#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTC24	164118	hgsc.bcm.edu	37	1	156551615	156551625	+	Frame_Shift_Del	DEL	GGGAGAAGCCT	GGGAGAAGCCT	-	rs576203714	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	GGGAGAAGCCT	GGGAGAAGCCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:156551615_156551625delGGGAGAAGCCT	ENST00000368237.3	+	1	459_469	c.459_469delGGGAGAAGCCT	c.(457-471)cagggagaagcctggfs	p.GEAW154fs	TTC24_ENST00000368236.3_Frame_Shift_Del_p.GEAW154fs			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	154										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AGGGTGACCAGGGAGAAGCCTGGGCAAAAAT	0.611																																					p.153_156del		Pindel,Atlas-Indel	.											.	TTC24	46	.	0			c.458_468del						PASS	.																																			SO:0001589	frameshift_variant	164118	exon2			.		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.459_469delGGGAGAAGCCT	1.37:g.156551615_156551625delGGGAGAAGCCT	ENSP00000357220:p.Gly154fs	87.0	0.0	.		69.0	13.0	0.188	NM_001105669	Q5T3H7	Frame_Shift_Del	DEL	ENST00000368237.3	37	CCDS53379.1																																																																																			.	.	none		0.611	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
TRAPPC9	83696	hgsc.bcm.edu	37	8	141468446	141468448	+	5'Flank	DEL	GAA	GAA	-			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:141468446_141468448delGAA	ENST00000438773.2	-	0	0				TRAPPC9_ENST00000389328.4_In_Frame_Del_p.S73del|TRAPPC9_ENST00000389327.3_5'Flank	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9						cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						AGGCCCCGCGGAAGCCCACTGTG	0.68																																					p.73_73del		Pindel,Atlas-Indel	.											.	TRAPPC9	114	.	0			c.217_219del						PASS	.																																			SO:0001631	upstream_gene_variant	83696	exon1			.	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187		8.37:g.141468446_141468448delGAA	Exception_encountered	137.0	0.0	.		120.0	24.0	0.200	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	In_Frame_Del	DEL	ENST00000438773.2	37	CCDS55278.1																																																																																			.	.	none		0.680	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
PANK2	80025	hgsc.bcm.edu	37	20	3891366	3891367	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr20:3891366_3891367insA	ENST00000316562.4	+	3	1130_1131	c.1124_1125insA	c.(1123-1128)ttaccafs	p.P376fs	PANK2_ENST00000497424.1_Frame_Shift_Ins_p.P85fs|PANK2_ENST00000610179.1_Frame_Shift_Ins_p.P253fs|PANK2_ENST00000464452.1_3'UTR	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	376					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGTCAGAAGTTACCATTTGATT	0.386																																					p.L375fs		Pindel,Atlas-Indel	.											.	PANK2	37	.	0			c.1124_1125insA						PASS	.																																			SO:0001589	frameshift_variant	80025	exon3			.	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1125dupA	20.37:g.3891367_3891367dupA	ENSP00000313377:p.Pro376fs	131.0	0.0	.		148.0	39.0	0.264	NM_153638	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Frame_Shift_Ins	INS	ENST00000316562.4	37	CCDS13071.2																																																																																			.	.	none		0.386	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
KMT2D	8085	hgsc.bcm.edu	37	12	49426852	49426853	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:49426852_49426853delCT	ENST00000301067.7	-	39	11634_11635	c.11635_11636delAG	c.(11635-11637)agtfs	p.S3879fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3879	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGACATCAGACTCTGCTGAAGA	0.584																																					p.3879_3879del		Pindel,Atlas-Indel	.											.	MLL2	1173	.	0			c.11636_11637del						PASS	.																																			SO:0001589	frameshift_variant	8085	exon39			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11635_11636delAG	12.37:g.49426854_49426855delCT	ENSP00000301067:p.Ser3879fs	66.0	0.0	.		69.0	14.0	0.203	NM_003482	O14687	Frame_Shift_Del	DEL	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.584	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
BTG2	7832	hgsc.bcm.edu	37	1	203276240	203276241	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:203276240_203276241delAA	ENST00000290551.4	+	2	222_223	c.151_152delAA	c.(151-153)aaafs	p.K51fs	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	51					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			AGAGCACTACAAACACCACTGG	0.594																																					p.50_51del		Atlas-Indel	.											.	BTG2	16	.	0			c.150_151del						PASS	.																																			SO:0001589	frameshift_variant	7832	exon2			.		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.151_152delAA	1.37:g.203276240_203276241delAA	ENSP00000290551:p.Lys51fs	76.0	0.0	0		52.0	10.0	0.192308	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Frame_Shift_Del	DEL	ENST00000290551.4	37	CCDS1437.1																																																																																			.	.	none		0.594	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
ATP2A3	489	hgsc.bcm.edu	37	17	3844342	3844343	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:3844342_3844343insC	ENST00000352011.3	-	14	2076_2077	c.2022_2023insG	c.(2020-2025)cgctgcfs	p.C675fs	ATP2A3_ENST00000359983.3_Frame_Shift_Ins_p.C675fs|ATP2A3_ENST00000397035.3_Frame_Shift_Ins_p.C675fs|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000309890.7_Frame_Shift_Ins_p.C675fs|ATP2A3_ENST00000397041.3_Frame_Shift_Ins_p.C675fs|ATP2A3_ENST00000397043.3_Frame_Shift_Ins_p.C675fs			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	675					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CGGGCGAAGCAGCGGGCGGTGC	0.663																																					p.C675fs	GBM(32;29 774 15719 37967)	Atlas-Indel	.											.	ATP2A3	148	.	0			c.2023_2024insG						PASS	.																																			SO:0001589	frameshift_variant	489	exon14			.		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2022_2023insG	17.37:g.3844342_3844343insC	ENSP00000301387:p.Cys675fs	81.0	0.0	0		46.0	25.0	0.543478	NM_174958	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Frame_Shift_Ins	INS	ENST00000352011.3	37	CCDS11041.1																																																																																			.	.	none		0.663	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
ATP2A3	489	hgsc.bcm.edu	37	17	3844337	3844338	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:3844337_3844338delGA	ENST00000352011.3	-	14	2081_2082	c.2027_2028delTC	c.(2026-2028)ttcfs	p.F676fs	ATP2A3_ENST00000359983.3_Frame_Shift_Del_p.F676fs|ATP2A3_ENST00000397035.3_Frame_Shift_Del_p.F676fs|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000309890.7_Frame_Shift_Del_p.F676fs|ATP2A3_ENST00000397041.3_Frame_Shift_Del_p.F676fs|ATP2A3_ENST00000397043.3_Frame_Shift_Del_p.F676fs			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	676					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CCACGCGGGCGAAGCAGCGGGC	0.673																																					p.676_677del	GBM(32;29 774 15719 37967)	Atlas-Indel	.											.	ATP2A3	148	.	0			c.2028_2029del						PASS	.																																			SO:0001589	frameshift_variant	489	exon14			.		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2027_2028delTC	17.37:g.3844337_3844338delGA	ENSP00000301387:p.Phe676fs	78.0	0.0	0		46.0	25.0	0.543478	NM_174958	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Frame_Shift_Del	DEL	ENST00000352011.3	37	CCDS11041.1																																																																																			.	.	none		0.673	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
ATP2A3	489	hgsc.bcm.edu	37	17	3844337	3844342	+	In_Frame_Del	DEL	GAAGCA	GAAGCA	-			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	GAAGCA	GAAGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:3844337_3844342delGAAGCA	ENST00000352011.3	-	14	2077_2082	c.2023_2028delTGCTTC	c.(2023-2028)tgcttcdel	p.CF675del	ATP2A3_ENST00000359983.3_In_Frame_Del_p.CF675del|ATP2A3_ENST00000397035.3_In_Frame_Del_p.CF675del|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000309890.7_In_Frame_Del_p.CF675del|ATP2A3_ENST00000397041.3_In_Frame_Del_p.CF675del|ATP2A3_ENST00000397043.3_In_Frame_Del_p.CF675del			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	675					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CCACGCGGGCGAAGCAGCGGGCGGTG	0.665																																					p.675_677del	GBM(32;29 774 15719 37967)	Pindel	.											.	ATP2A3	148	.	0			c.2024_2029del						PASS	.																																			SO:0001651	inframe_deletion	489	exon14			.		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2023_2028delTGCTTC	17.37:g.3844337_3844342delGAAGCA	ENSP00000301387:p.Cys675_Phe676del	80.0	0.0	.		50.0	25.0	0.500	NM_005173	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	In_Frame_Del	DEL	ENST00000352011.3	37	CCDS11041.1																																																																																			.	.	none		0.665	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
BTG1	694	hgsc.bcm.edu	37	12	92539203	92539203	+	Silent	SNP	G	G	A	rs369374957		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:92539203G>A	ENST00000256015.3	-	1	470	c.109C>T	c.(109-111)Ctg>Ttg	p.L37L	C12orf79_ENST00000549802.1_5'Flank|C12orf79_ENST00000546975.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000551563.2_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	37					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.L37L(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				AAGGTCTGCAGCTGTCGCTCG	0.677			T	MYC	BCLL																																p.L37L		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	BTG1,NS,lymphoid_neoplasm,0,3	BTG1	30	3	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C109T						PASS	.						38.0	41.0	40.0					12																	92539203		2203	4300	6503	SO:0001819	synonymous_variant	694	exon1			TCTGCAGCTGTCG		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.109C>T	12.37:g.92539203G>A		150.0	0.0	0		123.0	37.0	0.300813	NM_001731	P31607	Silent	SNP	ENST00000256015.3	37	CCDS9043.1																																																																																			.	.	alt		0.677	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
C10orf10	11067	hgsc.bcm.edu	37	10	45473249	45473249	+	Missense_Mutation	SNP	C	C	T	rs143373089	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr10:45473249C>T	ENST00000298295.3	-	2	447	c.230G>A	c.(229-231)cGc>cAc	p.R77H	RASSF4_ENST00000472561.1_Intron|C10orf10_ENST00000496638.1_Intron|RASSF4_ENST00000340258.5_Intron|RASSF4_ENST00000374417.2_Intron|RASSF4_ENST00000334940.6_Intron	NM_007021.3	NP_008952.1	Q9NTK1	DEPP_HUMAN	chromosome 10 open reading frame 10	77						mitochondrion (GO:0005739)				lung(1)	1						CACAGCAGGGCGGCCCTTCCG	0.662													C|||	9	0.00179712	0.0	0.0	5008	,	,		16959	0.0		0.0089	False		,,,				2504	0.0				p.R77H		Atlas-SNP	.											.	C10orf10	6	.	0			c.G230A						PASS	.	C	HIS/ARG,	3,4401		0,3,2199	37.0	38.0	38.0		230,	-4.3	0.0	10	dbSNP_134	38	26,8568		0,26,4271	yes	missense,intron	C10orf10,RASSF4	NM_007021.3,NM_032023.3	29,	0,29,6470	TT,TC,CC		0.3025,0.0681,0.2231	benign,	77/213,	45473249	29,12969	2202	4297	6499	SO:0001583	missense	11067	exon2			GCAGGGCGGCCCT	AB022718	CCDS7210.1	10q11.21	2014-07-31			ENSG00000165507	ENSG00000165507			23355	protein-coding gene	gene with protein product	"""decidual protein induced by progesterone"", ""fasting induced"", ""fat-specific expressed gene"""	611309				24530860, 19937567, 16123073	Standard	NM_007021		Approved	DEPP, FIG, Fseg	uc001jbr.4	Q9NTK1	OTTHUMG00000018063	ENST00000298295.3:c.230G>A	10.37:g.45473249C>T	ENSP00000298295:p.Arg77His	60.0	0.0	0		47.0	11.0	0.234043	NM_007021	B2R6A1|O94997|Q5T735|Q76MX8	Missense_Mutation	SNP	ENST00000298295.3	37	CCDS7210.1	6	0.0027472527472527475	0	0.0	0	0.0	0	0.0	6	0.0079155672823219	C	6.078	0.382727	0.11524	6.81E-4	0.003025	ENSG00000165507	ENST00000298295;ENST00000432283;ENST00000448778	T;T	0.41400	1.0;1.0	5.6	-4.3	0.03710	.	1.632960	0.03404	N	0.203779	T	0.12603	0.0306	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.07328	-1.0778	10	0.13853	T	0.58	0.1242	2.0776	0.03628	0.1107:0.292:0.3247:0.2726	.	77	Q9NTK1	DEPP_HUMAN	H	77	ENSP00000298295:R77H;ENSP00000414494:R77H	ENSP00000298295:R77H	R	-	2	0	C10orf10	44793255	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.941000	0.03925	-1.319000	0.02286	-1.332000	0.01269	CGC	C|0.998;T|0.002	0.002	strong		0.662	C10orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047758.1	NM_007021	
HIST1H2BO	8348	hgsc.bcm.edu	37	6	27861456	27861456	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:27861456G>A	ENST00000303806.4	+	1	254	c.216G>A	c.(214-216)gaG>gaA	p.E72E	HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000479986.1_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	72					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										ACATCTTTGAGCGCATCGCTG	0.602																																					p.E72E		Atlas-SNP	.											.	HIST1H2BO	30	.	0			c.G216A						PASS	.						131.0	120.0	123.0					6																	27861456		2203	4300	6503	SO:0001819	synonymous_variant	8348	exon1			CTTTGAGCGCATC	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.216G>A	6.37:g.27861456G>A		106.0	0.0	0		144.0	40.0	0.277778	NM_003527	Q3KPI7|Q8TCV6	Silent	SNP	ENST00000303806.4	37	CCDS4640.1																																																																																			.	.	none		0.602	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1	NM_003527	
NMRAL1	57407	hgsc.bcm.edu	37	16	4516347	4516347	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr16:4516347G>A	ENST00000574733.1	-	4	1065	c.336C>T	c.(334-336)agC>agT	p.S112S	NMRAL1_ENST00000572391.1_5'UTR|NMRAL1_ENST00000404295.3_Silent_p.S112S|NMRAL1_ENST00000283429.6_Silent_p.S112S|NMRAL1_ENST00000574425.1_Silent_p.S112S			Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	112						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|prostate(2)|stomach(1)	15						TCTCCAGGCCGCTGTAGACCA	0.597																																					p.S112S		Atlas-SNP	.											.	NMRAL1	31	.	0			c.C336T						PASS	.						45.0	44.0	44.0					16																	4516347		2197	4300	6497	SO:0001819	synonymous_variant	57407	exon4			CAGGCCGCTGTAG	AF225419	CCDS10516.1	16p13.3	2013-10-11			ENSG00000153406	ENSG00000153406		"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	24987	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 48A, member 1"""					19027726	Standard	NM_020677		Approved	FLJ25918, HSCARG, SDR48A1	uc002cwo.3	Q9HBL8	OTTHUMG00000129468	ENST00000574733.1:c.336C>T	16.37:g.4516347G>A		40.0	0.0	0		42.0	19.0	0.452381	NM_020677		Silent	SNP	ENST00000574733.1	37	CCDS10516.1																																																																																			.	.	none		0.597	NMRAL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438579.1	NM_020677	
LSAMP	4045	hgsc.bcm.edu	37	3	115805359	115805359	+	Missense_Mutation	SNP	C	C	T	rs577289191		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:115805359C>T	ENST00000490035.2	-	2	699	c.200G>A	c.(199-201)cGt>cAt	p.R67H	LSAMP_ENST00000539563.1_Missense_Mutation_p.R64H	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	67	Ig-like C2-type 1.				cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		GATGCCAGAACGGTTCAACCA	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20144	0.0		0.0	False		,,,				2504	0.0				p.R67H		Atlas-SNP	.											.	LSAMP	62	.	0			c.G200A						PASS	.						118.0	106.0	110.0					3																	115805359		2203	4300	6503	SO:0001583	missense	4045	exon2			CCAGAACGGTTCA	U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.200G>A	3.37:g.115805359C>T	ENSP00000419000:p.Arg67His	145.0	0.0	0		115.0	44.0	0.382609	NM_002338	Q8IV49	Missense_Mutation	SNP	ENST00000490035.2	37	CCDS2982.1	.	.	.	.	.	.	.	.	.	.	C	35	5.494944	0.96339	.	.	ENSG00000185565	ENST00000333617;ENST00000490035;ENST00000539563;ENST00000474851	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.78	5.78	0.91487	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70168	0.3193	H	0.95043	3.615	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.79063	-0.1957	10	0.87932	D	0	-8.0017	20.005	0.97433	0.0:1.0:0.0:0.0	.	67;67	B2RCU8;Q13449	.;LSAMP_HUMAN	H	51;67;64;101	ENSP00000328455:R51H;ENSP00000419000:R67H;ENSP00000443429:R64H;ENSP00000418506:R101H	ENSP00000328455:R51H	R	-	2	0	LSAMP	117288049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.058000	0.71126	2.745000	0.94114	0.555000	0.69702	CGT	.	.	none		0.473	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354495.4	NM_002338	
AMPD3	272	hgsc.bcm.edu	37	11	10523046	10523046	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:10523046G>A	ENST00000396554.3	+	12	2119	c.1778G>A	c.(1777-1779)cGg>cAg	p.R593Q	AMPD3_ENST00000530864.1_3'UTR|AMPD3_ENST00000444303.2_Missense_Mutation_p.R425Q	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	584					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		TTCCTGTTCCGGCCGCACTGT	0.632																																					p.R593Q		Atlas-SNP	.											.	AMPD3	68	.	0			c.G1778A						PASS	.						48.0	40.0	43.0					11																	10523046		2201	4294	6495	SO:0001583	missense	272	exon12			TGTTCCGGCCGCA	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.1778G>A	11.37:g.10523046G>A	ENSP00000379802:p.Arg593Gln	44.0	0.0	0		61.0	23.0	0.377049	NM_000480	A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	ENST00000396554.3	37	CCDS7802.1	.	.	.	.	.	.	.	.	.	.	G	37	6.087583	0.97271	.	.	ENSG00000133805	ENST00000444303;ENST00000396554;ENST00000396553;ENST00000528723;ENST00000529507	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.75	5.75	0.90469	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.94324	0.8176	H	0.95679	3.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95346	0.8442	10	0.87932	D	0	-21.5258	19.9577	0.97228	0.0:0.0:1.0:0.0	.	591;584;593	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	Q	425;593;584;591;584	ENSP00000396000:R425Q;ENSP00000379802:R593Q;ENSP00000379801:R584Q;ENSP00000436987:R591Q;ENSP00000431648:R584Q	ENSP00000379801:R584Q	R	+	2	0	AMPD3	10479622	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.714000	0.92807	0.563000	0.77884	CGG	.	.	none		0.632	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385783.2	NM_000480	
ITGA4	3676	hgsc.bcm.edu	37	2	182346352	182346352	+	Missense_Mutation	SNP	G	G	A	rs148901650	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:182346352G>A	ENST00000397033.2	+	7	1212	c.782G>A	c.(781-783)cGg>cAg	p.R261Q		NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	261					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GGTCATTTTCGGAGCCAGCAT	0.383													g|||	4	0.000798722	0.0	0.0	5008	,	,		17178	0.003		0.0	False		,,,				2504	0.001				p.R261Q		Atlas-SNP	.											ITGA4,NS,carcinoma,+1,1	ITGA4	142	1	0			c.G782A						PASS	.						62.0	57.0	59.0					2																	182346352		1814	4083	5897	SO:0001583	missense	3676	exon7			ATTTTCGGAGCCA		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.782G>A	2.37:g.182346352G>A	ENSP00000380227:p.Arg261Gln	82.0	0.0	0		62.0	24.0	0.387097	NM_000885	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	ENST00000397033.2	37	CCDS42788.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	10.52	1.373857	0.24857	.	.	ENSG00000115232	ENST00000425522;ENST00000397033;ENST00000233573	T;T	0.71341	-0.56;-0.56	5.54	2.49	0.30216	.	0.717535	0.13491	N	0.383966	T	0.51261	0.1664	N	0.21373	0.66	0.23972	N	0.996309	B;B	0.17852	0.007;0.024	B;B	0.06405	0.002;0.002	T	0.32745	-0.9895	10	0.28530	T	0.3	.	5.8849	0.18876	0.1841:0.0:0.5918:0.2241	.	261;261	E7EP60;P13612	.;ITA4_HUMAN	Q	261	ENSP00000380227:R261Q;ENSP00000233573:R261Q	ENSP00000233573:R261Q	R	+	2	0	ITGA4	182054597	0.655000	0.27376	0.213000	0.23690	0.293000	0.27360	1.099000	0.31013	0.630000	0.30394	-0.185000	0.12909	CGG	G|1.000;A|0.000	0.000	strong		0.383	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
POU2F2	5452	hgsc.bcm.edu	37	19	42603967	42603967	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr19:42603967G>A	ENST00000526816.2	-	6	325	c.310C>T	c.(310-312)Cag>Tag	p.Q104*	POU2F2_ENST00000529952.1_Nonsense_Mutation_p.Q104*|POU2F2_ENST00000342301.4_Nonsense_Mutation_p.Q104*|POU2F2_ENST00000529067.1_Nonsense_Mutation_p.Q104*|POU2F2_ENST00000560558.1_Nonsense_Mutation_p.Q65*|POU2F2_ENST00000389341.5_Nonsense_Mutation_p.Q104*|POU2F2_ENST00000560398.1_Nonsense_Mutation_p.Q126*|POU2F2_ENST00000533720.1_Nonsense_Mutation_p.Q104*			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	104					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	AGGAGCTGCTGTATGTCCTGG	0.617																																					p.Q104X		Atlas-SNP	.											.	POU2F2	106	.	0			c.C310T						PASS	.						37.0	37.0	37.0					19																	42603967		2191	4286	6477	SO:0001587	stop_gained	5452	exon6			GCTGCTGTATGTC		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.310C>T	19.37:g.42603967G>A	ENSP00000431603:p.Gln104*	75.0	0.0	0		77.0	25.0	0.324675	NM_002698	Q16648|Q7M4M8|Q9BRS4	Nonsense_Mutation	SNP	ENST00000526816.2	37	CCDS56095.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924697	0.73213	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952;ENST00000531773	.	.	.	4.93	4.93	0.64822	.	0.968583	0.08425	N	0.947819	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	17.4661	0.87633	0.0:0.0:1.0:0.0	.	.	.	.	X	104;104;104;104;103;104;104;92	.	ENSP00000292077:Q104X	Q	-	1	0	POU2F2	47295807	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.174000	0.89682	2.746000	0.94184	0.655000	0.94253	CAG	.	.	none		0.617	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
NDN	4692	hgsc.bcm.edu	37	15	23931597	23931597	+	Silent	SNP	G	G	A	rs142210120	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr15:23931597G>A	ENST00000331837.4	-	1	853	c.768C>T	c.(766-768)ccC>ccT	p.P256P		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	256	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		ACTCGTATTCGGGCGGCTCCA	0.562									Prader-Willi syndrome				G|||	9	0.00179712	0.0053	0.0029	5008	,	,		19044	0.0		0.0	False		,,,				2504	0.0				p.P256P		Atlas-SNP	.											NDN,right_upper_lobe,carcinoma,0,1	NDN	79	1	0			c.C768T						PASS	.	G		17,4389		0,17,2186	35.0	35.0	35.0		768	-7.0	0.0	15	dbSNP_134	35	3,8595		0,3,4296	no	coding-synonymous	NDN	NM_002487.2		0,20,6482	AA,AG,GG		0.0349,0.3858,0.1538		256/322	23931597	20,12984	2203	4299	6502	SO:0001819	synonymous_variant	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	GTATTCGGGCGGC	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.768C>T	15.37:g.23931597G>A		86.0	0.0	0		84.0	30.0	0.357143	NM_002487	B2R6Z5	Silent	SNP	ENST00000331837.4	37	CCDS10014.1																																																																																			G|0.998;A|0.002	0.002	strong		0.562	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
