#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ROBO2	6092	hgsc.bcm.edu	37	3	77147265	77147265	+	Silent	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:77147265G>A	ENST00000461745.1	+	2	1062	c.162G>A	c.(160-162)gcG>gcA	p.A54A	ROBO2_ENST00000487694.3_Silent_p.A70A|ROBO2_ENST00000332191.8_Silent_p.A54A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	54	Ig-like C2-type 1.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ACTGCAAGGCGGAGGGCCGGC	0.617																																					p.A54A		Atlas-SNP	.											.	ROBO2	527	.	0			c.G162A						PASS	.						53.0	59.0	57.0					3																	77147265		1980	4165	6145	SO:0001819	synonymous_variant	6092	exon2			CAAGGCGGAGGGC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.162G>A	3.37:g.77147265G>A		89.0	0.0	0		139.0	8.0	0.057554	NM_002942	O43608|Q19AB4|Q19AB5	Silent	SNP	ENST00000461745.1	37	CCDS43109.1																																																																																			.	.	none		0.617	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
PEX5L	51555	hgsc.bcm.edu	37	3	179525541	179525541	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:179525541G>A	ENST00000467460.1	-	14	1927	c.1597C>T	c.(1597-1599)Cga>Tga	p.R533*	PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000468741.1_Nonsense_Mutation_p.R341*|PEX5L_ENST00000392649.3_Nonsense_Mutation_p.R425*|PEX5L_ENST00000476138.1_Nonsense_Mutation_p.R490*|PEX5L_ENST00000485199.1_Nonsense_Mutation_p.R498*|PEX5L_ENST00000263962.8_Nonsense_Mutation_p.R531*|PEX5L_ENST00000472994.1_Nonsense_Mutation_p.R474*|PEX5L_ENST00000464614.1_Nonsense_Mutation_p.R425*|PEX5L_ENST00000465751.1_Nonsense_Mutation_p.R509*	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	533					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCCAGTGCTCGCGTATAGGCC	0.547																																					p.R533X		Atlas-SNP	.											.	PEX5L	104	.	0			c.C1597T						PASS	.						156.0	158.0	157.0					3																	179525541		2203	4300	6503	SO:0001587	stop_gained	51555	exon14			GTGCTCGCGTATA	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1597C>T	3.37:g.179525541G>A	ENSP00000419975:p.Arg533*	55.0	0.0	0		80.0	5.0	0.0625	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Nonsense_Mutation	SNP	ENST00000467460.1	37	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310115	0.60414	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	.	.	.	6.07	0.263	0.15602	.	0.062097	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.1829	18.2127	0.89876	0.0:0.0:0.3064:0.6936	.	.	.	.	X	533;531;498;531;425;341;490;421;474;425;509	.	ENSP00000263962:R531X	R	-	1	2	PEX5L	181008235	0.806000	0.28996	0.047000	0.18901	0.321000	0.28281	1.324000	0.33712	0.023000	0.15187	-0.291000	0.09656	CGA	.	.	none		0.547	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
ZC3H12A	80149	hgsc.bcm.edu	37	1	37948367	37948367	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:37948367C>T	ENST00000373087.6	+	6	1071	c.955C>T	c.(955-957)Cga>Tga	p.R319*		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GATCAAGTGCCGATTCTTCCA	0.592																																					p.R319X		Atlas-SNP	.											.	ZC3H12A	58	.	0			c.C955T						PASS	.						53.0	58.0	56.0					1																	37948367		2203	4300	6503	SO:0001587	stop_gained	80149	exon6			AAGTGCCGATTCT		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.955C>T	1.37:g.37948367C>T	ENSP00000362179:p.Arg319*	58.0	0.0	0		36.0	7.0	0.194444	NM_025079		Nonsense_Mutation	SNP	ENST00000373087.6	37	CCDS417.1	.	.	.	.	.	.	.	.	.	.	C	37	6.207425	0.97376	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	.	.	.	5.35	4.42	0.53409	.	0.056788	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-13.4531	12.5056	0.55979	0.4622:0.5378:0.0:0.0	.	.	.	.	X	319	.	ENSP00000362174:R319X	R	+	1	2	ZC3H12A	37720954	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.551000	0.67274	1.202000	0.43218	0.563000	0.77884	CGA	.	.	none		0.592	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
TEX15	56154	hgsc.bcm.edu	37	8	30706107	30706107	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:30706107C>A	ENST00000256246.2	-	1	501	c.427G>T	c.(427-429)Gtt>Ttt	p.V143F	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	143					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GCCATGGTAACTTTATTGGGA	0.423																																					p.V143F		Atlas-SNP	.											TEX15,colon,carcinoma,+1,1	TEX15	350	1	0			c.G427T						PASS	.						116.0	111.0	113.0					8																	30706107		2203	4300	6503	SO:0001583	missense	56154	exon1			TGGTAACTTTATT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.427G>T	8.37:g.30706107C>A	ENSP00000256246:p.Val143Phe	103.0	0.0	0		111.0	7.0	0.0630631	NM_031271		Missense_Mutation	SNP	ENST00000256246.2	37	CCDS6080.1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025481	0.35701	.	.	ENSG00000133863	ENST00000256246	T	0.13196	2.61	5.51	-1.39	0.08997	.	1.516910	0.03687	N	0.246505	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	P	0.44380	0.834	P	0.45506	0.483	T	0.41088	-0.9528	10	0.87932	D	0	.	10.4415	0.44469	0.0:0.5403:0.0:0.4597	.	143	Q9BXT5	TEX15_HUMAN	F	143	ENSP00000256246:V143F	ENSP00000256246:V143F	V	-	1	0	TEX15	30825649	0.034000	0.19679	0.002000	0.10522	0.030000	0.12068	0.067000	0.14510	-0.081000	0.12662	-0.302000	0.09304	GTT	.	.	none		0.423	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
EPSTI1	94240	hgsc.bcm.edu	37	13	43474489	43474489	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:43474489G>T	ENST00000398762.3	-	10	804	c.805C>A	c.(805-807)Caa>Aaa	p.Q269K	EPSTI1_ENST00000313640.7_Missense_Mutation_p.Q269K|EPSTI1_ENST00000313624.7_Missense_Mutation_p.Q258K			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	269										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		TCTTGCTCTTGCTGCTGCCGT	0.353																																					p.Q269K		Atlas-SNP	.											.	EPSTI1	47	.	0			c.C805A						PASS	.						210.0	180.0	191.0					13																	43474489		2202	4300	6502	SO:0001583	missense	94240	exon10			GCTCTTGCTGCTG	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.805C>A	13.37:g.43474489G>T	ENSP00000381746:p.Gln269Lys	77.0	0.0	0		65.0	4.0	0.0615385	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	37	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189527	0.38707	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	T	0.21191	2.02	5.15	3.42	0.39159	.	0.315322	0.27535	N	0.018925	T	0.27629	0.0679	M	0.67953	2.075	0.27333	N	0.956715	P;P	0.51537	0.946;0.946	P;P	0.48840	0.592;0.592	T	0.10064	-1.0646	10	0.49607	T	0.09	-9.5038	7.5873	0.27999	0.085:0.3183:0.5966:0.0	.	258;269	Q96J88-2;Q96J88-3	.;.	K	269;258;269	ENSP00000318982:Q269K	ENSP00000318643:Q258K	Q	-	1	0	EPSTI1	42372489	0.720000	0.27996	0.948000	0.38648	0.158000	0.22134	0.469000	0.22067	0.869000	0.35703	0.650000	0.86243	CAA	.	.	none		0.353	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
BTG2	7832	hgsc.bcm.edu	37	1	203276562	203276562	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:203276562G>A	ENST00000290551.4	+	2	544	c.473G>A	c.(472-474)aGc>aAc	p.S158N	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	158					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GCAGTCTCCAGCTAGGCCCTT	0.627																																					p.S158N		Atlas-SNP	.											.	BTG2	16	.	0			c.G473A						PASS	.						23.0	24.0	24.0					1																	203276562		2196	4278	6474	SO:0001583	missense	7832	exon2			TCTCCAGCTAGGC		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.473G>A	1.37:g.203276562G>A	ENSP00000290551:p.Ser158Asn	66.0	0.0	0		50.0	10.0	0.2	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902148	0.52227	.	.	ENSG00000159388	ENST00000290551	T	0.26373	1.74	4.76	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.46483	0.1395	M	0.73217	2.22	0.43338	D	0.995382	D	0.76494	0.999	D	0.66084	0.941	T	0.49021	-0.8982	10	0.87932	D	0	-21.5168	11.8943	0.52648	0.087:0.0:0.913:0.0	.	158	P78543	BTG2_HUMAN	N	158	ENSP00000290551:S158N	ENSP00000290551:S158N	S	+	2	0	BTG2	201543185	1.000000	0.71417	1.000000	0.80357	0.097000	0.18754	9.420000	0.97426	1.140000	0.42260	0.313000	0.20887	AGC	.	.	none		0.627	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
ASPH	444	hgsc.bcm.edu	37	8	62430094	62430094	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:62430094C>T	ENST00000379454.4	-	24	2306	c.2119G>A	c.(2119-2121)Gag>Aag	p.E707K	ASPH_ENST00000541428.1_Missense_Mutation_p.E678K	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	707					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TACTTGGTCTCGTTGGCACAT	0.507																																					p.E707K		Atlas-SNP	.											.	ASPH	87	.	0			c.G2119A						PASS	.						171.0	121.0	138.0					8																	62430094		2203	4300	6503	SO:0001583	missense	444	exon24			TGGTCTCGTTGGC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.2119G>A	8.37:g.62430094C>T	ENSP00000368767:p.Glu707Lys	72.0	0.0	0		77.0	13.0	0.168831	NM_004318	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Missense_Mutation	SNP	ENST00000379454.4	37	CCDS34898.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768991	0.49680	.	.	ENSG00000198363	ENST00000541428;ENST00000379454	T;T	0.43688	0.94;0.94	5.96	4.19	0.49359	.	0.116455	0.64402	D	0.000016	T	0.43144	0.1234	M	0.80422	2.495	0.80722	D	1	B;P	0.50943	0.235;0.94	B;B	0.37346	0.092;0.247	T	0.50734	-0.8793	10	0.49607	T	0.09	-19.997	12.9723	0.58520	0.0:0.8691:0.0:0.1309	.	678;707	F5H667;Q12797	.;ASPH_HUMAN	K	678;707	ENSP00000437864:E678K;ENSP00000368767:E707K	ENSP00000368767:E707K	E	-	1	0	ASPH	62592648	0.996000	0.38824	0.678000	0.29963	0.418000	0.31294	3.084000	0.50143	0.872000	0.35775	0.650000	0.86243	GAG	.	.	none		0.507	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378510.3	NM_004318	
