		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:105923874G>A	ENST00000357060.3	-	24	3339	c.3224C>T	c.(3223-3225)aCg>aTg	p.T1075M	WDR96_ENST00000428666.1_Missense_Mutation_p.T1076M	NM_025145.5	NP_079421.5														NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CACAACAAGCGTTCTCTCTGG	0.428																																					p.T1075M		Atlas-SNP	.											.	WDR96	183	.	0			c.C3224T						PASS	.						151.0	134.0	140.0					10																	105923874		2203	4300	6503	SO:0001583	missense	80217	exon24			ACAAGCGTTCTCT																												ENST00000357060.3:c.3224C>T	10.37:g.105923874G>A	ENSP00000349568:p.Thr1075Met	80.0	0.0	0		71.0	22.0	0.309859	NM_025145		Missense_Mutation	SNP	ENST00000357060.3	37	CCDS31281.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	4.355|4.355	0.065353|0.065353	0.08388|0.08388	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000434629|ENST00000357060;ENST00000428666	.|T;T	.|0.13778	.|2.56;2.56	6.06|6.06	1.42|1.42	0.22433|0.22433	.|.	.|0.338170	.|0.28589	.|N	.|0.014819	T|T	0.07324|0.07324	0.0185|0.0185	L|L	0.33485|0.33485	1.01|1.01	0.09310|0.09310	N|N	1|1	.|B;B	.|0.33171	.|0.241;0.4	.|B;B	.|0.25987	.|0.065;0.05	T|T	0.24440|0.24440	-1.0160|-1.0160	5|10	.|0.33141	.|T	.|0.24	.|.	3.9695|3.9695	0.09447|0.09447	0.1936:0.1251:0.5536:0.1277|0.1936:0.1251:0.5536:0.1277	.|.	.|1076;1075	.|G5E9L1;Q8NDM7	.|.;WDR96_HUMAN	C|M	436|1075;1076	.|ENSP00000349568:T1075M;ENSP00000400289:T1076M	.|ENSP00000349568:T1075M	R|T	-|-	1|2	0|0	WDR96|WDR96	105913864|105913864	0.781000|0.781000	0.28676|0.28676	0.590000|0.590000	0.28732|0.28732	0.048000|0.048000	0.14542|0.14542	1.142000|1.142000	0.31540|0.31540	0.894000|0.894000	0.36317|0.36317	-0.127000|-0.127000	0.14921|0.14921	CGC|ACG	G|1.000;T|0.000	.	alt		0.428	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ZNF474	133923	hgsc.bcm.edu	37	5	121488255	121488255	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:121488255G>T	ENST00000296600.4	+	2	953	c.570G>T	c.(568-570)aaG>aaT	p.K190N	CTC-441N14.1_ENST00000505209.1_RNA|ZNF474_ENST00000514925.1_Intron|CTC-441N14.2_ENST00000504829.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	190							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		GCAAGCCAAAGGGTGAGGGTC	0.522																																					p.K190N		Atlas-SNP	.											.	ZNF474	43	.	0			c.G570T						PASS	.						89.0	85.0	86.0					5																	121488255		2203	4300	6503	SO:0001583	missense	133923	exon2			GCCAAAGGGTGAG	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.570G>T	5.37:g.121488255G>T	ENSP00000296600:p.Lys190Asn	74.0	0.0	0		70.0	17.0	0.242857	NM_207317	A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	G	6.459	0.452915	0.12283	.	.	ENSG00000164185	ENST00000296600	T	0.51574	0.7	5.26	3.44	0.39384	Zinc finger, C2H2 (1);	0.638340	0.13037	N	0.418838	T	0.33381	0.0861	L	0.32530	0.975	0.25703	N	0.985565	B	0.10296	0.003	B	0.12837	0.008	T	0.15235	-1.0444	10	0.31617	T	0.26	-6.7594	6.1089	0.20090	0.0771:0.1358:0.6472:0.14	.	190	Q6S9Z5	ZN474_HUMAN	N	190	ENSP00000296600:K190N	ENSP00000296600:K190N	K	+	3	2	ZNF474	121516154	1.000000	0.71417	0.857000	0.33713	0.123000	0.20343	1.969000	0.40510	1.372000	0.46190	-0.122000	0.15005	AAG	.	.	none		0.522	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317	
KRTAP5-2	440021	hgsc.bcm.edu	37	11	1619234	1619234	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:1619234C>T	ENST00000412090.1	-	1	290	c.247G>A	c.(247-249)Ggc>Agc	p.G83S	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	83	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCTTGGAGCCCCCACAGGAG	0.662																																					p.G83S		Atlas-SNP	.											.	KRTAP5-2	38	.	0			c.G247A						PASS	.						60.0	83.0	75.0					11																	1619234		2202	4297	6499	SO:0001583	missense	440021	exon1			TGGAGCCCCCACA	AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.247G>A	11.37:g.1619234C>T	ENSP00000400041:p.Gly83Ser	118.0	0.0	0		102.0	19.0	0.186275	NM_001004325	A9JTZ1	Missense_Mutation	SNP	ENST00000412090.1	37	CCDS31331.1	.	.	.	.	.	.	.	.	.	.	c	13.71	2.319352	0.41096	.	.	ENSG00000205867	ENST00000412090	T	0.00864	5.6	3.88	2.92	0.33932	.	.	.	.	.	T	0.00967	0.0032	L	0.33189	0.99	0.24258	N	0.995291	P	0.51791	0.948	B	0.41332	0.354	T	0.56360	-0.7992	9	0.23891	T	0.37	.	8.6816	0.34212	0.2552:0.7448:0.0:0.0	.	83	Q701N4	KRA52_HUMAN	S	83	ENSP00000400041:G83S	ENSP00000400041:G83S	G	-	1	0	KRTAP5-2	1575810	0.042000	0.20092	0.984000	0.44739	0.843000	0.47879	0.460000	0.21924	0.712000	0.32039	0.447000	0.29281	GGC	.	.	none		0.662	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384775.1	NM_001004325	
CPA2	1358	hgsc.bcm.edu	37	7	129916536	129916536	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr7:129916536G>A	ENST00000222481.4	+	7	709	c.654G>A	c.(652-654)ctG>ctA	p.L218L		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	218					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.L216L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					TCTTCCTCCTGCCAGTCACAA	0.443																																					p.L218L		Atlas-SNP	.											CPA2,NS,carcinoma,0,1	CPA2	36	1	1	Substitution - coding silent(1)	endometrium(1)	c.G654A						PASS	.						212.0	192.0	199.0					7																	129916536		2203	4300	6503	SO:0001819	synonymous_variant	1358	exon7			CCTCCTGCCAGTC	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.654G>A	7.37:g.129916536G>A		115.0	0.0	0		88.0	5.0	0.0568182	NM_001869	A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Silent	SNP	ENST00000222481.4	37	CCDS5817.2																																																																																			.	.	none		0.443	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347124.2	NM_001869	
LIPN	643418	hgsc.bcm.edu	37	10	90537944	90537944	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:90537944A>G	ENST00000404459.1	+	9	1142	c.1142A>G	c.(1141-1143)gAt>gGt	p.D381G		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	381					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		TGGGGCCTCGATGCCCCTCAA	0.418																																					p.D381G		Atlas-SNP	.											.	LIPN	28	.	0			c.A1142G						PASS	.						78.0	73.0	74.0					10																	90537944		1878	4099	5977	SO:0001583	missense	643418	exon9			GCCTCGATGCCCC		CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.1142A>G	10.37:g.90537944A>G	ENSP00000383923:p.Asp381Gly	98.0	0.0	0		95.0	21.0	0.221053	NM_001102469	A7KIH9	Missense_Mutation	SNP	ENST00000404459.1	37	CCDS44456.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464544	0.63513	.	.	ENSG00000204020	ENST00000404459	T	0.64618	-0.11	5.21	4.07	0.47477	Alpha/beta hydrolase fold-1 (1);	.	.	.	.	T	0.76499	0.3996	M	0.80028	2.48	0.33987	D	0.648718	D	0.89917	1.0	D	0.81914	0.995	T	0.82043	-0.0653	8	.	.	.	-23.3114	8.0083	0.30338	0.8345:0.0:0.1655:0.0	.	381	Q5VXI9	LIPN_HUMAN	G	381	ENSP00000383923:D381G	.	D	+	2	0	LIPN	90527924	1.000000	0.71417	0.951000	0.38953	0.983000	0.72400	4.688000	0.61715	1.114000	0.41781	0.523000	0.50628	GAT	.	.	none		0.418	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049254.2	XM_926751	
RPL35A	6165	hgsc.bcm.edu	37	3	197678057	197678057	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:197678057C>T	ENST00000464167.1	+	3	306	c.39C>T	c.(37-39)ggC>ggT	p.G13G	IQCG_ENST00000480302.1_Intron|RPL35A_ENST00000329092.8_3'UTR|IQCG_ENST00000455191.1_5'Flank|IQCG_ENST00000453254.1_5'Flank|RPL35A_ENST00000448864.1_Silent_p.G13G|IQCG_ENST00000265239.6_Intron	NM_000996.2	NP_000987.2	P18077	RL35A_HUMAN	ribosomal protein L35a	13					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)|tRNA binding (GO:0000049)			lung(1)|prostate(1)|urinary_tract(1)	3	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;1.04e-23)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.182)		TTTTTGCTGGCTATAAGCGGG	0.443																																					p.G13G		Atlas-SNP	.											.	RPL35A	9	.	0			c.C39T						PASS	.						73.0	74.0	73.0					3																	197678057		2202	4298	6500	SO:0001819	synonymous_variant	6165	exon3			TGCTGGCTATAAG	X52966	CCDS33930.1	3q29	2011-04-06			ENSG00000182899	ENSG00000182899		"""L ribosomal proteins"""	10345	protein-coding gene	gene with protein product		180468				1577483, 8786106	Standard	NM_000996		Approved	L35A	uc003fyr.3	P18077	OTTHUMG00000155386	ENST00000464167.1:c.39C>T	3.37:g.197678057C>T		88.0	0.0	0		70.0	15.0	0.214286	NM_000996	Q08ES9|Q9BVN7	Silent	SNP	ENST00000464167.1	37	CCDS33930.1																																																																																			.	.	none		0.443	RPL35A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339788.1	NM_000996	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140810511	140810511	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:140810511G>A	ENST00000252085.3	+	1	327	c.185G>A	c.(184-186)cGc>cAc	p.R62H	PCDHGA10_ENST00000398610.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCGCGGAGCGCGGAGTCCGC	0.652																																					p.R62H		Atlas-SNP	.											PCDHGA12_ENST00000252085,NS,carcinoma,+1,4	PCDHGA12	271	4	0			c.G185A						PASS	.						58.0	72.0	67.0					5																	140810511		2202	4300	6502	SO:0001583	missense	26025	exon1			CGGAGCGCGGAGT	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.185G>A	5.37:g.140810511G>A	ENSP00000252085:p.Arg62His	109.0	0.0	0		102.0	12.0	0.117647	NM_032094	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1	.	.	.	.	.	.	.	.	.	.	g	10.60	1.395216	0.25205	.	.	ENSG00000253159	ENST00000252085	T	0.41400	1.0	5.55	3.74	0.42951	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.48822	0.1521	M	0.84433	2.695	0.09310	N	1	B;B	0.26809	0.16;0.1	B;B	0.27170	0.062;0.077	T	0.47995	-0.9073	9	0.52906	T	0.07	.	11.4063	0.49900	0.07:0.1252:0.8048:0.0	.	62;62	O60330-2;O60330	.;PCDGC_HUMAN	H	62	ENSP00000252085:R62H	ENSP00000252085:R62H	R	+	2	0	PCDHGA12	140790695	1.000000	0.71417	0.908000	0.35775	0.194000	0.23727	5.368000	0.66133	1.333000	0.45449	0.555000	0.69702	CGC	.	.	none		0.652	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
A2M	2	hgsc.bcm.edu	37	12	9266020	9266020	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr12:9266020C>T	ENST00000318602.7	-	2	513	c.206G>A	c.(205-207)gGa>gAa	p.G69E		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	69					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GCTCCTGTTTCCCCTGACAGA	0.527																																					p.G69E		Atlas-SNP	.											.	A2M	180	.	0			c.G206A						PASS	.						127.0	129.0	128.0					12																	9266020		2203	4300	6503	SO:0001583	missense	2	exon2			CTGTTTCCCCTGA	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.206G>A	12.37:g.9266020C>T	ENSP00000323929:p.Gly69Glu	135.0	0.0	0		144.0	28.0	0.194444	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	C	1.695	-0.503106	0.04261	.	.	ENSG00000175899	ENST00000318602;ENST00000540099;ENST00000404455	T;T	0.08008	3.14;3.14	4.83	-4.86	0.03132	.	0.951065	0.08710	N	0.905052	T	0.02848	0.0085	N	0.05487	-0.04	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.46707	-0.9172	10	0.02654	T	1	.	7.029	0.24956	0.0:0.27:0.1246:0.6054	.	69	P01023	A2MG_HUMAN	E	69;84;69	ENSP00000323929:G69E;ENSP00000385710:G69E	ENSP00000323929:G69E	G	-	2	0	A2M	9157287	0.000000	0.05858	0.002000	0.10522	0.888000	0.51559	-0.865000	0.04250	-0.510000	0.06523	-0.142000	0.14014	GGA	.	.	none		0.527	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