SBF2	81846	hgsc.bcm.edu	37	11	10051375	10051375	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:10051375G>A	ENST00000256190.8	-	5	587	c.450C>T	c.(448-450)gtC>gtT	p.V150V	SBF2_ENST00000527019.1_5'UTR	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	150	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TTTCCAAGGAGACATTCAGGC	0.408																																					p.V150V		Atlas-SNP	.											SBF2,NS,carcinoma,-2,1	SBF2	146	1	0			c.C450T						PASS	.						205.0	205.0	205.0					11																	10051375		2201	4294	6495	SO:0001819	synonymous_variant	81846	exon5			CAAGGAGACATTC	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.450C>T	11.37:g.10051375G>A		69.0	0.0	0		57.0	19.0	0.333333	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Silent	SNP	ENST00000256190.8	37	CCDS31427.1																																																																																			.	.	none		0.408	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
LRRTM1	347730	hgsc.bcm.edu	37	2	80529497	80529497	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:80529497A>G	ENST00000295057.3	-	2	2104	c.1448T>C	c.(1447-1449)aTg>aCg	p.M483T	CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000361291.4_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.M483T|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000496558.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	483					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CTGGGCAGACATGGCAGCCAT	0.542										HNSCC(69;0.2)																											p.M483T		Atlas-SNP	.											.	LRRTM1	251	.	0			c.T1448C						PASS	.						146.0	119.0	128.0					2																	80529497		2203	4300	6503	SO:0001583	missense	347730	exon2			GCAGACATGGCAG	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1448T>C	2.37:g.80529497A>G	ENSP00000295057:p.Met483Thr	123.0	0.0	0		103.0	23.0	0.223301	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	37	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	A	5.771	0.326657	0.10900	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.38722	1.12;1.12	5.18	5.18	0.71444	.	0.055879	0.64402	U	0.000001	T	0.21062	0.0507	N	0.03608	-0.345	0.46279	D	0.998961	B	0.12013	0.005	B	0.08055	0.003	T	0.09250	-1.0683	9	.	.	.	.	15.031	0.71708	1.0:0.0:0.0:0.0	.	483	Q86UE6	LRRT1_HUMAN	T	483	ENSP00000295057:M483T;ENSP00000386646:M483T	.	M	-	2	0	LRRTM1	80383008	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.349000	0.73013	1.930000	0.55929	0.459000	0.35465	ATG	.	.	none		0.542	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
SH3BP4	23677	hgsc.bcm.edu	37	2	235951281	235951281	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:235951281G>A	ENST00000409212.1	+	4	2375	c.1868G>A	c.(1867-1869)aGg>aAg	p.R623K	SH3BP4_ENST00000344528.4_Missense_Mutation_p.R623K|SH3BP4_ENST00000392011.2_Missense_Mutation_p.R623K			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	623					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		TCCGGGCAAAGGAGGTTTCTC	0.567																																					p.R623K		Atlas-SNP	.											SH3BP4,right_upper_lobe,carcinoma,+1,2	SH3BP4	109	2	0			c.G1868A						scavenged	.						58.0	56.0	57.0					2																	235951281		2203	4300	6503	SO:0001583	missense	23677	exon4			GGCAAAGGAGGTT	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1868G>A	2.37:g.235951281G>A	ENSP00000386862:p.Arg623Lys	83.0	1.0	0.0120482		76.0	29.0	0.381579	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621960	0.66787	.	.	ENSG00000130147	ENST00000392011;ENST00000409212;ENST00000344528	T;T;T	0.10005	2.92;2.92;2.92	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.23649	0.0572	L	0.36672	1.1	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.70716	0.97;0.97	T	0.00839	-1.1545	10	0.37606	T	0.19	-42.3967	17.0389	0.86483	0.0:0.0:1.0:0.0	.	623;623	A8K594;Q9P0V3	.;SH3B4_HUMAN	K	623	ENSP00000375867:R623K;ENSP00000386862:R623K;ENSP00000340237:R623K	ENSP00000340237:R623K	R	+	2	0	SH3BP4	235616020	1.000000	0.71417	0.989000	0.46669	0.922000	0.55478	9.458000	0.97634	2.354000	0.79902	0.655000	0.94253	AGG	.	.	none		0.567	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
PLCE1	51196	hgsc.bcm.edu	37	10	95791436	95791436	+	Silent	SNP	C	C	T	rs201117145		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr10:95791436C>T	ENST00000371380.3	+	1	868	c.633C>T	c.(631-633)gaC>gaT	p.D211D	PLCE1_ENST00000260766.3_Silent_p.D211D			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	211					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TAATTTTAGACGATTGTGGAA	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22116	0.0		0.0	False		,,,				2504	0.0				p.D211D		Atlas-SNP	.											.	PLCE1	543	.	0			c.C633T						PASS	.	C		9,3749		0,9,1870	84.0	80.0	81.0		633	-0.5	1.0	10		81	0,8202		0,0,4101	no	coding-synonymous	PLCE1	NM_016341.3		0,9,5971	TT,TC,CC		0.0,0.2395,0.0753		211/2303	95791436	9,11951	1879	4101	5980	SO:0001819	synonymous_variant	51196	exon2			TTTAGACGATTGT		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.633C>T	10.37:g.95791436C>T		98.0	0.0	0		100.0	33.0	0.33	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	37	CCDS41552.1																																																																																			C|1.000;T|0.000	0.000	strong		0.393	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
RAB11FIP1	80223	hgsc.bcm.edu	37	8	37729420	37729420	+	Missense_Mutation	SNP	G	G	A	rs560008452		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:37729420G>A	ENST00000330843.4	-	4	2912	c.2900C>T	c.(2899-2901)tCg>tTg	p.S967L	RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000523182.1_5'UTR	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	967					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TTCATCATCCGATGCGACTTC	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		23664	0.0		0.0	False		,,,				2504	0.0				p.S967L		Atlas-SNP	.											.	RAB11FIP1	105	.	0			c.C2900T						PASS	.						157.0	130.0	139.0					8																	37729420		2203	4300	6503	SO:0001583	missense	80223	exon4			TCATCCGATGCGA	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.2900C>T	8.37:g.37729420G>A	ENSP00000331342:p.Ser967Leu	113.0	0.0	0		103.0	7.0	0.0679612	NM_001002814	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	ENST00000330843.4	37	CCDS34882.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342297	0.81911	.	.	ENSG00000156675	ENST00000330843	T	0.26660	1.72	5.33	5.33	0.75918	.	0.000000	0.45867	D	0.000321	T	0.41511	0.1162	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.14952	-1.0454	10	0.45353	T	0.12	-12.8301	17.2186	0.86951	0.0:0.0:1.0:0.0	.	296;967	Q67C35;Q6WKZ4	.;RFIP1_HUMAN	L	967	ENSP00000331342:S967L	ENSP00000331342:S967L	S	-	2	0	RAB11FIP1	37848578	0.999000	0.42202	0.119000	0.21687	0.783000	0.44284	5.604000	0.67626	2.491000	0.84063	0.655000	0.94253	TCG	.	.	none		0.453	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376816.1	NM_025151	
MBL2	4153	hgsc.bcm.edu	37	10	54527908	54527908	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr10:54527908A>C	ENST00000373968.3	-	4	800	c.736T>G	c.(736-738)Ttc>Gtc	p.F246V		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	246					acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						CAGATAGGGAACTCACAGACG	0.463																																					p.F246V		Atlas-SNP	.											.	MBL2	55	.	0			c.T736G						PASS	.						211.0	195.0	201.0					10																	54527908		2202	4300	6502	SO:0001583	missense	4153	exon4			TAGGGAACTCACA	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.736T>G	10.37:g.54527908A>C	ENSP00000363079:p.Phe246Val	117.0	0.0	0		101.0	21.0	0.207921	NM_000242	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	ENST00000373968.3	37	CCDS7247.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575473	0.86645	.	.	ENSG00000165471	ENST00000373968	T	0.18810	2.19	5.03	5.03	0.67393	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.092185	0.48286	D	0.000196	T	0.40067	0.1102	L	0.58354	1.805	0.45995	D	0.998802	D	0.62365	0.991	D	0.64877	0.93	T	0.25328	-1.0135	10	0.87932	D	0	-16.6059	13.0118	0.58735	1.0:0.0:0.0:0.0	.	246	P11226	MBL2_HUMAN	V	246	ENSP00000363079:F246V	ENSP00000363079:F246V	F	-	1	0	MBL2	54197914	1.000000	0.71417	0.626000	0.29213	0.320000	0.28249	4.676000	0.61627	2.010000	0.58986	0.482000	0.46254	TTC	.	.	none		0.463	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242	
SLC26A3	1811	hgsc.bcm.edu	37	7	107408040	107408040	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:107408040C>T	ENST00000340010.5	-	20	2439	c.2255G>A	c.(2254-2256)cGt>cAt	p.R752H	SLC26A3_ENST00000422236.2_Missense_Mutation_p.R639H	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	752					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TACCCGATTACGTAATCCTCC	0.343																																					p.R752H		Atlas-SNP	.											SLC26A3,NS,carcinoma,0,4	SLC26A3	120	4	0			c.G2255A						PASS	.						101.0	105.0	103.0					7																	107408040		2203	4299	6502	SO:0001583	missense	1811	exon20			CGATTACGTAATC	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.2255G>A	7.37:g.107408040C>T	ENSP00000345873:p.Arg752His	176.0	0.0	0		156.0	40.0	0.25641	NM_000111		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.415080	0.42817	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.94613	-3.47;-3.31	4.64	3.77	0.43336	.	0.392271	0.27961	N	0.017141	D	0.90013	0.6882	L	0.46885	1.475	0.25690	N	0.985706	B;B	0.29955	0.163;0.263	B;B	0.20767	0.029;0.031	T	0.81976	-0.0686	10	0.38643	T	0.18	.	10.1245	0.42641	0.0:0.9054:0.0:0.0946	.	639;752	G5E9U3;P40879	.;S26A3_HUMAN	H	639;752	ENSP00000415817:R639H;ENSP00000345873:R752H	ENSP00000345873:R752H	R	-	2	0	SLC26A3	107195276	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	1.672000	0.37523	1.185000	0.42971	0.644000	0.83932	CGT	.	.	none		0.343	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111	
AMOT	154796	hgsc.bcm.edu	37	X	112065819	112065819	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chrX:112065819A>G	ENST00000524145.1	-	2	610	c.536T>C	c.(535-537)aTg>aCg	p.M179T	AMOT_ENST00000304758.1_Intron|AMOT_ENST00000371959.3_Missense_Mutation_p.M179T|AMOT_ENST00000371958.1_5'Flank|AMOT_ENST00000462114.1_5'Flank|AMOT_ENST00000371962.1_5'Flank			Q4VCS5	AMOT_HUMAN	angiomotin	179					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TGACATCTGCATTAGTCGTTC	0.537																																					p.M179T		Atlas-SNP	.											.	AMOT	204	.	0			c.T536C						PASS	.						264.0	194.0	215.0					X																	112065819		692	1591	2283	SO:0001583	missense	154796	exon1			ATCTGCATTAGTC	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.536T>C	X.37:g.112065819A>G	ENSP00000429013:p.Met179Thr	105.0	0.0	0		83.0	40.0	0.481928	NM_001113490	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	ENST00000524145.1	37	CCDS48154.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.296211	0.60086	.	.	ENSG00000126016	ENST00000371959;ENST00000524145	T;T	0.16196	2.36;2.36	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.42314	0.1197	M	0.77103	2.36	0.58432	D	0.999999	D	0.62365	0.991	D	0.68192	0.956	T	0.32295	-0.9912	9	.	.	.	-14.4782	14.2221	0.65833	1.0:0.0:0.0:0.0	.	179	Q4VCS5	AMOT_HUMAN	T	179	ENSP00000361027:M179T;ENSP00000429013:M179T	.	M	-	2	0	AMOT	111952475	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	9.339000	0.96797	1.956000	0.56807	0.486000	0.48141	ATG	.	.	none		0.537	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
HUNK	30811	hgsc.bcm.edu	37	21	33371069	33371069	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr21:33371069G>A	ENST00000270112.2	+	11	2077	c.1717G>A	c.(1717-1719)Gtg>Atg	p.V573M		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	573					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						CCACGTAGAAGTGCTGTCTCC	0.617																																					p.V573M		Atlas-SNP	.											.	HUNK	74	.	0			c.G1717A						PASS	.						84.0	62.0	69.0					21																	33371069		2203	4300	6503	SO:0001583	missense	30811	exon11			GTAGAAGTGCTGT	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1717G>A	21.37:g.33371069G>A	ENSP00000270112:p.Val573Met	85.0	0.0	0		88.0	33.0	0.375	NM_014586		Missense_Mutation	SNP	ENST00000270112.2	37	CCDS13610.1	.	.	.	.	.	.	.	.	.	.	G	3.553	-0.091199	0.07053	.	.	ENSG00000142149	ENST00000270112	T	0.67865	-0.29	4.39	-2.03	0.07365	.	0.724836	0.12754	N	0.441957	T	0.36799	0.0980	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.12167	-1.0558	10	0.40728	T	0.16	-0.7464	2.5976	0.04858	0.2287:0.2923:0.3446:0.1344	.	573	P57058	HUNK_HUMAN	M	573	ENSP00000270112:V573M	ENSP00000270112:V573M	V	+	1	0	HUNK	32292940	0.704000	0.27836	0.030000	0.17652	0.184000	0.23303	0.554000	0.23407	-0.353000	0.08224	-1.434000	0.01081	GTG	.	.	none		0.617	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
ASXL3	80816	hgsc.bcm.edu	37	18	31250736	31250736	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr18:31250736C>A	ENST00000269197.5	+	6	577	c.577C>A	c.(577-579)Cag>Aag	p.Q193K		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GTCTGATGAGCAGTCGGATTC	0.428																																					p.Q193K		Atlas-SNP	.											.	ASXL3	405	.	0			c.C577A						PASS	.						57.0	58.0	58.0					18																	31250736		1881	4091	5972	SO:0001583	missense	80816	exon6			GATGAGCAGTCGG	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.577C>A	18.37:g.31250736C>A	ENSP00000269197:p.Gln193Lys	110.0	0.0	0		154.0	31.0	0.201299	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.353018	0.61293	.	.	ENSG00000141431	ENST00000269197	T	0.15487	2.42	5.48	5.48	0.80851	.	.	.	.	.	T	0.35307	0.0927	L	0.43152	1.355	0.41121	D	0.985811	D	0.63880	0.993	D	0.67548	0.952	T	0.01480	-1.1344	9	0.44086	T	0.13	.	19.3689	0.94477	0.0:1.0:0.0:0.0	.	193	Q9C0F0	ASXL3_HUMAN	K	193	ENSP00000269197:Q193K	ENSP00000269197:Q193K	Q	+	1	0	ASXL3	29504734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.677000	0.68142	2.595000	0.87683	0.655000	0.94253	CAG	.	.	none		0.428	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
KMT2A	4297	hgsc.bcm.edu	37	11	118372519	118372519	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:118372519C>T	ENST00000389506.5	+	26	6443	c.6443C>T	c.(6442-6444)cCc>cTc	p.P2148L	KMT2A_ENST00000534358.1_Missense_Mutation_p.P2151L|KMT2A_ENST00000354520.4_Missense_Mutation_p.P2110L			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2148					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ATTCGAACACCCAGTTATTCT	0.468																																					p.P2151L		Atlas-SNP	.											.	MLL	548	.	0			c.C6452T						PASS	.						125.0	123.0	124.0					11																	118372519		2200	4296	6496	SO:0001583	missense	4297	exon26			GAACACCCAGTTA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6443C>T	11.37:g.118372519C>T	ENSP00000374157:p.Pro2148Leu	103.0	0.0	0		86.0	29.0	0.337209	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843826	0.71488	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.85411	-1.97;-1.98;-1.84	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.91560	0.7334	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.991;0.996	D	0.91992	0.5604	10	0.87932	D	0	.	16.9819	0.86329	0.0:1.0:0.0:0.0	.	2151;2148	E9PQG7;Q03164	.;MLL1_HUMAN	L	2151;2148;2110;1058	ENSP00000436786:P2151L;ENSP00000374157:P2148L;ENSP00000346516:P2110L	ENSP00000346516:P2110L	P	+	2	0	MLL	117877729	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.419000	0.66435	2.750000	0.94351	0.591000	0.81541	CCC	.	.	none		0.468	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
ADAMTS13	11093	hgsc.bcm.edu	37	9	136310909	136310909	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:136310909G>A	ENST00000371929.3	+	21	3144	c.2700G>A	c.(2698-2700)gcG>gcA	p.A900A	ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Silent_p.A869A|ADAMTS13_ENST00000355699.2_Silent_p.A900A|ADAMTS13_ENST00000536611.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	900	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.		A -> V (in dbSNP:rs685523). {ECO:0000269|PubMed:11557746, ECO:0000269|PubMed:11586351, ECO:0000269|Ref.6}.		cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GGACCCCTGCGGCAGGGTCGT	0.662																																					p.A900A		Atlas-SNP	.											.	ADAMTS13	113	.	0			c.G2700A						PASS	.						49.0	48.0	48.0					9																	136310909		2203	4300	6503	SO:0001819	synonymous_variant	11093	exon21			CCCTGCGGCAGGG	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2700G>A	9.37:g.136310909G>A		88.0	0.0	0		51.0	7.0	0.137255	NM_139027	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Silent	SNP	ENST00000371929.3	37	CCDS6970.1																																																																																			.	.	none		0.662	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
SLC4A4	8671	hgsc.bcm.edu	37	4	72338528	72338528	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:72338528C>T	ENST00000264485.5	+	14	1861	c.1744C>T	c.(1744-1746)Cgt>Tgt	p.R582C	SLC4A4_ENST00000512686.1_Missense_Mutation_p.R538C|SLC4A4_ENST00000351898.6_Missense_Mutation_p.R582C|SLC4A4_ENST00000340595.3_Missense_Mutation_p.R538C|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000425175.1_Missense_Mutation_p.R582C	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	582					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	ATACTTCACACGTTTCACGGA	0.448																																					p.R582C		Atlas-SNP	.											.	SLC4A4	269	.	0			c.C1744T						PASS	.						178.0	170.0	173.0					4																	72338528		2203	4300	6503	SO:0001583	missense	8671	exon14			TTCACACGTTTCA	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1744C>T	4.37:g.72338528C>T	ENSP00000264485:p.Arg582Cys	173.0	0.0	0		161.0	44.0	0.273292	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	C	32	5.150747	0.94645	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.44	5.44	0.79542	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94407	0.8201	H	0.96142	3.775	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0;1.0	D	0.95867	0.8888	10	0.87932	D	0	.	19.2755	0.94030	0.0:1.0:0.0:0.0	.	582;582;538;538;562;582	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R3;Q9Y6R1	.;.;.;.;.;S4A4_HUMAN	C	582;582;582;538;538	ENSP00000264485:R582C;ENSP00000393557:R582C;ENSP00000307349:R582C;ENSP00000422400:R538C;ENSP00000344272:R538C	ENSP00000264485:R582C	R	+	1	0	SLC4A4	72557392	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.818000	0.86416	2.553000	0.86117	0.655000	0.94253	CGT	.	.	none		0.448	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
ATP2A3	489	hgsc.bcm.edu	37	17	3844340	3844340	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:3844340G>C	ENST00000352011.3	-	14	2079	c.2025C>G	c.(2023-2025)tgC>tgG	p.C675W	ATP2A3_ENST00000359983.3_Missense_Mutation_p.C675W|ATP2A3_ENST00000397035.3_Missense_Mutation_p.C675W|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000309890.7_Missense_Mutation_p.C675W|ATP2A3_ENST00000397041.3_Missense_Mutation_p.C675W|ATP2A3_ENST00000397043.3_Missense_Mutation_p.C675W			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	675					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CGCGGGCGAAGCAGCGGGCGG	0.667																																					p.C675W	GBM(32;29 774 15719 37967)	Atlas-SNP	.											.	ATP2A3	148	.	0			c.C2025G						PASS	.						58.0	63.0	61.0					17																	3844340		2203	4296	6499	SO:0001583	missense	489	exon14			GGCGAAGCAGCGG		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2025C>G	17.37:g.3844340G>C	ENSP00000301387:p.Cys675Trp	82.0	0.0	0		44.0	25.0	0.568182	NM_174956	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	37	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570816	0.65765	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.95918	-3.85;-3.85;-3.85;-3.85;-3.85;-3.85	4.16	2.19	0.27852	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95204	0.8445	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.974;0.985;0.974;0.974;0.974	D	0.94182	0.7433	10	0.87932	D	0	.	10.0362	0.42131	0.1683:0.0:0.8317:0.0	.	675;675;675;675;675;675	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	W	675	ENSP00000380236:C675W;ENSP00000301387:C675W;ENSP00000353072:C675W;ENSP00000380234:C675W;ENSP00000312577:C675W;ENSP00000380229:C675W	ENSP00000312577:C675W	C	-	3	2	ATP2A3	3791089	1.000000	0.71417	0.997000	0.53966	0.890000	0.51754	6.421000	0.73353	0.714000	0.32081	0.561000	0.74099	TGC	.	.	none		0.667	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
KLHL36	79786	hgsc.bcm.edu	37	16	84691156	84691156	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr16:84691156G>A	ENST00000564996.1	+	3	884	c.743G>A	c.(742-744)cGc>cAc	p.R248H	KLHL36_ENST00000258157.5_Missense_Mutation_p.R248H	NM_024731.2	NP_079007.2	Q8N4N3	KLH36_HUMAN	kelch-like family member 36	248	BACK.				protein ubiquitination (GO:0016567)					endometrium(3)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CTGCTGCACCGCGTCAAGCCG	0.687																																					p.R248H		Atlas-SNP	.											.	KLHL36	51	.	0			c.G743A						PASS	.						36.0	30.0	32.0					16																	84691156		2197	4290	6487	SO:0001583	missense	79786	exon3			TGCACCGCGTCAA	AK022605	CCDS10948.1	16q24.1	2013-02-22	2013-02-22	2008-07-07	ENSG00000135686	ENSG00000135686		"""Kelch-like"", ""BTB/POZ domain containing"""	17844	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 44"", ""kelch-like 36 (Drosophila)"""	C16orf44			Standard	NM_024731		Approved	FLJ12543	uc002fig.3	Q8N4N3	OTTHUMG00000137642	ENST00000564996.1:c.743G>A	16.37:g.84691156G>A	ENSP00000456743:p.Arg248His	39.0	0.0	0		43.0	4.0	0.0930233	NM_024731	Q8N5G6|Q9H9U6	Missense_Mutation	SNP	ENST00000564996.1	37	CCDS10948.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491508	0.44249	.	.	ENSG00000135686	ENST00000325279;ENST00000258157	T	0.68903	-0.36	5.51	5.51	0.81932	BTB/Kelch-associated (2);	0.115666	0.64402	D	0.000018	T	0.66848	0.2831	L	0.27053	0.805	0.58432	D	0.99999	P;D	0.61080	0.72;0.989	B;P	0.56514	0.053;0.8	T	0.60826	-0.7186	10	0.15499	T	0.54	.	18.4088	0.90543	0.0:0.0:1.0:0.0	.	248;248	Q8N4N3-2;Q8N4N3	.;KLH36_HUMAN	H	248	ENSP00000258157:R248H	ENSP00000258157:R248H	R	+	2	0	KLHL36	83248657	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	4.951000	0.63610	2.582000	0.87167	0.563000	0.77884	CGC	.	.	none		0.687	KLHL36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269084.2		
SORL1	6653	hgsc.bcm.edu	37	11	121414264	121414264	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:121414264A>C	ENST00000260197.7	+	13	1822	c.1693A>C	c.(1693-1695)Acc>Ccc	p.T565P	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	565					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CAGATACAGTACCAATGAAGG	0.468																																					p.T565P		Atlas-SNP	.											.	SORL1	218	.	0			c.A1693C						PASS	.						127.0	127.0	127.0					11																	121414264		2203	4299	6502	SO:0001583	missense	6653	exon13			TACAGTACCAATG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.1693A>C	11.37:g.121414264A>C	ENSP00000260197:p.Thr565Pro	93.0	0.0	0		103.0	30.0	0.291262	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.654993	0.88056	.	.	ENSG00000137642	ENST00000260197	T	0.43294	0.95	5.8	5.8	0.92144	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.66665	0.2812	M	0.78456	2.415	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.70741	-0.4789	10	0.72032	D	0.01	.	16.1549	0.81657	1.0:0.0:0.0:0.0	.	565	Q92673	SORL_HUMAN	P	565	ENSP00000260197:T565P	ENSP00000260197:T565P	T	+	1	0	SORL1	120919474	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	9.056000	0.93881	2.209000	0.71365	0.533000	0.62120	ACC	.	.	none		0.468	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