AAGAB	79719	hgsc.bcm.edu	37	15	67524188	67524188	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr15:67524188T>C	ENST00000261880.5	-	5	603	c.499A>G	c.(499-501)Aat>Gat	p.N167D	AAGAB_ENST00000561452.1_Missense_Mutation_p.N58D|AAGAB_ENST00000542650.1_Missense_Mutation_p.N58D	NM_001271885.1|NM_001271886.1|NM_024666.3	NP_001258814.1|NP_001258815.1|NP_078942.3	Q6PD74	AAGAB_HUMAN	alpha- and gamma-adaptin binding protein	167					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9						ACATTGGCATTCAGGGCTTGG	0.368																																					p.N167D		Atlas-SNP	.											.	AAGAB	24	.	0			c.A499G						PASS	.						258.0	249.0	252.0					15																	67524188		1926	4146	6072	SO:0001583	missense	79719	exon5			TGGCATTCAGGGC	AL136715	CCDS42050.1, CCDS61679.1	15q22.33-q23	2014-02-12	2009-07-20		ENSG00000103591	ENSG00000103591			25662	protein-coding gene	gene with protein product		614888				11230166, 10477754	Standard	NM_024666		Approved	FLJ11506, p34	uc002aqk.5	Q6PD74	OTTHUMG00000172246	ENST00000261880.5:c.499A>G	15.37:g.67524188T>C	ENSP00000261880:p.Asn167Asp	76.0	0.0	0		69.0	5.0	0.0724638	NM_024666	B4DG44|Q6FI86|Q7Z5X9|Q9H0P1|Q9HAK0	Missense_Mutation	SNP	ENST00000261880.5	37	CCDS42050.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.830795	0.91036	.	.	ENSG00000103591	ENST00000261880;ENST00000542650	T;T	0.46451	0.89;0.87	5.21	5.21	0.72293	.	0.094714	0.85682	D	0.000000	T	0.55609	0.1931	M	0.68952	2.095	0.80722	D	1	D	0.52996	0.957	P	0.55667	0.781	T	0.53760	-0.8393	10	0.32370	T	0.25	-28.4102	15.2497	0.73536	0.0:0.0:0.0:1.0	.	167	Q6PD74	AAGAB_HUMAN	D	167;58	ENSP00000261880:N167D;ENSP00000440735:N58D	ENSP00000261880:N167D	N	-	1	0	AAGAB	65311242	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.428000	0.80296	2.180000	0.69256	0.528000	0.53228	AAT	.	.	none		0.368	AAGAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417472.1	NM_024666	
TMEM108	66000	hgsc.bcm.edu	37	3	133099739	133099739	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:133099739G>A	ENST00000321871.6	+	4	1394	c.1184G>A	c.(1183-1185)aGc>aAc	p.S395N	TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000515826.1_Missense_Mutation_p.S395N|TMEM108_ENST00000393130.3_Missense_Mutation_p.S395N	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	395						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GTCTCAGAAAGCACTATTTCT	0.592																																					p.S395N		Atlas-SNP	.											.	TMEM108	67	.	0			c.G1184A						PASS	.						51.0	51.0	51.0					3																	133099739		2203	4300	6503	SO:0001583	missense	66000	exon4			CAGAAAGCACTAT	AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.1184G>A	3.37:g.133099739G>A	ENSP00000324651:p.Ser395Asn	51.0	0.0	0		58.0	11.0	0.189655	NM_023943	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	ENST00000321871.6	37	CCDS33858.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419812	0.42918	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.51325	0.77;0.77;0.71	3.66	2.78	0.32641	.	0.563192	0.16981	N	0.191688	T	0.58935	0.2157	L	0.57536	1.79	0.25499	N	0.987578	D;B	0.67145	0.996;0.023	D;B	0.78314	0.991;0.01	T	0.43653	-0.9378	10	0.45353	T	0.12	-9.2727	6.9696	0.24642	0.2917:0.0:0.7083:0.0	.	395;395	E9PB58;Q6UXF1	.;TM108_HUMAN	N	395	ENSP00000324651:S395N;ENSP00000376838:S395N;ENSP00000423338:S395N	ENSP00000324651:S395N	S	+	2	0	TMEM108	134582429	0.989000	0.36119	0.992000	0.48379	0.937000	0.57800	0.931000	0.28871	0.881000	0.35993	0.561000	0.74099	AGC	.	.	none		0.592	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356907.2	NM_023943	
NEDD4	4734	hgsc.bcm.edu	37	15	56208006	56208006	+	Missense_Mutation	SNP	G	G	A	rs370853036|rs370701101		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr15:56208006G>A	ENST00000508342.1	-	1	1323	c.1024C>T	c.(1024-1026)Cgg>Tgg	p.R342W	NEDD4_ENST00000338963.2_Missense_Mutation_p.R342W|NEDD4_ENST00000506154.1_Missense_Mutation_p.R342W|NEDD4_ENST00000435532.3_Intron	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	342					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TGAAGCGGCCGTATGTCTCTT	0.418																																					p.R342W		Atlas-SNP	.											.	NEDD4	167	.	0			c.C1024T						PASS	.	G	,TRP/ARG	0,4376		0,0,2188	65.0	68.0	67.0		,1024	-0.7	0.8	15		67	1,8575		0,1,4287	no	intron,missense	NEDD4	NM_006154.2,NM_198400.2	,101	0,1,6475	AA,AG,GG		0.0117,0.0,0.0077	,probably-damaging	,342/1248	56208006	1,12951	2188	4288	6476	SO:0001583	missense	4734	exon1			GCGGCCGTATGTC	D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1024C>T	15.37:g.56208006G>A	ENSP00000424827:p.Arg342Trp	71.0	0.0	0		64.0	13.0	0.203125	NM_198400	A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	ENST00000508342.1	37		.	.	.	.	.	.	.	.	.	.	G	12.03	1.816573	0.32145	0.0	1.17E-4	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.45668	0.89;0.89;0.89	5.46	-0.682	0.11339	.	215.666000	0.00166	N	0.000000	T	0.48874	0.1524	M	0.63843	1.955	0.09310	N	0.999998	B;B;B	0.18968	0.032;0.019;0.032	B;B;B	0.16722	0.016;0.012;0.016	T	0.57717	-0.7763	10	0.87932	D	0	.	17.0411	0.86489	0.0:0.0:0.5238:0.4762	.	342;342;342	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	W	342	ENSP00000424827:R342W;ENSP00000345530:R342W;ENSP00000422705:R342W	ENSP00000345530:R342W	R	-	1	2	NEDD4	53995298	0.277000	0.24220	0.787000	0.31911	0.260000	0.26232	1.086000	0.30853	-0.015000	0.14150	-0.488000	0.04728	CGG	.	.	weak		0.418	NEDD4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000359817.1	NM_198400	
COL1A2	1278	hgsc.bcm.edu	37	7	94041934	94041934	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:94041934C>T	ENST00000297268.6	+	25	1914	c.1443C>T	c.(1441-1443)ggC>ggT	p.G481G		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	481					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	GCCCAATTGGCCCAGCTGGAG	0.512										HNSCC(75;0.22)																											p.G481G		Atlas-SNP	.											.	COL1A2	240	.	0			c.C1443T						PASS	.						51.0	50.0	50.0					7																	94041934		2203	4300	6503	SO:0001819	synonymous_variant	1278	exon25			AATTGGCCCAGCT	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1443C>T	7.37:g.94041934C>T		41.0	0.0	0		47.0	8.0	0.170213	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	37	CCDS34682.1																																																																																			.	.	none		0.512	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
CSMD1	64478	hgsc.bcm.edu	37	8	2944669	2944669	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:2944669C>T	ENST00000520002.1	-	50	7982	c.7427G>A	c.(7426-7428)cGa>cAa	p.R2476Q	CSMD1_ENST00000537824.1_Missense_Mutation_p.R2475Q|CSMD1_ENST00000602723.1_Missense_Mutation_p.R2476Q|CSMD1_ENST00000400186.3_Missense_Mutation_p.R2476Q|CSMD1_ENST00000542608.1_Missense_Mutation_p.R2475Q|CSMD1_ENST00000602557.1_Missense_Mutation_p.R2476Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2476	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.R2204P(1)|p.R2204Q(1)|p.R2475P(1)|p.R2475Q(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGTGGGTTTCGTCTACAGGT	0.507																																					p.R2475Q		Atlas-SNP	.											CSMD1_ENST00000537824,NS,carcinoma,0,4	CSMD1	1469	4	4	Substitution - Missense(4)	lung(2)|skin(2)	c.G7424A						PASS	.						106.0	106.0	106.0					8																	2944669		2042	4187	6229	SO:0001583	missense	64478	exon49			GGGTTTCGTCTAC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7427G>A	8.37:g.2944669C>T	ENSP00000430733:p.Arg2476Gln	78.0	0.0	0		52.0	9.0	0.173077	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	7.075	0.569036	0.13560	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.81	4.93	0.64822	Complement control module (2);Sushi/SCR/CCP (3);	0.172123	0.40064	N	0.001184	T	0.19005	0.0456	L	0.27053	0.805	0.42680	D	0.993547	B;B;B	0.23442	0.015;0.066;0.085	B;B;B	0.21917	0.008;0.037;0.022	T	0.04053	-1.0981	10	0.27785	T	0.31	.	14.2967	0.66318	0.0:0.9289:0.0:0.0711	.	2476;2476;2475	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	Q	2476;2476;2337;2475;2475	ENSP00000383047:R2476Q;ENSP00000430733:R2476Q;ENSP00000441462:R2475Q;ENSP00000446243:R2475Q	ENSP00000320445:R2337Q	R	-	2	0	CSMD1	2932076	0.648000	0.27313	0.059000	0.19551	0.012000	0.07955	1.487000	0.35540	2.749000	0.94314	0.561000	0.74099	CGA	.	.	none		0.507	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
COL22A1	169044	hgsc.bcm.edu	37	8	139606427	139606427	+	Missense_Mutation	SNP	A	A	G	rs72727814	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:139606427A>G	ENST00000303045.6	-	63	4894	c.4448T>C	c.(4447-4449)cTc>cCc	p.L1483P	COL22A1_ENST00000435777.1_Missense_Mutation_p.L1463P|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1483	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTGGGCCAGGAGGTAGGCGAG	0.577										HNSCC(7;0.00092)																											p.L1483P		Atlas-SNP	.											.	COL22A1	390	.	0			c.T4448C						PASS	.						35.0	39.0	37.0					8																	139606427		2203	4300	6503	SO:0001583	missense	169044	exon63			GCCAGGAGGTAGG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4448T>C	8.37:g.139606427A>G	ENSP00000303153:p.Leu1483Pro	155.0	0.0	0		117.0	11.0	0.0940171	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	37	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924459	0.52653	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.90504	-2.68;-2.57	5.92	5.92	0.95590	.	0.155601	0.29783	N	0.011218	D	0.93943	0.8061	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.77004	0.989;0.972	D	0.92409	0.5936	10	0.26408	T	0.33	.	15.5808	0.76439	1.0:0.0:0.0:0.0	.	1463;1483	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	P	1483;1463;1176	ENSP00000303153:L1483P;ENSP00000387655:L1463P	ENSP00000303153:L1483P	L	-	2	0	COL22A1	139675609	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	7.098000	0.76974	2.275000	0.75901	0.529000	0.55759	CTC	A|0.995;T|0.005	.	alt		0.577	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