MUC16	94025	hgsc.bcm.edu	37	19	9072256	9072256	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:9072256G>T	ENST00000397910.4	-	3	15393	c.15190C>A	c.(15190-15192)Ctc>Atc	p.L5064I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5066	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAGAGGAGAGCTTATCCTCT	0.478																																					p.L5064I		Atlas-SNP	.											.	MUC16	4315	.	0			c.C15190A						PASS	.						122.0	112.0	115.0					19																	9072256		1940	4136	6076	SO:0001583	missense	94025	exon3			AGGAGAGCTTATC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.15190C>A	19.37:g.9072256G>T	ENSP00000381008:p.Leu5064Ile	90.0	0.0	0		67.0	11.0	0.164179	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	4.778	0.144639	0.09134	.	.	ENSG00000181143	ENST00000397910	T	0.21932	1.98	1.74	-0.916	0.10489	.	.	.	.	.	T	0.07369	0.0186	N	0.08118	0	.	.	.	P	0.46020	0.871	B	0.31751	0.135	T	0.24404	-1.0161	8	0.87932	D	0	.	5.907	0.19006	0.0:0.0:0.4445:0.5555	.	5064	B5ME49	.	I	5064	ENSP00000381008:L5064I	ENSP00000381008:L5064I	L	-	1	0	MUC16	8933256	0.000000	0.05858	0.000000	0.03702	0.150000	0.21749	-2.735000	0.00802	-0.101000	0.12219	0.282000	0.19409	CTC	.	.	none		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ABCC10	89845	hgsc.bcm.edu	37	6	43399895	43399895	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:43399895C>T	ENST00000372530.4	+	3	392	c.177C>T	c.(175-177)atC>atT	p.I59I	ABCC10_ENST00000244533.3_Silent_p.I16I|ABCC10_ENST00000443426.2_Intron	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	59					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	CAGATTACATCCTACCCTGCA	0.567																																					p.I59I		Atlas-SNP	.											.	ABCC10	118	.	0			c.C177T						PASS	.						119.0	105.0	110.0					6																	43399895		2203	4300	6503	SO:0001819	synonymous_variant	89845	exon3			TTACATCCTACCC	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.177C>T	6.37:g.43399895C>T		48.0	0.0	0		46.0	6.0	0.130435	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	37	CCDS56430.1																																																																																			.	.	none		0.567	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
HNRNPD	3184	hgsc.bcm.edu	37	4	83294756	83294756	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr4:83294756G>A	ENST00000313899.7	-	1	353	c.76C>T	c.(76-78)Cag>Tag	p.Q26*	HNRNPD_ENST00000541060.1_5'UTR|RP11-127B20.3_ENST00000609552.1_RNA|HNRNPD_ENST00000353341.4_Nonsense_Mutation_p.Q26*|HNRNPD_ENST00000543098.1_Intron|HNRNPD_ENST00000352301.4_Nonsense_Mutation_p.Q26*|RP11-127B20.3_ENST00000609575.1_RNA	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	26	Ala-rich.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						gctccctcctgctcgcccgcc	0.771																																					p.Q26X		Atlas-SNP	.											.	HNRNPD	23	.	0			c.C76T						PASS	.						2.0	2.0	2.0					4																	83294756		1399	2648	4047	SO:0001587	stop_gained	3184	exon1			CCTCCTGCTCGCC	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.76C>T	4.37:g.83294756G>A	ENSP00000313199:p.Gln26*	18.0	0.0	0		23.0	6.0	0.26087	NM_031370	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Nonsense_Mutation	SNP	ENST00000313899.7	37	CCDS3592.1	.	.	.	.	.	.	.	.	.	.	G	40	8.250992	0.98727	.	.	ENSG00000138668	ENST00000313899;ENST00000353341;ENST00000352301;ENST00000307213;ENST00000507010;ENST00000503822	.	.	.	3.59	3.59	0.41128	.	0.717750	0.12547	N	0.459378	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	12.5691	0.56326	0.0:0.0:1.0:0.0	.	.	.	.	X	26;26;26;23;26;26	.	ENSP00000307544:Q23X	Q	-	1	0	HNRNPD	83513780	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.805000	0.55575	2.009000	0.58944	0.430000	0.28490	CAG	.	.	none		0.771	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
HEMK1	51409	hgsc.bcm.edu	37	3	50609175	50609175	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:50609175C>T	ENST00000232854.4	+	3	815	c.263C>T	c.(262-264)cCc>cTc	p.P88L	HEMK1_ENST00000434410.1_Missense_Mutation_p.P88L|C3orf18_ENST00000449241.1_5'Flank|HEMK1_ENST00000455834.1_Missense_Mutation_p.P88L	NM_016173.3	NP_057257.1	Q9Y5R4	HEMK1_HUMAN	HemK methyltransferase family member 1	88					DNA methylation (GO:0006306)	mitochondrion (GO:0005739)	DNA binding (GO:0003677)|N-methyltransferase activity (GO:0008170)|protein methyltransferase activity (GO:0008276)			lung(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)		TGGACCCAGCCCTTGACCTCT	0.572											OREG0015589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P88L		Atlas-SNP	.											.	HEMK1	17	.	0			c.C263T						PASS	.						126.0	132.0	130.0					3																	50609175		2203	4300	6503	SO:0001583	missense	51409	exon3			CCCAGCCCTTGAC	AF172244	CCDS2830.1	3p21	2008-02-05			ENSG00000114735	ENSG00000114735			24923	protein-coding gene	gene with protein product						10690633	Standard	XM_005265218		Approved	MTQ1	uc003dav.3	Q9Y5R4	OTTHUMG00000156849	ENST00000232854.4:c.263C>T	3.37:g.50609175C>T	ENSP00000232854:p.Pro88Leu	98.0	0.0	0	971	74.0	21.0	0.283784	NM_016173		Missense_Mutation	SNP	ENST00000232854.4	37	CCDS2830.1	.	.	.	.	.	.	.	.	.	.	c	11.65	1.703370	0.30232	.	.	ENSG00000114735	ENST00000434410;ENST00000232854;ENST00000455834	T;T;T	0.14893	2.47;2.47;2.47	5.53	4.65	0.58169	.	0.139018	0.49916	D	0.000131	T	0.17066	0.0410	L	0.52266	1.64	0.40106	D	0.976427	B	0.18166	0.026	B	0.19391	0.025	T	0.03555	-1.1025	10	0.41790	T	0.15	-7.7147	10.4992	0.44796	0.0:0.9105:0.0:0.0895	.	88	Q9Y5R4	HEMK1_HUMAN	L	88	ENSP00000404843:P88L;ENSP00000232854:P88L;ENSP00000404334:P88L	ENSP00000232854:P88L	P	+	2	0	HEMK1	50584179	0.736000	0.28164	0.993000	0.49108	0.191000	0.23601	0.979000	0.29500	1.485000	0.48380	0.651000	0.88453	CCC	.	.	none		0.572	HEMK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346231.1	NM_016173	
ACADM	34	hgsc.bcm.edu	37	1	76228440	76228440	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:76228440A>G	ENST00000370841.4	+	12	1695	c.1258A>G	c.(1258-1260)Aaa>Gaa	p.K420E	ACADM_ENST00000370834.5_Missense_Mutation_p.K453E|ACADM_ENST00000420607.2_Missense_Mutation_p.K424E|ACADM_ENST00000481374.1_Intron|ACADM_ENST00000543667.1_Missense_Mutation_p.K231E|ACADM_ENST00000541113.1_Missense_Mutation_p.K384E	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	420					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	TGACAAGTACAAAAATTAAAA	0.303																																					p.K424E		Atlas-SNP	.											.	ACADM	50	.	0			c.A1270G						PASS	.						22.0	25.0	24.0					1																	76228440		2173	4259	6432	SO:0001583	missense	34	exon12			AAGTACAAAAATT	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.1258A>G	1.37:g.76228440A>G	ENSP00000359878:p.Lys420Glu	406.0	0.0	0		367.0	71.0	0.19346	NM_001127328	Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	37	CCDS668.1	.	.	.	.	.	.	.	.	.	.	A	13.76	2.333626	0.41297	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000543667;ENST00000420607	D;D;D;D;D	0.97731	-4.51;-4.44;-4.49;-4.09;-4.51	5.87	5.87	0.94306	Acyl-CoA dehydrogenase/oxidase C-terminal (2);	0.137380	0.64402	D	0.000005	D	0.92519	0.7624	N	0.22421	0.69	0.54753	D	0.999987	B;B;B;B	0.20671	0.0;0.047;0.013;0.004	B;B;B;B	0.18561	0.001;0.022;0.008;0.003	D	0.90629	0.4565	10	0.87932	D	0	.	15.0981	0.72250	1.0:0.0:0.0:0.0	.	384;453;424;420	B7Z9I1;Q5T4U5;P11310-2;P11310	.;.;.;ACADM_HUMAN	E	420;453;384;231;424	ENSP00000359878:K420E;ENSP00000359871:K453E;ENSP00000442324:K384E;ENSP00000446176:K231E;ENSP00000409612:K424E	ENSP00000359871:K453E	K	+	1	0	ACADM	76001028	1.000000	0.71417	0.975000	0.42487	0.145000	0.21501	4.283000	0.58977	2.239000	0.73571	0.528000	0.53228	AAA	.	.	none		0.303	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1		
GPR34	2857	hgsc.bcm.edu	37	X	41555136	41555136	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chrX:41555136C>T	ENST00000378142.4	+	3	534	c.250C>T	c.(250-252)Cgt>Tgt	p.R84C	GPR34_ENST00000378138.5_Missense_Mutation_p.R84C|CASK_ENST00000378154.1_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378163.1_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000361962.4_Intron	NM_001097579.1|NM_005300.3	NP_001091048.1|NP_005291.1	Q9UPC5	GPR34_HUMAN	G protein-coupled receptor 34	84					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	14						GGGTATTCACCGTAAAAGAAA	0.383																																					p.R84C		Atlas-SNP	.											.	GPR34	42	.	0			c.C250T						PASS	.						112.0	101.0	105.0					X																	41555136		2203	4300	6503	SO:0001583	missense	2857	exon3			ATTCACCGTAAAA	AF039686	CCDS14258.1	Xp11.4	2012-08-21			ENSG00000171659	ENSG00000171659		"""GPCR / Class A : Orphans"""	4490	protein-coding gene	gene with protein product		300241				10395919, 10036181	Standard	NM_005300		Approved		uc004dfq.4	Q9UPC5	OTTHUMG00000021375	ENST00000378142.4:c.250C>T	X.37:g.41555136C>T	ENSP00000367384:p.Arg84Cys	110.0	0.0	0		106.0	44.0	0.415094	NM_001097579	O95853	Missense_Mutation	SNP	ENST00000378142.4	37	CCDS14258.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.922125	0.33908	.	.	ENSG00000171659	ENST00000378142;ENST00000378138;ENST00000535368	T;T	0.73575	-0.76;-0.76	5.87	5.87	0.94306	GPCR, rhodopsin-like superfamily (1);	0.199385	0.46758	D	0.000278	T	0.69788	0.3150	M	0.77103	2.36	0.41855	D	0.990198	P	0.36162	0.54	B	0.27076	0.076	T	0.74609	-0.3608	10	0.87932	D	0	-12.6129	8.3959	0.32557	0.1551:0.7665:0.0:0.0785	.	84	Q9UPC5	GPR34_HUMAN	C	84;84;37	ENSP00000367384:R84C;ENSP00000367378:R84C	ENSP00000367378:R84C	R	+	1	0	GPR34	41440080	0.961000	0.32948	1.000000	0.80357	0.995000	0.86356	1.419000	0.34793	2.466000	0.83321	0.594000	0.82650	CGT	.	.	none		0.383	GPR34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056264.1	NM_005300	