ZNF236	7776	hgsc.bcm.edu	37	18	74606988	74606988	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr18:74606988C>T	ENST00000253159.8	+	10	1629	c.1431C>T	c.(1429-1431)aaC>aaT	p.N477N	ZNF236_ENST00000320610.9_Silent_p.N479N	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	477					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCGAGGAGAACGGCGTGCGCT	0.662																																					p.N477N		Atlas-SNP	.											.	ZNF236	325	.	0			c.C1431T						PASS	.						81.0	94.0	90.0					18																	74606988		2184	4274	6458	SO:0001819	synonymous_variant	7776	exon10			GGAGAACGGCGTG	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.1431C>T	18.37:g.74606988C>T		40.0	0.0	0		53.0	23.0	0.433962	NM_007345	B2RTX9|Q9UL37	Silent	SNP	ENST00000253159.8	37	CCDS42447.1																																																																																			.	.	none		0.662	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
OR10G8	219869	hgsc.bcm.edu	37	11	123900714	123900714	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:123900714C>A	ENST00000431524.1	+	1	418	c.385C>A	c.(385-387)Ctc>Atc	p.L129I		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CAGTTACCCGCTCAGGTACAC	0.557																																					p.L129I		Atlas-SNP	.											.	OR10G8	132	.	0			c.C385A						PASS	.						152.0	142.0	146.0					11																	123900714		2201	4299	6500	SO:0001583	missense	219869	exon1			TACCCGCTCAGGT	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.385C>A	11.37:g.123900714C>A	ENSP00000389072:p.Leu129Ile	263.0	0.0	0		315.0	81.0	0.257143	NM_001004464	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	37	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167711	0.57476	.	.	ENSG00000234560	ENST00000431524	T	0.32753	1.44	3.04	2.11	0.27256	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38605	N	0.001629	T	0.61912	0.2385	H	0.97491	4.015	0.31448	N	0.671088	D	0.76494	0.999	D	0.85130	0.997	T	0.65825	-0.6074	10	0.87932	D	0	.	3.7997	0.08753	0.0:0.6176:0.0:0.3824	.	129	Q8NGN5	O10G8_HUMAN	I	129	ENSP00000389072:L129I	ENSP00000389072:L129I	L	+	1	0	OR10G8	123405924	0.486000	0.25980	0.977000	0.42913	0.770000	0.43624	1.056000	0.30480	1.684000	0.51022	0.650000	0.86243	CTC	.	.	none		0.557	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
HOXC11	3227	hgsc.bcm.edu	37	12	54367692	54367692	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:54367692A>T	ENST00000546378.1	+	1	783	c.667A>T	c.(667-669)Aaa>Taa	p.K223*	HOTAIR_ENST00000455246.1_RNA|HOTAIR_ENST00000424518.1_RNA|HOXC11_ENST00000243082.4_Nonsense_Mutation_p.K223*			O43248	HXC11_HUMAN	homeobox C11	223					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						GGAGCCGGCCAAAGGAGCCGC	0.716			T	NUP98	AML																																p.K223X		Atlas-SNP	.		Dom	yes		12	12q13.3	3227	homeo box C11		L	.	HOXC11	32	.	0			c.A667T						PASS	.						2.0	3.0	2.0					12																	54367692		1539	2840	4379	SO:0001587	stop_gained	3227	exon1			CCGGCCAAAGGAG		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.667A>T	12.37:g.54367692A>T	ENSP00000446680:p.Lys223*	31.0	0.0	0		22.0	7.0	0.318182	NM_014212	A8K7D1|Q96DH2	Nonsense_Mutation	SNP	ENST00000546378.1	37	CCDS8867.1	.	.	.	.	.	.	.	.	.	.	A	36	5.906095	0.97087	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	.	.	.	4.22	4.22	0.49857	.	0.150308	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7199	0.57136	1.0:0.0:0.0:0.0	.	.	.	.	X	223	.	ENSP00000243082:K223X	K	+	1	0	HOXC11	52653959	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.596000	0.61055	1.898000	0.54952	0.459000	0.35465	AAA	.	.	none		0.716	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2		
LIPT2	387787	hgsc.bcm.edu	37	11	74204727	74204727	+	Silent	SNP	A	A	G	rs4944895	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:74204727A>G	ENST00000310109.4	-	1	51	c.22T>C	c.(22-24)Ttg>Ctg	p.L8L	AP001372.2_ENST00000526036.1_lincRNA	NM_001144869.1	NP_001138341.1	A6NK58	LIPT2_HUMAN	lipoyl(octanoyl) transferase 2 (putative)	8					cellular protein modification process (GO:0006464)|lipoate biosynthetic process (GO:0009107)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|lipoyl(octanoyl) transferase activity (GO:0033819)|octanoyltransferase activity (GO:0016415)			endometrium(1)|prostate(1)|stomach(1)	3						AGGCGCACCAACCGAACGGCG	0.771													G|||	4671	0.932708	0.7579	0.9769	5008	,	,		11814	1.0		0.999	False		,,,				2504	1.0				p.L8L		Atlas-SNP	.											.	LIPT2	5	.	0			c.T22C						PASS	.						1.0	1.0	1.0					11																	74204727		89	361	450	SO:0001819	synonymous_variant	387787	exon1			GCACCAACCGAAC		CCDS44679.1	11q13.4	2009-09-09			ENSG00000175536	ENSG00000175536			37216	protein-coding gene	gene with protein product							Standard	NM_001144869		Approved		uc010rrk.2	A6NK58	OTTHUMG00000165646	ENST00000310109.4:c.22T>C	11.37:g.74204727A>G		0.0	0.0	.		6.0	6.0	1	NM_001144869		Silent	SNP	ENST00000310109.4	37	CCDS44679.1																																																																																			A|0.071;G|0.929	0.929	strong		0.771	LIPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385544.1	NM_001144869	
HSPG2	3339	hgsc.bcm.edu	37	1	22181246	22181246	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:22181246C>T	ENST00000374695.3	-	49	6225	c.6146G>A	c.(6145-6147)aGc>aAc	p.S2049N	HSPG2_ENST00000430507.1_5'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2049	Ig-like C2-type 5.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CGGCGGTGGGCTGGCATCTGA	0.632																																					p.S2049N		Atlas-SNP	.											.	HSPG2	311	.	0			c.G6146A						PASS	.						41.0	45.0	43.0					1																	22181246		2202	4299	6501	SO:0001583	missense	3339	exon49			GGTGGGCTGGCAT	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6146G>A	1.37:g.22181246C>T	ENSP00000363827:p.Ser2049Asn	112.0	0.0	0		80.0	33.0	0.4125	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	0.254	-1.004055	0.02112	.	.	ENSG00000142798	ENST00000374695	T	0.76448	-1.02	5.24	-0.118	0.13547	Immunoglobulin-like fold (1);	3.019920	0.01284	N	0.009819	T	0.65790	0.2725	L	0.41492	1.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30822	-0.9965	10	0.19590	T	0.45	.	1.3651	0.02200	0.1379:0.3557:0.2686:0.2378	.	2049	P98160	PGBM_HUMAN	N	2049	ENSP00000363827:S2049N	ENSP00000363827:S2049N	S	-	2	0	HSPG2	22053833	0.620000	0.27068	0.004000	0.12327	0.010000	0.07245	0.119000	0.15626	0.023000	0.15187	0.561000	0.74099	AGC	.	.	none		0.632	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
ALPK2	115701	hgsc.bcm.edu	37	18	56246643	56246643	+	Silent	SNP	G	G	T	rs373786602		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr18:56246643G>T	ENST00000361673.3	-	4	1578	c.1365C>A	c.(1363-1365)ccC>ccA	p.P455P	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	455						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.P455P(1)		NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						CAGCAGCCTCGGGAGCAGTGG	0.493											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P455P		Atlas-SNP	.											ALPK2_ENST00000361673,medulla,primitive_neuroectodermal_tumour-medulloblastoma,0,1	ALPK2	487	1	1	Substitution - coding silent(1)	central_nervous_system(1)	c.C1365A						PASS	.						138.0	139.0	138.0					18																	56246643		2203	4300	6503	SO:0001819	synonymous_variant	115701	exon4			AGCCTCGGGAGCA	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1365C>A	18.37:g.56246643G>T		201.0	0.0	0	1014	270.0	59.0	0.218519	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	ENST00000361673.3	37	CCDS11966.2																																																																																			.	.	alt		0.493	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
NTSR1	4923	hgsc.bcm.edu	37	20	61386045	61386045	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr20:61386045C>T	ENST00000370501.3	+	2	1094	c.723C>T	c.(721-723)acC>acT	p.T241T		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	241					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			AGGTCAACACCTTCATGTCCT	0.612																																					p.T241T	GBM(37;400 780 6403 19663 35669)	Atlas-SNP	.											.	NTSR1	59	.	0			c.C723T						PASS	.						129.0	115.0	120.0					20																	61386045		2202	4300	6502	SO:0001819	synonymous_variant	4923	exon2			CAACACCTTCATG		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.723C>T	20.37:g.61386045C>T		42.0	0.0	0		40.0	4.0	0.1	NM_002531	Q9H4H1|Q9H4T5	Silent	SNP	ENST00000370501.3	37	CCDS13502.1																																																																																			.	.	none		0.612	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080061.1		
PCDHA4	56144	hgsc.bcm.edu	37	5	140188702	140188702	+	Missense_Mutation	SNP	C	C	T	rs142688560		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr5:140188702C>T	ENST00000530339.1	+	1	1930	c.1930C>T	c.(1930-1932)Cgc>Tgc	p.R644C	PCDHA4_ENST00000512229.2_Missense_Mutation_p.R644C|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.R644C|PCDHA3_ENST00000522353.2_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACGCTCCGCGCCACCGCCT	0.682																																					p.R644C		Atlas-SNP	.											PCDHA4_ENST00000530339,NS,carcinoma,-1,2	PCDHA4	419	2	0			c.C1930T						PASS	.	C	,,,CYS/ARG,,CYS/ARG	4,4402	9.9+/-24.2	0,4,2199	76.0	79.0	78.0		,,,1930,,1930	4.1	0.0	5	dbSNP_134	78	13,8587	9.8+/-36.6	0,13,4287	yes	intron,intron,intron,missense,intron,missense	PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_031411.1,NM_031500.1	,,,180,,180	0,17,6486	TT,TC,CC		0.1512,0.0908,0.1307	,,,,,	,,,644/948,,644/799	140188702	17,12989	2203	4300	6503	SO:0001583	missense	56144	exon1			GCTCCGCGCCACC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1930C>T	5.37:g.140188702C>T	ENSP00000435300:p.Arg644Cys	93.0	0.0	0		82.0	6.0	0.0731707	NM_031500	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	c	8.422	0.846641	0.16963	9.08E-4	0.001512	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.53206	0.63;0.63;0.63	4.08	4.08	0.47627	Cadherin (4);Cadherin-like (1);	0.194269	0.23758	U	0.044856	T	0.70833	0.3269	M	0.91663	3.23	0.09310	N	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.73380	0.924;0.932;0.98	T	0.64214	-0.6460	10	0.87932	D	0	.	8.772	0.34737	0.1688:0.6675:0.1636:0.0	.	644;644;644	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	C	644	ENSP00000423470:R644C;ENSP00000349344:R644C;ENSP00000435300:R644C	ENSP00000349344:R644C	R	+	1	0	PCDHA4	140168886	0.000000	0.05858	0.047000	0.18901	0.020000	0.10135	-1.228000	0.02948	2.006000	0.58801	0.484000	0.47621	CGC	C|0.998;T|0.002	0.002	strong		0.682	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
MED29	55588	hgsc.bcm.edu	37	19	39884260	39884260	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr19:39884260C>T	ENST00000599213.2	+	3	370	c.343C>T	c.(343-345)Cag>Tag	p.Q115*	PAF1_ENST00000595564.1_5'Flank|PAF1_ENST00000221266.7_5'Flank|MED29_ENST00000315588.5_Nonsense_Mutation_p.Q136*|PAF1_ENST00000221265.3_5'Flank|MED29_ENST00000594368.1_Nonsense_Mutation_p.Q115*			Q9NX70	MED29_HUMAN	mediator complex subunit 29	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)|nucleus (GO:0005634)				lung(2)|ovary(1)|pancreas(1)	4	all_cancers(60;7.82e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;1.04e-26)|all cancers(26;7.68e-24)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			ACTCTGTGACCAGCTGGAGCT	0.502																																					p.Q136X		Atlas-SNP	.											.	MED29	13	.	0			c.C406T						PASS	.						160.0	158.0	159.0					19																	39884260		2203	4300	6503	SO:0001587	stop_gained	55588	exon3			TGTGACCAGCTGG	AL137304, AY729650	CCDS33021.1	19q13.2	2007-07-30	2007-07-30	2007-07-30		ENSG00000063322			23074	protein-coding gene	gene with protein product		612914	"""intersex-like (Drosophila)"""	IXL		15555573	Standard	NM_017592		Approved	DKFZp434H247	uc010xux.3	Q9NX70		ENST00000599213.2:c.343C>T	19.37:g.39884260C>T	ENSP00000471802:p.Gln115*	55.0	0.0	0		54.0	11.0	0.203704	NM_017592	B4DNQ6|M0R2E4|Q5XX09|Q9NTF4	Nonsense_Mutation	SNP	ENST00000599213.2	37		.	.	.	.	.	.	.	.	.	.	c	34	5.321841	0.95682	.	.	ENSG00000063322	ENST00000315588;ENST00000435462	.	.	.	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-0.4415	14.4916	0.67654	0.0:1.0:0.0:0.0	.	.	.	.	X	136;54	.	ENSP00000314343:Q136X	Q	+	1	0	MED29	44576100	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	7.286000	0.78671	2.261000	0.74972	0.558000	0.71614	CAG	.	.	none		0.502	MED29-011	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470870.1	XM_290829	
ENO1	2023	hgsc.bcm.edu	37	1	8927286	8927286	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:8927286G>C	ENST00000234590.4	-	6	453	c.334C>G	c.(334-336)Ctg>Gtg	p.L112V		NM_001428.3	NP_001419.1	P06733	ENOA_HUMAN	enolase 1, (alpha)	112	Required for repression of c-myc promoter activity.				carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	10	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GACACCCCCAGAATGGCGTTC	0.547																																					p.L112V	Esophageal Squamous(21;302 608 19946 22210 33560)	Atlas-SNP	.											.	ENO1	38	.	0			c.C334G						PASS	.						84.0	88.0	87.0					1																	8927286		2203	4300	6503	SO:0001583	missense	2023	exon6			CCCCCAGAATGGC	BC022545	CCDS97.1	1p36.2	2010-03-11			ENSG00000074800	ENSG00000074800	4.2.1.11		3350	protein-coding gene	gene with protein product		172430		ENO1L1, MPB1		9653645, 9691177	Standard	NM_001428		Approved	PPH, MBP-1	uc001apj.2	P06733	OTTHUMG00000001773	ENST00000234590.4:c.334C>G	1.37:g.8927286G>C	ENSP00000234590:p.Leu112Val	72.0	0.0	0		69.0	12.0	0.173913	NM_001428	B2RD59|P22712|Q16704|Q4TUS4|Q53FT9|Q53HR3|Q658M5|Q6GMP2|Q71V37|Q7Z3V6|Q8WU71|Q96GV1|Q9BT62|Q9UCH6|Q9UM55	Missense_Mutation	SNP	ENST00000234590.4	37	CCDS97.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685277	0.68157	.	.	ENSG00000074800	ENST00000234590	T	0.36157	1.27	5.5	1.51	0.23008	Enolase, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.57607	0.2065	M	0.85859	2.78	0.39404	D	0.966647	D;D;D	0.64830	0.994;0.974;0.989	D;P;P	0.68353	0.957;0.842;0.902	T	0.63056	-0.6722	10	0.87932	D	0	-10.1455	9.0472	0.36354	0.4206:0.0:0.5794:0.0	.	79;19;112	A4UCS8;P06733-2;P06733	.;.;ENOA_HUMAN	V	112	ENSP00000234590:L112V	ENSP00000234590:L112V	L	-	1	2	ENO1	8849873	1.000000	0.71417	0.995000	0.50966	0.731000	0.41821	2.308000	0.43690	0.687000	0.31509	0.655000	0.94253	CTG	.	.	none		0.547	ENO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004945.1	NM_001428	
MITF	4286	hgsc.bcm.edu	37	3	69988253	69988253	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:69988253T>G	ENST00000448226.2	+	4	714	c.587T>G	c.(586-588)tTt>tGt	p.F196C	MITF_ENST00000314557.6_Missense_Mutation_p.F89C|MITF_ENST00000472437.1_Missense_Mutation_p.F144C|MITF_ENST00000394355.2_Missense_Mutation_p.F171C|MITF_ENST00000352241.4_Missense_Mutation_p.F196C|MITF_ENST00000314589.5_Missense_Mutation_p.F180C|MITF_ENST00000394351.3_Missense_Mutation_p.F89C|MITF_ENST00000531774.1_Missense_Mutation_p.F33C|MITF_ENST00000328528.6_Missense_Mutation_p.F195C			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	196					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		TTGCAGGGATTTTATAAGTTT	0.438			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.F196C	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	156	.	0			c.T587G						PASS	.						96.0	92.0	93.0					3																	69988253		2203	4300	6503	SO:0001583	missense	4286	exon4			AGGGATTTTATAA		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.587T>G	3.37:g.69988253T>G	ENSP00000391803:p.Phe196Cys	225.0	0.0	0		201.0	54.0	0.268657	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	ENST00000448226.2	37		.	.	.	.	.	.	.	.	.	.	T	15.35	2.806498	0.50421	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000433517;ENST00000472437;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351;ENST00000531774	T;T;T;T;T;T;T;T;T;T	0.24723	2.66;2.18;2.43;2.63;1.84;2.63;2.64;2.42;1.84;2.44	5.99	5.99	0.97316	.	0.595462	0.16404	N	0.215904	T	0.23492	0.0568	N	0.08118	0	0.46798	D	0.999201	P;P;P;D;D;P;P	0.61697	0.679;0.547;0.911;0.99;0.969;0.924;0.948	B;B;P;P;P;P;P	0.53146	0.338;0.416;0.518;0.639;0.719;0.634;0.54	T	0.10800	-1.0614	9	.	.	.	.	15.0653	0.71989	0.0:0.0:0.0:1.0	.	144;89;89;171;180;195;196	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	C	196;196;88;144;195;180;180;171;89;89;33	ENSP00000295600:F196C;ENSP00000391803:F196C;ENSP00000418845:F144C;ENSP00000327867:F195C;ENSP00000398639:F180C;ENSP00000324443:F180C;ENSP00000377884:F171C;ENSP00000324246:F89C;ENSP00000377880:F89C;ENSP00000435909:F33C	.	F	+	2	0	MITF	70070943	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.848000	0.62874	2.291000	0.77112	0.533000	0.62120	TTT	.	.	none		0.438	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
C5orf42	65250	hgsc.bcm.edu	37	5	37169527	37169527	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr5:37169527A>G	ENST00000508244.1	-	33	6692	c.6599T>C	c.(6598-6600)tTg>tCg	p.L2200S	C5orf42_ENST00000425232.2_Missense_Mutation_p.L2200S|C5orf42_ENST00000274258.7_Missense_Mutation_p.L1080S			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	2200						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			AGGTGTGGACAAAAGGTAGAG	0.428																																					p.L2200S		Atlas-SNP	.											.	C5orf42	422	.	0			c.T6599C						PASS	.						74.0	76.0	75.0					5																	37169527		2203	4300	6503	SO:0001583	missense	65250	exon34			GTGGACAAAAGGT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.6599T>C	5.37:g.37169527A>G	ENSP00000421690:p.Leu2200Ser	129.0	0.0	0		151.0	31.0	0.205298	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	37	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809357	0.70797	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.44482	0.99;0.99;0.92;0.95	5.53	5.53	0.82687	.	0.264081	0.24523	N	0.037796	T	0.60958	0.2309	L	0.57536	1.79	0.36777	D	0.88412	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69117	-0.5230	10	0.66056	D	0.02	.	14.2343	0.65916	1.0:0.0:0.0:0.0	.	2200;1080	E9PH94;Q9H799	.;CE042_HUMAN	S	2200;2200;1080;1248;1080	ENSP00000421690:L2200S;ENSP00000389014:L2200S;ENSP00000274258:L1080S;ENSP00000424223:L1248S	ENSP00000274258:L1080S	L	-	2	0	C5orf42	37205284	1.000000	0.71417	0.996000	0.52242	0.390000	0.30446	5.994000	0.70623	2.092000	0.63282	0.533000	0.62120	TTG	.	.	none		0.428	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230400	23230400	+	Missense_Mutation	SNP	T	T	C	rs189360394		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr22:23230400T>C	ENST00000526893.1	+	1	441	c.167T>C	c.(166-168)gTt>gCt	p.V56A	IGLL5_ENST00000532223.2_Missense_Mutation_p.V56A|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.V56A	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	56						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						GGAGCCTCAGTTGGAAGCAGC	0.667													T|||	1	0.000199681	0.0	0.0014	5008	,	,		10673	0.0		0.0	False		,,,				2504	0.0				p.V56A		Atlas-SNP	.											.	IGLL5	26	.	0			c.T167C						PASS	.																																			SO:0001583	missense	100423062	exon1			CCTCAGTTGGAAG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.167T>C	22.37:g.23230400T>C	ENSP00000431254:p.Val56Ala	105.0	0.0	0		97.0	29.0	0.298969	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	T	0.035	-1.312432	0.01331	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00571	6.5;6.5	3.92	-3.93	0.04143	.	.	.	.	.	T	0.00356	0.0011	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.45071	-0.9286	9	0.54805	T	0.06	.	0.8497	0.01169	0.1514:0.2511:0.2977:0.2998	.	56	B9A064	IGLL5_HUMAN	A	56	ENSP00000436353:V56A;ENSP00000431254:V56A	ENSP00000431254:V56A	V	+	2	0	IGLL5	21560400	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.389000	0.02530	-0.629000	0.05575	-1.272000	0.01410	GTT	T|1.000;C|0.000	0.000	strong		0.667	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
EGFL7	51162	hgsc.bcm.edu	37	9	139566493	139566493	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:139566493A>C	ENST00000371699.1	+	9	1663	c.752A>C	c.(751-753)gAc>gCc	p.D251A	EGFL7_ENST00000371698.3_Missense_Mutation_p.D251A|MIR126_ENST00000362291.1_RNA|EGFL7_ENST00000308874.7_Missense_Mutation_p.D251A|EGFL7_ENST00000406555.3_Missense_Mutation_p.D251A			Q9UHF1	EGFL7_HUMAN	EGF-like-domain, multiple 7	251					angiogenesis (GO:0001525)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|negative regulation of cell migration (GO:0030336)|negative regulation of Notch signaling pathway (GO:0045746)|positive regulation of endothelial cell proliferation (GO:0001938)|vasculogenesis (GO:0001570)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)			kidney(2)|ovary(1)|prostate(2)|urinary_tract(1)	6	all_cancers(76;0.109)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		GGCCGCATCGACTCCCTGAGC	0.701											OREG0019619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D251A		Atlas-SNP	.											.	EGFL7	11	.	0			c.A752C						PASS	.						9.0	10.0	9.0					9																	139566493		2094	4090	6184	SO:0001583	missense	51162	exon10			GCATCGACTCCCT	AF186111	CCDS7002.1	9q34.3	2008-02-05			ENSG00000172889	ENSG00000172889			20594	protein-coding gene	gene with protein product		608582					Standard	NM_016215		Approved	ZNEU1	uc004cih.3	Q9UHF1	OTTHUMG00000020938	ENST00000371699.1:c.752A>C	9.37:g.139566493A>C	ENSP00000360764:p.Asp251Ala	48.0	0.0	0	1649	37.0	10.0	0.27027	NM_016215	B3KRP0|M9VTX9|Q5M7Y5|Q5VUD5|Q96EG0	Missense_Mutation	SNP	ENST00000371699.1	37	CCDS7002.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150127	0.78001	.	.	ENSG00000172889	ENST00000371699;ENST00000308874;ENST00000406555;ENST00000371698	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	4.15	4.15	0.48705	.	0.063724	0.64402	D	0.000013	D	0.91710	0.7379	M	0.66939	2.045	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.91909	0.5538	10	0.59425	D	0.04	-25.9573	12.025	0.53365	1.0:0.0:0.0:0.0	.	251	Q9UHF1	EGFL7_HUMAN	A	251	ENSP00000360764:D251A;ENSP00000307843:D251A;ENSP00000385639:D251A;ENSP00000360763:D251A	ENSP00000307843:D251A	D	+	2	0	EGFL7	138686314	1.000000	0.71417	0.984000	0.44739	0.768000	0.43524	6.528000	0.73807	1.518000	0.48934	0.459000	0.35465	GAC	.	.	none		0.701	EGFL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055094.1	NM_016215	