GOLGA3	2802	hgsc.bcm.edu	37	12	133389993	133389993	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:133389993G>T	ENST00000450791.2	-	3	602	c.419C>A	c.(418-420)tCt>tAt	p.S140Y	GOLGA3_ENST00000545875.1_Missense_Mutation_p.S140Y|GOLGA3_ENST00000204726.3_Missense_Mutation_p.S140Y|GOLGA3_ENST00000456883.2_Missense_Mutation_p.S140Y|GOLGA3_ENST00000537452.1_Missense_Mutation_p.S140Y			Q08378	GOGA3_HUMAN	golgin A3	140	Interaction with GOPC.	Cleavage; by caspase-3.			intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGGCAGGGGAGAATCTGTAGA	0.512																																					p.S140Y		Atlas-SNP	.											.	GOLGA3	234	.	0			c.C419A						PASS	.						51.0	46.0	48.0					12																	133389993		2203	4300	6503	SO:0001583	missense	2802	exon4			AGGGGAGAATCTG	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.419C>A	12.37:g.133389993G>T	ENSP00000410378:p.Ser140Tyr	35.0	0.0	0		43.0	7.0	0.162791	NM_001172557	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	ENST00000450791.2	37	CCDS9281.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118729	0.37436	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.35236	1.75;1.75;1.75;1.32;1.32	5.21	5.21	0.72293	.	0.414396	0.28665	N	0.014554	T	0.36026	0.0952	L	0.43152	1.355	0.80722	D	1	P;B;P	0.45078	0.85;0.432;0.492	B;B;B	0.40534	0.246;0.246;0.332	T	0.32587	-0.9901	10	0.72032	D	0.01	.	18.3644	0.90385	0.0:0.0:1.0:0.0	.	140;140;140	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	Y	140	ENSP00000204726:S140Y;ENSP00000410378:S140Y;ENSP00000409303:S140Y;ENSP00000442143:S140Y;ENSP00000442603:S140Y	ENSP00000204726:S140Y	S	-	2	0	GOLGA3	131900066	1.000000	0.71417	0.069000	0.20011	0.265000	0.26407	8.069000	0.89491	2.414000	0.81942	0.462000	0.41574	TCT	.	.	none		0.512	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397569.2	NM_005895	
PLEKHD1	400224	hgsc.bcm.edu	37	14	69951714	69951714	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:69951714C>G	ENST00000322564.7	+	1	244	c.32C>G	c.(31-33)cCc>cGc	p.P11R		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	11										breast(1)|endometrium(1)|kidney(2)	4						TCGGTGTCGCCCTCGCCGTCC	0.682																																					p.P11R		Atlas-SNP	.											.	PLEKHD1	24	.	0			c.C32G						PASS	.						46.0	48.0	47.0					14																	69951714		692	1591	2283	SO:0001583	missense	400224	exon1			TGTCGCCCTCGCC	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.32C>G	14.37:g.69951714C>G	ENSP00000317175:p.Pro11Arg	111.0	0.0	0		74.0	13.0	0.175676	NM_001161498	B9EJC2	Missense_Mutation	SNP	ENST00000322564.7	37	CCDS53903.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.158205	0.78114	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	T	0.75917	0.3915	L	0.54323	1.7	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.74677	-0.3585	7	.	.	.	.	18.5699	0.91132	0.0:1.0:0.0:0.0	.	11	B9EJC2	.	R	11	.	.	P	+	2	0	PLEKHD1	69021467	1.000000	0.71417	1.000000	0.80357	0.512000	0.34134	7.186000	0.77722	2.387000	0.81309	0.511000	0.50034	CCC	.	.	none		0.682	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
GDA	9615	hgsc.bcm.edu	37	9	74838127	74838127	+	Missense_Mutation	SNP	G	G	A	rs142139311	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:74838127G>A	ENST00000358399.3	+	7	791	c.698G>A	c.(697-699)cGt>cAt	p.R233H	GDA_ENST00000376989.3_Intron|GDA_ENST00000545168.1_Missense_Mutation_p.R159H|GDA_ENST00000376986.1_Intron|GDA_ENST00000477618.1_3'UTR|GDA_ENST00000238018.4_Missense_Mutation_p.R233H	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	233					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GCTAAAACCCGTGATTTGCAC	0.433													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18219	0.001		0.0	False		,,,				2504	0.0				p.R233H		Atlas-SNP	.											.	GDA	113	.	0			c.G698A						PASS	.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	174.0	154.0	161.0		698,476,476,698	-1.5	0.9	9	dbSNP_134	161	0,8600		0,0,4300	no	missense,missense,missense,missense	GDA	NM_001242505.1,NM_001242506.1,NM_001242507.1,NM_004293.3	29,29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign	233/472,159/381,159/381,233/455	74838127	1,13005	2203	4300	6503	SO:0001583	missense	9615	exon7			AAACCCGTGATTT	AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.698G>A	9.37:g.74838127G>A	ENSP00000351170:p.Arg233His	100.0	0.0	0		96.0	5.0	0.0520833	NM_004293	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	ENST00000358399.3	37	CCDS6641.1	.	.	.	.	.	.	.	.	.	.	G	1.462	-0.562132	0.03939	2.27E-4	0.0	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000358399;ENST00000414671	D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65	5.58	-1.51	0.08664	Amidohydrolase 1 (1);	0.560216	0.21401	N	0.075150	T	0.66376	0.2783	N	0.00496	-1.435	0.27209	N	0.959976	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.61402	-0.7070	10	0.15066	T	0.55	-0.897	10.6755	0.45783	0.739:0.0:0.261:0.0	.	233;233	Q9Y2T3-3;Q9Y2T3	.;GUAD_HUMAN	H	159;233;233;99	ENSP00000437972:R159H;ENSP00000238018:R233H;ENSP00000351170:R233H;ENSP00000403897:R99H	ENSP00000238018:R233H	R	+	2	0	GDA	74027947	0.001000	0.12720	0.885000	0.34714	0.643000	0.38383	0.307000	0.19296	-0.524000	0.06400	-0.783000	0.03347	CGT	G|1.000;A|0.000	0.000	weak		0.433	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052633.1		
PCYOX1L	78991	hgsc.bcm.edu	37	5	148742308	148742308	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr5:148742308G>T	ENST00000274569.4	+	2	259	c.197G>T	c.(196-198)cGc>cTc	p.R66L	PCYOX1L_ENST00000514349.1_5'UTR	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	66					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGGTGGCCGCTTGGCCACC	0.612																																					p.R66L	Ovarian(62;1136 1477 27277 27495)	Atlas-SNP	.											.	PCYOX1L	32	.	0			c.G197T						PASS	.						102.0	107.0	105.0					5																	148742308		2203	4300	6503	SO:0001583	missense	78991	exon2			GTGGCCGCTTGGC		CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.197G>T	5.37:g.148742308G>T	ENSP00000274569:p.Arg66Leu	58.0	0.0	0		44.0	14.0	0.318182	NM_024028	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	ENST00000274569.4	37	CCDS4296.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532690	0.85812	.	.	ENSG00000145882	ENST00000274569	T	0.14391	2.51	5.23	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.26121	-1.0112	10	0.87932	D	0	-20.8276	16.1457	0.81563	0.0:0.1339:0.8661:0.0	.	66	Q8NBM8	PCYXL_HUMAN	L	66	ENSP00000274569:R66L	ENSP00000274569:R66L	R	+	2	0	PCYOX1L	148722501	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	7.840000	0.86819	1.321000	0.45227	0.561000	0.74099	CGC	.	.	none		0.612	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252331.2	NM_024028	
EVC2	132884	hgsc.bcm.edu	37	4	5630349	5630349	+	Missense_Mutation	SNP	C	C	T	rs145693546	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:5630349C>T	ENST00000344408.5	-	12	1876	c.1823G>A	c.(1822-1824)cGt>cAt	p.R608H	EVC2_ENST00000310917.2_Missense_Mutation_p.R528H|EVC2_ENST00000344938.1_Missense_Mutation_p.R608H	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	608					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R608H(2)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						GCCCTGCACACGGGTCTCTGA	0.507													C|||	2	0.000399361	0.0	0.0014	5008	,	,		15112	0.0		0.001	False		,,,				2504	0.0				p.R608H		Atlas-SNP	.											EVC2,NS,carcinoma,0,2	EVC2	202	2	2	Substitution - Missense(2)	lung(1)|pancreas(1)	c.G1823A						PASS	.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	117.0	107.0	110.0		1583,1823	4.0	0.9	4	dbSNP_134	110	18,8582	13.3+/-46.6	0,18,4282	yes	missense,missense	EVC2	NM_001166136.1,NM_147127.4	29,29	0,18,6485	TT,TC,CC		0.2093,0.0,0.1384	benign,benign	528/1229,608/1309	5630349	18,12988	2203	4300	6503	SO:0001583	missense	132884	exon12			TGCACACGGGTCT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1823G>A	4.37:g.5630349C>T	ENSP00000342144:p.Arg608His	68.0	0.0	0		51.0	10.0	0.196078	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	37	CCDS3382.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.35	2.806076	0.50421	0.0	0.002093	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.77229	-1.08;-1.08;-1.08	4.89	4.03	0.46877	.	0.241588	0.35555	N	0.003133	T	0.69663	0.3136	M	0.65975	2.015	0.34074	D	0.65882	P	0.38565	0.637	B	0.32211	0.142	T	0.77616	-0.2521	10	0.39692	T	0.17	-15.3919	8.6899	0.34260	0.0:0.8367:0.0:0.1633	.	608	Q86UK5	LBN_HUMAN	H	608;528;608	ENSP00000339954:R608H;ENSP00000311683:R528H;ENSP00000342144:R608H	ENSP00000311683:R528H	R	-	2	0	EVC2	5681250	0.208000	0.23494	0.945000	0.38365	0.980000	0.70556	0.324000	0.19610	2.426000	0.82243	0.484000	0.47621	CGT	C|0.998;T|0.002	0.002	strong		0.507	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