IRS1	3667	hgsc.bcm.edu	37	2	227663446	227663446	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:227663446G>A	ENST00000305123.5	-	1	1029	c.9C>T	c.(7-9)agC>agT	p.S3S	RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	3	Mediates interaction with PHIP. {ECO:0000250}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TCTCCGGAGGGCTCGCCATGC	0.677																																					p.S3S		Atlas-SNP	.											.	IRS1	141	.	0			c.C9T						PASS	.						12.0	13.0	13.0					2																	227663446		2195	4291	6486	SO:0001819	synonymous_variant	3667	exon1			CGGAGGGCTCGCC		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.9C>T	2.37:g.227663446G>A		73.0	0.0	0		74.0	14.0	0.189189	NM_005544		Silent	SNP	ENST00000305123.5	37	CCDS2463.1																																																																																			.	.	none		0.677	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
EFHC1	114327	hgsc.bcm.edu	37	6	52344443	52344443	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:52344443G>T	ENST00000371068.5	+	9	1601	c.1498G>T	c.(1498-1500)Ggt>Tgt	p.G500C	EFHC1_ENST00000538167.1_Missense_Mutation_p.G481C|EFHC1_ENST00000433625.2_Missense_Mutation_p.G409C	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	500	DM10 3. {ECO:0000255|PROSITE- ProRule:PRU00665}.					axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					TCCAGTGTTTGGTCACCGGTT	0.433																																					p.G500C		Atlas-SNP	.											.	EFHC1	68	.	0			c.G1498T						PASS	.						184.0	187.0	186.0					6																	52344443		2203	4300	6503	SO:0001583	missense	114327	exon9			GTGTTTGGTCACC	AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1498G>T	6.37:g.52344443G>T	ENSP00000360107:p.Gly500Cys	96.0	0.0	0		98.0	17.0	0.173469	NM_018100	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	ENST00000371068.5	37	CCDS4942.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354583	0.61293	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.70869	-0.27;-0.52;-0.48	5.62	4.76	0.60689	Uncharacterised domain DM10 (2);	0.049564	0.85682	D	0.000000	T	0.80819	0.4696	M	0.89163	3.01	0.48341	D	0.999637	D;B;P	0.89917	1.0;0.37;0.873	D;B;P	0.74023	0.982;0.311;0.583	D	0.84095	0.0392	10	0.66056	D	0.02	-6.5516	9.8614	0.41116	0.1553:0.0:0.8447:0.0	.	481;409;500	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	C	500;409;481	ENSP00000360107:G500C;ENSP00000416492:G409C;ENSP00000444521:G481C	ENSP00000360107:G500C	G	+	1	0	EFHC1	52452402	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	3.224000	0.51238	1.382000	0.46385	0.555000	0.69702	GGT	.	.	none		0.433	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040905.2	NM_018100	
MCM4	4173	hgsc.bcm.edu	37	8	48889332	48889332	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr8:48889332G>A	ENST00000262105.2	+	16	2795	c.2586G>A	c.(2584-2586)ttG>ttA	p.L862L	MCM4_ENST00000523944.1_Silent_p.L862L|RNU6-519P_ENST00000410590.1_RNA	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	862					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CCGTGCGCTTGCTCTGAAGCC	0.527																																					p.L862L		Atlas-SNP	.											.	MCM4	97	.	0			c.G2586A						PASS	.						128.0	115.0	120.0					8																	48889332		2203	4300	6503	SO:0001819	synonymous_variant	4173	exon17			GCGCTTGCTCTGA		CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.2586G>A	8.37:g.48889332G>A		48.0	0.0	0		51.0	10.0	0.196078	NM_182746	Q8NEH1|Q99658	Silent	SNP	ENST00000262105.2	37	CCDS6143.1																																																																																			.	.	none		0.527	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377791.1	NM_005914	
DUSP2	1844	hgsc.bcm.edu	37	2	96810559	96810559	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:96810559G>C	ENST00000288943.4	-	2	536	c.451C>G	c.(451-453)Ctg>Gtg	p.L151V	AC012307.2_ENST00000449242.1_lincRNA	NM_004418.3	NP_004409.1	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	151					endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(1)|lung(2)|skin(1)	5		Ovarian(717;0.0228)				GTTGGCGGCAGCGCAGGGGCG	0.662																																					p.L151V		Atlas-SNP	.											.	DUSP2	20	.	0			c.C451G						PASS	.						11.0	15.0	14.0					2																	96810559		2143	4243	6386	SO:0001583	missense	1844	exon2			GCGGCAGCGCAGG	L11329	CCDS2016.1	2q11	2011-06-09			ENSG00000158050	ENSG00000158050		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3068	protein-coding gene	gene with protein product		603068				7806236, 7590752, 12673251	Standard	NM_004418		Approved	PAC-1	uc002svk.4	Q05923	OTTHUMG00000130456	ENST00000288943.4:c.451C>G	2.37:g.96810559G>C	ENSP00000288943:p.Leu151Val	54.0	0.0	0		60.0	10.0	0.166667	NM_004418	Q53T45	Missense_Mutation	SNP	ENST00000288943.4	37	CCDS2016.1	.	.	.	.	.	.	.	.	.	.	g	9.396	1.076711	0.20227	.	.	ENSG00000158050	ENST00000288943	T	0.02763	4.17	4.3	-2.2	0.06994	.	0.606495	0.16301	N	0.220447	T	0.02380	0.0073	L	0.52126	1.63	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.43015	-0.9417	10	0.27785	T	0.31	.	2.2955	0.04149	0.1178:0.1236:0.3826:0.376	.	151	Q05923	DUS2_HUMAN	V	151	ENSP00000288943:L151V	ENSP00000288943:L151V	L	-	1	2	DUSP2	96174286	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.849000	0.27723	-0.252000	0.09528	-0.532000	0.04303	CTG	.	.	none		0.662	DUSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252847.1	NM_004418	
ARHGAP21	57584	hgsc.bcm.edu	37	10	24909112	24909112	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:24909112C>T	ENST00000396432.2	-	9	2198	c.1712G>A	c.(1711-1713)cGa>cAa	p.R571Q	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.R358Q	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	570					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						ACCACTCATTCGCCTGTTATC	0.393																																					p.R571Q		Atlas-SNP	.											.	ARHGAP21	185	.	0			c.G1712A						PASS	.						74.0	75.0	75.0					10																	24909112		2203	4300	6503	SO:0001583	missense	57584	exon9			CTCATTCGCCTGT	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1712G>A	10.37:g.24909112C>T	ENSP00000379709:p.Arg571Gln	93.0	0.0	0		87.0	20.0	0.229885	NM_020824	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000396432.2	37	CCDS7144.2	.	.	.	.	.	.	.	.	.	.	c	11.85	1.760900	0.31137	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.54675	2.52;2.63;0.56;0.58	5.5	4.6	0.57074	.	0.207171	0.40064	N	0.001187	T	0.62527	0.2435	M	0.70595	2.14	0.09310	N	0.999999	D;D	0.76494	0.981;0.999	B;P	0.57960	0.405;0.83	T	0.55354	-0.8154	10	0.23891	T	0.37	.	10.5329	0.44988	0.1326:0.7983:0.0:0.0691	.	561;570	F8W9U9;Q5T5U3	.;RHG21_HUMAN	Q	571;560;358;561;571;406	ENSP00000379709:R571Q;ENSP00000365604:R358Q;ENSP00000365592:R561Q;ENSP00000405018:R571Q	ENSP00000365604:R358Q	R	-	2	0	ARHGAP21	24949118	0.989000	0.36119	0.027000	0.17364	0.013000	0.08279	3.061000	0.49963	1.464000	0.47987	-0.127000	0.14921	CGA	.	.	none		0.393	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047229.4	NM_020824	
CA4	762	hgsc.bcm.edu	37	17	58227428	58227428	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:58227428C>T	ENST00000300900.4	+	1	132	c.33C>T	c.(31-33)tcC>tcT	p.S11S		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	11					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	TGGCCCTCTCCGCGGCGCGGC	0.761																																					p.S11S		Atlas-SNP	.											.	CA4	20	.	0			c.C33T						PASS	.						10.0	12.0	11.0					17																	58227428		2156	4197	6353	SO:0001819	synonymous_variant	762	exon1			CCTCTCCGCGGCG	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.33C>T	17.37:g.58227428C>T		46.0	0.0	0		53.0	5.0	0.0943396	NM_000717	B4DQA4|Q6FHI7	Silent	SNP	ENST00000300900.4	37	CCDS11624.1																																																																																			.	.	none		0.761	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717	
IL2RA	3559	hgsc.bcm.edu	37	10	6104051	6104051	+	Splice_Site	SNP	C	C	T	rs267602536		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr10:6104051C>T	ENST00000379959.3	-	1	237	c.64G>A	c.(64-66)Gag>Aag	p.E22K	IL2RA_ENST00000256876.6_Splice_Site_p.E22K|IL2RA_ENST00000379954.1_Splice_Site_p.E22K	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	22	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AGGCCCTTACCTGCCTGGCAG	0.612																																					p.E22K		Atlas-SNP	.											.	IL2RA	37	.	0			c.G64A						PASS	.						65.0	63.0	64.0					10																	6104051		2203	4300	6503	SO:0001630	splice_region_variant	3559	exon1			CCTTACCTGCCTG	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.64+1G>A	10.37:g.6104051C>T		113.0	0.0	0		93.0	16.0	0.172043	NM_000417	Q5W007	Missense_Mutation	SNP	ENST00000379959.3	37	CCDS7076.1	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805459	0.70682	.	.	ENSG00000134460	ENST00000379959;ENST00000397240;ENST00000379954;ENST00000256876	T;T;T	0.52526	1.26;0.66;1.32	5.24	5.24	0.73138	Complement control module (1);Sushi/SCR/CCP (1);	0.606025	0.15011	N	0.285558	T	0.52629	0.1746	L	0.58101	1.795	0.43462	D	0.995663	D;P	0.54047	0.964;0.956	P;P	0.48270	0.538;0.572	T	0.51052	-0.8754	9	.	.	.	-19.9974	14.3538	0.66722	0.0:1.0:0.0:0.0	.	22;22	Q5W005;P01589	.;IL2RA_HUMAN	K	22;8;22;22	ENSP00000369293:E22K;ENSP00000369287:E22K;ENSP00000256876:E22K	.	E	-	1	0	IL2RA	6144057	1.000000	0.71417	1.000000	0.80357	0.163000	0.22366	1.983000	0.40648	2.436000	0.82500	0.563000	0.77884	GAG	.	.	none		0.612	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417	Missense_Mutation
HTR1B	3351	hgsc.bcm.edu	37	6	78172576	78172576	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:78172576A>G	ENST00000369947.2	-	1	914	c.545T>C	c.(544-546)cTg>cCg	p.L182P		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	182					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GAAGGGCGGCAGCGAGATAGA	0.602																																					p.L182P		Atlas-SNP	.											.	HTR1B	55	.	0			c.T545C						PASS	.						71.0	76.0	75.0					6																	78172576		2203	4300	6503	SO:0001583	missense	3351	exon1			GGCGGCAGCGAGA	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.545T>C	6.37:g.78172576A>G	ENSP00000358963:p.Leu182Pro	92.0	0.0	0		95.0	14.0	0.147368	NM_000863	Q4VAY7	Missense_Mutation	SNP	ENST00000369947.2	37	CCDS4986.1	.	.	.	.	.	.	.	.	.	.	A	18.96	3.733478	0.69189	.	.	ENSG00000135312	ENST00000369947	T	0.75704	-0.96	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.137678	0.47455	D	0.000229	T	0.80618	0.4657	M	0.76328	2.33	0.80722	D	1	D	0.56521	0.976	D	0.63703	0.917	T	0.81895	-0.0723	9	.	.	.	.	14.1973	0.65679	1.0:0.0:0.0:0.0	.	182	P28222	5HT1B_HUMAN	P	182	ENSP00000358963:L182P	.	L	-	2	0	HTR1B	78229295	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.995000	0.93534	2.138000	0.66242	0.454000	0.30748	CTG	.	.	none		0.602	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