ESRRG	2104	hgsc.bcm.edu	37	1	216680465	216680465	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:216680465G>T	ENST00000408911.3	-	7	1346	c.1193C>A	c.(1192-1194)gCg>gAg	p.A398E	ESRRG_ENST00000360012.3_Missense_Mutation_p.A375E|ESRRG_ENST00000366938.2_Missense_Mutation_p.A375E|ESRRG_ENST00000361395.2_Missense_Mutation_p.A375E|ESRRG_ENST00000366940.2_Missense_Mutation_p.A375E|ESRRG_ENST00000359162.2_Missense_Mutation_p.A375E|ESRRG_ENST00000487276.1_Missense_Mutation_p.A375E|ESRRG_ENST00000361525.3_Missense_Mutation_p.A375E|ESRRG_ENST00000366937.1_Missense_Mutation_p.A410E|ESRRG_ENST00000391890.3_Missense_Mutation_p.A382E|ESRRG_ENST00000463665.1_Missense_Mutation_p.A336E|ESRRG_ENST00000493603.1_Missense_Mutation_p.A375E|ESRRG_ENST00000493748.1_Missense_Mutation_p.A375E	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	398					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ATCCTGCAGCGCTTCATGTAA	0.473																																					p.A410E		Atlas-SNP	.											.	ESRRG	111	.	0			c.C1229A						PASS	.						108.0	97.0	100.0					1																	216680465		2203	4300	6503	SO:0001583	missense	2104	exon8			TGCAGCGCTTCAT	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.1193C>A	1.37:g.216680465G>T	ENSP00000386171:p.Ala398Glu	226.0	0.0	0		171.0	52.0	0.304094	NM_001243518	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	37	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493119	0.84962	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748	D;D;D;D;D;D;D;D;D;D;D;D;D	0.96554	-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05;-4.05	5.61	5.61	0.85477	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98868	0.9617	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99391	1.0925	10	0.87932	D	0	.	19.652	0.95819	0.0:0.0:1.0:0.0	.	336;410;398	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	E	375;375;410;398;375;375;375;375;375;382;336;375;375;375	ENSP00000355225:A375E;ENSP00000355907:A375E;ENSP00000355904:A410E;ENSP00000386171:A398E;ENSP00000352077:A375E;ENSP00000354584:A375E;ENSP00000355905:A375E;ENSP00000353108:A375E;ENSP00000419594:A375E;ENSP00000375761:A382E;ENSP00000418629:A336E;ENSP00000419155:A375E;ENSP00000417374:A375E	ENSP00000346386:A375E	A	-	2	0	ESRRG	214747088	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.869000	0.99810	2.656000	0.90262	0.561000	0.74099	GCG	.	.	none		0.473	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
FAT4	79633	hgsc.bcm.edu	37	4	126328261	126328261	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:126328261T>C	ENST00000394329.3	+	3	5547	c.5534T>C	c.(5533-5535)gTg>gCg	p.V1845A	FAT4_ENST00000335110.5_Missense_Mutation_p.V143A	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1845	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCCAGACCCGTGTACTCTTTT	0.413																																					p.V1845A		Atlas-SNP	.											FAT4_ENST00000394329,NS,carcinoma,-1,4	FAT4	1752	4	0			c.T5534C						scavenged	.						133.0	130.0	131.0					4																	126328261		2203	4300	6503	SO:0001583	missense	79633	exon3			GACCCGTGTACTC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5534T>C	4.37:g.126328261T>C	ENSP00000377862:p.Val1845Ala	124.0	1.0	0.00806452		126.0	31.0	0.246032	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	T	2.201	-0.382986	0.04966	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01228	5.14;5.14	5.41	5.41	0.78517	Cadherin (2);Cadherin-like (1);	0.000000	0.31233	U	0.008019	T	0.01421	0.0046	N	0.21324	0.655	0.28172	N	0.928529	B;B	0.22480	0.07;0.004	B;B	0.29942	0.109;0.009	T	0.45818	-0.9235	10	0.10111	T	0.7	.	12.2953	0.54842	0.0:0.0:0.1413:0.8587	.	143;1845	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	A	1845;143	ENSP00000377862:V1845A;ENSP00000335169:V143A	ENSP00000335169:V143A	V	+	2	0	FAT4	126547711	1.000000	0.71417	0.996000	0.52242	0.229000	0.25112	3.796000	0.55507	2.168000	0.68352	0.528000	0.53228	GTG	.	.	none		0.413	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
RCVRN	5957	hgsc.bcm.edu	37	17	9804381	9804381	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:9804381G>T	ENST00000226193.5	-	2	858	c.418C>A	c.(418-420)Ctc>Atc	p.L140I	RCVRN_ENST00000570909.3_5'UTR	NM_002903.2	NP_002894.1	P35243	RECO_HUMAN	recoverin	140					phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of calcium ion transport (GO:0051924)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	dendrite (GO:0030425)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	12						TCTGGAAGGAGCTTCACGTCC	0.453																																					p.L140I		Atlas-SNP	.											.	RCVRN	34	.	0			c.C418A						PASS	.						105.0	98.0	100.0					17																	9804381		2203	4300	6503	SO:0001583	missense	5957	exon2			GAAGGAGCTTCAC	BC001720	CCDS11151.1	17p13.1	2013-01-10		2006-09-26	ENSG00000109047	ENSG00000109047		"""EF-hand domain containing"""	9937	protein-coding gene	gene with protein product		179618		RCV1		1387789, 12507501, 1467959, 12789533	Standard	NM_002903		Approved		uc002gme.1	P35243	OTTHUMG00000130268	ENST00000226193.5:c.418C>A	17.37:g.9804381G>T	ENSP00000226193:p.Leu140Ile	96.0	0.0	0		70.0	33.0	0.471429	NM_002903	Q53XL0	Missense_Mutation	SNP	ENST00000226193.5	37	CCDS11151.1	.	.	.	.	.	.	.	.	.	.	G	7.190	0.591431	0.13812	.	.	ENSG00000109047	ENST00000226193	T	0.67345	-0.26	5.89	-1.12	0.09808	EF-hand-like domain (1);	0.735456	0.13380	N	0.392228	T	0.41305	0.1153	N	0.11023	0.085	0.20489	N	0.999893	B	0.09022	0.002	B	0.18561	0.022	T	0.22243	-1.0222	10	0.51188	T	0.08	.	5.0991	0.14749	0.1996:0.0:0.4512:0.3493	.	140	P35243	RECO_HUMAN	I	140	ENSP00000226193:L140I	ENSP00000226193:L140I	L	-	1	0	RCVRN	9745106	0.005000	0.15991	0.002000	0.10522	0.266000	0.26442	0.055000	0.14229	-0.375000	0.07955	-0.136000	0.14681	CTC	.	.	none		0.453	RCVRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252600.2	NM_002903	
KIAA0226	9711	hgsc.bcm.edu	37	3	197409444	197409444	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:197409444C>T	ENST00000296343.5	-	14	2022	c.2023G>A	c.(2023-2025)Ggg>Agg	p.G675R	KIAA0226_ENST00000389665.5_Missense_Mutation_p.G700R|KIAA0226_ENST00000273582.5_Missense_Mutation_p.G630R	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	675					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GCGTGCTGCCCGTCATCCGGT	0.582																																					p.G675R	Esophageal Squamous(3;167 355 3763 15924)	Atlas-SNP	.											KIAA0226_ENST00000273582,NS,carcinoma,0,2	KIAA0226	136	2	0			c.G2023A						PASS	.						60.0	64.0	62.0					3																	197409444		2164	4264	6428	SO:0001583	missense	9711	exon14			GCTGCCCGTCATC	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.2023G>A	3.37:g.197409444C>T	ENSP00000296343:p.Gly675Arg	129.0	0.0	0		101.0	31.0	0.306931	NM_014687	Q96CK5	Missense_Mutation	SNP	ENST00000296343.5	37	CCDS43195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.78|19.78	3.890439|3.890439	0.72524|0.72524	.|.	.|.	ENSG00000145016|ENSG00000145016	ENST00000273582;ENST00000296343;ENST00000389665|ENST00000413360	T;T;T|.	0.42900|.	0.96;0.96;0.96|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.057192|.	0.64402|.	D|.	0.000001|.	T|T	0.60650|0.60650	0.2285|0.2285	L|L	0.31926|0.31926	0.97|0.97	0.80722|0.80722	D|D	1|1	D;D;D|.	0.71674|.	0.998;0.961;0.986|.	P;B;P|.	0.58013|.	0.831;0.411;0.479|.	T|T	0.53258|0.53258	-0.8464|-0.8464	10|5	0.25751|.	T|.	0.34|.	.|.	19.8677|19.8677	0.96824|0.96824	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	700;630;675|.	Q92622-3;Q92622-2;Q92622|.	.;.;RUBIC_HUMAN|.	R|Q	630;675;700|636	ENSP00000273582:G630R;ENSP00000296343:G675R;ENSP00000374316:G700R|.	ENSP00000273582:G630R|.	G|R	-|-	1|2	0|0	KIAA0226|KIAA0226	198893841|198893841	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.930000|0.930000	0.56654|0.56654	7.818000|7.818000	0.86416|0.86416	2.709000|2.709000	0.92574|0.92574	0.655000|0.655000	0.94253|0.94253	GGG|CGG	.	.	none		0.582	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
RNF25	64320	hgsc.bcm.edu	37	2	219538411	219538411	+	5'Flank	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:219538411C>T	ENST00000295704.2	-	0	0				STK36_ENST00000392106.2_Nonsense_Mutation_p.R50*|STK36_ENST00000295709.3_Nonsense_Mutation_p.R50*|STK36_ENST00000440309.1_Nonsense_Mutation_p.R50*|STK36_ENST00000392105.3_Nonsense_Mutation_p.R50*	NM_022453.2	NP_071898.2	Q96BH1	RNF25_HUMAN	ring finger protein 25						positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|NF-kappaB binding (GO:0051059)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24		Renal(207;0.0474)		Epithelial(149;6.99e-07)|all cancers(144;0.000129)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAATTTGCAACGAGAGATTGA	0.478																																					p.R50X		Atlas-SNP	.											.	STK36	111	.	0			c.C148T						PASS	.						81.0	78.0	79.0					2																	219538411		2203	4300	6503	SO:0001631	upstream_gene_variant	27148	exon3			TTGCAACGAGAGA		CCDS2420.1	2q35	2008-02-05			ENSG00000163481	ENSG00000163481		"""RING-type (C3HC4) zinc fingers"""	14662	protein-coding gene	gene with protein product						12748188	Standard	NM_022453		Approved	AO7, FLJ13906	uc002vit.3	Q96BH1	OTTHUMG00000133077		2.37:g.219538411C>T	Exception_encountered	111.0	0.0	0		97.0	41.0	0.42268	NM_015690	A8K0D6|Q53HQ5|Q9H874	Nonsense_Mutation	SNP	ENST00000295704.2	37	CCDS2420.1	.	.	.	.	.	.	.	.	.	.	C	37	6.227986	0.97394	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309;ENST00000424080	.	.	.	5.72	5.72	0.89469	.	0.000000	0.36444	N	0.002587	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.345	14.7034	0.69171	0.1448:0.8552:0.0:0.0	.	.	.	.	X	50	.	ENSP00000295709:R50X	R	+	1	2	STK36	219246655	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.931000	0.56529	2.717000	0.92951	0.655000	0.94253	CGA	.	.	none		0.478	RNF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256721.1	NM_022453	
THSD7A	221981	hgsc.bcm.edu	37	7	11418733	11418733	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:11418733G>A	ENST00000423059.4	-	26	5016	c.4765C>T	c.(4765-4767)Cgg>Tgg	p.R1589W	AC004538.3_ENST00000421121.1_RNA|AC004538.3_ENST00000595972.1_RNA|AC004538.3_ENST00000599875.1_RNA|AC004538.3_ENST00000428967.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1589					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTCCTTCCCCGTCCTGCTGGG	0.493										HNSCC(18;0.044)																											p.R1589W		Atlas-SNP	.											THSD7A,NS,carcinoma,+2,1	THSD7A	219	1	0			c.C4765T						PASS	.						101.0	100.0	100.0					7																	11418733		1895	4112	6007	SO:0001583	missense	221981	exon25			TTCCCCGTCCTGC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4765C>T	7.37:g.11418733G>A	ENSP00000406482:p.Arg1589Trp	244.0	0.0	0		288.0	110.0	0.381944	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066037	0.76187	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59502	0.26	5.87	3.08	0.35506	.	0.226724	0.46145	N	0.000304	T	0.56124	0.1964	L	0.38175	1.15	0.37238	D	0.906008	D;D	0.69078	0.997;0.997	P;P	0.57468	0.821;0.821	T	0.58973	-0.7541	10	0.54805	T	0.06	.	5.9024	0.18974	0.2052:0.0:0.6592:0.1356	.	1589;1589	Q9UPZ6;C9JL67	THS7A_HUMAN;.	W	1589	ENSP00000406482:R1589W	ENSP00000262042:R1589W	R	-	1	2	THSD7A	11385258	0.960000	0.32886	0.994000	0.49952	0.996000	0.88848	0.464000	0.21988	0.382000	0.24878	0.650000	0.86243	CGG	.	.	none		0.493	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
CDH4	1002	hgsc.bcm.edu	37	20	60427861	60427861	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr20:60427861G>A	ENST00000360469.5	+	6	872	c.784G>A	c.(784-786)Gac>Aac	p.D262N	CDH4_ENST00000543233.1_Missense_Mutation_p.D188N	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	262	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GAACCCCATCGACCTGTACAT	0.597																																					p.D262N		Atlas-SNP	.											.	CDH4	172	.	0			c.G784A						PASS	.						174.0	131.0	146.0					20																	60427861		2203	4300	6503	SO:0001583	missense	1002	exon6			CCCATCGACCTGT	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.784G>A	20.37:g.60427861G>A	ENSP00000353656:p.Asp262Asn	44.0	0.0	0		59.0	19.0	0.322034	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546059	0.65198	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.50548	0.74;0.74	4.76	4.76	0.60689	Cadherin (4);Cadherin-like (1);	0.050803	0.85682	D	0.000000	T	0.35307	0.0927	L	0.37630	1.12	0.80722	D	1	P	0.40431	0.717	B	0.29716	0.106	T	0.21042	-1.0257	9	.	.	.	.	17.758	0.88455	0.0:0.0:1.0:0.0	.	262	P55283	CADH4_HUMAN	N	262;170;188	ENSP00000353656:D262N;ENSP00000443301:D188N	.	D	+	1	0	CDH4	59861256	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.517000	0.98020	2.202000	0.70862	0.561000	0.74099	GAC	.	.	none		0.597	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
XYLT2	64132	hgsc.bcm.edu	37	17	48431146	48431146	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:48431146G>A	ENST00000017003.2	+	2	340	c.291G>A	c.(289-291)cgG>cgA	p.R97R	XYLT2_ENST00000507602.1_Silent_p.R97R	NM_022167.2	NP_071450.2	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	97					chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			endometrium(2)|kidney(2)|large_intestine(4)|pancreas(1)|prostate(2)|urinary_tract(1)	12	Breast(11;7.18e-19)					AGGTGGTACGGGCAGTAACCA	0.721																																					p.R97R		Atlas-SNP	.											.	XYLT2	51	.	0			c.G291A						PASS	.						7.0	8.0	7.0					17																	48431146		2124	4155	6279	SO:0001819	synonymous_variant	64132	exon2			GGTACGGGCAGTA	AJ277442	CCDS11563.1	17q21.33	2013-02-25			ENSG00000015532	ENSG00000015532	2.4.2.26		15517	protein-coding gene	gene with protein product	"""protein xylosyltransferase 2"""	608125				11099377	Standard	NM_022167		Approved	XT-II, PXYLT2	uc002iqo.3	Q9H1B5	OTTHUMG00000162057	ENST00000017003.2:c.291G>A	17.37:g.48431146G>A		44.0	0.0	0		40.0	16.0	0.4	NM_022167	Q6UY41|Q86V00	Silent	SNP	ENST00000017003.2	37	CCDS11563.1																																																																																			.	.	none		0.721	XYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367046.1	NM_022167	
C19orf40	91442	hgsc.bcm.edu	37	19	33465059	33465059	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr19:33465059G>A	ENST00000588258.1	+	4	447	c.337G>A	c.(337-339)Gga>Aga	p.G113R	CEP89_ENST00000305768.5_5'Flank|C19orf40_ENST00000590281.1_Missense_Mutation_p.G113R|CEP89_ENST00000591863.1_5'Flank|C19orf40_ENST00000589646.1_Missense_Mutation_p.G18R|C19orf40_ENST00000590179.1_Missense_Mutation_p.G18R|CEP89_ENST00000590597.2_5'Flank	NM_152266.3	NP_689479.1	Q9BTP7	FAP24_HUMAN	chromosome 19 open reading frame 40	113					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7	Esophageal squamous(110;0.137)					GCTGGACCTTGGAATGGTGCT	0.483								Direct reversal of damage																													p.G113R		Atlas-SNP	.											.	C19orf40	21	.	0			c.G337A						PASS	.						99.0	84.0	89.0					19																	33465059		2203	4300	6503	SO:0001583	missense	91442	exon4			GACCTTGGAATGG	AK128668	CCDS12426.1, CCDS74327.1	19q13.11	2011-11-24			ENSG00000131944	ENSG00000131944			28467	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 24kDa"""	610884				17289582	Standard	XM_005259393		Approved	FLJ46828, MGC32020, FAAP24	uc002nud.4	Q9BTP7		ENST00000588258.1:c.337G>A	19.37:g.33465059G>A	ENSP00000466121:p.Gly113Arg	99.0	0.0	0		179.0	27.0	0.150838	NM_152266	B3KY46|Q8WUJ7|Q96FX6	Missense_Mutation	SNP	ENST00000588258.1	37	CCDS12426.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759304	0.89932	.	.	ENSG00000131944	ENST00000254262	.	.	.	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.78272	0.4257	M	0.72894	2.215	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.80291	-0.1444	9	0.52906	T	0.07	-16.8937	17.2132	0.86936	0.0:0.0:1.0:0.0	.	113	Q9BTP7	FAP24_HUMAN	R	113	.	ENSP00000254262:G113R	G	+	1	0	C19orf40	38156899	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.004000	0.93583	2.229000	0.72834	0.467000	0.42956	GGA	.	.	none		0.483	C19orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450823.2	NM_152266	
TNPO1	3842	hgsc.bcm.edu	37	5	72173116	72173116	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr5:72173116G>A	ENST00000337273.5	+	9	1289	c.863G>A	c.(862-864)tGg>tAg	p.W288*	TNPO1_ENST00000506351.2_Nonsense_Mutation_p.W280*|TNPO1_ENST00000454282.1_Nonsense_Mutation_p.W238*|TNPO1_ENST00000523768.1_Nonsense_Mutation_p.W238*|TNPO1_ENST00000447967.2_3'UTR|MIR4804_ENST00000581683.1_RNA	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	288					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		TGTGAATTTTGGCTAACTTTA	0.358																																					p.W288X		Atlas-SNP	.											.	TNPO1	90	.	0			c.G863A						PASS	.						106.0	103.0	104.0					5																	72173116		2203	4300	6503	SO:0001587	stop_gained	3842	exon9			AATTTTGGCTAAC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.863G>A	5.37:g.72173116G>A	ENSP00000336712:p.Trp288*	107.0	0.0	0		116.0	37.0	0.318966	NM_002270	B4DVC6|Q92957|Q92975	Nonsense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	G	37	6.330344	0.97480	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.7328	19.7884	0.96447	0.0:0.0:1.0:0.0	.	.	.	.	X	288;238;238;280	.	ENSP00000336712:W288X	W	+	2	0	TNPO1	72208872	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.318000	0.96334	2.758000	0.94735	0.650000	0.86243	TGG	.	.	none		0.358	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
PRICKLE2	166336	hgsc.bcm.edu	37	3	64148736	64148736	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:64148736G>A	ENST00000295902.6	-	3	799	c.214C>T	c.(214-216)Cga>Tga	p.R72*	PRICKLE2_ENST00000564377.1_Nonsense_Mutation_p.R128*	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	72	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.R72*(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		TGCTTGATTCGCAGTTTCTCT	0.463																																					p.R72X		Atlas-SNP	.											PRICKLE2,NS,carcinoma,0,1	PRICKLE2	88	1	1	Substitution - Nonsense(1)	stomach(1)	c.C214T						PASS	.						248.0	232.0	237.0					3																	64148736		2203	4300	6503	SO:0001587	stop_gained	166336	exon3			TGATTCGCAGTTT	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.214C>T	3.37:g.64148736G>A	ENSP00000295902:p.Arg72*	146.0	0.0	0		134.0	47.0	0.350746	NM_198859	Q0VF44	Nonsense_Mutation	SNP	ENST00000295902.6	37	CCDS2902.1	.	.	.	.	.	.	.	.	.	.	G	41	8.954524	0.99016	.	.	ENSG00000163637	ENST00000295902;ENST00000498162	.	.	.	5.77	2.64	0.31445	.	0.000000	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3932	15.4473	0.75240	0.0:0.0:0.5029:0.4971	.	.	.	.	X	72	.	ENSP00000295902:R72X	R	-	1	2	PRICKLE2	64123776	0.988000	0.35896	0.988000	0.46212	0.973000	0.67179	1.613000	0.36900	0.743000	0.32719	-0.284000	0.09977	CGA	.	.	none		0.463	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352219.1	NM_198859	
ADAT1	23536	hgsc.bcm.edu	37	16	75646759	75646759	+	Splice_Site	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr16:75646759C>T	ENST00000307921.3	-	7	570	c.425G>A	c.(424-426)tGt>tAt	p.C142Y		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	142	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						GGCATCCCCACCTGCAGAGAA	0.473																																					p.C142Y		Atlas-SNP	.											.	ADAT1	45	.	0			c.G425A						PASS	.						41.0	44.0	43.0					16																	75646759		2197	4299	6496	SO:0001630	splice_region_variant	23536	exon7			TCCCCACCTGCAG	AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.425-1G>A	16.37:g.75646759C>T		119.0	0.0	0		121.0	15.0	0.123967	NM_012091	Q9NVB7|Q9UNG3	Missense_Mutation	SNP	ENST00000307921.3	37	CCDS10922.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.971912	0.92919	.	.	ENSG00000065457	ENST00000307921;ENST00000542252	D	0.98221	-4.8	5.75	5.75	0.90469	Adenosine deaminase/editase (3);	0.085290	0.85682	D	0.000000	D	0.99318	0.9761	H	0.95187	3.635	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.98931	1.0787	10	0.87932	D	0	.	18.5379	0.91017	0.0:1.0:0.0:0.0	.	142	Q9BUB4	ADAT1_HUMAN	Y	142;113	ENSP00000310015:C142Y	ENSP00000310015:C142Y	C	-	2	0	ADAT1	74204260	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.747000	0.85070	2.716000	0.92895	0.655000	0.94253	TGT	.	.	none		0.473	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269027.1	NM_012091	Missense_Mutation
CCL2	6347	hgsc.bcm.edu	37	17	32583751	32583751	+	Missense_Mutation	SNP	A	A	T	rs148285031	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:32583751A>T	ENST00000225831.4	+	3	270	c.205A>T	c.(205-207)Att>Ttt	p.I69F	CCL2_ENST00000580907.1_3'UTR|AC005549.3_ENST00000601918.1_5'Flank	NM_002982.3	NP_002973.1	P13500	CCL2_HUMAN	chemokine (C-C motif) ligand 2	69					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|aging (GO:0007568)|angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeleton organization (GO:0007010)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|helper T cell extravasation (GO:0035684)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|maternal process involved in parturition (GO:0060137)|monocyte chemotaxis (GO:0002548)|negative regulation of angiogenesis (GO:0016525)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of natural killer cell chemotaxis (GO:2000502)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|organ regeneration (GO:0031100)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of calcium ion import (GO:0090280)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of T cell activation (GO:0050870)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of vascular endothelial growth factor production (GO:0010574)|response to activity (GO:0014823)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to vitamin B3 (GO:0033552)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	CCR2 chemokine receptor binding (GO:0031727)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			kidney(1)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	6	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Danazol(DB01406)|Mimosine(DB01055)	CTTCAAGACCATTGTGGCCAA	0.522																																					p.I69F		Atlas-SNP	.											.	CCL2	10	.	0			c.A205T						PASS	.						102.0	86.0	92.0					17																	32583751		2203	4300	6503	SO:0001583	missense	6347	exon3			AAGACCATTGTGG	BC009716	CCDS11277.1	17q11.2-q21.1	2013-02-25	2002-08-22	2002-08-23	ENSG00000108691	ENSG00000108691		"""Chemokine ligands"", ""Endogenous ligands"""	10618	protein-coding gene	gene with protein product	"""monocyte chemotactic protein 1, homologous to mouse Sig-je"", ""monocyte chemoattractant protein-1"", ""monocyte chemotactic and activating factor"", ""monocyte secretory protein JE"", ""small inducible cytokine subfamily A (Cys-Cys), member 2"""	158105	"""small inducible cytokine A2 (monocyte chemotactic protein 1, homologous to mouse Sig-je)"""	SCYA2		2004761	Standard	NM_002982		Approved	MCP1, MCP-1, MCAF, SMC-CF, GDCF-2, HC11, MGC9434	uc002hhy.3	P13500	OTTHUMG00000132887	ENST00000225831.4:c.205A>T	17.37:g.32583751A>T	ENSP00000225831:p.Ile69Phe	90.0	0.0	0		91.0	12.0	0.131868	NM_002982	B2R4V3|Q9UDF3	Missense_Mutation	SNP	ENST00000225831.4	37	CCDS11277.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.012994	0.35511	.	.	ENSG00000108691	ENST00000225831	T	0.04603	3.59	4.97	2.68	0.31781	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.619000	0.03674	N	0.244424	T	0.04998	0.0134	.	.	.	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.40136	-0.9579	9	0.66056	D	0.02	.	4.3276	0.11048	0.7323:0.0:0.0939:0.1739	.	69	P13500	CCL2_HUMAN	F	69	ENSP00000225831:I69F	ENSP00000225831:I69F	I	+	1	0	CCL2	29607864	0.000000	0.05858	0.000000	0.03702	0.862000	0.49288	-0.199000	0.09491	0.430000	0.26230	0.402000	0.26972	ATT	A|0.999;G|0.001	.	alt		0.522	CCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256384.2	NM_002982	