CSMD3	114788	hgsc.bcm.edu	37	8	113657379	113657379	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr8:113657379G>A	ENST00000297405.5	-	20	3513	c.3269C>T	c.(3268-3270)tCt>tTt	p.S1090F	MIR2053_ENST00000459295.1_RNA|CSMD3_ENST00000352409.3_Missense_Mutation_p.S1090F|CSMD3_ENST00000455883.2_Missense_Mutation_p.S986F|CSMD3_ENST00000343508.3_Missense_Mutation_p.S1050F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1090	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1090Y(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACAATTCAGAGAATTTGGATA	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1090F		Atlas-SNP	.											CSMD3_ENST00000343508,NS,carcinoma,0,5	CSMD3	2325	5	1	Substitution - Missense(1)	large_intestine(1)	c.C3269T						PASS	.						92.0	92.0	92.0					8																	113657379		2203	4300	6503	SO:0001583	missense	114788	exon20			TTCAGAGAATTTG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3269C>T	8.37:g.113657379G>A	ENSP00000297405:p.Ser1090Phe	90.0	0.0	0		66.0	14.0	0.212121	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979091	0.74360	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.68	5.68	0.88126	CUB (5);	0.073489	0.56097	D	0.000033	T	0.54565	0.1866	M	0.62016	1.91	0.43069	D	0.994709	B;B;D	0.67145	0.016;0.02;0.996	B;B;D	0.66602	0.026;0.044;0.945	T	0.53301	-0.8458	10	0.66056	D	0.02	.	20.1553	0.98111	0.0:0.0:1.0:0.0	.	986;1090;1050	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	F	1050;1090;430;986;1090	ENSP00000345799:S1050F;ENSP00000297405:S1090F;ENSP00000341558:S430F;ENSP00000412263:S986F;ENSP00000343124:S1090F	ENSP00000297405:S1090F	S	-	2	0	CSMD3	113726555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.677000	0.74503	2.838000	0.97847	0.591000	0.81541	TCT	.	.	none		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
RNF128	79589	hgsc.bcm.edu	37	X	105970554	105970554	+	Missense_Mutation	SNP	G	G	C	rs148223909		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:105970554G>C	ENST00000255499.2	+	1	661	c.411G>C	c.(409-411)gaG>gaC	p.E137D	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	137	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TGGCTTATGAGAGAGGGGCGT	0.602																																					p.E137D		Atlas-SNP	.											.	RNF128	74	.	0			c.G411C						PASS	.	G	,ASP/GLU	0,3835		0,0,1632,571	53.0	49.0	50.0		,411	2.4	1.0	X	dbSNP_134	50	1,6727		0,1,2427,1872	no	intron,missense	RNF128	NM_024539.3,NM_194463.1	,45	0,1,4059,2443	CC,CG,GG,G		0.0149,0.0,0.0095	,benign	,137/429	105970554	1,10562	2203	4300	6503	SO:0001583	missense	79589	exon1			TTATGAGAGAGGG	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.411G>C	X.37:g.105970554G>C	ENSP00000255499:p.Glu137Asp	197.0	0.0	0		176.0	50.0	0.284091	NM_194463	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000255499.2	37	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636379	0.29068	0.0	1.49E-4	ENSG00000133135	ENST00000255499	T	0.07444	3.19	4.29	2.37	0.29283	Protease-associated domain, PA (1);	0.762462	0.12450	N	0.467829	T	0.04770	0.0129	N	0.16368	0.405	0.32627	N	0.522588	B	0.02656	0.0	B	0.08055	0.003	T	0.28522	-1.0041	10	0.22706	T	0.39	.	5.6553	0.17639	0.123:0.1989:0.6781:0.0	.	137	Q8TEB7	RN128_HUMAN	D	137	ENSP00000255499:E137D	ENSP00000255499:E137D	E	+	3	2	RNF128	105857210	1.000000	0.71417	0.999000	0.59377	0.855000	0.48748	0.891000	0.28309	0.771000	0.33359	0.600000	0.82982	GAG	G|1.000;C|0.000	0.000	weak		0.602	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
GDF3	9573	hgsc.bcm.edu	37	12	7848214	7848214	+	Silent	SNP	C	C	T	rs376751766		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:7848214C>T	ENST00000329913.3	-	1	158	c.111G>A	c.(109-111)aaG>aaA	p.K37K		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	37					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GTGAAGGCGCCTTATCTAAGC	0.478																																					p.K37K		Atlas-SNP	.											.	GDF3	68	.	0			c.G111A						PASS	.	C		0,4406		0,0,2203	47.0	48.0	48.0		111	-1.4	0.0	12		48	1,8599		0,1,4299	no	coding-synonymous	GDF3	NM_020634.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		37/365	7848214	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9573	exon1			AGGCGCCTTATCT	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.111G>A	12.37:g.7848214C>T		119.0	0.0	0		82.0	13.0	0.158537	NM_020634	Q8NEJ4	Silent	SNP	ENST00000329913.3	37	CCDS8581.1																																																																																			.	.	weak		0.478	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399717.1		
BTG1	694	hgsc.bcm.edu	37	12	92539200	92539200	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:92539200G>A	ENST00000256015.3	-	1	473	c.112C>T	c.(112-114)Cag>Tag	p.Q38*	RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000546975.1_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	38					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.Q38E(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGAAGGTCTGCAGCTGTCGC	0.682			T	MYC	BCLL																																p.Q38X		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	BTG1,NS,lymphoid_neoplasm,0,1	BTG1	30	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C112T						scavenged	.						37.0	40.0	39.0					12																	92539200		2203	4300	6503	SO:0001587	stop_gained	694	exon1			AGGTCTGCAGCTG		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.112C>T	12.37:g.92539200G>A	ENSP00000256015:p.Gln38*	123.0	1.0	0.00813008		85.0	12.0	0.141176	NM_001731	P31607	Nonsense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	G	39	7.775086	0.98483	.	.	ENSG00000133639	ENST00000256015	.	.	.	3.92	1.83	0.25207	.	0.185973	0.48286	D	0.000200	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-3.618	9.7333	0.40374	0.0:0.1525:0.6897:0.1579	.	.	.	.	X	38	.	ENSP00000256015:Q38X	Q	-	1	0	BTG1	91063331	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.272000	0.89885	0.765000	0.33221	0.455000	0.32223	CAG	.	.	none		0.682	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
STK11	6794	hgsc.bcm.edu	37	19	1220490	1220490	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:1220490C>T	ENST00000326873.7	+	4	1756	c.583C>T	c.(583-585)Ctg>Ttg	p.L195L		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(3)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		AATCTCCGACCTGGGCGTGGC	0.687		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.L195L		Atlas-SNP	.	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	STK11,NS,carcinoma,0,1	STK11	410	1	27	Whole gene deletion(20)|Deletion - Frameshift(4)|Unknown(3)	cervix(14)|lung(9)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.C583T						PASS	.						35.0	40.0	38.0					19																	1220490		2011	4156	6167	SO:0001819	synonymous_variant	6794	exon4	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	TCCGACCTGGGCG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.583C>T	19.37:g.1220490C>T		66.0	0.0	0		68.0	10.0	0.147059	NM_000455	B2RBX7|E7EW76	Silent	SNP	ENST00000326873.7	37	CCDS45896.1																																																																																			.	.	none		0.687	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
AKAP11	11215	hgsc.bcm.edu	37	13	42877901	42877901	+	Silent	SNP	C	C	T	rs201525107	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:42877901C>T	ENST00000025301.2	+	8	5194	c.5019C>T	c.(5017-5019)gcC>gcT	p.A1673A		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1673					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GCCTGGCAGCCGACAGTGGGA	0.507													C|||	3	0.000599042	0.0	0.0	5008	,	,		18914	0.003		0.0	False		,,,				2504	0.0				p.A1673A		Atlas-SNP	.											.	AKAP11	146	.	0			c.C5019T						PASS	.						37.0	35.0	36.0					13																	42877901		2203	4300	6503	SO:0001819	synonymous_variant	11215	exon8			GGCAGCCGACAGT	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5019C>T	13.37:g.42877901C>T		110.0	0.0	0		96.0	24.0	0.25	NM_016248	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	37	CCDS9383.1																																																																																			C|1.000;T|0.000	0.000	strong		0.507	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
CD79B	974	hgsc.bcm.edu	37	17	62006798	62006798	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr17:62006798T>A	ENST00000006750.3	-	5	679	c.587A>T	c.(586-588)tAc>tTc	p.Y196F	CD79B_ENST00000392795.3_Missense_Mutation_p.Y197F|CD79B_ENST00000349817.2_Missense_Mutation_p.Y92F	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	196	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.Y196C(1)|p.Y196F(1)|p.Y196S(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						CCTTACCTCGTAGGTGTGATC	0.632			"""Mis, O"""		DLBCL																																p.Y197F		Atlas-SNP	.		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	CD79B,NS,lymphoid_neoplasm,-1,13	CD79B	38	13	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.A590T						PASS	.						93.0	74.0	81.0					17																	62006798		2203	4300	6503	SO:0001583	missense	974	exon5			ACCTCGTAGGTGT	L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.587A>T	17.37:g.62006798T>A	ENSP00000006750:p.Tyr196Phe	71.0	0.0	0		50.0	21.0	0.42	NM_001039933	Q53FS2|Q9BU06	Missense_Mutation	SNP	ENST00000006750.3	37	CCDS11655.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.930227	0.52866	.	.	ENSG00000007312	ENST00000349817;ENST00000392795;ENST00000006750	D;D;D	0.96587	-4.06;-4.06;-4.06	4.2	4.2	0.49525	.	0.000000	0.64402	D	0.000002	D	0.95601	0.8570	N	0.24115	0.695	0.43426	D	0.995588	D;D	0.76494	0.996;0.999	D;D	0.85130	0.986;0.997	D	0.95387	0.8478	10	0.87932	D	0	-12.4743	9.5968	0.39578	0.0:0.0:0.0:1.0	.	92;196	P40259-2;P40259	.;CD79B_HUMAN	F	92;197;196	ENSP00000245862:Y92F;ENSP00000376544:Y197F;ENSP00000006750:Y196F	ENSP00000006750:Y196F	Y	-	2	0	CD79B	59360530	0.997000	0.39634	0.977000	0.42913	0.245000	0.25701	3.902000	0.56310	1.782000	0.52362	0.358000	0.22013	TAC	.	.	none		0.632	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417711.1		