MYC	4609	hgsc.bcm.edu	37	8	128751032	128751032	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr8:128751032G>A	ENST00000259523.6	+	2	1729	c.524G>A	c.(523-525)aGc>aAc	p.S175N	MYC_ENST00000524013.1_Missense_Mutation_p.S189N|MYC_ENST00000377970.2_Missense_Mutation_p.S190N			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	175					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	TCCACCTCCAGCTTGTACCTG	0.667		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S190N		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,lymphoid_neoplasm,0,2	MYC	168	2	0			c.G569A						PASS	.						23.0	24.0	24.0					8																	128751032		2202	4299	6501	SO:0001583	missense	4609	exon2			CCTCCAGCTTGTA		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.524G>A	8.37:g.128751032G>A	ENSP00000259523:p.Ser175Asn	69.0	0.0	0	1567	52.0	10.0	0.192308	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	G	15.78	2.935198	0.52866	.	.	ENSG00000136997	ENST00000259523;ENST00000377970;ENST00000524013;ENST00000454617	T;T;T	0.18174	2.23;2.23;2.23	4.78	3.89	0.44902	Transcription regulator Myc, N-terminal (1);	0.540883	0.20177	N	0.097620	T	0.35008	0.0917	L	0.57536	1.79	0.32900	D	0.512998	D	0.58970	0.984	P	0.62491	0.903	T	0.50642	-0.8804	10	0.62326	D	0.03	-20.4131	14.2765	0.66184	0.0:0.1501:0.8499:0.0	.	175	P01106	MYC_HUMAN	N	175;190;189;156	ENSP00000259523:S175N;ENSP00000367207:S190N;ENSP00000430235:S189N	ENSP00000259523:S175N	S	+	2	0	MYC	128820214	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	5.074000	0.64401	1.102000	0.41551	0.561000	0.74099	AGC	.	.	none		0.667	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
ZNF367	195828	hgsc.bcm.edu	37	9	99180102	99180102	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr9:99180102C>T	ENST00000375256.4	-	1	509	c.213G>A	c.(211-213)tgG>tgA	p.W71*		NM_153695.3	NP_710162.1	Q7RTV3	ZN367_HUMAN	zinc finger protein 367	71					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(4)|large_intestine(3)|lung(3)|prostate(1)	12		Acute lymphoblastic leukemia(62;0.0167)				CGCCCCAGCGCCACGGGTACA	0.756																																					p.W71X		Atlas-SNP	.											.	ZNF367	27	.	0			c.G213A						PASS	.						6.0	7.0	7.0					9																	99180102		2098	4155	6253	SO:0001587	stop_gained	195828	exon1			CCAGCGCCACGGG	AK091289	CCDS6718.1	9q22	2008-05-02			ENSG00000165244	ENSG00000165244		"""Zinc fingers, C2H2-type"""	18320	protein-coding gene	gene with protein product		610160					Standard	NM_153695		Approved	FLJ33970	uc004awf.3	Q7RTV3	OTTHUMG00000020295	ENST00000375256.4:c.213G>A	9.37:g.99180102C>T	ENSP00000364405:p.Trp71*	59.0	0.0	0		46.0	6.0	0.130435	NM_153695	Q6Q7C8	Nonsense_Mutation	SNP	ENST00000375256.4	37	CCDS6718.1	.	.	.	.	.	.	.	.	.	.	C	40	8.166298	0.98686	.	.	ENSG00000165244	ENST00000375256	.	.	.	3.45	3.45	0.39498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4595	15.072	0.72046	0.0:1.0:0.0:0.0	.	.	.	.	X	71	.	ENSP00000364405:W71X	W	-	3	0	ZNF367	98219923	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.458000	0.73509	1.758000	0.51981	0.313000	0.20887	TGG	.	.	none		0.756	ZNF367-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053266.1		
CRIP1	1396	hgsc.bcm.edu	37	14	105954689	105954689	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr14:105954689A>C	ENST00000330233.7	+	3	1100	c.157A>C	c.(157-159)Aac>Cac	p.N53H	C14orf80_ENST00000329886.7_5'Flank|CRIP1_ENST00000409393.2_Missense_Mutation_p.N53H|C14orf80_ENST00000392522.3_5'Flank|C14orf80_ENST00000334656.7_5'Flank|C14orf80_ENST00000392527.1_5'Flank|CRIP1_ENST00000551180.1_Missense_Mutation_p.Q21P|C14orf80_ENST00000354560.6_5'Flank|C14orf80_ENST00000392523.4_5'Flank|CRIP1_ENST00000392531.3_Missense_Mutation_p.N53H			P50238	CRIP1_HUMAN	cysteine-rich protein 1 (intestinal)	53	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|cellular response to antibiotic (GO:0071236)|cellular response to UV-B (GO:0071493)|heart development (GO:0007507)|immune response (GO:0006955)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|prostate gland stromal morphogenesis (GO:0060741)|regulation of gene expression (GO:0010468)|response to organic substance (GO:0010033)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)	AT DNA binding (GO:0003680)|DNA binding, bending (GO:0008301)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)						Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.235)		ACCCTACTGCAACCACCCCTG	0.642																																					p.N53H		Atlas-SNP	.											.	CRIP1	1	.	0			c.A157C						PASS	.						46.0	62.0	57.0					14																	105954689		2202	4300	6502	SO:0001583	missense	1396	exon4			TACTGCAACCACC		CCDS10004.1	14q32.33	2004-06-18			ENSG00000213145	ENSG00000213145			2360	protein-coding gene	gene with protein product		123875				9480758	Standard	NM_001311		Approved	CRIP	uc001yri.4	P50238	OTTHUMG00000029908	ENST00000330233.7:c.157A>C	14.37:g.105954689A>C	ENSP00000332449:p.Asn53His	149.0	0.0	0		108.0	17.0	0.157407	NM_001311	H3BPI2|Q13628|Q53XY7|Q96J34	Missense_Mutation	SNP	ENST00000330233.7	37	CCDS10004.1	.	.	.	.	.	.	.	.	.	.	A	4.183	0.032586	0.08101	.	.	ENSG00000213145	ENST00000330233;ENST00000409393;ENST00000392531	D;D;D	0.87491	-2.26;-2.26;-2.26	4.76	4.76	0.60689	Zinc finger, LIM-type (4);	0.000000	0.53938	U	0.000044	T	0.73613	0.3609	.	.	.	0.51012	D	0.999902	B	0.06786	0.001	B	0.18263	0.021	T	0.65257	-0.6212	9	0.07482	T	0.82	-7.0094	9.4659	0.38813	0.8215:0.1785:0.0:0.0	.	53	P50238	CRIP1_HUMAN	H	53	ENSP00000332449:N53H;ENSP00000386340:N53H;ENSP00000376315:N53H	ENSP00000447493:N53H	N	+	1	0	CRIP1	105025734	1.000000	0.71417	1.000000	0.80357	0.504000	0.33889	1.736000	0.38187	1.775000	0.52247	0.528000	0.53228	AAC	.	.	none		0.642	CRIP1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335466.2	NM_001311	
GZMM	3004	hgsc.bcm.edu	37	19	549011	549011	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:549011C>T	ENST00000264553.3	+	4	476	c.438C>T	c.(436-438)agC>agT	p.S146S		NM_001258351.1|NM_005317.3	NP_001245280.1|NP_005308	P51124	GRAM_HUMAN	granzyme M (lymphocyte met-ase 1)	146	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|membrane (GO:0016020)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(1)|prostate(1)	3		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCGGTGCAGCATGGCCGGCT	0.687																																					p.S146S		Atlas-SNP	.											GZMM,bladder,carcinoma,+1,1	GZMM	11	1	0			c.C438T						PASS	.						13.0	15.0	14.0					19																	549011		2189	4274	6463	SO:0001819	synonymous_variant	3004	exon4			GTGCAGCATGGCC		CCDS12031.1, CCDS74240.1	19p13.3	2008-07-16				ENSG00000197540			4712	protein-coding gene	gene with protein product	"""lymphocyte met-ase 1"""	600311				8119738	Standard	NM_005317		Approved	MET1, LMET1	uc002low.2	P51124		ENST00000264553.3:c.438C>T	19.37:g.549011C>T		94.0	0.0	0		103.0	11.0	0.106796	NM_005317		Silent	SNP	ENST00000264553.3	37	CCDS12031.1																																																																																			.	.	none		0.687	GZMM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451895.2	NM_005317	
CYB5R4	51167	hgsc.bcm.edu	37	6	84569547	84569547	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:84569547C>G	ENST00000369681.5	+	1	186	c.46C>G	c.(46-48)Cag>Gag	p.Q16E	CYB5R4_ENST00000369679.4_5'UTR	NM_016230.3	NP_057314.2	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	16					cell development (GO:0048468)|detection of oxygen (GO:0003032)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|perinuclear region of cytoplasm (GO:0048471)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NAD(P)H oxidase activity (GO:0016174)|NADPH-hemoprotein reductase activity (GO:0003958)|oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor (GO:0016653)			breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	23		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		CAGGTCGCAGCAGCGTGTCGC	0.677											OREG0017553	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q16E	Esophageal Squamous(86;1289 1332 25971 40349 52675)	Atlas-SNP	.											.	CYB5R4	72	.	0			c.C46G						PASS	.						21.0	25.0	24.0					6																	84569547		2202	4300	6502	SO:0001583	missense	51167	exon1			TCGCAGCAGCGTG	AF169803	CCDS5000.2	6q14.2	2012-09-19		2005-07-13	ENSG00000065615	ENSG00000065615	1.6.2.2		20147	protein-coding gene	gene with protein product		608343	"""NADPH cytochrome B5 oxidoreductase"""	NCB5OR		10611283	Standard	NM_016230		Approved	b5+b5R, dJ676J13.1	uc003pkf.3	Q7L1T6	OTTHUMG00000015118	ENST00000369681.5:c.46C>G	6.37:g.84569547C>G	ENSP00000358695:p.Gln16Glu	84.0	0.0	0	1230	76.0	14.0	0.184211	NM_016230	B1AEM2|Q5TGI9|Q9NUE4|Q9UHI9	Missense_Mutation	SNP	ENST00000369681.5	37	CCDS5000.2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031288	0.75504	.	.	ENSG00000065615	ENST00000369681	T	0.44482	0.92	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.40222	0.1108	L	0.53249	1.67	0.80722	D	1	P	0.49185	0.92	P	0.48304	0.573	T	0.09509	-1.0671	10	0.40728	T	0.16	-26.7412	19.2909	0.94098	0.0:1.0:0.0:0.0	.	16	Q7L1T6	NB5R4_HUMAN	E	16	ENSP00000358695:Q16E	ENSP00000358695:Q16E	Q	+	1	0	CYB5R4	84626266	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	6.502000	0.73695	2.894000	0.99253	0.655000	0.94253	CAG	.	.	none		0.677	CYB5R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041362.4	NM_016230	
FANCG	2189	hgsc.bcm.edu	37	9	35077020	35077020	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr9:35077020C>T	ENST00000378643.3	-	6	1216	c.725G>A	c.(724-726)cGg>cAg	p.R242Q	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	242					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAACACAGGCCGTGGACACAG	0.552			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																													p.R242Q		Atlas-SNP	.	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	FANCG	56	.	0			c.G725A						PASS	.						88.0	92.0	91.0					9																	35077020		2203	4300	6503	SO:0001583	missense	2189	exon6			ACAGGCCGTGGAC	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.725G>A	9.37:g.35077020C>T	ENSP00000367910:p.Arg242Gln	85.0	0.0	0		80.0	19.0	0.2375	NM_004629		Missense_Mutation	SNP	ENST00000378643.3	37	CCDS6574.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.152449	0.38021	.	.	ENSG00000221829	ENST00000378643;ENST00000543657	T	0.37235	1.21	6.07	3.23	0.37069	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.18467	0.0443	L	0.27053	0.805	0.09310	N	0.999999	P	0.36438	0.553	B	0.20955	0.032	T	0.10800	-1.0614	9	0.26408	T	0.33	-8.4425	6.3483	0.21361	0.0:0.6801:0.1565:0.1633	.	242	O15287	FANCG_HUMAN	Q	242	ENSP00000367910:R242Q	ENSP00000367910:R242Q	R	-	2	0	FANCG	35067020	0.334000	0.24739	0.327000	0.25402	0.992000	0.81027	0.672000	0.25187	0.442000	0.26555	0.655000	0.94253	CGG	.	.	none		0.552	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