LATS2	26524	hgsc.bcm.edu	37	13	21562181	21562181	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr13:21562181C>T	ENST00000382592.4	-	4	2143	c.1738G>A	c.(1738-1740)Gtc>Atc	p.V580I	LATS2_ENST00000542899.1_Missense_Mutation_p.V580I|LATS2_ENST00000472754.1_5'Flank	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		TTTTTGCGGACGGGAACGGGA	0.557																																					p.V580I		Atlas-SNP	.											.	LATS2	176	.	0			c.G1738A						PASS	.						240.0	243.0	242.0					13																	21562181		2203	4300	6503	SO:0001583	missense	26524	exon4			TGCGGACGGGAAC	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1738G>A	13.37:g.21562181C>T	ENSP00000372035:p.Val580Ile	450.0	1.0	0.00222222		385.0	96.0	0.249351	NM_014572		Missense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558695	0.65538	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.41758	0.99;0.99	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000018	T	0.42854	0.1221	L	0.52905	1.665	0.58432	D	0.999998	P	0.47106	0.89	B	0.40741	0.339	T	0.41787	-0.9489	10	0.44086	T	0.13	.	18.8138	0.92070	0.0:1.0:0.0:0.0	.	580	Q9NRM7	LATS2_HUMAN	I	580	ENSP00000372035:V580I;ENSP00000441817:V580I	ENSP00000372035:V580I	V	-	1	0	LATS2	20460181	1.000000	0.71417	0.029000	0.17559	0.542000	0.35054	7.273000	0.78527	2.691000	0.91804	0.549000	0.68633	GTC	.	.	none		0.557	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1		
PCDHA8	56140	hgsc.bcm.edu	37	5	140222523	140222523	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr5:140222523C>T	ENST00000531613.1	+	1	1617	c.1617C>T	c.(1615-1617)gaC>gaT	p.D539D	PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.D539D|PCDHA3_ENST00000522353.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	539	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGCGCGACGCGGGCGTGC	0.672																																					p.D539D		Atlas-SNP	.											.	PCDHA8	366	.	0			c.C1617T						PASS	.						52.0	62.0	59.0					5																	140222523		2193	4266	6459	SO:0001819	synonymous_variant	56140	exon1			GCGCGACGCGGGC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1617C>T	5.37:g.140222523C>T		71.0	0.0	0		67.0	24.0	0.358209	NM_031856	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			.	.	none		0.672	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
HEPHL1	341208	hgsc.bcm.edu	37	11	93819329	93819329	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:93819329C>G	ENST00000315765.9	+	11	2062	c.2054C>G	c.(2053-2055)aCa>aGa	p.T685R		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	685	Plastocyanin-like 4.				copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.A687fs*12(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				ATGGCCACAACAGCATTCATG	0.517																																					p.T685R		Atlas-SNP	.											.	HEPHL1	144	.	1	Deletion - Frameshift(1)	ovary(1)	c.C2054G						PASS	.						72.0	69.0	70.0					11																	93819329		2013	4186	6199	SO:0001583	missense	341208	exon11			CCACAACAGCATT	BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.2054C>G	11.37:g.93819329C>G	ENSP00000313699:p.Thr685Arg	68.0	0.0	0		71.0	7.0	0.0985916	NM_001098672	Q3C1W7	Missense_Mutation	SNP	ENST00000315765.9	37	CCDS44710.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269221	0.80469	.	.	ENSG00000181333	ENST00000315765	D	0.99834	-7.04	5.94	5.94	0.96194	Cupredoxin (2);	0.099149	0.64402	D	0.000001	D	0.99680	0.9880	M	0.81239	2.535	0.51012	D	0.999906	D	0.54772	0.968	P	0.50231	0.635	D	0.98400	1.0567	10	0.72032	D	0.01	.	20.3736	0.98901	0.0:1.0:0.0:0.0	.	685	Q6MZM0	HPHL1_HUMAN	R	685	ENSP00000313699:T685R	ENSP00000313699:T685R	T	+	2	0	HEPHL1	93458977	1.000000	0.71417	0.100000	0.21137	0.672000	0.39443	7.332000	0.79203	2.820000	0.97059	0.650000	0.86243	ACA	.	.	none		0.517	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396103.2	XM_291947	
HRH1	3269	hgsc.bcm.edu	37	3	11302022	11302022	+	Silent	SNP	C	C	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:11302022C>A	ENST00000397056.1	+	3	1490	c.1299C>A	c.(1297-1299)atC>atA	p.I433I	HRH1_ENST00000438284.2_Silent_p.I433I|HRH1_ENST00000431010.2_Silent_p.I433I	NM_000861.3|NM_001098211.1	NP_000852.1|NP_001091681.1	P35367	HRH1_HUMAN	histamine receptor H1	433					cellular response to histamine (GO:0071420)|eosinophil chemotaxis (GO:0048245)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|inositol phosphate-mediated signaling (GO:0048016)|memory (GO:0007613)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|regulation of vascular permeability (GO:0043114)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|histamine receptor activity (GO:0004969)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25					Aceprometazine(DB01615)|Alcaftadine(DB06766)|Alimemazine(DB01246)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Antazoline(DB08799)|Aripiprazole(DB01238)|Asenapine(DB06216)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzatropine(DB00245)|Bepotastine(DB04890)|Betahistine(DB06698)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlorcyclizine(DB08936)|Chloropyramine(DB08800)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clemastine(DB00283)|Clofedanol(DB04837)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Dimetindene(DB08801)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Escitalopram(DB01175)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Iloperidone(DB04946)|Imipramine(DB00458)|Isothipendyl(DB08802)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Loxapine(DB00408)|Maprotiline(DB00934)|Meclizine(DB00737)|Mepyramine(DB06691)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Paliperidone(DB01267)|Phenindamine(DB01619)|Pheniramine(DB01620)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	CTTATTTCATCTTCTTCATGG	0.478																																					p.I433I		Atlas-SNP	.											HRH1,NS,lymphoid_neoplasm,+1,1	HRH1	58	1	0			c.C1299A						PASS	.						242.0	248.0	246.0					3																	11302022		2203	4300	6503	SO:0001819	synonymous_variant	3269	exon3			TTTCATCTTCTTC		CCDS2604.1	3p25	2012-11-12			ENSG00000196639	ENSG00000196639		"""GPCR / Class A : Histamine receptors"""	5182	protein-coding gene	gene with protein product		600167				8003029	Standard	NM_001098211		Approved		uc010hds.3	P35367	OTTHUMG00000129719	ENST00000397056.1:c.1299C>A	3.37:g.11302022C>A		84.0	0.0	0		97.0	26.0	0.268041	NM_000861	A8K047|Q6P9E5	Silent	SNP	ENST00000397056.1	37	CCDS2604.1																																																																																			.	.	none		0.478	HRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251928.2		
WIPI1	55062	hgsc.bcm.edu	37	17	66423340	66423340	+	Silent	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:66423340G>T	ENST00000262139.5	-	11	1127	c.1128C>A	c.(1126-1128)tcC>tcA	p.S376S	RP11-120M18.2_ENST00000592030.1_RNA|MIR635_ENST00000384830.1_RNA|WIPI1_ENST00000546360.1_Silent_p.S294S|WIPI1_ENST00000589459.1_5'UTR	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	376					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						ACTGAGGTAAGGAAGGTCTGA	0.498																																					p.S376S		Atlas-SNP	.											.	WIPI1	46	.	0			c.C1128A						PASS	.						356.0	280.0	306.0					17																	66423340		2203	4300	6503	SO:0001819	synonymous_variant	55062	exon11			AGGTAAGGAAGGT		CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.1128C>A	17.37:g.66423340G>T		121.0	0.0	0		108.0	5.0	0.0462963	NM_017983	Q8IXM5|Q9NWF8	Silent	SNP	ENST00000262139.5	37	CCDS11677.1																																																																																			.	.	none		0.498	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1	NM_017983	
HNRNPD	3184	hgsc.bcm.edu	37	4	83294683	83294683	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:83294683C>T	ENST00000313899.7	-	1	426	c.149G>A	c.(148-150)gGa>gAa	p.G50E	RP11-127B20.3_ENST00000609575.1_RNA|HNRNPD_ENST00000541060.1_5'UTR|HNRNPD_ENST00000352301.4_Missense_Mutation_p.G50E|RP11-127B20.3_ENST00000609552.1_RNA|HNRNPD_ENST00000543098.1_Intron|HNRNPD_ENST00000353341.4_Missense_Mutation_p.G50E	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	50					circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						agacgcggttccgcccccggt	0.726																																					p.G50E		Atlas-SNP	.											.	HNRNPD	23	.	0			c.G149A						PASS	.						31.0	22.0	25.0					4																	83294683		2046	3968	6014	SO:0001583	missense	3184	exon1			GCGGTTCCGCCCC	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.149G>A	4.37:g.83294683C>T	ENSP00000313199:p.Gly50Glu	67.0	0.0	0		60.0	18.0	0.3	NM_031370	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Missense_Mutation	SNP	ENST00000313899.7	37	CCDS3592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.92|12.92	2.081828|2.081828	0.36758|0.36758	.|.	.|.	ENSG00000138668|ENSG00000138668	ENST00000307213|ENST00000313899;ENST00000353341;ENST00000352301;ENST00000507010;ENST00000503822	.|T;T;T;T;T	.|0.70749	.|-0.38;-0.13;-0.51;2.07;1.63	3.73|3.73	3.73|3.73	0.42828|0.42828	.|CARG-binding factor, N-terminal (1);	.|0.784110	.|0.11609	.|N	.|0.546925	T|T	0.64338|0.64338	0.2589|0.2589	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.69078	.|0.997;0.997;0.997;0.997	.|D;D;D;D	.|0.74023	.|0.969;0.969;0.969;0.982	T|T	0.54879|0.54879	-0.8227|-0.8227	6|10	0.10902|0.06365	T|T	0.67|0.9	.|.	11.2766|11.2766	0.49170|0.49170	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|50;50;50;50	.|Q14103-4;Q14103-3;Q14103-2;Q14103	.|.;.;.;HNRPD_HUMAN	K|E	46|50	.|ENSP00000313199:G50E;ENSP00000313327:G50E;ENSP00000305860:G50E;ENSP00000421952:G50E;ENSP00000422615:G50E	ENSP00000307544:E46K|ENSP00000313199:G50E	E|G	-|-	1|2	0|0	HNRNPD|HNRNPD	83513707|83513707	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.839000|0.839000	0.47603|0.47603	2.895000|2.895000	0.48648|0.48648	2.108000|2.108000	0.64289|0.64289	0.479000|0.479000	0.44913|0.44913	GAA|GGA	.	.	none		0.726	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
LRP1B	53353	hgsc.bcm.edu	37	2	141571231	141571231	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:141571231A>G	ENST00000389484.3	-	32	6325	c.5354T>C	c.(5353-5355)aTc>aCc	p.I1785T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1785					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTACCCATGATGGTTAGGGC	0.368										TSP Lung(27;0.18)																											p.I1785T	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.T5354C						PASS	.						165.0	147.0	153.0					2																	141571231		2203	4300	6503	SO:0001583	missense	53353	exon32			CCCATGATGGTTA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5354T>C	2.37:g.141571231A>G	ENSP00000374135:p.Ile1785Thr	239.0	0.0	0		211.0	26.0	0.123223	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.520516	0.64747	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91792	-2.91	5.83	5.83	0.93111	Six-bladed beta-propeller, TolB-like (1);	0.072198	0.56097	D	0.000037	D	0.90611	0.7056	M	0.72894	2.215	0.58432	D	0.999994	P	0.43094	0.799	B	0.35931	0.214	D	0.91189	0.4982	10	0.52906	T	0.07	.	16.1982	0.82046	1.0:0.0:0.0:0.0	.	1785	Q9NZR2	LRP1B_HUMAN	T	1785;1723	ENSP00000374135:I1785T	ENSP00000374135:I1785T	I	-	2	0	LRP1B	141287701	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.282000	0.95840	2.226000	0.72624	0.533000	0.62120	ATC	.	.	none		0.368	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
EPHX1	2052	hgsc.bcm.edu	37	1	226016540	226016540	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:226016540G>T	ENST00000366837.4	+	2	306	c.110G>T	c.(109-111)gGc>gTc	p.G37V	EPHX1_ENST00000272167.5_Missense_Mutation_p.G37V	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	37					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					TGGGGGCCAGGCACGAGGTCC	0.592																																					p.G37V		Atlas-SNP	.											.	EPHX1	57	.	0			c.G110T						PASS	.						45.0	41.0	43.0					1																	226016540		2203	4300	6503	SO:0001583	missense	2052	exon2			GGCCAGGCACGAG	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.110G>T	1.37:g.226016540G>T	ENSP00000355802:p.Gly37Val	116.0	0.0	0		109.0	29.0	0.266055	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006109	0.54361	.	.	ENSG00000143819	ENST00000445856;ENST00000272167;ENST00000448202;ENST00000366837	T;T;T;T	0.19250	2.47;3.52;2.16;3.52	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.50051	0.1593	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.55623	-0.8112	10	0.72032	D	0.01	-4.5382	18.2926	0.90135	0.0:0.0:1.0:0.0	.	37	P07099	HYEP_HUMAN	V	37	ENSP00000398491:G37V;ENSP00000272167:G37V;ENSP00000408469:G37V;ENSP00000355802:G37V	ENSP00000272167:G37V	G	+	2	0	EPHX1	224083163	1.000000	0.71417	0.058000	0.19502	0.009000	0.06853	9.481000	0.97933	2.316000	0.78162	0.462000	0.41574	GGC	.	.	none		0.592	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
PPM1H	57460	hgsc.bcm.edu	37	12	63328431	63328431	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:63328431C>T	ENST00000228705.6	-	1	386	c.86G>A	c.(85-87)aGc>aAc	p.S29N	Y_RNA_ENST00000516851.1_RNA	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	29							phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		GCCTCCGCAGCTGCCGCCGCC	0.667																																					p.S29N		Atlas-SNP	.											.	PPM1H	42	.	0			c.G86A						PASS	.						6.0	9.0	8.0					12																	63328431		1801	3941	5742	SO:0001583	missense	57460	exon1			CCGCAGCTGCCGC	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.86G>A	12.37:g.63328431C>T	ENSP00000228705:p.Ser29Asn	76.0	0.0	0		77.0	27.0	0.350649	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	37	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341429	0.41498	.	.	ENSG00000111110	ENST00000228705	T	0.23147	1.92	3.82	3.82	0.43975	.	0.240619	0.25247	N	0.032057	T	0.18215	0.0437	L	0.33485	1.01	0.22666	N	0.99887	B	0.02656	0.0	B	0.01281	0.0	T	0.12066	-1.0562	9	.	.	.	-2.3967	11.0859	0.48086	0.0:1.0:0.0:0.0	.	29	Q9ULR3	PPM1H_HUMAN	N	29	ENSP00000228705:S29N	.	S	-	2	0	PPM1H	61614698	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.755000	0.47540	1.964000	0.57103	0.561000	0.74099	AGC	.	.	none		0.667	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
DTX1	1840	hgsc.bcm.edu	37	12	113496147	113496147	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:113496147C>T	ENST00000257600.3	+	1	653	c.150C>T	c.(148-150)aaC>aaT	p.N50N		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	50	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						ACATTGAGAACGTGCTGAAGG	0.652																																					p.N50N		Atlas-SNP	.											.	DTX1	83	.	0			c.C150T						PASS	.						118.0	102.0	108.0					12																	113496147		2203	4300	6503	SO:0001819	synonymous_variant	1840	exon1			TGAGAACGTGCTG	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.150C>T	12.37:g.113496147C>T		66.0	0.0	0		59.0	9.0	0.152542	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																			.	.	none		0.652	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651379	1651379	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:1651379G>A	ENST00000399676.2	+	1	347	c.309G>A	c.(307-309)ggG>ggA	p.G103G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	103	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TCTCCTGTGGGGTGTCCAAGG	0.677																																					p.G103G		Atlas-SNP	.											.	KRTAP5-5	86	.	0			c.G309A						PASS	.						53.0	69.0	63.0					11																	1651379		2199	4296	6495	SO:0001819	synonymous_variant	439915	exon1			CTGTGGGGTGTCC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.309G>A	11.37:g.1651379G>A		69.0	0.0	0		73.0	20.0	0.273973	NM_001001480	A8MWN2	Silent	SNP	ENST00000399676.2	37	CCDS41592.1																																																																																			.	.	none		0.677	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
VEGFB	7423	hgsc.bcm.edu	37	11	64004667	64004667	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:64004667A>G	ENST00000309422.2	+	5	679	c.383A>G	c.(382-384)aAa>aGa	p.K128R	RP11-783K16.14_ENST00000539963.1_RNA|VEGFB_ENST00000426086.2_Missense_Mutation_p.K128R|RP11-783K16.14_ENST00000534988.1_RNA	NM_001243733.1|NM_003377.4	NP_001230662.1|NP_003368.1	P49765	VEGFB_HUMAN	vascular endothelial growth factor B	128					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|coronary vasculature development (GO:0060976)|induction of positive chemotaxis (GO:0050930)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular wound healing (GO:0035470)|protein O-linked glycosylation (GO:0006493)|response to drug (GO:0042493)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|heparin binding (GO:0008201)|vascular endothelial growth factor receptor 1 binding (GO:0043183)			endometrium(2)|large_intestine(2)|prostate(1)|stomach(1)	6					Aflibercept(DB08885)	AGACCTAAAAAAAAGGACAGT	0.468																																					p.K128R		Atlas-SNP	.											VEGFB,NS,carcinoma,+1,2	VEGFB	18	2	0			c.A383G						PASS	.						138.0	122.0	128.0					11																	64004667		2201	4297	6498	SO:0001583	missense	7423	exon5			CTAAAAAAAAGGA	BC008818	CCDS8062.1, CCDS58144.1	11q13	2005-09-29				ENSG00000173511			12681	protein-coding gene	gene with protein product		601398		VRF		8637916, 8919691	Standard	NM_001243733		Approved	VEGFL	uc001nyw.3	P49765		ENST00000309422.2:c.383A>G	11.37:g.64004667A>G	ENSP00000311127:p.Lys128Arg	93.0	0.0	0		72.0	23.0	0.319444	NM_003377	Q16528	Missense_Mutation	SNP	ENST00000309422.2	37	CCDS8062.1	.	.	.	.	.	.	.	.	.	.	A	6.839	0.523936	0.13066	.	.	ENSG00000173511	ENST00000309422;ENST00000426086	.	.	.	4.49	2.07	0.26955	Platelet-derived growth factor (PDGF) (1);	0.627685	0.14547	N	0.312918	T	0.23846	0.0577	N	0.16656	0.425	0.20821	N	0.999844	B;B	0.12630	0.005;0.006	B;B	0.11329	0.006;0.005	T	0.17198	-1.0377	9	0.33141	T	0.24	-0.6901	6.5128	0.22232	0.7986:0.0:0.2014:0.0	.	128;128	P49765-2;P49765	.;VEGFB_HUMAN	R	128	.	ENSP00000311127:K128R	K	+	2	0	VEGFB	63761243	0.305000	0.24481	0.257000	0.24404	0.294000	0.27393	0.587000	0.23909	0.303000	0.22785	-0.421000	0.06004	AAA	.	.	none		0.468	VEGFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396393.2	NM_003377	
MLC1	23209	hgsc.bcm.edu	37	22	50521550	50521550	+	Missense_Mutation	SNP	G	G	A	rs145484765		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr22:50521550G>A	ENST00000311597.5	-	3	836	c.230C>T	c.(229-231)cCg>cTg	p.P77L	MLC1_ENST00000450140.2_Missense_Mutation_p.P77L|MLC1_ENST00000395876.2_Missense_Mutation_p.P77L|MLC1_ENST00000431262.2_Intron|MLC1_ENST00000538737.1_Missense_Mutation_p.P77L|MLC1_ENST00000535444.1_5'UTR	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	77					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		CATCTCAGCCGGGAACACGTT	0.612																																					p.P77L		Atlas-SNP	.											.	MLC1	48	.	0			c.C230T						PASS	.	G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	173.0	137.0	149.0		230,230	5.1	0.9	22	dbSNP_134	149	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	MLC1	NM_015166.3,NM_139202.2	98,98	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging	77/378,77/378	50521550	3,13003	2203	4300	6503	SO:0001583	missense	23209	exon3			TCAGCCGGGAACA	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.230C>T	22.37:g.50521550G>A	ENSP00000310375:p.Pro77Leu	37.0	0.0	0		50.0	15.0	0.3	NM_015166	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226551	0.79576	0.0	3.49E-4	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000450140	D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.96331	0.8803	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.96877	0.9643	10	0.87932	D	0	-1.3356	17.2773	0.87119	0.0:0.0:1.0:0.0	.	77;77;77	F5H1B9;B7Z1X1;Q15049	.;.;MLC1_HUMAN	L	77	ENSP00000379216:P77L;ENSP00000310375:P77L;ENSP00000445805:P77L;ENSP00000412448:P77L	ENSP00000310375:P77L	P	-	2	0	MLC1	48863677	1.000000	0.71417	0.902000	0.35471	0.418000	0.31294	8.814000	0.91968	2.360000	0.80028	0.655000	0.94253	CCG	G|1.000;A|0.000	0.000	weak		0.612	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166	
UNC5D	137970	hgsc.bcm.edu	37	8	35624423	35624423	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:35624423G>A	ENST00000404895.2	+	15	2645	c.2317G>A	c.(2317-2319)Gtc>Atc	p.V773I	UNC5D_ENST00000453357.2_Missense_Mutation_p.V768I|UNC5D_ENST00000287272.2_Missense_Mutation_p.V704I|UNC5D_ENST00000449677.1_Missense_Mutation_p.V349I|UNC5D_ENST00000416672.1_Missense_Mutation_p.V778I|UNC5D_ENST00000420357.1_Missense_Mutation_p.V706I	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	773					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCTGCAGGAAGTCCCGTTCTC	0.552																																					p.V773I		Atlas-SNP	.											.	UNC5D	393	.	0			c.G2317A						PASS	.						83.0	71.0	75.0					8																	35624423		2203	4300	6503	SO:0001583	missense	137970	exon15			CAGGAAGTCCCGT	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2317G>A	8.37:g.35624423G>A	ENSP00000385143:p.Val773Ile	63.0	0.0	0		63.0	14.0	0.222222	NM_080872	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	8.206	0.799214	0.16397	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.39997	1.08;1.55;1.58;1.09;1.05;3.01	5.79	5.79	0.91817	.	0.055301	0.64402	D	0.000001	T	0.21801	0.0525	N	0.04018	-0.295	0.47737	D	0.999503	B;B;B	0.26445	0.149;0.095;0.149	B;B;B	0.20955	0.025;0.032;0.014	T	0.18777	-1.0326	10	0.02654	T	1	-26.7072	20.0411	0.97590	0.0:0.0:1.0:0.0	.	349;768;773	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	I	773;706;704;778;768;349	ENSP00000385143:V773I;ENSP00000392739:V706I;ENSP00000287272:V704I;ENSP00000412652:V778I;ENSP00000394303:V768I;ENSP00000397211:V349I	ENSP00000287272:V704I	V	+	1	0	UNC5D	35743965	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.193000	0.65120	2.739000	0.93911	0.655000	0.94253	GTC	.	.	none		0.552	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
MUC4	4585	hgsc.bcm.edu	37	3	195506458	195506458	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:195506458G>A	ENST00000463781.3	-	2	12452	c.11993C>T	c.(11992-11994)gCc>gTc	p.A3998V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3998V|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGAGGGGTGGCGTGACCTGT	0.607																																					p.A3998V		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.C11993T						scavenged	.						14.0	11.0	12.0					3																	195506458		667	1478	2145	SO:0001583	missense	4585	exon2			GGGGTGGCGTGAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11993C>T	3.37:g.195506458G>A	ENSP00000417498:p.Ala3998Val	15.0	1.0	0.0666667		20.0	3.0	0.15	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	8.296	0.818787	0.16607	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.48836	1.3;0.8	0.764	-0.332	0.12675	.	0.000000	0.25514	U	0.030158	T	0.32763	0.0840	N	0.19112	0.55	0.09310	N	1	P	0.52170	0.951	P	0.52066	0.689	T	0.15350	-1.0440	9	.	.	.	.	1.7796	0.03028	0.253:0.0:0.4302:0.3168	rs2948678	3870	E7ESK3	.	V	3998	ENSP00000417498:A3998V;ENSP00000420243:A3998V	.	A	-	2	0	MUC4	196991237	0.000000	0.05858	0.001000	0.08648	0.181000	0.23173	-0.179000	0.09768	-0.110000	0.12022	0.064000	0.15345	GCC	.	.	none		0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