CUX1	1523	hgsc.bcm.edu	37	7	101892121	101892121	+	Silent	SNP	G	G	A	rs410825	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr7:101892121G>A	ENST00000292535.7	+	24	4355	c.4317G>A	c.(4315-4317)ccG>ccA	p.P1439P	CUX1_ENST00000547394.2_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000360264.3_Silent_p.P1450P|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000549414.2_Silent_p.P1417P|CUX1_ENST00000550008.2_Silent_p.P1383P|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.P1281P|CUX1_ENST00000546411.2_Silent_p.P1337P|CUX1_ENST00000292538.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	1439					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GCTCCGCGCCGCCGCCCAGCA	0.831													G|||	2727	0.544529	0.3147	0.5	5008	,	,		1201	0.9097		0.4901	False		,,,				2504	0.5665				p.P1450P		Atlas-SNP	.											.	CUX1	253	.	0			c.G4350A						PASS	.						1.0	1.0	1.0					7																	101892121		593	1623	2216	SO:0001819	synonymous_variant	1523	exon24			CGCGCCGCCGCCC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.4317G>A	7.37:g.101892121G>A		0.0	0.0	.		5.0	5.0	1	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	ENST00000292535.7	37	CCDS5721.1																																																																																			G|0.460;A|0.540	0.540	strong		0.831	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
SALL1	6299	hgsc.bcm.edu	37	16	51175655	51175655	+	Missense_Mutation	SNP	C	C	T	rs113614842|rs199760974	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr16:51175655C>T	ENST00000251020.4	-	2	511	c.478G>A	c.(478-480)Ggc>Agc	p.G160S	SALL1_ENST00000440970.1_Missense_Mutation_p.G63S|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	160	Poly-Gly.				adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ccgccgccgccgctgctgctg	0.632													c|||	53	0.0105831	0.0234	0.0014	5008	,	,		12568	0.0		0.0	False		,,,				2504	0.0215				p.G160S	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.G478A						PASS	.						24.0	26.0	25.0					16																	51175655		2196	4299	6495	SO:0001583	missense	6299	exon2			CGCCGCCGCTGCT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.478G>A	16.37:g.51175655C>T	ENSP00000251020:p.Gly160Ser	83.0	0.0	0		43.0	8.0	0.186047	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.627404	0.00007	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06849	3.36;3.25	0.817	-1.63	0.08345	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.44003	-0.9356	9	0.02654	T	1	.	4.4659	0.11689	0.0:0.5444:0.0:0.4556	.	160	Q9NSC2	SALL1_HUMAN	S	160;63;124	ENSP00000251020:G160S;ENSP00000407914:G63S	ENSP00000251020:G160S	G	-	1	0	SALL1	49733156	1.000000	0.71417	0.002000	0.10522	0.010000	0.07245	1.889000	0.39718	-0.863000	0.04084	-1.054000	0.02325	GGC	.	.	weak		0.632	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
CCDC81	60494	hgsc.bcm.edu	37	11	86131001	86131001	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr11:86131001C>T	ENST00000445632.2	+	14	1995	c.1723C>T	c.(1723-1725)Cga>Tga	p.R575*	CCDC81_ENST00000278487.3_Nonsense_Mutation_p.R310*|CCDC81_ENST00000528728.1_Nonsense_Mutation_p.R310*|CCDC81_ENST00000354755.1_Nonsense_Mutation_p.R485*	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	575										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				TGAGCTGGAGCGAGTAAATAG	0.507																																					p.R575X		Atlas-SNP	.											.	CCDC81	89	.	0			c.C1723T						PASS	.						87.0	75.0	79.0					11																	86131001		2202	4299	6501	SO:0001587	stop_gained	60494	exon14			CTGGAGCGAGTAA	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1723C>T	11.37:g.86131001C>T	ENSP00000415528:p.Arg575*	72.0	0.0	0		74.0	16.0	0.216216	NM_001156474	A0AVL7|Q53FW3|Q9H5E5	Nonsense_Mutation	SNP	ENST00000445632.2	37	CCDS53691.1	.	.	.	.	.	.	.	.	.	.	C	44	10.710250	0.99454	.	.	ENSG00000149201	ENST00000354755;ENST00000278487;ENST00000445632;ENST00000528728	.	.	.	5.16	1.89	0.25635	.	0.306262	0.25236	N	0.032136	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.9965	10.4293	0.44398	0.5496:0.4504:0.0:0.0	.	.	.	.	X	485;310;575;310	.	.	R	+	1	2	CCDC81	85808649	0.100000	0.21855	0.007000	0.13788	0.208000	0.24298	0.133000	0.15912	0.683000	0.31428	0.555000	0.69702	CGA	.	.	none		0.507	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393756.1	NM_021827	
SLC16A1	6566	hgsc.bcm.edu	37	1	113460019	113460019	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:113460019C>T	ENST00000538576.1	-	4	1840	c.1009G>A	c.(1009-1011)Gtt>Att	p.V337I	SLC16A1_ENST00000433570.4_Missense_Mutation_p.V337I|SLC16A1_ENST00000369626.3_Missense_Mutation_p.V337I	NM_001166496.1	NP_001159968.1	P53985	MOT1_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 1	337					behavioral response to nutrient (GO:0051780)|blood coagulation (GO:0007596)|cellular metabolic process (GO:0044237)|cellular response to organic cyclic compound (GO:0071407)|centrosome organization (GO:0051297)|glucose homeostasis (GO:0042593)|leukocyte migration (GO:0050900)|lipid metabolic process (GO:0006629)|mevalonate transport (GO:0015728)|monocarboxylic acid transport (GO:0015718)|plasma membrane lactate transport (GO:0035879)|pyruvate metabolic process (GO:0006090)|regulation of insulin secretion (GO:0050796)|response to food (GO:0032094)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	mevalonate transmembrane transporter activity (GO:0015130)|monocarboxylic acid transmembrane transporter activity (GO:0008028)|organic cyclic compound binding (GO:0097159)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|urinary_tract(1)	20	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Acetic acid(DB03166)|Aminohippurate(DB00345)|Ampicillin(DB00415)|Foscarnet(DB00529)|Gamma Hydroxybutyric Acid(DB01440)|Methotrexate(DB00563)|Nateglinide(DB00731)|Niacin(DB00627)|Niflumic Acid(DB04552)|Pravastatin(DB00175)|Probenecid(DB01032)|Pyruvic acid(DB00119)|Salicylic acid(DB00936)|Valproic Acid(DB00313)	TTTGCAACAACGGAAGCCGCA	0.458																																					p.V337I		Atlas-SNP	.											.	SLC16A1	61	.	0			c.G1009A						PASS	.						64.0	52.0	56.0					1																	113460019		2203	4300	6503	SO:0001583	missense	6566	exon4			CAACAACGGAAGC	BC026317	CCDS858.1	1p12	2013-07-18	2013-07-18		ENSG00000155380	ENSG00000155380		"""Solute carriers"""	10922	protein-coding gene	gene with protein product		600682	"""solute carrier family 16 (monocarboxylic acid transporters), member 1"", ""solute carrier family 16, member 1 (monocarboxylic acid transporter 1)"""			8124722, 7835905	Standard	NM_003051		Approved	MCT, MCT1	uc001ecy.3	P53985	OTTHUMG00000012129	ENST00000538576.1:c.1009G>A	1.37:g.113460019C>T	ENSP00000441065:p.Val337Ile	162.0	0.0	0		113.0	30.0	0.265487	NM_001166496	Q49A45|Q5T8R6|Q9NSJ9	Missense_Mutation	SNP	ENST00000538576.1	37	CCDS858.1	.	.	.	.	.	.	.	.	.	.	C	0.510	-0.867034	0.02590	.	.	ENSG00000155380	ENST00000369626;ENST00000538576;ENST00000458229;ENST00000433570	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.56	-8.41	0.00961	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.434923	0.25001	N	0.033909	T	0.10380	0.0254	N	0.05199	-0.095	0.09310	N	1	B;B	0.21147	0.052;0.006	B;B	0.24006	0.05;0.03	T	0.15925	-1.0420	10	0.10902	T	0.67	.	20.5631	0.99335	0.0:0.7483:0.0:0.2517	.	337;337	Q49A45;P53985	.;MOT1_HUMAN	I	337	ENSP00000358640:V337I;ENSP00000441065:V337I;ENSP00000416167:V337I;ENSP00000445061:V337I	ENSP00000358640:V337I	V	-	1	0	SLC16A1	113261542	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.393000	0.07305	-1.666000	0.01475	-1.166000	0.01754	GTT	.	.	none		0.458	SLC16A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033539.1	NM_003051	
NR0B1	190	hgsc.bcm.edu	37	X	30327153	30327153	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:30327153C>T	ENST00000378970.4	-	1	562	c.328G>A	c.(328-330)Ggc>Agc	p.G110S	NR0B1_ENST00000378963.1_5'Flank|NR0B1_ENST00000453287.1_Missense_Mutation_p.G110S	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	110	4 X 67 AA tandem repeats.				adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	GGATCAGAGCCGCACGAACAG	0.692											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G110S		Atlas-SNP	.											.	NR0B1	61	.	0			c.G328A						PASS	.						22.0	25.0	24.0					X																	30327153		2197	4287	6484	SO:0001583	missense	190	exon1			CAGAGCCGCACGA	S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.328G>A	X.37:g.30327153C>T	ENSP00000368253:p.Gly110Ser	134.0	0.0	0	816	141.0	10.0	0.070922	NM_000475	Q96F69	Missense_Mutation	SNP	ENST00000378970.4	37	CCDS14223.1	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612239	0.28712	.	.	ENSG00000169297	ENST00000378970;ENST00000453287	D;D	0.97404	-3.49;-4.37	4.42	3.54	0.40534	.	0.173259	0.28109	N	0.016578	D	0.94660	0.8278	L	0.55743	1.74	0.31729	N	0.637317	P	0.46621	0.881	B	0.41860	0.368	D	0.93333	0.6703	10	0.46703	T	0.11	-9.6228	9.3873	0.38352	0.0:0.8933:0.0:0.1067	.	110	P51843	NR0B1_HUMAN	S	110	ENSP00000368253:G110S;ENSP00000396403:G110S	ENSP00000368253:G110S	G	-	1	0	NR0B1	30237074	0.999000	0.42202	0.832000	0.32986	0.238000	0.25445	1.241000	0.32743	0.957000	0.37930	0.513000	0.50165	GGC	.	.	none		0.692	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056161.1	NM_000475	