HIST1H3F	8968	hgsc.bcm.edu	37	6	26250506	26250506	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26250506G>A	ENST00000446824.2	-	1	329	c.328C>T	c.(328-330)Ctg>Ttg	p.L110L	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	110					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						ATAGCACACAGGTTGGTGTCC	0.602											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L110L		Atlas-SNP	.											.	HIST1H3F	16	.	0			c.C328T						PASS	.						102.0	99.0	100.0					6																	26250506		2203	4300	6503	SO:0001819	synonymous_variant	8968	exon1			CACACAGGTTGGT	Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.328C>T	6.37:g.26250506G>A		87.0	0.0	0	785	75.0	18.0	0.24	NM_021018	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000446824.2	37	CCDS4600.1																																																																																			.	.	none		0.602	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040098.1	NM_021018	
SIPA1	6494	hgsc.bcm.edu	37	11	65416900	65416900	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:65416900C>T	ENST00000394224.3	+	10	2770	c.2474C>T	c.(2473-2475)gCc>gTc	p.A825V	MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000527525.1_Missense_Mutation_p.A723V|SIPA1_ENST00000534313.1_Missense_Mutation_p.A825V|SIPA1_ENST00000394227.3_Missense_Mutation_p.A723V	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	825					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						GGGGATCTGGCCGAGGAGAGG	0.637																																					p.A825V		Atlas-SNP	.											.	SIPA1	45	.	0			c.C2474T						PASS	.						41.0	36.0	38.0					11																	65416900		2197	4292	6489	SO:0001583	missense	6494	exon10			ATCTGGCCGAGGA	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.2474C>T	11.37:g.65416900C>T	ENSP00000377771:p.Ala825Val	78.0	0.0	0		59.0	12.0	0.20339	NM_006747	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	C	15.08	2.728042	0.48833	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.82344	-1.6;-1.59;-1.6;-1.59	4.77	3.86	0.44501	.	1.724340	0.04463	N	0.374696	T	0.75583	0.3869	L	0.27053	0.805	0.09310	N	0.999998	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.59375	-0.7466	10	0.33940	T	0.23	-1.6822	9.3108	0.37903	0.0:0.899:0.0:0.101	.	723;825	F6RY50;Q96FS4	.;SIPA1_HUMAN	V	825;723;825;723	ENSP00000436269:A825V;ENSP00000433686:A723V;ENSP00000377771:A825V;ENSP00000377774:A723V	ENSP00000377771:A825V	A	+	2	0	SIPA1	65173476	0.672000	0.27530	0.445000	0.26908	0.419000	0.31324	1.953000	0.40352	1.152000	0.42452	0.462000	0.41574	GCC	.	.	none		0.637	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747	
AKAP8	10270	hgsc.bcm.edu	37	19	15484046	15484046	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:15484046C>T	ENST00000269701.2	-	5	537	c.477G>A	c.(475-477)ggG>ggA	p.G159G		NM_005858.3	NP_005849.1	O43823	AKAP8_HUMAN	A kinase (PRKA) anchor protein 8	159					mitotic chromosome condensation (GO:0007076)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	condensed chromosome (GO:0000793)|female pronucleus (GO:0001939)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)	26						TGCGGTCGGACCCCAGGTCGA	0.662																																					p.G159G	GBM(190;1671 2163 3274 27186 30476)	Atlas-SNP	.											.	AKAP8	68	.	0			c.G477A						PASS	.						31.0	36.0	34.0					19																	15484046		2203	4300	6503	SO:0001819	synonymous_variant	10270	exon5			GTCGGACCCCAGG	Y11997	CCDS12329.1	19p13.12	2012-05-16			ENSG00000105127	ENSG00000105127		"""A-kinase anchor proteins"""	378	protein-coding gene	gene with protein product	"""A-kinase anchor protein, 95kDa"""	604692				9473338	Standard	NM_005858		Approved	AKAP95, DKFZp586B1222	uc002nav.3	O43823		ENST00000269701.2:c.477G>A	19.37:g.15484046C>T		105.0	0.0	0		97.0	17.0	0.175258	NM_005858		Silent	SNP	ENST00000269701.2	37	CCDS12329.1																																																																																			.	.	none		0.662	AKAP8-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461293.3	NM_005858	
TAF5L	27097	hgsc.bcm.edu	37	1	229730826	229730826	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:229730826T>G	ENST00000366676.1	-	4	987	c.988A>C	c.(988-990)Aat>Cat	p.N330H	TAF5L_ENST00000258281.2_Missense_Mutation_p.N330H			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	330					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				GTGCCTGCATTATCATCCTCA	0.512																																					p.N330H		Atlas-SNP	.											.	TAF5L	76	.	0			c.A988C						PASS	.						73.0	69.0	70.0					1																	229730826		2202	4300	6502	SO:0001583	missense	27097	exon5			CTGCATTATCATC	AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.988A>C	1.37:g.229730826T>G	ENSP00000355636:p.Asn330His	30.0	0.0	0		37.0	18.0	0.486486	NM_014409	Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	ENST00000366676.1	37	CCDS1581.1	.	.	.	.	.	.	.	.	.	.	T	11.66	1.704776	0.30232	.	.	ENSG00000135801	ENST00000366676;ENST00000258281	T;T	0.59638	0.25;0.25	5.8	-0.833	0.10782	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	1.250220	0.04766	N	0.427222	T	0.47783	0.1464	L	0.40543	1.245	0.09310	N	1	B	0.20164	0.042	B	0.19946	0.027	T	0.39057	-0.9632	10	0.48119	T	0.1	-0.299	6.7515	0.23489	0.0:0.3607:0.1239:0.5154	.	330	O75529	TAF5L_HUMAN	H	330	ENSP00000355636:N330H;ENSP00000258281:N330H	ENSP00000258281:N330H	N	-	1	0	TAF5L	227797449	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.085000	0.14912	-0.150000	0.11195	-0.256000	0.11100	AAT	.	.	none		0.512	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095229.1	NM_014409	
TAF1B	9014	hgsc.bcm.edu	37	2	10008516	10008516	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:10008516C>G	ENST00000263663.5	+	6	699	c.511C>G	c.(511-513)Cac>Gac	p.H171D	TAF1B_ENST00000402170.1_3'UTR|TAF1B_ENST00000396242.3_5'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	171	N-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTCTGACATCCACACTCGAAA	0.428																																					p.H171D		Atlas-SNP	.											.	TAF1B	62	.	0			c.C511G						PASS	.						93.0	81.0	85.0					2																	10008516		2203	4300	6503	SO:0001583	missense	9014	exon6			GACATCCACACTC	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.511C>G	2.37:g.10008516C>G	ENSP00000263663:p.His171Asp	259.0	0.0	0		269.0	50.0	0.185874	NM_005680	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	ENST00000263663.5	37	CCDS33143.1	.	.	.	.	.	.	.	.	.	.	C	4.630	0.117174	0.08881	.	.	ENSG00000115750	ENST00000263663;ENST00000402170	T	0.02552	4.25	5.41	1.22	0.21188	.	2.518540	0.00906	N	0.002413	T	0.02571	0.0078	N	0.19112	0.55	0.19575	N	0.999964	B;B;B	0.14805	0.002;0.006;0.011	B;B;B	0.18871	0.007;0.007;0.023	T	0.44221	-0.9342	9	.	.	.	0.1658	4.2181	0.10544	0.4494:0.3528:0.0:0.1978	.	171;171;171	B5MD29;Q53T94;Q53T94-2	.;TAF1B_HUMAN;.	D	171	ENSP00000263663:H171D	.	H	+	1	0	TAF1B	9925967	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.563000	0.23547	0.067000	0.16545	-0.150000	0.13652	CAC	.	.	none		0.428	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
HIST1H4F	8361	hgsc.bcm.edu	37	6	26240823	26240823	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26240823G>A	ENST00000377745.2	+	1	263	c.170G>A	c.(169-171)gGt>gAt	p.G57D		NM_003540.3	NP_003531.1	P62805	H4_HUMAN	histone cluster 1, H4f	57					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.G57D(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GAGACCCGCGGTGTTCTTAAG	0.577																																					p.G57D		Atlas-SNP	.											HIST1H4F,colon,carcinoma,0,1	HIST1H4F	9	1	1	Substitution - Missense(1)	large_intestine(1)	c.G170A						PASS	.						76.0	67.0	70.0					6																	26240823		2203	4300	6503	SO:0001583	missense	8361	exon1			CCCGCGGTGTTCT	M60749	CCDS4598.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198327			"""Histones / Replication-dependent"""	4783	protein-coding gene	gene with protein product		602824	"""H4 histone family, member C"", ""histone 1, H4f"""	H4FC		1916825, 9119399, 12408966	Standard	NM_003540		Approved	H4/c, H4	uc003nhe.1	P62805	OTTHUMG00000014443	ENST00000377745.2:c.170G>A	6.37:g.26240823G>A	ENSP00000366974:p.Gly57Asp	128.0	0.0	0		103.0	15.0	0.145631	NM_003540	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377745.2	37	CCDS4598.1	.	.	.	.	.	.	.	.	.	.	.	14.99	2.700370	0.48307	.	.	ENSG00000198327	ENST00000377745	T	0.67523	-0.27	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.74374	0.3708	.	.	.	0.51233	D	0.999914	.	.	.	.	.	.	T	0.78013	-0.2370	7	0.66056	D	0.02	.	16.4132	0.83726	0.0:0.0:1.0:0.0	.	.	.	.	D	57	ENSP00000366974:G57D	ENSP00000366974:G57D	G	+	2	0	HIST1H4F	26348802	1.000000	0.71417	0.993000	0.49108	0.003000	0.03518	9.222000	0.95196	2.430000	0.82344	0.563000	0.77884	GGT	.	.	none		0.577	HIST1H4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040106.1	NM_003540	
ZC2HC1A	51101	hgsc.bcm.edu	37	8	79629693	79629693	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr8:79629693T>C	ENST00000263849.4	+	9	1045	c.943T>C	c.(943-945)Tgc>Cgc	p.C315R	IL7_ENST00000519833.1_5'Flank	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	315							metal ion binding (GO:0046872)										GGCCAAATTTTGCTGTGAATG	0.368																																					p.C315R		Atlas-SNP	.											.	.	.	.	0			c.T943C						PASS	.						145.0	145.0	145.0					8																	79629693		2203	4300	6503	SO:0001583	missense	51101	exon9			AAATTTTGCTGTG		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.943T>C	8.37:g.79629693T>C	ENSP00000263849:p.Cys315Arg	80.0	0.0	0		80.0	17.0	0.2125	NM_016010	Q9Y372	Missense_Mutation	SNP	ENST00000263849.4	37	CCDS6223.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.88|18.88	3.717860|3.717860	0.68844|0.68844	.|.	.|.	ENSG00000104427|ENSG00000104427	ENST00000263849|ENST00000519307	D|.	0.82984|.	-1.67|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.085531|.	0.85682|.	D|.	0.000000|.	T|T	0.78610|0.78610	0.4310|0.4310	M|M	0.84511|0.84511	2.7|2.7	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.81437|0.81437	-0.0933|-0.0933	9|5	.|.	.|.	.|.	-8.3283|-8.3283	15.2358|15.2358	0.73430|0.73430	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	315|.	Q96GY0|.	F164A_HUMAN|.	R|S	315|186	ENSP00000263849:C315R|.	.|.	C|L	+|+	1|2	0|0	FAM164A|FAM164A	79792248|79792248	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.975000|0.975000	0.68041|0.68041	6.025000|6.025000	0.70864|0.70864	2.060000|2.060000	0.61445|0.61445	0.482000|0.482000	0.46254|0.46254	TGC|TTG	.	.	none		0.368	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379423.2	NM_016010	