GRHPR	9380	hgsc.bcm.edu	37	9	37424891	37424891	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:37424891C>G	ENST00000318158.6	+	2	218	c.133C>G	c.(133-135)Cta>Gta	p.L45V	GRHPR_ENST00000607784.1_Missense_Mutation_p.L45V|GRHPR_ENST00000493368.1_3'UTR	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	45					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		TGCCAAGGAGCTAGAGCGAGG	0.667																																					p.L45V		Atlas-SNP	.											.	GRHPR	35	.	0			c.C133G						PASS	.						51.0	48.0	49.0					9																	37424891		2203	4300	6503	SO:0001583	missense	9380	exon2			AAGGAGCTAGAGC	AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.133C>G	9.37:g.37424891C>G	ENSP00000313432:p.Leu45Val	59.0	0.0	0		45.0	9.0	0.2	NM_012203	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	ENST00000318158.6	37	CCDS6609.1	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950791	0.53186	.	.	ENSG00000137106	ENST00000377824;ENST00000318158	D;D	0.86497	-2.13;-2.13	5.98	4.14	0.48551	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.91123	0.7205	M	0.71206	2.165	0.80722	D	1	P	0.52577	0.954	P	0.61800	0.894	D	0.91620	0.5310	10	0.72032	D	0.01	-4.6267	11.2546	0.49045	0.0:0.8007:0.0:0.1993	.	45	Q9UBQ7	GRHPR_HUMAN	V	45	ENSP00000367055:L45V;ENSP00000313432:L45V	ENSP00000313432:L45V	L	+	1	2	GRHPR	37414891	1.000000	0.71417	1.000000	0.80357	0.084000	0.17831	2.842000	0.48230	1.558000	0.49541	0.650000	0.86243	CTA	.	.	none		0.667	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052442.1	NM_012203	
BRINP3	339479	hgsc.bcm.edu	37	1	190423955	190423955	+	Silent	SNP	T	T	C	rs190123682		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:190423955T>C	ENST00000367462.3	-	2	297	c.66A>G	c.(64-66)gcA>gcG	p.A22A	BRINP3_ENST00000534846.1_5'UTR	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	22					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GAAGACTCAGTGCTATCCACT	0.512																																					p.A22A		Atlas-SNP	.											.	FAM5C	343	.	0			c.A66G						PASS	.						82.0	80.0	81.0					1																	190423955		2203	4300	6503	SO:0001819	synonymous_variant	339479	exon2			ACTCAGTGCTATC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.66A>G	1.37:g.190423955T>C		100.0	0.0	0		94.0	29.0	0.308511	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	37	CCDS1373.1																																																																																			T|0.999;G|0.001	.	alt		0.512	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
MMP2	4313	hgsc.bcm.edu	37	16	55518022	55518022	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr16:55518022T>G	ENST00000219070.4	+	3	984	c.475T>G	c.(475-477)Ttt>Gtt	p.F159V	MMP2_ENST00000437642.2_Missense_Mutation_p.F109V|MMP2_ENST00000570308.1_Missense_Mutation_p.F83V|MMP2_ENST00000543485.1_Missense_Mutation_p.F83V	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	159	Collagenase-like 1.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	CCCACTGCGGTTTTCTCGAAT	0.552																																					p.F159V		Atlas-SNP	.											MMP2,NS,carcinoma,-1,1	MMP2	119	1	0			c.T475G						PASS	.						150.0	121.0	131.0					16																	55518022		2198	4300	6498	SO:0001583	missense	4313	exon3			CTGCGGTTTTCTC		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.475T>G	16.37:g.55518022T>G	ENSP00000219070:p.Phe159Val	117.0	0.0	0		123.0	56.0	0.455285	NM_004530	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	37	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.162604	0.78226	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.54279	0.58;0.58;0.58	4.72	4.72	0.59763	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.047110	0.85682	D	0.000000	T	0.67449	0.2894	M	0.90198	3.095	0.80722	D	1	P;P	0.50369	0.75;0.934	P;P	0.48227	0.571;0.538	T	0.77005	-0.2748	10	0.72032	D	0.01	.	14.5064	0.67755	0.0:0.0:0.0:1.0	.	109;159	E9PE45;P08253	.;MMP2_HUMAN	V	159;83;109	ENSP00000219070:F159V;ENSP00000444143:F83V;ENSP00000394237:F109V	ENSP00000219070:F159V	F	+	1	0	MMP2	54075523	1.000000	0.71417	0.975000	0.42487	0.982000	0.71751	5.073000	0.64395	1.902000	0.55061	0.374000	0.22700	TTT	.	.	none		0.552	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3		
RASEF	158158	hgsc.bcm.edu	37	9	85597645	85597645	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:85597645T>A	ENST00000376447.3	-	17	2430	c.2170A>T	c.(2170-2172)Acc>Tcc	p.T724S		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	724					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TTGGTCCCGGTTAGATTGGTA	0.428																																					p.T724S		Atlas-SNP	.											.	RASEF	69	.	0			c.A2170T						PASS	.						390.0	359.0	369.0					9																	85597645		2203	4300	6503	SO:0001583	missense	158158	exon17			TCCCGGTTAGATT	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.2170A>T	9.37:g.85597645T>A	ENSP00000365630:p.Thr724Ser	303.0	0.0	0		216.0	54.0	0.25	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	37	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	T	1.831	-0.469844	0.04445	.	.	ENSG00000165105	ENST00000376447	T	0.60299	0.2	5.05	2.74	0.32292	.	0.565295	0.19132	N	0.121917	T	0.23806	0.0576	N	0.03608	-0.345	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.18272	-1.0342	10	0.07482	T	0.82	.	2.812	0.05444	0.1889:0.2494:0.0:0.5616	.	724	Q8IZ41	RASEF_HUMAN	S	724	ENSP00000365630:T724S	ENSP00000365630:T724S	T	-	1	0	RASEF	84787465	0.035000	0.19736	0.053000	0.19242	0.783000	0.44284	0.275000	0.18698	0.795000	0.33922	0.482000	0.46254	ACC	.	.	none		0.428	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
MGAT5B	146664	hgsc.bcm.edu	37	17	74922752	74922752	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:74922752G>A	ENST00000569840.2	+	10	1805	c.1231G>A	c.(1231-1233)Ggc>Agc	p.G411S	MGAT5B_ENST00000428789.2_Missense_Mutation_p.G422S|MGAT5B_ENST00000301618.4_Missense_Mutation_p.G411S	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	411					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CACGCTGCACGGCTACCGGAC	0.637																																					p.G422S		Atlas-SNP	.											.	MGAT5B	98	.	0			c.G1264A						PASS	.						119.0	103.0	108.0					17																	74922752		2203	4295	6498	SO:0001583	missense	146664	exon9			CTGCACGGCTACC	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1231G>A	17.37:g.74922752G>A	ENSP00000456037:p.Gly411Ser	28.0	0.0	0		25.0	9.0	0.36	NM_198955	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	ENST00000569840.2	37	CCDS59299.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.886158	0.91814	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.48522	0.81;0.81	5.14	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.63815	0.2543	L	0.58302	1.8	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.66252	-0.5970	10	0.59425	D	0.04	-39.314	14.4167	0.67155	0.0:0.1487:0.8513:0.0	.	422;411	Q3V5L5-2;Q3V5L5-5	.;.	S	411;422	ENSP00000301618:G411S;ENSP00000391227:G422S	ENSP00000301618:G411S	G	+	1	0	MGAT5B	72434347	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	9.627000	0.98412	1.082000	0.41137	0.561000	0.74099	GGC	.	.	none		0.637	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460624.2	NM_144677	
INPP4B	8821	hgsc.bcm.edu	37	4	143129658	143129658	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:143129658C>T	ENST00000513000.1	-	15	1425	c.992G>A	c.(991-993)aGc>aAc	p.S331N	INPP4B_ENST00000262992.4_Missense_Mutation_p.S331N|INPP4B_ENST00000508116.1_Missense_Mutation_p.S331N|INPP4B_ENST00000308502.4_Missense_Mutation_p.S331N|INPP4B_ENST00000509777.1_Missense_Mutation_p.S331N	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	331					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CTCTCCTTTGCTGCTGCTTGA	0.303																																					p.S331N		Atlas-SNP	.											INPP4B,NS,carcinoma,-1,1	INPP4B	132	1	0			c.G992A						PASS	.						101.0	100.0	100.0					4																	143129658		2203	4300	6503	SO:0001583	missense	8821	exon15			CCTTTGCTGCTGC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.992G>A	4.37:g.143129658C>T	ENSP00000425487:p.Ser331Asn	220.0	0.0	0		206.0	30.0	0.145631	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	37	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	3.515	-0.098886	0.07010	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.71	3.07	0.35406	.	0.135929	0.64402	D	0.000002	T	0.23410	0.0566	L	0.44542	1.39	0.41670	D	0.989239	B;B	0.13145	0.003;0.007	B;B	0.17722	0.007;0.019	T	0.05632	-1.0873	10	0.18276	T	0.48	.	10.0078	0.41968	0.0:0.7762:0.0:0.2238	.	202;331	B7Z6T2;O15327	.;INP4B_HUMAN	N	331;331;331;202;331;331;146;146;331;202	ENSP00000425487:S331N;ENSP00000262992:S331N;ENSP00000308441:S331N;ENSP00000423954:S331N;ENSP00000422793:S331N;ENSP00000426207:S146N;ENSP00000427250:S331N;ENSP00000421065:S202N	ENSP00000262992:S331N	S	-	2	0	INPP4B	143349108	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.877000	0.39598	0.777000	0.33496	-0.300000	0.09419	AGC	.	.	none		0.303	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
PCDHA1	56147	hgsc.bcm.edu	37	5	140167650	140167650	+	Missense_Mutation	SNP	C	C	T	rs190769137		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr5:140167650C>T	ENST00000504120.2	+	1	1775	c.1775C>T	c.(1774-1776)gCg>gTg	p.A592V	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Missense_Mutation_p.A592V	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	592	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATGTGGTGGCGAAGGTGCGC	0.687																																					p.A592V		Atlas-SNP	.											PCDHA1_ENST00000504120,NS,carcinoma,+1,2	PCDHA1	387	2	0			c.C1775T						PASS	.						105.0	98.0	101.0					5																	140167650		2203	4299	6502	SO:0001583	missense	56147	exon1			TGGTGGCGAAGGT	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1775C>T	5.37:g.140167650C>T	ENSP00000420840:p.Ala592Val	130.0	0.0	0		139.0	46.0	0.330935	NM_031410	O75288|Q9NRT7	Missense_Mutation	SNP	ENST00000504120.2	37	CCDS54913.1	.	.	.	.	.	.	.	.	.	.	c	13.07	2.127280	0.37533	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.51574	0.7;0.7	3.36	3.36	0.38483	Cadherin (3);Cadherin-like (1);	0.410677	0.17341	U	0.177745	T	0.39860	0.1094	L	0.52011	1.625	0.26452	N	0.975595	B;B	0.34372	0.451;0.191	B;B	0.29598	0.104;0.063	T	0.40117	-0.9580	10	0.59425	D	0.04	.	11.6879	0.51497	0.0:0.7539:0.2461:0.0	.	592;592	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	V	592	ENSP00000420840:A592V;ENSP00000367373:A592V	ENSP00000367373:A592V	A	+	2	0	PCDHA1	140147834	0.000000	0.05858	0.977000	0.42913	0.384000	0.30261	0.552000	0.23376	1.572000	0.49736	0.484000	0.47621	GCG	C|1.000;G|0.000	.	alt		0.687	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
MAML3	55534	hgsc.bcm.edu	37	4	140811100	140811100	+	Missense_Mutation	SNP	T	T	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:140811100T>C	ENST00000509479.2	-	2	2346	c.1490A>G	c.(1489-1491)cAg>cGg	p.Q497R	MAML3_ENST00000327122.5_Missense_Mutation_p.Q341R|MAML3_ENST00000398940.1_Splice_Site_p.Q36R	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					ctgctgctgctgctgctgctg	0.542																																					p.Q497R		Atlas-SNP	.											MAML3_ENST00000509479,caecum,carcinoma,+1,12	MAML3	192	12	0			c.A1490G						PASS	.						13.0	19.0	17.0					4																	140811100		2113	4228	6341	SO:0001583	missense	55534	exon2			TGCTGCTGCTGCT	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1490A>G	4.37:g.140811100T>C	ENSP00000421180:p.Gln497Arg	94.0	0.0	0		90.0	14.0	0.155556	NM_018717		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	t	10.16	1.273989	0.23221	.	.	ENSG00000196782	ENST00000509479;ENST00000327122;ENST00000398940	T;T	0.55052	0.54;0.54	4.53	4.53	0.55603	.	0.270437	0.26275	N	0.025317	T	0.45577	0.1349	N	0.08118	0	0.34541	D	0.710295	P	0.45126	0.851	P	0.55391	0.775	T	0.60571	-0.7237	10	0.51188	T	0.08	.	10.2567	0.43401	0.0:0.0:0.0:1.0	.	497	Q96JK9	MAML3_HUMAN	R	497;341;36	ENSP00000421180:Q497R;ENSP00000313316:Q341R	ENSP00000313316:Q341R	Q	-	2	0	MAML3	141030550	0.992000	0.36948	0.937000	0.37676	0.553000	0.35397	-0.323000	0.07997	1.657000	0.50732	0.374000	0.22700	CAG	.	.	none		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
DES	1674	hgsc.bcm.edu	37	2	220283213	220283213	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:220283213G>A	ENST00000373960.3	+	1	115	c.29G>A	c.(28-30)cGc>cAc	p.R10H		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	10	Head.				cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		TCCAGCCAGCGCGTGTCCTCC	0.751																																					p.R10H		Atlas-SNP	.											.	DES	53	.	0			c.G29A						PASS	.						9.0	11.0	11.0					2																	220283213		1907	3736	5643	SO:0001583	missense	1674	exon1			GCCAGCGCGTGTC	AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.29G>A	2.37:g.220283213G>A	ENSP00000363071:p.Arg10His	82.0	0.0	0		85.0	18.0	0.211765	NM_001927	Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Missense_Mutation	SNP	ENST00000373960.3	37	CCDS33383.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.780499	0.70222	.	.	ENSG00000175084	ENST00000373960	D	0.83506	-1.73	5.12	4.24	0.50183	Intermediate filament head, DNA-binding domain (1);	0.124060	0.34603	N	0.003830	T	0.81103	0.4753	L	0.57536	1.79	0.41720	D	0.989502	D	0.53885	0.963	B	0.42593	0.392	D	0.83492	0.0070	10	0.62326	D	0.03	.	14.9895	0.71374	0.0:0.0:0.8562:0.1438	.	10	P17661	DESM_HUMAN	H	10	ENSP00000363071:R10H	ENSP00000363071:R10H	R	+	2	0	DES	219991457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.656000	0.46716	1.283000	0.44513	0.555000	0.69702	CGC	.	.	none		0.751	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130240.1	NM_001927	
ZMYM4	9202	hgsc.bcm.edu	37	1	35885121	35885121	+	Missense_Mutation	SNP	G	G	A	rs142484548		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:35885121G>A	ENST00000314607.6	+	30	4570	c.4490G>A	c.(4489-4491)cGc>cAc	p.R1497H	ZMYM4_ENST00000373297.2_Missense_Mutation_p.R1408H	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	1497					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CAACCTGAGCGCTCCTGTGTC	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		18645	0.0		0.001	False		,,,				2504	0.0				p.R1497H		Atlas-SNP	.											.	ZMYM4	143	.	0			c.G4490A						PASS	.	G	HIS/ARG	0,4406		0,0,2203	116.0	114.0	115.0		4490	4.8	1.0	1	dbSNP_134	115	3,8597	3.0+/-9.4	0,3,4297	no	missense	ZMYM4	NM_005095.2	29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	1497/1549	35885121	3,13003	2203	4300	6503	SO:0001583	missense	9202	exon30			CTGAGCGCTCCTG	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.4490G>A	1.37:g.35885121G>A	ENSP00000322915:p.Arg1497His	102.0	0.0	0		89.0	28.0	0.314607	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	19.99	3.928681	0.73327	0.0	3.49E-4	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.25749	1.78;1.8	5.82	4.85	0.62838	.	0.046961	0.85682	D	0.000000	T	0.48150	0.1484	M	0.68317	2.08	0.58432	D	0.999998	D	0.71674	0.998	D	0.75020	0.985	T	0.31223	-0.9951	10	0.39692	T	0.17	-7.0451	15.7205	0.77705	0.0:0.0:0.8628:0.1372	.	1497	Q5VZL5	ZMYM4_HUMAN	H	1497;1408	ENSP00000322915:R1497H;ENSP00000362394:R1408H	ENSP00000322915:R1497H	R	+	2	0	ZMYM4	35657708	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.988000	0.70579	2.752000	0.94435	0.655000	0.94253	CGC	G|1.000;A|0.000	0.000	strong		0.438	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	
BEGAIN	57596	hgsc.bcm.edu	37	14	101005056	101005056	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr14:101005056C>G	ENST00000355173.2	-	7	1103	c.1032G>C	c.(1030-1032)gaG>gaC	p.E344D	BEGAIN_ENST00000443071.2_Missense_Mutation_p.E344D|BEGAIN_ENST00000556751.1_Missense_Mutation_p.E280D|CTD-2062F14.3_ENST00000553301.1_lincRNA	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	344						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GAGGGCTGCCCTCGTAGGTGG	0.721																																					p.E344D	NSCLC(159;1889 2010 9965 27479 40101)	Atlas-SNP	.											.	BEGAIN	32	.	0			c.G1032C						PASS	.						26.0	21.0	23.0					14																	101005056		2155	4244	6399	SO:0001583	missense	57596	exon7			GCTGCCCTCGTAG	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.1032G>C	14.37:g.101005056C>G	ENSP00000347301:p.Glu344Asp	147.0	0.0	0		625.0	37.0	0.0592	NM_020836	Q9NPU3|Q9P282	Missense_Mutation	SNP	ENST00000355173.2	37	CCDS9962.1	.	.	.	.	.	.	.	.	.	.	C	7.497	0.651923	0.14516	.	.	ENSG00000183092	ENST00000355173;ENST00000556751;ENST00000443071	.	.	.	4.17	2.26	0.28386	.	0.267762	0.26282	N	0.025278	T	0.15522	0.0374	N	0.04880	-0.145	0.22796	N	0.998728	B	0.22211	0.066	B	0.24006	0.05	T	0.29427	-1.0012	9	0.14252	T	0.57	.	8.346	0.32272	0.0:0.719:0.1908:0.0902	.	344	Q9BUH8	BEGIN_HUMAN	D	344;280;344	.	ENSP00000347301:E344D	E	-	3	2	BEGAIN	100074809	0.958000	0.32768	0.475000	0.27278	0.055000	0.15305	0.567000	0.23608	0.201000	0.20466	0.462000	0.41574	GAG	.	.	none		0.721	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	NM_020836	
OR6C75	390323	hgsc.bcm.edu	37	12	55759668	55759668	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:55759668T>G	ENST00000343399.3	+	1	774	c.774T>G	c.(772-774)atT>atG	p.I258M		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TCATGTACATTAAGACTTCTG	0.413																																					p.I258M		Atlas-SNP	.											.	OR6C75	67	.	0			c.T774G						PASS	.						94.0	83.0	87.0					12																	55759668		2203	4300	6503	SO:0001583	missense	390323	exon1			GTACATTAAGACT		CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.774T>G	12.37:g.55759668T>G	ENSP00000368987:p.Ile258Met	79.0	0.0	0		88.0	27.0	0.306818	NM_001005497		Missense_Mutation	SNP	ENST00000343399.3	37	CCDS31820.1	.	.	.	.	.	.	.	.	.	.	t	10.13	1.265821	0.23136	.	.	ENSG00000187857	ENST00000343399	T	0.38722	1.12	5.22	-2.86	0.05717	GPCR, rhodopsin-like superfamily (1);	0.145223	0.31199	N	0.008068	T	0.21387	0.0515	N	0.20986	0.625	0.24027	N	0.99612	B	0.28128	0.201	B	0.33799	0.17	T	0.08848	-1.0702	10	0.44086	T	0.13	.	1.1064	0.01694	0.2021:0.2798:0.2947:0.2233	.	258	A6NL08	O6C75_HUMAN	M	258	ENSP00000368987:I258M	ENSP00000368987:I258M	I	+	3	3	OR6C75	54045935	0.000000	0.05858	0.991000	0.47740	0.983000	0.72400	-3.438000	0.00471	-0.367000	0.08052	-0.362000	0.07510	ATT	.	.	none		0.413	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406418.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138804	37138804	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:37138804G>T	ENST00000373509.5	+	3	610	c.237G>T	c.(235-237)gaG>gaT	p.E79D		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	170					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.E79D(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	ACTGGGGAGAGCTGGTGAGTG	0.687			T	BCL6	NHL																																p.E170D		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,4	PIM1	71	4	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G510T						PASS	.						51.0	53.0	52.0					6																	37138804		2203	4300	6503	SO:0001583	missense	5292	exon3			GGGAGAGCTGGTG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.237G>T	6.37:g.37138804G>T	ENSP00000362608:p.Glu79Asp	83.0	0.0	0		82.0	22.0	0.268293	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.999653	0.35320	.	.	ENSG00000137193	ENST00000373509	T	0.66280	-0.2	4.44	0.389	0.16269	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.068351	0.56097	D	0.000034	T	0.16938	0.0407	N	0.11023	0.085	0.34210	D	0.674133	B	0.15473	0.013	B	0.14578	0.011	T	0.02345	-1.1173	10	0.37606	T	0.19	.	4.6029	0.12363	0.4591:0.0:0.3935:0.1474	.	170	P11309	PIM1_HUMAN	D	79	ENSP00000362608:E79D	ENSP00000362608:E79D	E	+	3	2	PIM1	37246782	0.728000	0.28080	0.985000	0.45067	0.975000	0.68041	0.054000	0.14205	-0.042000	0.13535	0.549000	0.68633	GAG	.	.	none		0.687	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
AP1M1	8907	hgsc.bcm.edu	37	19	16319908	16319908	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr19:16319908G>A	ENST00000291439.3	+	5	915	c.466G>A	c.(466-468)Gcg>Acg	p.A156T	AP1M1_ENST00000590756.1_Missense_Mutation_p.A84T|AP1M1_ENST00000444449.2_Missense_Mutation_p.A156T|AP1M1_ENST00000429941.2_Missense_Mutation_p.A156T|AP1M1_ENST00000541844.1_Missense_Mutation_p.A84T	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	156					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CGTCACCAACGCGGTGTCCTG	0.582																																					p.A156T		Atlas-SNP	.											.	AP1M1	48	.	0			c.G466A						PASS	.						132.0	119.0	124.0					19																	16319908		2203	4300	6503	SO:0001583	missense	8907	exon5			ACCAACGCGGTGT		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.466G>A	19.37:g.16319908G>A	ENSP00000291439:p.Ala156Thr	109.0	0.0	0		98.0	26.0	0.265306	NM_001130524	Q4TTY5	Missense_Mutation	SNP	ENST00000291439.3	37	CCDS12342.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027439	0.75390	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.66460	0.4;0.37;0.38;-0.21	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.79981	0.4540	M	0.68728	2.09	0.80722	D	1	P;D;D	0.89917	0.539;1.0;1.0	B;D;D	0.97110	0.14;1.0;0.999	T	0.81936	-0.0705	10	0.56958	D	0.05	-20.3738	16.0736	0.80951	0.0:0.0:1.0:0.0	.	156;156;156	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	T	156;156;84;156	ENSP00000388996:A156T;ENSP00000291439:A156T;ENSP00000445682:A84T;ENSP00000411498:A156T	ENSP00000291439:A156T	A	+	1	0	AP1M1	16180908	1.000000	0.71417	0.668000	0.29813	0.779000	0.44077	9.400000	0.97290	2.249000	0.74217	0.563000	0.77884	GCG	.	.	none		0.582	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460492.1	NM_032493	
NFKBIA	4792	hgsc.bcm.edu	37	14	35873697	35873697	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr14:35873697T>A	ENST00000216797.5	-	1	255	c.154A>T	c.(154-156)Atc>Ttc	p.I52F	NFKBIA_ENST00000557100.1_5'UTR|NFKBIA_ENST00000557140.1_Missense_Mutation_p.I52F|NFKBIA_ENST00000557389.1_5'Flank	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	52					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	TCGAGGCGGATCTCCTGCAGC	0.682																																					p.I52F		Atlas-SNP	.											.	NFKBIA	28	.	0			c.A154T						PASS	.						17.0	18.0	18.0					14																	35873697		2200	4296	6496	SO:0001583	missense	4792	exon1			GGCGGATCTCCTG		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.154A>T	14.37:g.35873697T>A	ENSP00000216797:p.Ile52Phe	74.0	0.0	0		55.0	18.0	0.327273	NM_020529	B2R8L6	Missense_Mutation	SNP	ENST00000216797.5	37	CCDS9656.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.057033	0.76074	.	.	ENSG00000100906	ENST00000216797;ENST00000557140	T;T	0.49720	0.87;0.77	3.87	3.87	0.44632	.	.	.	.	.	T	0.41994	0.1183	L	0.51422	1.61	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.32134	-0.9918	9	0.36615	T	0.2	-37.6328	12.9569	0.58432	0.0:0.0:0.0:1.0	.	52;52	G3V3I4;P25963	.;IKBA_HUMAN	F	52	ENSP00000216797:I52F;ENSP00000451257:I52F	ENSP00000216797:I52F	I	-	1	0	NFKBIA	34943448	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.352000	0.66028	1.510000	0.48803	0.260000	0.18958	ATC	.	.	none		0.682	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