HTT	3064	hgsc.bcm.edu	37	4	3184180	3184180	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr4:3184180A>G	ENST00000355072.5	+	37	4994	c.4849A>G	c.(4849-4851)Atg>Gtg	p.M1617V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1617					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CATCCTCCCAATGTTAGCCAA	0.502																																					p.M1617V		Atlas-SNP	.											.	HTT	221	.	0			c.A4849G						PASS	.						135.0	137.0	137.0					4																	3184180		2052	4201	6253	SO:0001583	missense	3064	exon37			CTCCCAATGTTAG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.4849A>G	4.37:g.3184180A>G	ENSP00000347184:p.Met1617Val	88.0	0.0	0		51.0	16.0	0.313726	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	A	13.10	2.136143	0.37728	.	.	ENSG00000197386	ENST00000355072	T	0.05139	3.49	4.98	3.81	0.43845	.	0.000000	0.85682	D	0.000000	T	0.06554	0.0168	L	0.60455	1.87	0.48185	D	0.9996	P	0.35328	0.495	B	0.23852	0.049	T	0.27773	-1.0064	10	0.42905	T	0.14	.	9.3075	0.37885	0.9186:0.0:0.0814:0.0	.	1617	P42858	HD_HUMAN	V	1617	ENSP00000347184:M1617V	ENSP00000347184:M1617V	M	+	1	0	HTT	3153978	1.000000	0.71417	0.796000	0.32109	0.774000	0.43823	6.119000	0.71590	0.931000	0.37242	-0.379000	0.06801	ATG	.	.	none		0.502	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
PLXNB3	5365	hgsc.bcm.edu	37	X	153039489	153039489	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:153039489C>T	ENST00000361971.5	+	20	3569	c.3455C>T	c.(3454-3456)cCc>cTc	p.P1152L	SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538966.1_Missense_Mutation_p.P1175L|PLXNB3_ENST00000538282.1_Missense_Mutation_p.P762L|PLXNB3_ENST00000538776.1_Missense_Mutation_p.P805L	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1152					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCCTGGCACCCCTCAGCCGC	0.692																																					p.P1175L		Atlas-SNP	.											.	PLXNB3	208	.	0			c.C3524T						PASS	.						16.0	17.0	17.0					X																	153039489		2174	4240	6414	SO:0001583	missense	5365	exon21			TGGCACCCCTCAG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3455C>T	X.37:g.153039489C>T	ENSP00000355378:p.Pro1152Leu	58.0	0.0	0		50.0	10.0	0.2	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539525	0.45176	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.69435	5.19;5.16;4.57;-0.4	5.14	5.14	0.70334	.	0.117279	0.56097	D	0.000021	T	0.67581	0.2908	M	0.71036	2.16	0.36580	D	0.873501	B;P;P	0.45768	0.409;0.866;0.668	B;P;B	0.44811	0.168;0.461;0.318	T	0.75755	-0.3206	10	0.46703	T	0.11	.	10.9628	0.47395	0.0:0.8153:0.1847:0.0	.	805;1175;1152	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	L	1175;1152;805;762	ENSP00000442736:P1175L;ENSP00000355378:P1152L;ENSP00000445569:P805L;ENSP00000441919:P762L	ENSP00000355378:P1152L	P	+	2	0	PLXNB3	152692683	0.722000	0.28017	0.054000	0.19295	0.555000	0.35460	1.617000	0.36943	2.125000	0.65367	0.529000	0.55759	CCC	.	.	none		0.692	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
NOTUM	147111	hgsc.bcm.edu	37	17	79912130	79912130	+	Splice_Site	SNP	A	A	G			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr17:79912130A>G	ENST00000409678.3	-	10	1568		c.e10+1			NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)							extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			AGGGACACTGACCTCCGGATG	0.607																																					.		Atlas-SNP	.											.	NOTUM	50	.	0			c.1184+2T>C						PASS	.						80.0	70.0	73.0					17																	79912130		2203	4300	6503	SO:0001630	splice_region_variant	147111	exon11			ACACTGACCTCCG	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.1184+1T>C	17.37:g.79912130A>G		93.0	0.0	0		84.0	5.0	0.0595238	NM_178493	Q8N410|Q8NI82	Splice_Site	SNP	ENST00000409678.3	37	CCDS32771.2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.302227	0.81136	.	.	ENSG00000185269	ENST00000409678	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3587	0.66754	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTUM	77505420	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.222000	0.89777	1.985000	0.57927	0.533000	0.62120	.	.	.	none		0.607	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335123.2	NM_178493	Intron
ISCU	23479	hgsc.bcm.edu	37	12	108956417	108956417	+	Missense_Mutation	SNP	T	T	G	rs67681514|rs10778647	byFrequency	TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:108956417T>G	ENST00000311893.9	+	1	41	c.19T>G	c.(19-21)Ttc>Gtc	p.F7V	SART3_ENST00000546611.1_5'Flank|ISCU_ENST00000338291.4_5'UTR|ISCU_ENST00000431221.2_Missense_Mutation_p.F7V|ISCU_ENST00000547005.1_Missense_Mutation_p.F7V|ISCU_ENST00000539593.1_Missense_Mutation_p.F7V|SART3_ENST00000431469.2_5'Flank|SART3_ENST00000228284.3_5'Flank|ISCU_ENST00000535729.1_Missense_Mutation_p.F7V|SART3_ENST00000552221.1_5'Flank|ISCU_ENST00000392807.4_5'UTR	NM_213595.2	NP_998760.1	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme	7				F -> G (in Ref. 1; AAG37428 and 3; AAH11906). {ECO:0000305}.	iron-sulfur cluster assembly (GO:0016226)|nitrogen fixation (GO:0009399)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|iron-sulfur cluster binding (GO:0051536)|protein complex scaffold (GO:0032947)			kidney(2)|large_intestine(2)|lung(4)|prostate(2)|urinary_tract(1)	11						GGCTGGGGCTTTCCGTCTGAG	0.746													G|||	4477	0.89397	0.8396	0.8775	5008	,	,		9082	0.9544		0.8678	False		,,,				2504	0.9438				p.F7V		Atlas-SNP	.											.	ISCU	19	.	0			c.T19G						PASS	.						2.0	3.0	3.0					12																	108956417		1074	2745	3819	SO:0001583	missense	23479	exon1			GGGGCTTTCCGTC	U47101	CCDS9118.1, CCDS44966.1, CCDS73518.1	12q24.1	2013-08-05	2013-08-05	2006-10-24	ENSG00000136003	ENSG00000136003			29882	protein-coding gene	gene with protein product		611911	"""NifU-like N-terminal domain containing"", ""IscU iron-sulfur cluster scaffold homolog (E. coli)"", ""iron-sulfur cluster scaffold homolog (E. coli)"""	NIFUN		8875867, 11060020	Standard	XM_005268760		Approved	ISU2, hnifU, IscU	uc010sxc.2	Q9H1K1	OTTHUMG00000168420	ENST00000311893.9:c.19T>G	12.37:g.108956417T>G	ENSP00000310623:p.Phe7Val	0.0	0.0	.		6.0	6.0	1	NM_213595	Q6P713|Q99617|Q9H1K2	Missense_Mutation	SNP	ENST00000311893.9	37	CCDS44966.1	1931	0.8841575091575091	428	0.8699186991869918	313	0.8646408839779005	539	0.9423076923076923	651	0.8588390501319261	G	10.60	1.395545	0.25205	.	.	ENSG00000136003	ENST00000535729;ENST00000431221;ENST00000547005;ENST00000311893;ENST00000539593	T;T;T;T;T	0.62364	0.03;0.05;0.03;0.07;0.06	4.95	4.95	0.65309	.	0.282027	0.39341	N	0.001397	T	0.00012	0.0000	N	0.08118	0	0.09310	P	0.9999999999944561	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.33240	-0.9876	9	0.17369	T	0.5	.	11.0295	0.47763	0.0:0.0:0.8142:0.1858	rs10778647;rs59554812	7;7;7;7	B3KQ30;Q9H1K1;B4DNC9;F5H5N2	.;ISCU_HUMAN;.;.	V	7	ENSP00000445598:F7V;ENSP00000411108:F7V;ENSP00000446606:F7V;ENSP00000310623:F7V;ENSP00000443272:F7V	ENSP00000310623:F7V	F	+	1	0	ISCU	107480547	0.093000	0.21703	0.631000	0.29282	0.038000	0.13279	2.348000	0.44045	1.467000	0.48044	-0.121000	0.15023	TTC	GG|0.500;TT|0.500	.	alt		0.746	ISCU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399693.1	NM_014301	
USP4	7375	hgsc.bcm.edu	37	3	49362425	49362425	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:49362425G>C	ENST00000265560.4	-	5	581	c.535C>G	c.(535-537)Cgt>Ggt	p.R179G	USP4_ENST00000351842.4_Missense_Mutation_p.R179G|USP4_ENST00000416417.1_Missense_Mutation_p.R179G|USP4_ENST00000415188.1_Missense_Mutation_p.R179G	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	179	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CGTGTTTCACGCTCCGCAGGG	0.502																																					p.R179G		Atlas-SNP	.											USP4,mouth,carcinoma,+1,1	USP4	72	1	0			c.C535G						PASS	.						182.0	180.0	181.0					3																	49362425		2203	4300	6503	SO:0001583	missense	7375	exon5			TTTCACGCTCCGC	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.535C>G	3.37:g.49362425G>C	ENSP00000265560:p.Arg179Gly	87.0	0.0	0		102.0	10.0	0.0980392	NM_199443	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	ENST00000265560.4	37	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997823	0.54147	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.32023	1.98;2.1;1.47	5.51	2.33	0.28932	.	0.100082	0.64402	N	0.000006	T	0.26268	0.0641	L	0.41824	1.3	0.32078	N	0.593569	P;B	0.39624	0.681;0.372	B;B	0.38755	0.281;0.095	T	0.38457	-0.9660	10	0.72032	D	0.01	-9.6545	12.7177	0.57123	0.0:0.0:0.3137:0.6863	.	179;179	Q13107-2;Q13107	.;UBP4_HUMAN	G	179	ENSP00000341028:R179G;ENSP00000265560:R179G;ENSP00000400623:R179G	ENSP00000265560:R179G	R	-	1	0	USP4	49337429	1.000000	0.71417	0.005000	0.12908	0.963000	0.63663	4.711000	0.61881	0.644000	0.30656	0.491000	0.48974	CGT	.	.	none		0.502	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
AIM1L	55057	hgsc.bcm.edu	37	1	26655287	26655287	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr1:26655287C>T	ENST00000308182.5	-	15	1686	c.1257G>A	c.(1255-1257)gtG>gtA	p.V419V	AIM1L_ENST00000527815.1_Silent_p.V590V			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like	419	Beta/gamma crystallin 'Greek key' 9. {ECO:0000255|PROSITE-ProRule:PRU00028}.						carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GCAGGCTCCGCACCTCCCTGC	0.602																																					p.V1464V		Atlas-SNP	.											.	AIM1L	98	.	0			c.G4392A						PASS	.						144.0	122.0	129.0					1																	26655287		2203	4300	6503	SO:0001819	synonymous_variant	55057	exon16			GCTCCGCACCTCC			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.1257G>A	1.37:g.26655287C>T		61.0	0.0	0		47.0	12.0	0.255319	NM_001039775	B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	37																																																																																				.	.	none		0.602	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