NEB	4703	hgsc.bcm.edu	37	2	152486080	152486080	+	Silent	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr2:152486080G>T	ENST00000172853.10	-	64	9222	c.9075C>A	c.(9073-9075)gcC>gcA	p.A3025A	NEB_ENST00000604864.1_Silent_p.A3268A|NEB_ENST00000409198.1_Silent_p.A3025A|NEB_ENST00000397345.3_Silent_p.A3268A|NEB_ENST00000603639.1_Silent_p.A3268A|NEB_ENST00000427231.2_Silent_p.A3268A			P20929	NEBU_HUMAN	nebulin	3025					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGAGGCCTTGGCAGCCACGA	0.438																																					p.A3268A		Atlas-SNP	.											.	NEB	1697	.	0			c.C9804A						PASS	.						154.0	153.0	153.0					2																	152486080		1944	4138	6082	SO:0001819	synonymous_variant	4703	exon68			GGCCTTGGCAGCC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9075C>A	2.37:g.152486080G>T		62.0	0.0	0		66.0	13.0	0.19697	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.	.	none		0.438	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SNX1	6642	hgsc.bcm.edu	37	15	64410372	64410372	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr15:64410372G>A	ENST00000559844.1	+	3	342	c.328G>A	c.(328-330)Gcc>Acc	p.A110T	SNX1_ENST00000560829.1_5'UTR|SNX1_ENST00000353874.4_Missense_Mutation_p.A110T|SNX1_ENST00000261889.5_Missense_Mutation_p.A110T|SNX1_ENST00000561026.1_Intron			Q13596	SNX1_HUMAN	sorting nexin 1	110					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GAAGGTGCTAGCCAAAACACT	0.438																																					p.A110T		Atlas-SNP	.											.	SNX1	36	.	0			c.G328A						PASS	.						111.0	100.0	104.0					15																	64410372		2203	4300	6503	SO:0001583	missense	6642	exon3			GTGCTAGCCAAAA	BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.328G>A	15.37:g.64410372G>A	ENSP00000453785:p.Ala110Thr	202.0	0.0	0		140.0	35.0	0.25	NM_003099	A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Missense_Mutation	SNP	ENST00000559844.1	37	CCDS32266.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.429880	0.25726	.	.	ENSG00000028528	ENST00000380285;ENST00000353874	T	0.46063	0.88	5.66	4.75	0.60458	.	0.625902	0.17890	N	0.158550	T	0.32133	0.0819	N	0.19112	0.55	0.28175	N	0.928424	B;B;B;B	0.23990	0.095;0.011;0.012;0.011	B;B;B;B	0.34991	0.158;0.063;0.193;0.034	T	0.28299	-1.0048	10	0.20519	T	0.43	-11.319	12.4081	0.55451	0.0774:0.0:0.9226:0.0	.	110;110;110;110	Q6ZRJ8;Q53GY8;A6NKH4;Q13596	.;.;.;SNX1_HUMAN	T	110	ENSP00000326668:A110T	ENSP00000326668:A110T	A	+	1	0	SNX1	62197425	1.000000	0.71417	0.654000	0.29608	0.054000	0.15201	3.917000	0.56424	1.542000	0.49330	0.655000	0.94253	GCC	.	.	none		0.438	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418559.1	NM_003099	
ZMYM2	7750	hgsc.bcm.edu	37	13	20641392	20641392	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr13:20641392G>A	ENST00000382874.2	+	22	3505	c.3315G>A	c.(3313-3315)aaG>aaA	p.K1105K	ZMYM2_ENST00000382871.2_Silent_p.K1105K|ZMYM2_ENST00000382869.3_Silent_p.K1105K|ZMYM2_ENST00000494061.2_3'UTR	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	1105					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		AATCAGTAAAGTTAAAAGAGG	0.328																																					p.K1105K		Atlas-SNP	.											.	ZMYM2	191	.	0			c.G3315A						PASS	.						43.0	38.0	39.0					13																	20641392		1816	4065	5881	SO:0001819	synonymous_variant	7750	exon22			AGTAAAGTTAAAA	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.3315G>A	13.37:g.20641392G>A		78.0	0.0	0		80.0	19.0	0.2375	NM_001190964	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Silent	SNP	ENST00000382874.2	37	CCDS45016.1																																																																																			.	.	none		0.328	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
RXFP2	122042	hgsc.bcm.edu	37	13	32376518	32376518	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr13:32376518C>G	ENST00000298386.2	+	18	2312	c.2241C>G	c.(2239-2241)gaC>gaG	p.D747E	RXFP2_ENST00000380314.1_Missense_Mutation_p.D723E	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	747					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		CACTTGGAGACAGTATAATGA	0.368																																					p.D747E		Atlas-SNP	.											.	RXFP2	95	.	0			c.C2241G						PASS	.						170.0	186.0	181.0					13																	32376518		2203	4300	6503	SO:0001583	missense	122042	exon18			TGGAGACAGTATA	AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.2241C>G	13.37:g.32376518C>G	ENSP00000298386:p.Asp747Glu	107.0	0.0	0		95.0	22.0	0.231579	NM_130806	B1ALE9|Q3KU23	Missense_Mutation	SNP	ENST00000298386.2	37	CCDS9342.1	.	.	.	.	.	.	.	.	.	.	C	12.46	1.945129	0.34283	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.71698	-0.59;-0.53	5.78	2.1	0.27182	.	0.061064	0.64402	D	0.000009	T	0.56514	0.1990	L	0.40543	1.245	0.27142	N	0.96162	B;B	0.10296	0.003;0.003	B;B	0.12156	0.007;0.007	T	0.43956	-0.9359	10	0.30078	T	0.28	.	7.8028	0.29185	0.0:0.4382:0.4154:0.1463	.	723;747	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	E	723;747	ENSP00000369670:D723E;ENSP00000298386:D747E	ENSP00000298386:D747E	D	+	3	2	RXFP2	31274518	0.006000	0.16342	0.996000	0.52242	0.918000	0.54935	-0.743000	0.04845	0.358000	0.24211	0.655000	0.94253	GAC	.	.	none		0.368	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044399.1	NM_130806	
EIF4A2	1974	hgsc.bcm.edu	37	3	186502430	186502430	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:186502430C>T	ENST00000323963.5	+	3	217	c.153C>T	c.(151-153)taC>taT	p.Y51Y	SNORA4_ENST00000584302.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000356531.5_Missense_Mutation_p.T3M|RP11-573D15.9_ENST00000577781.1_RNA|EIF4A2_ENST00000440191.2_Silent_p.Y52Y|SNORA63_ENST00000363548.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORA63_ENST00000363450.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	51					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		TCTATGCTTACGGTTTTGAGA	0.358			T	BCL6	NHL																																p.Y51Y		Atlas-SNP	.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	55	.	0			c.C153T						PASS	.						124.0	130.0	128.0					3																	186502430		2203	4300	6503	SO:0001819	synonymous_variant	1974	exon3			TGCTTACGGTTTT	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.153C>T	3.37:g.186502430C>T		110.0	0.0	0		95.0	20.0	0.210526	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Silent	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	C	13.35	2.211860	0.39102	.	.	ENSG00000156976	ENST00000356531	T	0.34275	1.37	4.6	-3.99	0.04069	.	.	.	.	.	T	0.23532	0.0569	.	.	.	0.24291	N	0.99516	B	0.06786	0.001	B	0.01281	0.0	T	0.34527	-0.9825	8	0.87932	D	0	-2.7687	7.1768	0.25749	0.0:0.4534:0.1318:0.4148	.	3	Q9NZE6	.	M	3	ENSP00000348925:T3M	ENSP00000348925:T3M	T	+	2	0	EIF4A2	187985124	0.974000	0.33945	0.990000	0.47175	0.994000	0.84299	0.071000	0.14594	-0.466000	0.06943	-0.237000	0.12165	ACG	.	.	none		0.358	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
IRF4	3662	hgsc.bcm.edu	37	6	393209	393209	+	Silent	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:393209C>T	ENST00000380956.4	+	2	183	c.57C>T	c.(55-57)tgC>tgT	p.C19C	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	19					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		CGGTGAGCTGCGGCAACGGGA	0.711			T	IGH@	MM																																p.C19C		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C57T						PASS	.						29.0	32.0	31.0					6																	393209		2181	4272	6453	SO:0001819	synonymous_variant	3662	exon2			GAGCTGCGGCAAC	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.57C>T	6.37:g.393209C>T		135.0	0.0	0		180.0	73.0	0.405556	NM_001195286	Q5VUI7|Q99660	Silent	SNP	ENST00000380956.4	37	CCDS4469.1																																																																																			.	.	none		0.711	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
HIST2H2BE	8349	hgsc.bcm.edu	37	1	149858111	149858111	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr1:149858111C>G	ENST00000369155.2	-	1	121	c.80G>C	c.(79-81)gGc>gCc	p.G27A	BOLA1_ENST00000369153.2_5'Flank|HIST2H2AC_ENST00000331380.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	27					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			GCGCTTCTTGCCGTCTTTCTT	0.567																																					p.G27A		Atlas-SNP	.											HIST2H2BE,NS,carcinoma,0,2	HIST2H2BE	33	2	0			c.G80C						PASS	.						136.0	131.0	133.0					1																	149858111		2203	4300	6503	SO:0001583	missense	8349	exon1			TTCTTGCCGTCTT	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.80G>C	1.37:g.149858111C>G	ENSP00000358151:p.Gly27Ala	97.0	0.0	0		88.0	16.0	0.181818	NM_003528	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	37	CCDS936.1	.	.	.	.	.	.	.	.	.	.	C	17.03	3.285780	0.59867	.	.	ENSG00000184678	ENST00000369155	T	0.23348	1.91	5.99	5.99	0.97316	Histone-fold (2);	0.137618	0.47093	D	0.000241	T	0.18593	0.0446	M	0.74881	2.28	0.35748	D	0.819229	B	0.26602	0.154	B	0.10450	0.005	T	0.05517	-1.0880	10	0.66056	D	0.02	.	13.3551	0.60623	0.0:0.9245:0.0:0.0755	.	27	Q16778	H2B2E_HUMAN	A	27	ENSP00000358151:G27A	ENSP00000358151:G27A	G	-	2	0	HIST2H2BE	148124735	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.440000	0.44855	2.857000	0.98124	0.650000	0.86243	GGC	.	.	none		0.567	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528	
TMEM132A	54972	hgsc.bcm.edu	37	11	60699343	60699343	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:60699343T>C	ENST00000453848.2	+	6	1357	c.1199T>C	c.(1198-1200)aTc>aCc	p.I400T	TMEM132A_ENST00000005286.4_Missense_Mutation_p.I401T			Q24JP5	T132A_HUMAN	transmembrane protein 132A	400						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						AGAGCCCTTATCCCACTGGCC	0.622																																					p.I401T		Atlas-SNP	.											.	TMEM132A	135	.	0			c.T1202C						PASS	.						78.0	79.0	79.0					11																	60699343		2203	4299	6502	SO:0001583	missense	54972	exon6			CCCTTATCCCACT	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1199T>C	11.37:g.60699343T>C	ENSP00000405823:p.Ile400Thr	137.0	0.0	0		104.0	20.0	0.192308	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	T	13.06	2.125456	0.37533	.	.	ENSG00000006118	ENST00000444690;ENST00000453848;ENST00000005286	T;T	0.16457	2.34;2.34	4.61	4.61	0.57282	.	0.392434	0.20638	N	0.088449	T	0.15478	0.0373	L	0.42245	1.32	0.32827	D	0.503569	B;P;B;B	0.35272	0.417;0.493;0.277;0.277	B;B;B;B	0.28011	0.085;0.085;0.053;0.053	T	0.19910	-1.0291	10	0.87932	D	0	.	14.0171	0.64531	0.0:0.0:0.0:1.0	.	389;151;400;401	Q24JP5-3;Q24JP5-4;Q24JP5;Q24JP5-2	.;.;T132A_HUMAN;.	T	151;400;401	ENSP00000405823:I400T;ENSP00000005286:I401T	ENSP00000005286:I401T	I	+	2	0	TMEM132A	60455919	0.622000	0.27085	0.808000	0.32385	0.726000	0.41606	3.959000	0.56744	1.859000	0.53934	0.374000	0.22700	ATC	.	.	none		0.622	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