ASTN2	23245	hgsc.bcm.edu	37	9	120053673	120053673	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:120053673C>T	ENST00000313400.4	-	2	662	c.562G>A	c.(562-564)Gcc>Acc	p.A188T	ASTN2_ENST00000373996.3_Missense_Mutation_p.A188T|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000361209.2_Missense_Mutation_p.A188T			O75129	ASTN2_HUMAN	astrotactin 2	188					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						AGAGTGGGGGCGGTGGCTTGG	0.612																																					p.A188T		Atlas-SNP	.											.	ASTN2	307	.	0			c.G562A						PASS	.						58.0	59.0	59.0					9																	120053673		2203	4300	6503	SO:0001583	missense	23245	exon2			TGGGGGCGGTGGC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.562G>A	9.37:g.120053673C>T	ENSP00000314038:p.Ala188Thr	108.0	0.0	0		102.0	30.0	0.294118	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	37		.	.	.	.	.	.	.	.	.	.	C	19.69	3.874260	0.72180	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.09911	2.94;2.94;2.93	5.06	2.05	0.26809	.	0.244788	0.32548	N	0.005950	T	0.06917	0.0176	N	0.24115	0.695	0.32617	N	0.523907	P;B;P	0.44627	0.769;0.003;0.839	B;B;B	0.42188	0.113;0.001;0.379	T	0.25222	-1.0138	9	.	.	.	-22.1157	6.4925	0.22123	0.0:0.5158:0.3027:0.1815	.	188;188;188	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	T	188	ENSP00000314038:A188T;ENSP00000363108:A188T;ENSP00000354504:A188T	.	A	-	1	0	ASTN2	119093494	0.958000	0.32768	0.990000	0.47175	0.990000	0.78478	1.685000	0.37659	0.840000	0.34995	-0.119000	0.15052	GCC	.	.	none		0.612	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
HNF4G	3174	hgsc.bcm.edu	37	8	76463645	76463645	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:76463645A>C	ENST00000354370.1	+	5	534	c.264A>C	c.(262-264)agA>agC	p.R88S	HNF4G_ENST00000396423.2_Missense_Mutation_p.R125S			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	88					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			AACGTGACAGAATAAGCACCA	0.423																																					p.R125S		Atlas-SNP	.											.	HNF4G	111	.	0			c.A375C						PASS	.						134.0	105.0	115.0					8																	76463645		2203	4300	6503	SO:0001583	missense	3174	exon4			TGACAGAATAAGC		CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.264A>C	8.37:g.76463645A>C	ENSP00000346339:p.Arg88Ser	70.0	0.0	0		49.0	9.0	0.183673	NM_004133	Q7Z2V9|Q9UH81|Q9UIS6	Missense_Mutation	SNP	ENST00000354370.1	37		.	.	.	.	.	.	.	.	.	.	A	18.28	3.589200	0.66105	.	.	ENSG00000164749	ENST00000354370;ENST00000396423	D;D	0.94687	-3.49;-3.49	5.07	3.74	0.42951	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.93090	0.7800	M	0.81942	2.565	0.58432	D	0.999992	B;P	0.41784	0.269;0.762	B;B	0.43194	0.141;0.411	D	0.92226	0.5788	10	0.72032	D	0.01	.	3.366	0.07203	0.6409:0.0:0.3591:0.0	.	125;88	F1D8Q4;Q14541	.;HNF4G_HUMAN	S	88;125	ENSP00000346339:R88S;ENSP00000379701:R125S	ENSP00000346339:R88S	R	+	3	2	HNF4G	76626200	1.000000	0.71417	0.996000	0.52242	0.873000	0.50193	2.625000	0.46452	2.026000	0.59711	0.528000	0.53228	AGA	.	.	none		0.423	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000313914.2	NM_004133	
CNTN1	1272	hgsc.bcm.edu	37	12	41316167	41316167	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:41316167T>A	ENST00000551295.2	+	5	454	c.337T>A	c.(337-339)Tac>Aac	p.Y113N	CNTN1_ENST00000547849.1_Missense_Mutation_p.Y113N|CNTN1_ENST00000360099.3_Missense_Mutation_p.Y113N|CNTN1_ENST00000547702.1_Missense_Mutation_p.Y113N|CNTN1_ENST00000347616.1_Missense_Mutation_p.Y113N|CNTN1_ENST00000348761.2_Missense_Mutation_p.Y102N	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	113	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TGGAATATACTACTGTTTAGC	0.408																																					p.Y113N		Atlas-SNP	.											.	CNTN1	207	.	0			c.T337A						PASS	.						126.0	113.0	117.0					12																	41316167		2203	4300	6503	SO:0001583	missense	1272	exon5			ATATACTACTGTT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.337T>A	12.37:g.41316167T>A	ENSP00000447006:p.Tyr113Asn	110.0	0.0	0		121.0	17.0	0.140496	NM_001256063	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.031394	0.54790	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73;2.73	5.65	4.43	0.53597	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.389023	0.28560	N	0.014920	T	0.12518	0.0304	N	0.16833	0.445	0.32815	D	0.501984	B;B;B	0.25206	0.12;0.072;0.089	B;B;B	0.38156	0.137;0.173;0.266	T	0.12192	-1.0557	10	0.72032	D	0.01	.	11.327	0.49454	0.0:0.0:0.3207:0.6793	.	113;102;113	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	N	113;113;113;113;113;102	ENSP00000448004:Y113N;ENSP00000447006:Y113N;ENSP00000448653:Y113N;ENSP00000325660:Y113N;ENSP00000353213:Y113N;ENSP00000261160:Y102N	ENSP00000325660:Y113N	Y	+	1	0	CNTN1	39602434	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	2.599000	0.46231	2.285000	0.76669	0.477000	0.44152	TAC	.	.	none		0.408	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
PDZRN3	23024	hgsc.bcm.edu	37	3	73433731	73433731	+	Silent	SNP	G	G	A	rs142044798		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:73433731G>A	ENST00000263666.4	-	10	2100	c.1986C>T	c.(1984-1986)taC>taT	p.Y662Y	PDZRN3_ENST00000466780.1_Silent_p.Y319Y|PDZRN3_ENST00000462146.2_Silent_p.Y319Y|PDZRN3_ENST00000466348.1_5'Flank|PDZRN3_ENST00000535920.1_Silent_p.Y384Y|PDZRN3_ENST00000479530.1_Silent_p.Y379Y	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	662					neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		AGTACAGGCCGTAAGGGGTGG	0.657																																					p.Y662Y		Atlas-SNP	.											.	PDZRN3	196	.	0			c.C1986T						PASS	.	G		0,4406		0,0,2203	43.0	47.0	45.0		1986	3.0	0.4	3	dbSNP_134	45	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PDZRN3	NM_015009.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		662/1067	73433731	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23024	exon10			CAGGCCGTAAGGG	AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.1986C>T	3.37:g.73433731G>A		83.0	0.0	0		71.0	28.0	0.394366	NM_015009	A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	ENST00000263666.4	37	CCDS33789.1																																																																																			G|1.000;A|0.000	0.000	weak		0.657	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352460.1	XM_041363	
MAB21L2	10586	hgsc.bcm.edu	37	4	151504768	151504768	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:151504768G>A	ENST00000317605.4	+	1	1692	c.587G>A	c.(586-588)gGc>gAc	p.G196D	RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000510413.1_Intron|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_5'Flank	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	196					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CCTTGGCCCGGCCCCAATCGG	0.647																																					p.G196D		Atlas-SNP	.											.	MAB21L2	53	.	0			c.G587A						PASS	.						34.0	37.0	36.0					4																	151504768		2202	4297	6499	SO:0001583	missense	10586	exon1			GGCCCGGCCCCAA	AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.587G>A	4.37:g.151504768G>A	ENSP00000324701:p.Gly196Asp	45.0	0.0	0		34.0	10.0	0.294118	NM_006439	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	37	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	G	13.00	2.105797	0.37145	.	.	ENSG00000181541	ENST00000317605	T	0.07800	3.16	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.09247	0.0228	N	0.22421	0.69	0.80722	D	1	B	0.29232	0.238	B	0.34590	0.186	T	0.38735	-0.9647	10	0.24483	T	0.36	-20.9107	19.4978	0.95081	0.0:0.0:1.0:0.0	.	196	Q9Y586	MB212_HUMAN	D	196	ENSP00000324701:G196D	ENSP00000324701:G196D	G	+	2	0	MAB21L2	151724218	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	9.869000	0.99810	2.608000	0.88229	0.462000	0.41574	GGC	.	.	none		0.647	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439	
ZNF347	84671	hgsc.bcm.edu	37	19	53643815	53643815	+	Missense_Mutation	SNP	G	G	A	rs142427199		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr19:53643815G>A	ENST00000334197.7	-	5	2334	c.2266C>T	c.(2266-2268)Cgg>Tgg	p.R756W	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_Missense_Mutation_p.R757W|ZNF347_ENST00000601469.2_Missense_Mutation_p.R757W	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	756					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TGAATTCCCCGATGTCTTGCA	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		22355	0.0		0.001	False		,,,				2504	0.0				p.R757W	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											ZNF347,caecum,carcinoma,0,2	ZNF347	87	2	0			c.C2269T						PASS	.	G	TRP/ARG,TRP/ARG,TRP/ARG	4,4402	8.1+/-20.4	0,4,2199	161.0	154.0	157.0		2269,2269,2266	0.9	0.0	19	dbSNP_134	157	28,8572	19.2+/-60.6	0,28,4272	no	missense,missense,missense	ZNF347	NM_001172674.1,NM_001172675.1,NM_032584.2	101,101,101	0,32,6471	AA,AG,GG		0.3256,0.0908,0.246	probably-damaging,probably-damaging,probably-damaging	757/841,757/841,756/840	53643815	32,12974	2203	4300	6503	SO:0001583	missense	84671	exon5			TTCCCCGATGTCT	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2266C>T	19.37:g.53643815G>A	ENSP00000334146:p.Arg756Trp	157.0	0.0	0		108.0	29.0	0.268519	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249852	0.39797	9.08E-4	0.003256	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.07688	3.17;3.17	3.16	0.931	0.19460	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19366	0.0465	M	0.74258	2.255	0.09310	N	1	D;D	0.76494	0.999;0.99	P;P	0.59948	0.866;0.552	T	0.09378	-1.0677	9	0.87932	D	0	.	4.1023	0.10018	0.2165:0.0:0.5954:0.1881	.	757;756	G5E9N4;Q96SE7	.;ZN347_HUMAN	W	756;757	ENSP00000334146:R756W;ENSP00000405218:R757W	ENSP00000334146:R756W	R	-	1	2	ZNF347	58335627	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.521000	0.06245	0.188000	0.20168	0.655000	0.94253	CGG	G|0.997;A|0.003	0.003	strong		0.423	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
P2RX5	5026	hgsc.bcm.edu	37	17	3599171	3599171	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:3599171G>T	ENST00000225328.5	-	1	527	c.129C>A	c.(127-129)taC>taA	p.Y43*	P2RX5_ENST00000345901.3_Nonsense_Mutation_p.Y43*|P2RX5-TAX1BP3_ENST00000550383.1_Nonsense_Mutation_p.Y43*|P2RX5_ENST00000551178.1_Nonsense_Mutation_p.Y43*|P2RX5_ENST00000547178.1_Nonsense_Mutation_p.Y43*|P2RX5_ENST00000435558.1_Nonsense_Mutation_p.Y43*|P2RX5_ENST00000552276.1_Nonsense_Mutation_p.Y43*	NM_001204519.1|NM_002561.3	NP_001191448.1|NP_002552.2	Q93086	P2RX5_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 5	43					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transport (GO:0006810)	integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|ion channel activity (GO:0005216)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	11						ACACGACCAGGTACGCCAGGA	0.632																																					p.Y43X		Atlas-SNP	.											.	P2RX5	36	.	0			c.C129A						PASS	.						62.0	55.0	57.0					17																	3599171		2203	4300	6503	SO:0001587	stop_gained	5026	exon1			GACCAGGTACGCC	AF016709	CCDS11034.1, CCDS11035.1, CCDS56014.1, CCDS56015.1	17p13.3	2012-01-17			ENSG00000083454	ENSG00000083454		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8536	protein-coding gene	gene with protein product		602836				9414125	Standard	NM_002561		Approved	P2X5	uc002fwi.3	Q93086	OTTHUMG00000090700	ENST00000225328.5:c.129C>A	17.37:g.3599171G>T	ENSP00000225328:p.Tyr43*	97.0	0.0	0		60.0	33.0	0.55	NM_001204519	G5E981|O43450|O75540|Q308M5|Q59F38|Q8IXW4|Q93087|Q9NZV0	Nonsense_Mutation	SNP	ENST00000225328.5	37	CCDS11034.1	.	.	.	.	.	.	.	.	.	.	G	37	5.998360	0.97184	.	.	ENSG00000083454	ENST00000435558;ENST00000551178;ENST00000547178;ENST00000225328;ENST00000345901;ENST00000440619	.	.	.	3.86	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4541	6.3266	0.21246	0.1038:0.1894:0.7068:0.0	.	.	.	.	X	43	.	ENSP00000225328:Y43X	Y	-	3	2	P2RX5	3545920	1.000000	0.71417	0.990000	0.47175	0.652000	0.38707	5.955000	0.70306	1.877000	0.54381	0.313000	0.20887	TAC	.	.	none		0.632	P2RX5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207388.3	NM_002561, NM_175080, NM_175081	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230295	23230295	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr22:23230295G>C	ENST00000526893.1	+	1	336	c.62G>C	c.(61-63)aGg>aCg	p.R21T	IGLL5_ENST00000532223.2_Missense_Mutation_p.R21T|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Missense_Mutation_p.R21T	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	21						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCTGGTCCCAGGCAGCGCTGG	0.672																																					p.R21T		Atlas-SNP	.											.	IGLL5	26	.	0			c.G62C						PASS	.																																			SO:0001583	missense	100423062	exon1			GTCCCAGGCAGCG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.62G>C	22.37:g.23230295G>C	ENSP00000431254:p.Arg21Thr	146.0	0.0	0		111.0	33.0	0.297297	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	G	9.712	1.157214	0.21454	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00609	6.24;6.25	3.25	-1.58	0.08479	.	.	.	.	.	T	0.00468	0.0015	L	0.29908	0.895	0.09310	N	1	D	0.61697	0.99	P	0.44647	0.456	T	0.49532	-0.8930	9	0.20519	T	0.43	.	3.5094	0.07703	0.3613:0.1968:0.4419:0.0	.	21	B9A064	IGLL5_HUMAN	T	21	ENSP00000436353:R21T;ENSP00000431254:R21T	ENSP00000431254:R21T	R	+	2	0	IGLL5	21560295	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.328000	0.07945	-0.196000	0.10366	0.643000	0.83706	AGG	.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
KIF6	221458	hgsc.bcm.edu	37	6	39563864	39563864	+	Missense_Mutation	SNP	T	T	G	rs150066437		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:39563864T>G	ENST00000287152.7	-	7	906	c.812A>C	c.(811-813)aAg>aCg	p.K271T	KIF6_ENST00000373215.3_Missense_Mutation_p.K271T|KIF6_ENST00000373213.4_Missense_Mutation_p.K110T|KIF6_ENST00000538893.1_Missense_Mutation_p.K271T|KIF6_ENST00000373216.3_Missense_Mutation_p.K271T	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	271	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GTTGATATACTTGGCCTCTGT	0.438																																					p.K271T		Atlas-SNP	.											.	KIF6	233	.	0			c.A812C						PASS	.						109.0	100.0	103.0					6																	39563864		2203	4300	6503	SO:0001583	missense	221458	exon7			ATATACTTGGCCT	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.812A>C	6.37:g.39563864T>G	ENSP00000287152:p.Lys271Thr	138.0	0.0	0		207.0	71.0	0.342995	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	37	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.15|16.15	3.041241|3.041241	0.55003|0.55003	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893;ENST00000441975;ENST00000373211|ENST00000458470	T;T;T;T;T;T|.	0.75260|.	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92|.	5.98|5.98	5.98|5.98	0.97165|0.97165	Kinesin, motor domain (4);|.	.|.	.|.	.|.	.|.	T|T	0.46795|0.46795	0.1411|0.1411	L|L	0.38692|0.38692	1.165|1.165	0.80722|0.80722	D|D	1|1	D;P;D;D|.	0.89917|.	1.0;0.929;0.959;1.0|.	D;P;P;D|.	0.85130|.	0.995;0.614;0.749;0.997|.	T|T	0.45116|0.45116	-0.9283|-0.9283	9|5	0.02654|.	T|.	1|.	.|.	14.7079|14.7079	0.69206|0.69206	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	271;271;271;271|.	E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9|.	.;.;.;KIF6_HUMAN|.	T|R	271;271;110;271;271;58;62|163	ENSP00000287152:K271T;ENSP00000362312:K271T;ENSP00000362309:K110T;ENSP00000362311:K271T;ENSP00000441435:K271T;ENSP00000404856:K58T|.	ENSP00000287152:K271T|.	K|S	-|-	2|1	0|0	KIF6|KIF6	39671842|39671842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	8.040000|8.040000	0.89188|0.89188	2.288000|2.288000	0.76882|0.76882	0.528000|0.528000	0.53228|0.53228	AAG|AGT	T|1.000;C|0.000	.	alt		0.438	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	
MTUS1	57509	hgsc.bcm.edu	37	8	17611707	17611707	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:17611707G>T	ENST00000262102.6	-	2	1834	c.1610C>A	c.(1609-1611)aCc>aAc	p.T537N	MTUS1_ENST00000519263.1_Missense_Mutation_p.T537N|MTUS1_ENST00000381862.3_Missense_Mutation_p.T537N|MTUS1_ENST00000381869.3_Missense_Mutation_p.T537N	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	537					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		TGAGGCACTGGTCTGCTGAGG	0.438																																					p.T537N		Atlas-SNP	.											MTUS1,colon,carcinoma,0,3	MTUS1	144	3	0			c.C1610A						PASS	.						214.0	206.0	209.0					8																	17611707		2077	4205	6282	SO:0001583	missense	57509	exon2			GCACTGGTCTGCT	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.1610C>A	8.37:g.17611707G>T	ENSP00000262102:p.Thr537Asn	210.0	0.0	0		196.0	59.0	0.30102	NM_001001924	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	ENST00000262102.6	37	CCDS43717.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063884	0.36373	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.37752	3.02;1.18;3.02;2.04	5.1	3.23	0.37069	.	0.444177	0.20589	N	0.089392	T	0.25195	0.0612	L	0.29908	0.895	0.09310	N	1	P;B;B	0.43287	0.802;0.091;0.091	B;B;B	0.36719	0.231;0.018;0.018	T	0.08764	-1.0706	10	0.72032	D	0.01	-0.6686	11.7274	0.51716	0.0:0.1343:0.726:0.1397	.	537;537;537	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	N	537	ENSP00000371293:T537N;ENSP00000262102:T537N;ENSP00000430167:T537N;ENSP00000371286:T537N	ENSP00000262102:T537N	T	-	2	0	MTUS1	17655987	0.002000	0.14202	0.001000	0.08648	0.541000	0.35023	1.088000	0.30877	0.803000	0.34113	0.650000	0.86243	ACC	.	.	none		0.438	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
PIM1	5292	hgsc.bcm.edu	37	6	37138937	37138937	+	Silent	SNP	C	C	T	rs548710452	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:37138937C>T	ENST00000373509.5	+	4	650	c.277C>T	c.(277-279)Ctg>Ttg	p.L93L		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	184					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AGTGGTCCTGCTGAAGAAGGT	0.657			T	BCL6	NHL								C|||	2	0.000399361	0.0	0.0	5008	,	,		14843	0.002		0.0	False		,,,				2504	0.0				p.L184L		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	.	PIM1	71	.	0			c.C550T						PASS	.						73.0	81.0	79.0					6																	37138937		2203	4300	6503	SO:0001819	synonymous_variant	5292	exon4			GTCCTGCTGAAGA		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.277C>T	6.37:g.37138937C>T		54.0	0.0	0		73.0	15.0	0.205479	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.657	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
BTG2	7832	hgsc.bcm.edu	37	1	203274836	203274836	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:203274836G>C	ENST00000290551.4	+	1	173	c.102G>C	c.(100-102)agG>agC	p.R34S	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	34					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			GCGAGCAGAGGCTTAAGGTCT	0.716																																					p.R34S		Atlas-SNP	.											.	BTG2	16	.	0			c.G102C						PASS	.						15.0	16.0	15.0					1																	203274836		2144	4202	6346	SO:0001583	missense	7832	exon1			GCAGAGGCTTAAG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.102G>C	1.37:g.203274836G>C	ENSP00000290551:p.Arg34Ser	103.0	0.0	0		72.0	17.0	0.236111	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406597	0.62399	.	.	ENSG00000159388	ENST00000290551	T	0.22743	1.94	4.66	-6.66	0.01789	Anti-proliferative protein (3);	0.165673	0.37761	N	0.001941	T	0.18551	0.0445	L	0.48362	1.52	0.38784	D	0.954828	P	0.38922	0.651	B	0.40329	0.326	T	0.03852	-1.0998	10	0.66056	D	0.02	-8.3253	16.012	0.80409	0.156:0.0:0.844:0.0	.	34	P78543	BTG2_HUMAN	S	34	ENSP00000290551:R34S	ENSP00000290551:R34S	R	+	3	2	BTG2	201541459	0.998000	0.40836	0.005000	0.12908	0.842000	0.47809	0.428000	0.21395	-1.534000	0.01743	-0.362000	0.07510	AGG	.	.	none		0.716	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
TMEM206	55248	hgsc.bcm.edu	37	1	212558714	212558714	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:212558714C>T	ENST00000261455.4	-	4	534	c.397G>A	c.(397-399)Gag>Aag	p.E133K	TMEM206_ENST00000471937.1_5'UTR|TMEM206_ENST00000535273.1_Missense_Mutation_p.E194K	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	133						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		GGAATGACCTCGTAATGGTGC	0.542																																					p.E194K		Atlas-SNP	.											.	TMEM206	41	.	0			c.G580A						PASS	.						123.0	114.0	117.0					1																	212558714		2203	4300	6503	SO:0001583	missense	55248	exon5			TGACCTCGTAATG	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.397G>A	1.37:g.212558714C>T	ENSP00000261455:p.Glu133Lys	130.0	0.0	0		97.0	29.0	0.298969	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	37	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.739315	0.69304	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.43	4.52	0.55395	.	0.094468	0.64402	D	0.000001	T	0.25975	0.0633	N	0.14661	0.345	0.37847	D	0.929241	B;P	0.49253	0.017;0.921	B;B	0.30251	0.004;0.113	T	0.30679	-0.9970	9	0.62326	D	0.03	-12.0706	14.0882	0.64973	0.0:0.9274:0.0:0.0725	.	194;133	B7Z4D6;Q9H813	.;TM206_HUMAN	K	133;194	.	ENSP00000261455:E133K	E	-	1	0	TMEM206	210625337	1.000000	0.71417	0.906000	0.35671	0.978000	0.69477	3.406000	0.52637	1.284000	0.44531	0.655000	0.94253	GAG	.	.	none		0.542	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144852401	144852401	+	3'UTR	SNP	G	G	A	rs587735104	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:144852401G>A	ENST00000369354.3	-	0	7287				PDE4DIP_ENST00000369356.4_Nonsense_Mutation_p.Q2348*|PDE4DIP_ENST00000313382.9_3'UTR|PDE4DIP_ENST00000369359.4_3'UTR|PDE4DIP_ENST00000530740.1_3'UTR|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CACCTTTCCTGCTGTTTTAAG	0.562			T	PDGFRB	MPD								.|||	3	0.000599042	0.0	0.0	5008	,	,		40235	0.003		0.0	False		,,,				2504	0.0				p.Q2348X		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.C7042T						PASS	.						59.0	54.0	56.0					1																	144852401		1568	3582	5150	SO:0001624	3_prime_UTR_variant	9659	exon44			TTTCCTGCTGTTT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.*57C>T	1.37:g.144852401G>A		84.0	0.0	0		71.0	7.0	0.0985916	NM_001198834	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Nonsense_Mutation	SNP	ENST00000369354.3	37	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	.	49	15.474733	0.99835	.	.	ENSG00000178104	ENST00000369356	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	13.0279	0.58825	0.0:0.0:1.0:0.0	.	.	.	.	X	2348	.	ENSP00000358363:Q2348X	Q	-	1	0	PDE4DIP	143563758	1.000000	0.71417	0.658000	0.29665	0.982000	0.71751	4.724000	0.61972	2.216000	0.71823	0.549000	0.68633	CAG	.	.	none		0.562	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