RNF10	9921	hgsc.bcm.edu	37	12	121014414	121014414	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr12:121014414G>C	ENST00000325954.4	+	17	2842	c.2381G>C	c.(2380-2382)aGa>aCa	p.R794T	POP5_ENST00000542776.1_5'Flank|RNF10_ENST00000542701.1_3'UTR|RNF10_ENST00000413266.2_Missense_Mutation_p.R799T	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	794					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ggaaagaaaagaaaaaaacag	0.443																																					p.R794T		Atlas-SNP	.											.	RNF10	75	.	0			c.G2381C						PASS	.						84.0	80.0	81.0					12																	121014414		2203	4300	6503	SO:0001583	missense	9921	exon17			AGAAAAGAAAAAA	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.2381G>C	12.37:g.121014414G>C	ENSP00000322242:p.Arg794Thr	113.0	0.0	0		77.0	14.0	0.181818	NM_014868	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.368859	0.61624	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000538254	D;D	0.89415	-2.51;-2.51	6.09	6.09	0.99107	.	0.204155	0.51477	D	0.000100	D	0.82554	0.5062	L	0.36672	1.1	0.50813	D	0.999892	B;P	0.48764	0.277;0.915	B;B	0.36922	0.068;0.236	D	0.84750	0.0756	10	0.72032	D	0.01	.	12.9234	0.58245	0.0733:0.0:0.9267:0.0	.	799;794	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	T	794;794;799;129	ENSP00000322242:R794T;ENSP00000415682:R799T	ENSP00000322242:R794T	R	+	2	0	RNF10	119498797	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.030000	0.64128	2.899000	0.99337	0.655000	0.94253	AGA	.	.	none		0.443	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
FBP2	8789	hgsc.bcm.edu	37	9	97321395	97321395	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr9:97321395C>T	ENST00000375337.3	-	7	911	c.845G>A	c.(844-846)tGc>tAc	p.C282Y	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	282					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				CACGGGATTGCATTCATACAG	0.597																																					p.C282Y		Atlas-SNP	.											.	FBP2	26	.	0			c.G845A						PASS	.						56.0	53.0	54.0					9																	97321395		2203	4300	6503	SO:0001583	missense	8789	exon7			GGATTGCATTCAT	Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.845G>A	9.37:g.97321395C>T	ENSP00000364486:p.Cys282Tyr	62.0	0.0	0		62.0	6.0	0.0967742	NM_003837	Q17R39|Q6FI53	Missense_Mutation	SNP	ENST00000375337.3	37	CCDS6711.1	.	.	.	.	.	.	.	.	.	.	.	25.5	4.645909	0.87958	.	.	ENSG00000130957	ENST00000375337	T	0.73152	-0.72	5.43	5.43	0.79202	.	0.045824	0.85682	D	0.000000	D	0.88786	0.6531	H	0.94734	3.575	0.80722	D	1	D	0.64830	0.994	D	0.69479	0.964	D	0.91262	0.5037	10	0.87932	D	0	0.263	19.4276	0.94749	0.0:1.0:0.0:0.0	.	282	O00757	F16P2_HUMAN	Y	282	ENSP00000364486:C282Y	ENSP00000364486:C282Y	C	-	2	0	FBP2	96361216	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.327000	0.79147	2.813000	0.96785	0.655000	0.94253	TGC	.	.	none		0.597	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053189.1	NM_003837	
DCT	1638	hgsc.bcm.edu	37	13	95092324	95092324	+	Missense_Mutation	SNP	A	A	G	rs138244474		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:95092324A>G	ENST00000377028.5	-	8	1801	c.1388T>C	c.(1387-1389)gTt>gCt	p.V463A	DCT_ENST00000446125.1_Missense_Mutation_p.V496A	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	463					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AGTTTCTTCAACTGAAACTAA	0.428																																					p.V496A		Atlas-SNP	.											DCT_ENST00000446125,colon,carcinoma,0,2	DCT	186	2	0			c.T1487C						scavenged	.	A	ALA/VAL,ALA/VAL	0,4406		0,0,2203	56.0	56.0	56.0		1487,1388	-0.7	0.8	13	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DCT	NM_001129889.1,NM_001922.3	64,64	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign,benign	496/553,463/520	95092324	1,13005	2203	4300	6503	SO:0001583	missense	1638	exon10			TCTTCAACTGAAA	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1388T>C	13.37:g.95092324A>G	ENSP00000366227:p.Val463Ala	121.0	1.0	0.00826446		92.0	12.0	0.130435	NM_001129889	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.082364	0.00371	0.0	1.16E-4	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.99023	-5.32;-5.34	4.7	-0.737	0.11129	.	0.914482	0.09445	N	0.801161	D	0.95262	0.8463	L	0.29908	0.895	0.19300	N	0.999973	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	D	0.89694	0.3900	10	0.09590	T	0.72	-2.0498	4.6745	0.12705	0.6146:0.0:0.2503:0.1351	.	496;463	Q09GT4;P40126	.;TYRP2_HUMAN	A	463;496	ENSP00000366227:V463A;ENSP00000392762:V496A	ENSP00000366227:V463A	V	-	2	0	DCT	93890325	0.000000	0.05858	0.758000	0.31321	0.085000	0.17905	-0.583000	0.05807	-0.035000	0.13691	0.460000	0.39030	GTT	A|1.000;G|0.000	0.000	weak		0.428	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3		
ZNF503	84858	hgsc.bcm.edu	37	10	77158962	77158962	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr10:77158962C>T	ENST00000372524.4	-	2	1972	c.1486G>A	c.(1486-1488)Gcc>Acc	p.A496T	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503_ENST00000535216.1_Missense_Mutation_p.A496T|ZNF503-AS2_ENST00000466942.2_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	496					G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					GGGTGGCCGGCCAGGGAGGGC	0.687																																					p.A496T		Atlas-SNP	.											.	ZNF503	25	.	0			c.G1486A						PASS	.						14.0	16.0	15.0					10																	77158962		2197	4291	6488	SO:0001583	missense	84858	exon2			GGCCGGCCAGGGA	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1486G>A	10.37:g.77158962C>T	ENSP00000361602:p.Ala496Thr	21.0	0.0	0		21.0	10.0	0.47619	NM_032772	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	C	9.686	1.150705	0.21371	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	T;T	0.49720	0.77;0.77	4.04	4.04	0.47022	.	0.331694	0.32918	N	0.005493	T	0.31263	0.0791	N	0.24115	0.695	0.35873	D	0.828373	B	0.18863	0.031	B	0.13407	0.009	T	0.29822	-0.9999	10	0.19590	T	0.45	-16.1824	11.987	0.53153	0.0:0.8248:0.1752:0.0	.	496	Q96F45	ZN503_HUMAN	T	496;496;459	ENSP00000361602:A496T;ENSP00000438988:A496T	ENSP00000361594:A459T	A	-	1	0	ZNF503	76828968	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.688000	0.25422	2.084000	0.62774	0.551000	0.68910	GCC	.	.	none		0.687	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
DAZAP1	26528	hgsc.bcm.edu	37	19	1434903	1434903	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:1434903C>T	ENST00000233078.4	+	12	1377	c.1216C>T	c.(1216-1218)Cga>Tga	p.R406*	DAZAP1_ENST00000336761.6_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	406					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCACCCCTACCGACGCTAGCC	0.672																																					p.R406X		Atlas-SNP	.											.	DAZAP1	52	.	0			c.C1216T						PASS	.						9.0	10.0	10.0					19																	1434903		2140	4189	6329	SO:0001587	stop_gained	26528	exon12			CCCTACCGACGCT		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1216C>T	19.37:g.1434903C>T	ENSP00000233078:p.Arg406*	49.0	0.0	0		47.0	19.0	0.404255	NM_018959	Q96MJ3|Q9NRR9	Nonsense_Mutation	SNP	ENST00000233078.4	37	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	C	38	6.709031	0.97780	.	.	ENSG00000071626	ENST00000233078	.	.	.	5.26	3.02	0.34903	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8945	0.58091	0.4422:0.5578:0.0:0.0	.	.	.	.	X	406	.	ENSP00000233078:R406X	R	+	1	2	DAZAP1	1385903	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.926000	0.40084	1.186000	0.42985	0.561000	0.74099	CGA	.	.	none		0.672	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
PSG8	440533	hgsc.bcm.edu	37	19	43268286	43268286	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr19:43268286T>C	ENST00000306511.4	-	2	309	c.212A>G	c.(211-213)cAa>cGa	p.Q71R	PSG8_ENST00000404209.4_Missense_Mutation_p.Q71R|PSG8_ENST00000401467.2_Missense_Mutation_p.Q71R|PSG8_ENST00000406636.3_Intron	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	71	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GTCCCTGATTTGCCCTTTGTA	0.413																																					p.Q71R		Atlas-SNP	.											.	PSG8	101	.	0			c.A212G						PASS	.						174.0	186.0	182.0					19																	43268286		2203	4292	6495	SO:0001583	missense	440533	exon2			CTGATTTGCCCTT	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.212A>G	19.37:g.43268286T>C	ENSP00000305005:p.Gln71Arg	194.0	0.0	0		155.0	18.0	0.116129	NM_001130167	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	ENST00000306511.4	37	CCDS33037.1	.	.	.	.	.	.	.	.	.	.	t	5.359	0.251452	0.10130	.	.	ENSG00000124467	ENST00000404209;ENST00000401467;ENST00000407488;ENST00000306511	T;T;T	0.01484	4.84;4.84;4.84	1.35	0.162	0.14981	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03434	0.0099	M	0.80422	2.495	0.09310	N	1	B;B;P;B;B	0.39044	0.003;0.001;0.656;0.002;0.003	B;B;B;B;B	0.40982	0.008;0.01;0.345;0.005;0.008	T	0.29610	-1.0006	9	0.52906	T	0.07	.	4.2604	0.10739	0.0:0.0:0.3569:0.6431	.	71;71;71;71;71	B5MCQ0;Q9UQ74;E7ENH0;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.;.	R	71	ENSP00000385869:Q71R;ENSP00000386090:Q71R;ENSP00000305005:Q71R	ENSP00000305005:Q71R	Q	-	2	0	PSG8	47960126	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.899000	0.04101	-0.017000	0.14103	0.155000	0.16302	CAA	.	.	none		0.413	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464526.1		
TNF	7124	hgsc.bcm.edu	37	6	31543608	31543608	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr6:31543608C>T	ENST00000449264.2	+	1	265	c.90C>T	c.(88-90)tgC>tgT	p.C30C		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	30					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	CCAGGCGGTGCTTGTTCCTCA	0.632									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.C30C		Atlas-SNP	.											.	TNF	15	.	0			c.C90T						PASS	.						74.0	74.0	74.0					6																	31543608		2203	4300	6503	SO:0001819	synonymous_variant	7124	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	GCGGTGCTTGTTC	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.90C>T	6.37:g.31543608C>T		54.0	0.0	0		40.0	14.0	0.35	NM_000594	O43647|Q9P1Q2|Q9UIV3	Silent	SNP	ENST00000449264.2	37	CCDS4702.1																																																																																			.	.	none		0.632	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