SCN4A	6329	hgsc.bcm.edu	37	17	62045701	62045701	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:62045701C>T	ENST00000435607.1	-	6	794	c.718G>A	c.(718-720)Gtg>Atg	p.V240M	SCN4A_ENST00000578147.1_Missense_Mutation_p.V240M	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	240					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGGGCCCCCACGATCGTCTTC	0.597																																					p.V240M		Atlas-SNP	.											.	SCN4A	205	.	0			c.G718A						PASS	.						69.0	70.0	70.0					17																	62045701		2092	4260	6352	SO:0001583	missense	6329	exon6			CCCCCACGATCGT	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.718G>A	17.37:g.62045701C>T	ENSP00000396320:p.Val240Met	107.0	0.0	0		80.0	6.0	0.075	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	37	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275416	0.80580	.	.	ENSG00000007314	ENST00000435607	D	0.98968	-5.28	5.08	5.08	0.68730	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99309	0.9758	M	0.91090	3.175	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.99000	1.0811	10	0.87932	D	0	.	17.6345	0.88118	0.0:1.0:0.0:0.0	.	240	P35499	SCN4A_HUMAN	M	240	ENSP00000396320:V240M	ENSP00000396320:V240M	V	-	1	0	SCN4A	59399433	1.000000	0.71417	0.967000	0.41034	0.635000	0.38103	7.651000	0.83577	2.648000	0.89879	0.561000	0.74099	GTG	.	.	none		0.597	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
BTBD9	114781	hgsc.bcm.edu	37	6	38545397	38545397	+	Missense_Mutation	SNP	T	T	C	rs373363401		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:38545397T>C	ENST00000481247.1	-	6	1284	c.1133A>G	c.(1132-1134)tAt>tGt	p.Y378C	BTBD9_ENST00000314100.6_Missense_Mutation_p.Y310C|BTBD9_ENST00000408958.1_Missense_Mutation_p.Y310C|BTBD9_ENST00000403056.1_Missense_Mutation_p.Y378C|BTBD9_ENST00000419706.2_Missense_Mutation_p.Y319C	NM_001099272.1|NM_052893.1	NP_001092742.1|NP_443125.1	Q96Q07	BTBD9_HUMAN	BTB (POZ) domain containing 9	378					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|circadian sleep/wake cycle, non-REM sleep (GO:0042748)|long-term memory (GO:0007616)|multicellular organismal iron ion homeostasis (GO:0060586)|regulation of synaptic vesicle endocytosis (GO:1900242)|sensory perception of temperature stimulus (GO:0050951)|serotonin metabolic process (GO:0042428)					breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	12						GGCTGGAAAATATAATTTCTG	0.358																																					p.Y378C		Atlas-SNP	.											.	BTBD9	85	.	0			c.A1133G						PASS	.	T	CYS/TYR,CYS/TYR,CYS/TYR,CYS/TYR	0,3730		0,0,1865	102.0	97.0	99.0		1133,956,1133,929	5.7	1.0	6		99	2,8190		0,2,4094	no	missense,missense,missense,missense	BTBD9	NM_001099272.1,NM_001172418.1,NM_052893.1,NM_152733.2	194,194,194,194	0,2,5959	CC,CT,TT		0.0244,0.0,0.0168	probably-damaging,probably-damaging,probably-damaging,probably-damaging	378/613,319/583,378/613,310/545	38545397	2,11920	1865	4096	5961	SO:0001583	missense	114781	exon7			GGAAAATATAATT		CCDS43458.1, CCDS47418.1, CCDS54998.1	6p21	2014-01-28			ENSG00000183826	ENSG00000183826		"""BTB/POZ domain containing"""	21228	protein-coding gene	gene with protein product		611237				11572484	Standard	NM_052893		Approved	KIAA1880, dJ322I12.1	uc010jwx.3	Q96Q07	OTTHUMG00000014634	ENST00000481247.1:c.1133A>G	6.37:g.38545397T>C	ENSP00000418751:p.Tyr378Cys	54.0	0.0	0		51.0	21.0	0.411765	NM_052893	Q494V9|Q494W1|Q96M00	Missense_Mutation	SNP	ENST00000481247.1	37	CCDS47418.1	.	.	.	.	.	.	.	.	.	.	T	17.04	3.288377	0.59976	0.0	2.44E-4	ENSG00000183826	ENST00000314100;ENST00000481247;ENST00000419706;ENST00000403056;ENST00000408958	D;D;T;D;D	0.98135	-4.74;-4.74;-0.95;-4.74;-4.74	5.71	5.71	0.89125	Coagulation factor 5/8 C-terminal type domain (1);Galactose-binding domain-like (1);	0.124631	0.56097	D	0.000033	D	0.98298	0.9436	M	0.69523	2.12	0.80722	D	1	B;D	0.89917	0.07;1.0	B;D	0.87578	0.078;0.998	D	0.99437	1.0937	10	0.59425	D	0.04	.	15.9738	0.80044	0.0:0.0:0.0:1.0	.	319;378	Q494V9;Q96Q07	.;BTBD9_HUMAN	C	310;378;319;378;310	ENSP00000323408:Y310C;ENSP00000418751:Y378C;ENSP00000415365:Y319C;ENSP00000386121:Y378C;ENSP00000386211:Y310C	ENSP00000323408:Y310C	Y	-	2	0	BTBD9	38653375	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.854000	0.86942	2.179000	0.69175	0.528000	0.53228	TAT	.	.	weak		0.358	BTBD9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040433.2	NM_152733	
PLD6	201164	hgsc.bcm.edu	37	17	17106346	17106346	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr17:17106346C>G	ENST00000321560.3	-	2	522	c.494G>C	c.(493-495)aGg>aCg	p.R165T	RP11-45M22.4_ENST00000427497.3_3'UTR	NM_178836.3	NP_849158.2	Q8N2A8	PLD6_HUMAN	phospholipase D family, member 6	165	PLD phosphodiesterase. {ECO:0000255|PROSITE-ProRule:PRU00153}.				DNA methylation involved in gamete generation (GO:0043046)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|meiotic nuclear division (GO:0007126)|mitochondrial fusion (GO:0008053)|P granule organization (GO:0030719)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|piRNA metabolic process (GO:0034587)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	cardiolipin hydrolase activity (GO:0035755)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)	2						GATGAGCACCCTCTTGTCCAC	0.532																																					p.R165T		Atlas-SNP	.											.	PLD6	9	.	0			c.G494C						PASS	.						134.0	105.0	115.0					17																	17106346		2203	4300	6503	SO:0001583	missense	201164	exon2			AGCACCCTCTTGT	AK090899	CCDS11182.1	17p11.2	2008-08-14			ENSG00000179598	ENSG00000179598			30447	protein-coding gene	gene with protein product		614960				12477932	Standard	NM_178836		Approved		uc002gqz.3	Q8N2A8	OTTHUMG00000059278	ENST00000321560.3:c.494G>C	17.37:g.17106346C>G	ENSP00000317177:p.Arg165Thr	161.0	0.0	0		105.0	21.0	0.2	NM_178836	Q8N5Y1	Missense_Mutation	SNP	ENST00000321560.3	37	CCDS11182.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.914|9.914	1.210336|1.210336	0.22289|0.22289	.|.	.|.	ENSG00000179598|ENSG00000179598	ENST00000427497|ENST00000321560	.|T	.|0.20881	.|2.04	5.15|5.15	2.94|2.94	0.34122|0.34122	.|Phospholipase D/Transphosphatidylase (2);	.|0.167628	.|0.50627	.|D	.|0.000117	T|T	0.13286|0.13286	0.0322|0.0322	L|L	0.35249|0.35249	1.045|1.045	0.27240|0.27240	N|N	0.959164|0.959164	.|B	.|0.22683	.|0.073	.|B	.|0.20577	.|0.03	T|T	0.19679|0.19679	-1.0298|-1.0298	6|10	0.87932|0.30854	D|T	0|0.27	-7.1851|-7.1851	5.2864|5.2864	0.15704|0.15704	0.0:0.231:0.1386:0.6304|0.0:0.231:0.1386:0.6304	.|.	.|165	.|Q8N2A8	.|PLD6_HUMAN	D|T	138|165	.|ENSP00000317177:R165T	ENSP00000394249:E138D|ENSP00000317177:R165T	E|R	-|-	3|2	2|0	PLD6|PLD6	17047071|17047071	0.962000|0.962000	0.33011|0.33011	0.997000|0.997000	0.53966|0.53966	0.623000|0.623000	0.37688|0.37688	1.395000|1.395000	0.34520|0.34520	0.395000|0.395000	0.25257|0.25257	-0.302000|-0.302000	0.09304|0.09304	GAG|AGG	.	.	none		0.532	PLD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131600.2	NM_178836	
TMEM135	65084	hgsc.bcm.edu	37	11	87024484	87024484	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:87024484G>A	ENST00000305494.5	+	11	993	c.954G>A	c.(952-954)ctG>ctA	p.L318L	TMEM135_ENST00000532959.1_Silent_p.L189L|TMEM135_ENST00000535167.1_Silent_p.L179L|TMEM135_ENST00000340353.7_Silent_p.L296L	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	318					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GTTGCTTCCTGCGCTGGATCA	0.289																																					p.L318L		Atlas-SNP	.											.	TMEM135	40	.	0			c.G954A						PASS	.						94.0	97.0	96.0					11																	87024484		2201	4297	6498	SO:0001819	synonymous_variant	65084	exon11			CTTCCTGCGCTGG	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.954G>A	11.37:g.87024484G>A		260.0	0.0	0		227.0	46.0	0.202643	NM_022918	Q6AW91|Q8ND01|Q9H6M3	Silent	SNP	ENST00000305494.5	37	CCDS8280.1																																																																																			.	.	none		0.289	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393875.1	NM_022918	
HIST1H2BG	8339	hgsc.bcm.edu	37	6	26216544	26216544	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr6:26216544G>A	ENST00000244601.3	-	1	328	c.328C>T	c.(328-330)Cac>Tac	p.H110Y	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	110					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				GACACTGCGTGCTTGGCCAGC	0.552																																					p.H110Y		Atlas-SNP	.											.	HIST1H2BG	25	.	0			c.C328T						PASS	.						96.0	96.0	96.0					6																	26216544		2203	4300	6503	SO:0001583	missense	8339	exon1			CTGCGTGCTTGGC	M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.328C>T	6.37:g.26216544G>A	ENSP00000244601:p.His110Tyr	69.0	0.0	0		76.0	7.0	0.0921053	NM_003518	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	ENST00000244601.3	37	CCDS4594.1	.	.	.	.	.	.	.	.	.	.	.	17.25	3.343011	0.61073	.	.	ENSG00000187990	ENST00000244601	T	0.51574	0.7	3.89	3.89	0.44902	.	0.000000	0.35124	U	0.003433	T	0.55033	0.1895	.	.	.	0.38755	D	0.954201	.	.	.	.	.	.	T	0.63193	-0.6692	7	0.87932	D	0	.	15.3699	0.74554	0.0:0.0:1.0:0.0	.	.	.	.	Y	110	ENSP00000244601:H110Y	ENSP00000244601:H110Y	H	-	1	0	HIST1H2BG	26324523	1.000000	0.71417	1.000000	0.80357	0.162000	0.22319	7.631000	0.83237	2.172000	0.68678	0.561000	0.74099	CAC	.	.	none		0.552	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040109.2	NM_003518	
TRPM6	140803	hgsc.bcm.edu	37	9	77400960	77400960	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr9:77400960C>G	ENST00000360774.1	-	21	2986	c.2749G>C	c.(2749-2751)Gcc>Ccc	p.A917P	TRPM6_ENST00000451710.3_Missense_Mutation_p.A917P|TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000361255.3_Missense_Mutation_p.A912P|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.A917P|TRPM6_ENST00000449912.2_Missense_Mutation_p.A912P	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	917					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						AGGCCAATGGCCACAGTTTCT	0.448																																					p.A917P		Atlas-SNP	.											TRPM6_ENST00000451710,axilla,malignant_melanoma,+1,2	TRPM6	377	2	0			c.G2749C						PASS	.						178.0	163.0	168.0					9																	77400960		2203	4300	6503	SO:0001583	missense	140803	exon21			CAATGGCCACAGT	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.2749G>C	9.37:g.77400960C>G	ENSP00000354006:p.Ala917Pro	158.0	0.0	0		132.0	27.0	0.204545	NM_017662	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	ENST00000360774.1	37	CCDS6647.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648930	0.67358	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54	5.14	5.14	0.70334	Ion transport (1);	0.144833	0.64402	D	0.000008	D	0.87771	0.6261	M	0.91612	3.225	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.80764	0.994;0.988;0.99	D	0.90238	0.4284	10	0.87932	D	0	.	18.7871	0.91960	0.0:1.0:0.0:0.0	.	580;917;912	F5H7D1;Q9BX84;Q9BX84-3	.;TRPM6_HUMAN;.	P	917;917;912;912;917;580;580	ENSP00000354006:A917P;ENSP00000407341:A917P;ENSP00000396672:A912P;ENSP00000354962:A912P;ENSP00000366060:A917P	ENSP00000309693:A580P	A	-	1	0	TRPM6	76590780	1.000000	0.71417	0.999000	0.59377	0.077000	0.17291	7.602000	0.82796	2.669000	0.90835	0.549000	0.68633	GCC	.	.	none		0.448	TRPM6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052693.1	NM_017662	