TRPC6	7225	hgsc.bcm.edu	37	11	101375357	101375357	+	Missense_Mutation	SNP	G	G	A	rs199884871		TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr11:101375357G>A	ENST00000344327.3	-	2	767	c.343C>T	c.(343-345)Cgg>Tgg	p.R115W	TRPC6_ENST00000532133.1_Missense_Mutation_p.R115W|TRPC6_ENST00000348423.4_Missense_Mutation_p.R115W|TRPC6_ENST00000360497.4_Missense_Mutation_p.R115W|TRPC6_ENST00000526713.1_5'Flank	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	115					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		AACATCTTCCGCACCACTGGG	0.473																																					p.R115W	Colon(166;1315 1927 11094 12848 34731)	Atlas-SNP	.											TRPC6,NS,carcinoma,+1,1	TRPC6	132	1	0			c.C343T						PASS	.	G	TRP/ARG	0,4406		0,0,2203	156.0	142.0	147.0		343	4.0	1.0	11		147	1,8597	1.2+/-3.3	0,1,4298	no	missense	TRPC6	NM_004621.5	101	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign	115/932	101375357	1,13003	2203	4299	6502	SO:0001583	missense	7225	exon2			TCTTCCGCACCAC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.343C>T	11.37:g.101375357G>A	ENSP00000340913:p.Arg115Trp	93.0	0.0	0		72.0	6.0	0.0833333	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607032	0.66558	0.0	1.16E-4	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.96	3.95	0.45737	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.82130	0.4970	M	0.83692	2.655	0.51233	D	0.999918	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.986;0.999;0.992	D	0.83852	0.0263	10	0.72032	D	0.01	-15.8714	13.7254	0.62754	0.0:0.0:0.6021:0.3979	.	115;115;115	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	W	115	ENSP00000340913:R115W;ENSP00000435574:R115W;ENSP00000343672:R115W;ENSP00000353687:R115W	ENSP00000340913:R115W	R	-	1	2	TRPC6	100880567	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.284000	0.43478	0.673000	0.31224	0.655000	0.94253	CGG	.	.	weak		0.473	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
ARIH2	10425	hgsc.bcm.edu	37	3	49017001	49017001	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr3:49017001G>A	ENST00000356401.4	+	12	1387	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M	ARIH2_ENST00000490095.1_3'UTR|RP13-131K19.1_ENST00000415982.1_RNA|ARIH2_ENST00000449376.1_Missense_Mutation_p.V350M|RP13-131K19.1_ENST00000429681.1_RNA	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	350					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TCCTGACATCGTGAACCAGAG	0.498																																					p.V350M		Atlas-SNP	.											ARIH2,NS,carcinoma,0,1	ARIH2	32	1	0			c.G1048A						scavenged	.						142.0	120.0	128.0					3																	49017001		2203	4300	6503	SO:0001583	missense	10425	exon12			GACATCGTGAACC	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.1048G>A	3.37:g.49017001G>A	ENSP00000348769:p.Val350Met	74.0	1.0	0.0135135		84.0	14.0	0.166667	NM_006321	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	37	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213019	0.79352	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	D;D	0.82711	-1.64;-1.64	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.86108	0.5854	N	0.24115	0.695	0.80722	D	1	D;D;P	0.76494	0.999;0.998;0.792	P;D;B	0.70935	0.813;0.971;0.154	D	0.86779	0.1978	10	0.52906	T	0.07	.	19.9097	0.97022	0.0:0.0:1.0:0.0	.	357;350;350	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	M	350;350;349;174	ENSP00000348769:V350M;ENSP00000403222:V350M	ENSP00000348769:V350M	V	+	1	0	ARIH2	48992005	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.418000	0.80167	2.710000	0.92621	0.472000	0.43445	GTG	.	.	none		0.498	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	
NEBL	10529	hgsc.bcm.edu	37	10	21309077	21309077	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr10:21309077C>T	ENST00000417816.2	-	3	571	c.218G>A	c.(217-219)cGc>cAc	p.R73H	NEBL_ENST00000377159.4_Missense_Mutation_p.R39H	NM_001173484.1|NM_213569.2	NP_001166955.1|NP_998734.1	O76041	NEBL_HUMAN	nebulette	737					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						CTGCTTCAGGCGAAGATTTTC	0.413																																					p.R73H		Atlas-SNP	.											NEBL_ENST00000417816,NS,malignant_melanoma,-1,2	NEBL	199	2	0			c.G218A						PASS	.						105.0	99.0	101.0					10																	21309077		2203	4300	6503	SO:0001583	missense	10529	exon3			TTCAGGCGAAGAT	Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000417816.2:c.218G>A	10.37:g.21309077C>T	ENSP00000393896:p.Arg73His	96.0	0.0	0		113.0	8.0	0.0707965	NM_001173484	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	ENST00000417816.2	37	CCDS7133.1	.	.	.	.	.	.	.	.	.	.	c	27.3	4.819770	0.90873	.	.	ENSG00000078114	ENST00000417816;ENST00000377159	T;T	0.42131	0.98;0.98	5.24	5.24	0.73138	.	.	.	.	.	T	0.61223	0.2330	L	0.53729	1.69	0.41209	D	0.986421	D	0.89917	1.0	D	0.91635	0.999	T	0.60459	-0.7259	9	0.48119	T	0.1	.	17.9579	0.89075	0.0:1.0:0.0:0.0	.	73	Q70I54	.	H	73;39	ENSP00000393896:R73H;ENSP00000366364:R39H	ENSP00000366364:R39H	R	-	2	0	NEBL	21349083	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.105000	0.71505	2.595000	0.87683	0.651000	0.88453	CGC	.	.	none		0.413	NEBL-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047112.1	NM_006393	
PLEKHD1	400224	hgsc.bcm.edu	37	14	69951715	69951715	+	Silent	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr14:69951715C>T	ENST00000322564.7	+	1	245	c.33C>T	c.(31-33)ccC>ccT	p.P11P		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	11										breast(1)|endometrium(1)|kidney(2)	4						CGGTGTCGCCCTCGCCGTCCC	0.687																																					p.P11P		Atlas-SNP	.											.	PLEKHD1	24	.	0			c.C33T						PASS	.						46.0	48.0	47.0					14																	69951715		692	1591	2283	SO:0001819	synonymous_variant	400224	exon1			GTCGCCCTCGCCG	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.33C>T	14.37:g.69951715C>T		111.0	0.0	0		73.0	12.0	0.164384	NM_001161498	B9EJC2	Silent	SNP	ENST00000322564.7	37	CCDS53903.1																																																																																			.	.	none		0.687	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
RASA3	22821	hgsc.bcm.edu	37	13	114783725	114783725	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chr13:114783725C>T	ENST00000334062.7	-	11	1067	c.946G>A	c.(946-948)Gtg>Atg	p.V316M	RASA3_ENST00000542651.1_3'UTR|RASA3_ENST00000389544.4_Missense_Mutation_p.V284M	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	316					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GACGCTGACACGGGCTGCGGG	0.682																																					p.V316M		Atlas-SNP	.											.	RASA3	83	.	0			c.G946A						PASS	.						9.0	8.0	8.0					13																	114783725		2091	4147	6238	SO:0001583	missense	22821	exon11			CTGACACGGGCTG		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.946G>A	13.37:g.114783725C>T	ENSP00000335029:p.Val316Met	132.0	0.0	0		84.0	18.0	0.214286	NM_007368	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	ENST00000334062.7	37	CCDS32016.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529328	0.64860	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.17691	2.26;2.26	4.49	4.49	0.54785	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.062063	0.64402	D	0.000006	T	0.36220	0.0959	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	P	0.62649	0.905	T	0.09058	-1.0692	9	.	.	.	.	15.9295	0.79648	0.0:1.0:0.0:0.0	.	316	Q14644	RASA3_HUMAN	M	316;284	ENSP00000335029:V316M;ENSP00000374195:V284M	.	V	-	1	0	RASA3	113801827	1.000000	0.71417	0.760000	0.31359	0.031000	0.12232	4.899000	0.63245	2.004000	0.58718	0.491000	0.48974	GTG	.	.	none		0.682	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
SYTL5	94122	hgsc.bcm.edu	37	X	37965974	37965974	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A6HO-01A-11D-A31X-10	TCGA-FA-A6HO-10A-01D-A31X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	4663fa5a-53e7-40be-a662-6aaa4e456475	16d8b5be-a00c-43cf-8121-f0c8b5dcc5c2	g.chrX:37965974G>T	ENST00000357972.5	+	11	1830	c.1284G>T	c.(1282-1284)aaG>aaT	p.K428N	SYTL5_ENST00000297875.2_Missense_Mutation_p.K428N|TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000456733.2_Missense_Mutation_p.K450N			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	428	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						TTTTTGTCAAGAATTGCAGAA	0.428																																					p.K450N		Atlas-SNP	.											.	SYTL5	72	.	0			c.G1350T						PASS	.						138.0	111.0	120.0					X																	37965974		2202	4300	6502	SO:0001583	missense	94122	exon11			TGTCAAGAATTGC		CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1284G>T	X.37:g.37965974G>T	ENSP00000350657:p.Lys428Asn	178.0	0.0	0		194.0	33.0	0.170103	NM_001163334	A2RRF2	Missense_Mutation	SNP	ENST00000357972.5	37	CCDS14244.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699815	0.68501	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	T;T;T	0.70045	-0.45;-0.45;-0.45	5.71	5.71	0.89125	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.050650	0.85682	D	0.000000	T	0.80502	0.4635	M	0.81497	2.545	0.41478	D	0.988146	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.961	T	0.78453	-0.2198	10	0.21014	T	0.42	-19.1341	13.0607	0.59005	0.0784:0.0:0.9216:0.0	.	450;428	A2RRF2;Q8TDW5	.;SYTL5_HUMAN	N	428;428;450	ENSP00000297875:K428N;ENSP00000350657:K428N;ENSP00000395220:K450N	ENSP00000297875:K428N	K	+	3	2	SYTL5	37850918	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.373000	0.44266	2.394000	0.81467	0.594000	0.82650	AAG	.	.	none		0.428	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780	