ZNF846	162993	hgsc.bcm.edu	37	19	9868728	9868728	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:9868728T>C	ENST00000397902.2	-	6	1438	c.1025A>G	c.(1024-1026)gAg>gGg	p.E342G	ZNF846_ENST00000592859.1_Intron|ZNF846_ENST00000588267.1_Intron|ZNF846_ENST00000586293.1_3'UTR	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						TTTTCCACACTCCTTACATTC	0.383																																					p.E342G		Atlas-SNP	.											.	ZNF846	61	.	0			c.A1025G						PASS	.						52.0	57.0	55.0					19																	9868728		2174	4292	6466	SO:0001583	missense	162993	exon6			CCACACTCCTTAC	AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.1025A>G	19.37:g.9868728T>C	ENSP00000380999:p.Glu342Gly	81.0	0.0	0		80.0	15.0	0.1875	NM_001077624	A8K0H1|B3KUP1	Missense_Mutation	SNP	ENST00000397902.2	37	CCDS42496.1	.	.	.	.	.	.	.	.	.	.	.	16.53	3.150075	0.57151	.	.	ENSG00000196605	ENST00000397902	T	0.07444	3.19	2.01	0.932	0.19466	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09113	0.0225	M	0.65320	2	0.09310	N	1	B	0.30793	0.295	B	0.30855	0.121	T	0.29731	-1.0002	8	.	.	.	.	5.5686	0.17184	0.2448:0.0:0.0:0.7551	.	342	Q147U1	ZN846_HUMAN	G	342	ENSP00000380999:E342G	.	E	-	2	0	ZNF846	9729728	0.000000	0.05858	0.012000	0.15200	0.932000	0.56968	-0.585000	0.05794	0.217000	0.20800	0.374000	0.22700	GAG	.	.	none		0.383	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624	
ISLR2	57611	hgsc.bcm.edu	37	15	74426853	74426853	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr15:74426853G>T	ENST00000361742.3	+	4	2527	c.1758G>T	c.(1756-1758)gaG>gaT	p.E586D	ISLR2_ENST00000565540.1_Missense_Mutation_p.E586D|ISLR2_ENST00000419208.1_Missense_Mutation_p.E586D|ISLR2_ENST00000565159.1_Missense_Mutation_p.E586D|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000453268.2_Missense_Mutation_p.E586D|ISLR2_ENST00000435464.1_Missense_Mutation_p.E586D|ISLR2_ENST00000445793.1_Missense_Mutation_p.E586D	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	586					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						CCAAGAAGGAGCTCCCATCGC	0.642																																					p.E586D		Atlas-SNP	.											.	ISLR2	78	.	0			c.G1758T						PASS	.						35.0	31.0	32.0					15																	74426853		2198	4296	6494	SO:0001583	missense	57611	exon4			GAAGGAGCTCCCA		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.1758G>T	15.37:g.74426853G>T	ENSP00000355402:p.Glu586Asp	95.0	0.0	0		75.0	8.0	0.106667	NM_001130138	A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	G	15.55	2.865890	0.51588	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000395121;ENST00000419208	T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37	4.73	0.492	0.16872	.	0.059441	0.64402	D	0.000003	T	0.41627	0.1167	L	0.27053	0.805	0.34021	D	0.652649	D	0.57257	0.979	P	0.49999	0.628	T	0.51371	-0.8714	10	0.27785	T	0.31	.	8.8954	0.35460	0.4526:0.0:0.5474:0.0	.	586	Q6UXK2	ISLR2_HUMAN	D	586;586;586;586;175;586	ENSP00000403244:E586D;ENSP00000355402:E586D;ENSP00000411443:E586D;ENSP00000411834:E586D;ENSP00000408872:E586D	ENSP00000355402:E586D	E	+	3	2	ISLR2	72213906	0.924000	0.31332	0.992000	0.48379	0.893000	0.52053	0.436000	0.21526	0.207000	0.20607	0.313000	0.20887	GAG	.	.	none		0.642	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269046.1	NM_020851	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17167456	17167456	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr11:17167456T>G	ENST00000265970.7	-	6	1593	c.1594A>C	c.(1594-1596)Aaa>Caa	p.K532Q	PIK3C2A_ENST00000540361.1_Missense_Mutation_p.K152Q|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	532					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TACAGGTGTTTGTTTAAATCC	0.333																																					p.K532Q		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.A1594C						PASS	.						133.0	141.0	138.0					11																	17167456		2200	4293	6493	SO:0001583	missense	5286	exon6			GGTGTTTGTTTAA	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.1594A>C	11.37:g.17167456T>G	ENSP00000265970:p.Lys532Gln	83.0	0.0	0		75.0	15.0	0.2	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.099125	0.56183	.	.	ENSG00000011405	ENST00000265970;ENST00000540361;ENST00000544896	T;T	0.63744	-0.06;0.37	5.32	5.32	0.75619	.	0.091731	0.64402	D	0.000001	T	0.75213	0.3819	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	T	0.71368	-0.4614	10	0.14656	T	0.56	-12.0604	15.5669	0.76300	0.0:0.0:0.0:1.0	.	532;532	F5H5W9;O00443	.;P3C2A_HUMAN	Q	532;152;532	ENSP00000265970:K532Q;ENSP00000438687:K152Q	ENSP00000265970:K532Q	K	-	1	0	PIK3C2A	17124032	1.000000	0.71417	0.997000	0.53966	0.601000	0.36947	5.361000	0.66092	2.140000	0.66376	0.482000	0.46254	AAA	.	.	none		0.333	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
ZNF534	147658	hgsc.bcm.edu	37	19	52941505	52941505	+	Silent	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr19:52941505T>C	ENST00000332323.6	+	4	892	c.831T>C	c.(829-831)caT>caC	p.H277H	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Silent_p.H264H|ZNF534_ENST00000432303.2_Intron	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						AGAAAATTCATACTGGACAGA	0.383																																					p.H277H		Atlas-SNP	.											.	ZNF534	105	.	0			c.T831C						PASS	.						54.0	49.0	50.0					19																	52941505		1568	3582	5150	SO:0001819	synonymous_variant	147658	exon4			AATTCATACTGGA	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.831T>C	19.37:g.52941505T>C		82.0	0.0	0		65.0	15.0	0.230769	NM_001143939	Q76KX9	Silent	SNP	ENST00000332323.6	37	CCDS46165.1																																																																																			.	.	none		0.383	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
LRRFIP2	9209	hgsc.bcm.edu	37	3	37151161	37151161	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr3:37151161T>C	ENST00000336686.4	-	10	627	c.547A>G	c.(547-549)Aca>Gca	p.T183A	LRRFIP2_ENST00000396428.2_Intron|LRRFIP2_ENST00000421307.1_Missense_Mutation_p.T183A|LRRFIP2_ENST00000421276.2_Intron|LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000354379.4_Intron			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	183	DVL3-binding.|Ser-rich.				Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CTCTTATATGTTGCCAGAGGG	0.368																																					p.T183A		Atlas-SNP	.											.	LRRFIP2	71	.	1	Whole gene deletion(1)	ovary(1)	c.A547G						PASS	.						109.0	112.0	111.0					3																	37151161		2203	4300	6503	SO:0001583	missense	9209	exon11			TATATGTTGCCAG	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.547A>G	3.37:g.37151161T>C	ENSP00000338727:p.Thr183Ala	198.0	0.0	0		218.0	42.0	0.192661	NM_006309	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Missense_Mutation	SNP	ENST00000336686.4	37	CCDS2664.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.905655	0.33628	.	.	ENSG00000093167	ENST00000421307;ENST00000336686	T;T	0.46063	0.88;0.88	5.49	4.34	0.51931	.	0.352176	0.29884	N	0.010945	T	0.23766	0.0575	N	0.08118	0	0.33957	D	0.645154	B	0.23650	0.089	B	0.23852	0.049	T	0.24621	-1.0155	10	0.39692	T	0.17	2.162	11.145	0.48426	0.0:0.0723:0.0:0.9277	.	183	Q9Y608	LRRF2_HUMAN	A	183	ENSP00000392217:T183A;ENSP00000338727:T183A	ENSP00000338727:T183A	T	-	1	0	LRRFIP2	37126165	0.998000	0.40836	0.323000	0.25347	0.646000	0.38490	2.746000	0.47467	1.106000	0.41623	-0.256000	0.11100	ACA	.	.	none		0.368	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253335.3	NM_006309	
NAT8L	339983	hgsc.bcm.edu	37	4	2062888	2062888	+	Splice_Site	SNP	C	C	T	rs376253416		TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr4:2062888C>T	ENST00000423729.2	+	2	540	c.540C>T	c.(538-540)ccC>ccT	p.P180P	NAT8L_ENST00000331662.3_Splice_Site_p.P12P	NM_178557.3	NP_848652.2	Q8N9F0	NAT8L_HUMAN	N-acetyltransferase 8-like (GCN5-related, putative)	180	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				metabolic process (GO:0008152)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)	aspartate N-acetyltransferase activity (GO:0017188)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0315)			TGAAGCCGCCCGGTGAGTCCC	0.706																																					p.P180P		Atlas-SNP	.											.	NAT8L	23	.	0			c.C540T						PASS	.	C		0,4366		0,0,2183	23.0	23.0	23.0		540	-8.1	0.1	4		23	1,8573		0,1,4286	no	coding-synonymous-near-splice	NAT8L	NM_178557.3		0,1,6469	TT,TC,CC		0.0117,0.0,0.0077		180/303	2062888	1,12939	2183	4287	6470	SO:0001630	splice_region_variant	339983	exon2			GCCGCCCGGTGAG	AK094797	CCDS3359.1, CCDS3359.2	4p16.3	2011-11-16	2008-09-24		ENSG00000185818	ENSG00000185818			26742	protein-coding gene	gene with protein product		610647	"""N-acetyltransferase 8-like"""			11397015	Standard	NM_178557		Approved	FLJ37478, Hcml3	uc003geq.2	Q8N9F0	OTTHUMG00000121151	ENST00000423729.2:c.541+1C>T	4.37:g.2062888C>T		125.0	0.0	0		115.0	19.0	0.165217	NM_178557		Silent	SNP	ENST00000423729.2	37	CCDS3359.2																																																																																			.	.	weak		0.706	NAT8L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178557	Silent
SPRY4	81848	hgsc.bcm.edu	37	5	141694497	141694497	+	Silent	SNP	G	G	A			TCGA-FA-A6HN-01A-11D-A31X-10	TCGA-FA-A6HN-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	01217848-97f3-4995-89c8-3b0cf9527c40	6c06b9ec-6df2-4029-9b30-c38448f9637f	g.chr5:141694497G>A	ENST00000434127.2	-	2	420	c.177C>T	c.(175-177)gcC>gcT	p.A59A	SPRY4_ENST00000344120.4_Silent_p.A82A|SPRY4_ENST00000503582.1_5'Flank	NM_001127496.1	NP_001120968.1	Q9C004	SPY4_HUMAN	sprouty homolog 4 (Drosophila)	59					multicellular organismal development (GO:0007275)|negative regulation of MAP kinase activity (GO:0043407)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(1)	18		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGTGGTCAGGGCCAGGCTAG	0.642									Testicular Cancer, Familial Clustering of																												p.A82A		Atlas-SNP	.											.	SPRY4	31	.	0			c.C246T						PASS	.						29.0	32.0	31.0					5																	141694497		2198	4294	6492	SO:0001819	synonymous_variant	81848	exon3	Familial Cancer Database		GGTCAGGGCCAGG	AF227516	CCDS4274.1, CCDS47296.1	5q31.3	2010-08-05			ENSG00000187678	ENSG00000187678			15533	protein-coding gene	gene with protein product		607984				16465403	Standard	NM_030964		Approved		uc010jgi.1	Q9C004	OTTHUMG00000129663	ENST00000434127.2:c.177C>T	5.37:g.141694497G>A		117.0	0.0	0		96.0	22.0	0.229167	NM_030964	A4FVB2|A4FVB3|Q6QIX2|Q9C003	Silent	SNP	ENST00000434127.2	37	CCDS47296.1																																																																																			.	.	none		0.642	SPRY4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370652.1		