TRIM11	81559	hgsc.bcm.edu	37	1	228594049	228594049	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:228594049C>T	ENST00000284551.6	-	1	492	c.214G>A	c.(214-216)Gct>Act	p.A72T	RP11-245P10.4_ENST00000436779.1_RNA|TRIM11_ENST00000493030.2_5'Flank|TRIM11_ENST00000366699.3_Missense_Mutation_p.A72T	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	72					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				GCCATCTTAGCAAGCGGGCGG	0.761																																					p.A72T		Atlas-SNP	.											.	TRIM11	38	.	0			c.G214A						PASS	.						4.0	5.0	5.0					1																	228594049		1955	3850	5805	SO:0001583	missense	81559	exon1			TCTTAGCAAGCGG	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.214G>A	1.37:g.228594049C>T	ENSP00000284551:p.Ala72Thr	39.0	0.0	0		29.0	10.0	0.344828	NM_145214	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	ENST00000284551.6	37	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843037	0.51057	.	.	ENSG00000154370	ENST00000284551;ENST00000366699	T;T	0.17528	2.27;2.27	4.73	2.76	0.32466	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.39475	N	0.001359	T	0.16685	0.0401	L	0.52206	1.635	0.24507	N	0.994226	B;B;B	0.34313	0.01;0.448;0.002	B;B;B	0.41374	0.04;0.355;0.005	T	0.13019	-1.0525	10	0.40728	T	0.16	.	3.8353	0.08891	0.1669:0.5793:0.1621:0.0917	.	72;72;72	Q96F44-3;Q96F44-2;Q96F44	.;.;TRI11_HUMAN	T	72	ENSP00000284551:A72T;ENSP00000355660:A72T	ENSP00000284551:A72T	A	-	1	0	TRIM11	226660672	0.000000	0.05858	0.962000	0.40283	0.979000	0.70002	-0.146000	0.10250	0.476000	0.27440	0.491000	0.48974	GCT	.	.	none		0.761	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230348	23230348	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr22:23230348C>T	ENST00000526893.1	+	1	389	c.115C>T	c.(115-117)Ctg>Ttg	p.L39L	IGLL5_ENST00000532223.2_Silent_p.L39L|hsa-mir-5571_ENST00000577998.1_RNA|IGLL5_ENST00000531372.1_Silent_p.L39L	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	39						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCATGGCCTGCTGCGCCCAAT	0.687																																					p.L39L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C115T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGCCTGCTGCGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.115C>T	22.37:g.23230348C>T		128.0	0.0	0		95.0	32.0	0.336842	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.687	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ABCF1	23	hgsc.bcm.edu	37	6	30553422	30553422	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:30553422C>T	ENST00000326195.8	+	16	1675	c.1563C>T	c.(1561-1563)ctC>ctT	p.L521L	MIR877_ENST00000401282.1_RNA|ABCF1_ENST00000376545.3_Silent_p.L483L|ABCF1_ENST00000396515.4_Intron	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	521	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TCATCCACCTCGATGCCCAGC	0.532																																					p.L521L		Atlas-SNP	.											.	ABCF1	61	.	0			c.C1563T						PASS	.						118.0	109.0	113.0					6																	30553422		1511	2709	4220	SO:0001819	synonymous_variant	23	exon16			CCACCTCGATGCC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.1563C>T	6.37:g.30553422C>T		42.0	0.0	0		57.0	20.0	0.350877	NM_001025091	A2BF75|O14897|Q69YP6	Silent	SNP	ENST00000326195.8	37	CCDS34380.1																																																																																			.	.	none		0.532	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076137.3		
TWIST2	117581	hgsc.bcm.edu	37	2	239757191	239757191	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:239757191G>A	ENST00000448943.2	+	1	519	c.335G>A	c.(334-336)aGg>aAg	p.R112K		NM_057179.2	NP_476527.1	Q8WVJ9	TWST2_HUMAN	twist family bHLH transcription factor 2	112	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CTGGCCGCCAGGTACATAGAC	0.607																																					p.R112K		Atlas-SNP	.											.	TWIST2	6	.	0			c.G335A						PASS	.						110.0	94.0	99.0					2																	239757191		692	1591	2283	SO:0001583	missense	117581	exon1			CCGCCAGGTACAT	BC017907	CCDS46558.1	2q37.3	2013-10-17	2013-10-17		ENSG00000233608	ENSG00000233608		"""Basic helix-loop-helix proteins"""	20670	protein-coding gene	gene with protein product		607556	"""twist homolog 2 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 2"""			7589808, 9061034	Standard	NM_057179		Approved	DERMO1, Dermo-1, bHLHa39	uc021vyw.2	Q8WVJ9	OTTHUMG00000152836	ENST00000448943.2:c.335G>A	2.37:g.239757191G>A	ENSP00000405176:p.Arg112Lys	23.0	0.0	0		27.0	8.0	0.296296	NM_057179	Q3SYL6	Missense_Mutation	SNP	ENST00000448943.2	37	CCDS46558.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.216947	0.79352	.	.	ENSG00000233608	ENST00000448943	D	0.97791	-4.54	4.99	4.99	0.66335	Helix-loop-helix DNA-binding (5);	.	.	.	.	D	0.95220	0.8450	N	0.04724	-0.175	0.80722	D	1	P	0.46395	0.877	P	0.49953	0.627	D	0.96576	0.9427	9	0.59425	D	0.04	.	18.297	0.90150	0.0:0.0:1.0:0.0	.	112	Q8WVJ9	TWST2_HUMAN	K	112	ENSP00000405176:R112K	ENSP00000405176:R112K	R	+	2	0	TWIST2	.	1.000000	0.71417	1.000000	0.80357	0.377000	0.30045	9.385000	0.97223	2.290000	0.77057	0.557000	0.71058	AGG	.	.	none		0.607	TWIST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393081.1		
TP53	7157	hgsc.bcm.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R273C	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,adenocarcinoma,+1,1300	TP53	33396	1300	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	c.C817T	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343	PASS	.						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AAACACGCACCTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	71.0	0.0	0		56.0	28.0	0.5	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	.	.	weak		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
HSPG2	3339	hgsc.bcm.edu	37	1	22181135	22181135	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:22181135C>G	ENST00000374695.3	-	49	6336	c.6257G>C	c.(6256-6258)aGg>aCg	p.R2086T	HSPG2_ENST00000430507.1_Missense_Mutation_p.R36T	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2086	Ig-like C2-type 6.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACCCCCTCGCCTGTACCAGGT	0.642																																					p.R2086T		Atlas-SNP	.											.	HSPG2	311	.	0			c.G6257C						PASS	.						33.0	33.0	33.0					1																	22181135		2199	4293	6492	SO:0001583	missense	3339	exon49			CCTCGCCTGTACC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6257G>C	1.37:g.22181135C>G	ENSP00000363827:p.Arg2086Thr	64.0	0.0	0		58.0	24.0	0.413793	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383625	0.42207	.	.	ENSG00000142798	ENST00000374695;ENST00000430507	T;T	0.17854	2.25;2.25	5.54	-0.126	0.13515	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.398345	0.17595	N	0.168617	T	0.32734	0.0839	M	0.87900	2.915	0.23215	N	0.998107	P;B	0.45044	0.849;0.324	P;B	0.54174	0.744;0.174	T	0.11324	-1.0592	10	0.66056	D	0.02	.	5.4421	0.16515	0.1437:0.44:0.0:0.4163	.	26;2086	Q59EG0;P98160	.;PGBM_HUMAN	T	2086;36	ENSP00000363827:R2086T;ENSP00000416385:R36T	ENSP00000363827:R2086T	R	-	2	0	HSPG2	22053722	0.848000	0.29623	0.999000	0.59377	0.821000	0.46438	-0.049000	0.11924	0.050000	0.15949	0.561000	0.74099	AGG	.	.	none		0.642	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
MUC5B	727897	hgsc.bcm.edu	37	11	1258387	1258387	+	Missense_Mutation	SNP	G	G	A	rs202160055		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:1258387G>A	ENST00000529681.1	+	25	3348	c.3290G>A	c.(3289-3291)cGc>cAc	p.R1097H	MUC5B_ENST00000447027.1_Missense_Mutation_p.R1100H	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1097	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCGCCTGCCGCTCCCAGGTG	0.682																																					p.R1097H		Atlas-SNP	.											MUC5B,NS,carcinoma,+1,4	MUC5B	473	4	0			c.G3290A						scavenged	.						10.0	16.0	14.0					11																	1258387		1900	4086	5986	SO:0001583	missense	727897	exon25			CCTGCCGCTCCCA	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3290G>A	11.37:g.1258387G>A	ENSP00000436812:p.Arg1097His	15.0	1.0	0.0666667		26.0	7.0	0.269231	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	G	6.941	0.543406	0.13250	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.72505	-0.66;-0.66	4.38	-0.728	0.11162	von Willebrand factor, type D domain (1);Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.30198	0.0757	N	0.00135	-2.02	0.26154	N	0.980103	B;B;B	0.24132	0.004;0.098;0.098	B;B;B	0.12837	0.001;0.008;0.008	T	0.37934	-0.9684	9	0.87932	D	0	.	8.5449	0.33415	0.6733:0.0:0.3267:0.0	rs35573593	1097;1790;1100	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	H	1097;1100;1098;1167	ENSP00000436812:R1097H;ENSP00000415793:R1100H	ENSP00000343037:R1098H	R	+	2	0	MUC5B	1214963	0.002000	0.14202	0.101000	0.21167	0.007000	0.05969	0.139000	0.16036	-0.476000	0.06842	-0.379000	0.06801	CGC	.	.	weak		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MT-ND5	4540	hgsc.bcm.edu	37	M	12519	12519	+	Silent	SNP	T	T	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chrM:12519T>C	ENST00000361567.2	+	1	183	c.183T>C	c.(181-183)gtT>gtC	p.V61V	MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TS2_ENST00000387449.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	61					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GACCAAGAAGTTATTATCTCG	0.403																																					p.V61V		Atlas-SNP	.											.	.	.	.	0			c.T183C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			AGAAGTTATTATC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.183T>C	M.37:g.12519T>C		28.0	0.0	0		20.0	6.0	0.3	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	37																																																																																				.	.	weak		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
EIF3E	3646	hgsc.bcm.edu	37	8	109215229	109215229	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:109215229G>A	ENST00000220849.5	-	12	1344	c.1282C>T	c.(1282-1284)Cag>Tag	p.Q428*	EIF3E_ENST00000519030.1_Nonsense_Mutation_p.Q335*|EIF3E_ENST00000519517.1_5'Flank	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E									p.Q428*(3)	EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			CTGCTATTCTGATTAAGTTTC	0.383																																					p.Q428X	GBM(15;360 410 8460 34179 52246)	Atlas-SNP	.											EIF3E,NS,carcinoma,0,3	EIF3E	73	3	3	Substitution - Nonsense(3)	endometrium(3)	c.C1282T						PASS	.						160.0	144.0	150.0					8																	109215229		2203	4300	6503	SO:0001587	stop_gained	3646	exon12			TATTCTGATTAAG	U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.1282C>T	8.37:g.109215229G>A	ENSP00000220849:p.Gln428*	131.0	0.0	0		115.0	41.0	0.356522	NM_001568		Nonsense_Mutation	SNP	ENST00000220849.5	37	CCDS6308.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.746950|4.746950	0.89663|0.89663	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000220849;ENST00000519030|ENST00000522352	.|.	.|.	.|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.213853|.	0.50627|.	D|.	0.000113|.	.|T	.|0.71728	.|0.3374	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69587	.|-0.5105	.|4	0.06625|.	T|.	0.88|.	-9.9569|-9.9569	15.4346|15.4346	0.75137|0.75137	0.0:0.0:0.8605:0.1395|0.0:0.0:0.8605:0.1395	.|.	.|.	.|.	.|.	X|L	428;335|138	.|.	ENSP00000220849:Q428X|.	Q|S	-|-	1|2	0|0	EIF3E|EIF3E	109284405|109284405	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.670000|4.670000	0.61583|0.61583	2.697000|2.697000	0.92050|0.92050	0.585000|0.585000	0.79938|0.79938	CAG|TCA	.	.	none		0.383	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103570659	103570659	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr14:103570659C>T	ENST00000380069.3	+	4	1293	c.1217C>T	c.(1216-1218)gCg>gTg	p.A406V		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	406					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						AGTCACTGGGCGGCCGCCGAG	0.687																																					p.A406V		Atlas-SNP	.											.	EXOC3L4	35	.	0			c.C1217T						PASS	.						10.0	12.0	11.0					14																	103570659		2188	4293	6481	SO:0001583	missense	91828	exon4			ACTGGGCGGCCGC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.1217C>T	14.37:g.103570659C>T	ENSP00000369409:p.Ala406Val	97.0	0.0	0		54.0	30.0	0.555556	NM_001077594	Q14CR2	Missense_Mutation	SNP	ENST00000380069.3	37	CCDS32163.1	.	.	.	.	.	.	.	.	.	.	C	2.404	-0.336881	0.05278	.	.	ENSG00000205436	ENST00000380069	T	0.05925	3.37	4.18	-2.7	0.06004	.	0.665977	0.14024	N	0.346640	T	0.05135	0.0137	L	0.57536	1.79	0.09310	N	1	B	0.32543	0.375	B	0.28139	0.086	T	0.28202	-1.0051	10	0.33141	T	0.24	-4.2103	3.2771	0.06902	0.3063:0.3183:0.0:0.3754	.	406	Q17RC7	EX3L4_HUMAN	V	406	ENSP00000369409:A406V	ENSP00000369409:A406V	A	+	2	0	EXOC3L4	102640412	0.005000	0.15991	0.001000	0.08648	0.081000	0.17604	-0.056000	0.11787	-0.925000	0.03775	-0.284000	0.09977	GCG	.	.	none		0.687	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
FKBP6	8468	hgsc.bcm.edu	37	7	72743416	72743416	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:72743416T>G	ENST00000252037.4	+	3	298	c.229T>G	c.(229-231)Ttt>Gtt	p.F77V	TRIM50_ENST00000333149.2_5'Flank|FKBP6_ENST00000413573.2_Intron|TRIM50_ENST00000493498.1_5'Flank|FKBP6_ENST00000431982.2_Missense_Mutation_p.F72V	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	77	PPIase FKBP-type. {ECO:0000255|PROSITE- ProRule:PRU00277}.				cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TTCTAATTACTTTAGGAAAAC	0.448																																					p.F77V		Atlas-SNP	.											.	FKBP6	35	.	0			c.T229G						PASS	.						179.0	178.0	178.0					7																	72743416		2203	4300	6503	SO:0001583	missense	8468	exon3			AATTACTTTAGGA	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.229T>G	7.37:g.72743416T>G	ENSP00000252037:p.Phe77Val	118.0	0.0	0		96.0	32.0	0.333333	NM_003602	B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	ENST00000252037.4	37	CCDS43595.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484818	0.26598	.	.	ENSG00000077800	ENST00000431982;ENST00000442793;ENST00000252037	D;D;D	0.85411	-1.98;-1.98;-1.98	4.76	2.36	0.29203	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (2);	0.301814	0.36101	N	0.002792	T	0.64283	0.2584	N	0.08118	0	0.30677	N	0.752777	B;B	0.20988	0.05;0.005	B;B	0.21360	0.034;0.03	T	0.52939	-0.8508	10	0.15499	T	0.54	-9.3851	4.5343	0.12020	0.1432:0.1673:0.0:0.6895	.	72;77	O75344-2;O75344	.;FKBP6_HUMAN	V	72;72;77	ENSP00000416277:F72V;ENSP00000402360:F72V;ENSP00000252037:F77V	ENSP00000252037:F77V	F	+	1	0	FKBP6	72381352	0.006000	0.16342	0.983000	0.44433	0.769000	0.43574	1.100000	0.31025	0.208000	0.20626	-0.611000	0.04053	TTT	.	.	none		0.448	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602	
INPP4B	8821	hgsc.bcm.edu	37	4	143235864	143235864	+	Splice_Site	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:143235864C>T	ENST00000513000.1	-	9	857		c.e9+1		INPP4B_ENST00000262992.4_Splice_Site|INPP4B_ENST00000508116.1_Splice_Site|INPP4B_ENST00000308502.4_Splice_Site|INPP4B_ENST00000509777.1_Splice_Site	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa						cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					GAAACACTTACCCCAACTTCT	0.413																																					.		Atlas-SNP	.											.	INPP4B	132	.	0			c.423+1G>A						PASS	.						125.0	128.0	127.0					4																	143235864		2203	4300	6503	SO:0001630	splice_region_variant	8821	exon10			CACTTACCCCAAC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.423+1G>A	4.37:g.143235864C>T		121.0	0.0	0		116.0	44.0	0.37931	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Splice_Site	SNP	ENST00000513000.1	37	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.550239	0.45383	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116;ENST00000509777;ENST00000510812	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0793	0.80989	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	INPP4B	143455314	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	4.418000	0.59828	2.873000	0.98535	0.561000	0.74099	.	.	.	none		0.413	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	Intron
LONRF2	164832	hgsc.bcm.edu	37	2	100916227	100916227	+	Missense_Mutation	SNP	C	C	T	rs562655594		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:100916227C>T	ENST00000393437.3	-	5	1858	c.1219G>A	c.(1219-1221)Gtg>Atg	p.V407M	LONRF2_ENST00000409647.1_Missense_Mutation_p.V164M	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	407							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						GCATCCTCCACGTCATCCGGA	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		12846	0.0		0.0	False		,,,				2504	0.001				p.V407M		Atlas-SNP	.											.	LONRF2	62	.	0			c.G1219A						PASS	.						93.0	91.0	92.0					2																	100916227		2203	4300	6503	SO:0001583	missense	164832	exon5			CCTCCACGTCATC	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1219G>A	2.37:g.100916227C>T	ENSP00000377086:p.Val407Met	149.0	0.0	0		126.0	40.0	0.31746	NM_198461	B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	37	CCDS2046.2	.	.	.	.	.	.	.	.	.	.	C	8.636	0.894790	0.17613	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.85171	-1.79;-1.95	4.49	0.225	0.15325	.	1.629190	0.04000	N	0.296277	T	0.70046	0.3179	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.55761	-0.8090	10	0.31617	T	0.26	0.8737	5.3436	0.15996	0.2827:0.3821:0.0:0.3351	.	407	Q1L5Z9	LONF2_HUMAN	M	407;164	ENSP00000377086:V407M;ENSP00000386823:V164M	ENSP00000377086:V407M	V	-	1	0	LONRF2	100282659	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.351000	0.07711	-0.152000	0.11156	-0.474000	0.04947	GTG	.	.	none		0.463	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
SEMA3D	223117	hgsc.bcm.edu	37	7	84685039	84685039	+	Silent	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:84685039A>G	ENST00000284136.6	-	7	898	c.855T>C	c.(853-855)gtT>gtC	p.V285V	SEMA3D_ENST00000444867.1_Silent_p.V285V	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	285	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						TTGCCTTACAAACTCTTCCAA	0.259																																					p.V285V	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											.	SEMA3D	177	.	0			c.T855C						PASS	.																																			SO:0001819	synonymous_variant	223117	exon7			CTTACAAACTCTT	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.855T>C	7.37:g.84685039A>G		46.0	0.0	0		49.0	19.0	0.387755	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	ENST00000284136.6	37	CCDS34676.1																																																																																			.	.	none		0.259	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
RAN	5901	hgsc.bcm.edu	37	12	131359242	131359242	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:131359242G>A	ENST00000543796.1	+	5	657	c.399G>A	c.(397-399)gcG>gcA	p.A133A	RAN_ENST00000392367.3_Silent_p.A150A|RAN_ENST00000392369.2_Silent_p.A133A|RAN_ENST00000254675.3_Silent_p.A45A|RAN_ENST00000541630.1_Silent_p.A45A			P62826	RAN_HUMAN	RAN, member RAS oncogene family	133					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		AAGTGAAGGCGAAATCCATTG	0.398																																					p.A133A		Atlas-SNP	.											.	RAN	18	.	0			c.G399A						PASS	.						100.0	88.0	92.0					12																	131359242		2203	4300	6503	SO:0001819	synonymous_variant	5901	exon5			GAAGGCGAAATCC	M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.399G>A	12.37:g.131359242G>A		107.0	0.0	0		81.0	18.0	0.222222	NM_006325	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Silent	SNP	ENST00000543796.1	37	CCDS9271.1																																																																																			.	.	none		0.398	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259441.2	NM_006325	
MPPED1	758	hgsc.bcm.edu	37	22	43870785	43870785	+	Silent	SNP	C	C	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr22:43870785C>A	ENST00000417669.2	+	4	1020	c.576C>A	c.(574-576)atC>atA	p.I192I	MPPED1_ENST00000443721.1_Silent_p.I192I|MPPED1_ENST00000538182.1_Silent_p.I225I|MPPED1_ENST00000414469.2_Silent_p.I86I|MPPED1_ENST00000542779.1_Silent_p.I192I|MPPED1_ENST00000439548.1_Silent_p.I34I			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	192							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				CCAACTGCATCTACCTTCAGG	0.577																																					p.I192I		Atlas-SNP	.											.	MPPED1	59	.	0			c.C576A						PASS	.						108.0	112.0	111.0					22																	43870785		2047	4195	6242	SO:0001819	synonymous_variant	758	exon4			CTGCATCTACCTT	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.576C>A	22.37:g.43870785C>A		105.0	0.0	0		85.0	24.0	0.282353	NM_001044370	A8K159|B7Z2S9|Q8N361	Silent	SNP	ENST00000417669.2	37	CCDS46723.1																																																																																			.	.	none		0.577	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370	
EPHB4	2050	hgsc.bcm.edu	37	7	100420197	100420197	+	Silent	SNP	C	C	T	rs532613401		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:100420197C>T	ENST00000358173.3	-	4	972	c.504G>A	c.(502-504)ccG>ccA	p.P168P	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Silent_p.P168P	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	168	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCTTGCTGAGCGGTCCCAGAC	0.657													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15631	0.0		0.0	False		,,,				2504	0.0				p.P168P	GBM(200;2113 3072 25865 52728)	Atlas-SNP	.											.	EPHB4	106	.	0			c.G504A						PASS	.						44.0	44.0	44.0					7																	100420197		2203	4300	6503	SO:0001819	synonymous_variant	2050	exon4			GCTGAGCGGTCCC	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.504G>A	7.37:g.100420197C>T		110.0	0.0	0		86.0	18.0	0.209302	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	37	CCDS5706.1																																																																																			.	.	none		0.657	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
KLHL14	57565	hgsc.bcm.edu	37	18	30350108	30350108	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr18:30350108C>T	ENST00000359358.4	-	2	885	c.447G>A	c.(445-447)ctG>ctA	p.L149L	KLHL14_ENST00000358095.4_Silent_p.L149L|AC012123.1_ENST00000426194.1_Intron	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	149	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						TGTCCAGGGACAGGGTCACGT	0.637																																					p.L149L		Atlas-SNP	.											.	KLHL14	92	.	0			c.G447A						PASS	.						99.0	94.0	95.0					18																	30350108		2203	4300	6503	SO:0001819	synonymous_variant	57565	exon2			CAGGGACAGGGTC	AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.447G>A	18.37:g.30350108C>T		112.0	0.0	0		159.0	82.0	0.515723	NM_020805	A6NNW1|B4DHA0|Q8WU41	Silent	SNP	ENST00000359358.4	37	CCDS32813.1																																																																																			.	.	none		0.637	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448376.1		
ZNF276	92822	hgsc.bcm.edu	37	16	89790056	89790056	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr16:89790056C>T	ENST00000443381.2	+	4	1042	c.945C>T	c.(943-945)gaC>gaT	p.D315D	ZNF276_ENST00000446326.2_Missense_Mutation_p.T112M|ZNF276_ENST00000568064.1_Missense_Mutation_p.T234M|ZNF276_ENST00000289816.5_Silent_p.D240D|VPS9D1_ENST00000389386.3_5'Flank	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CGGACAGCGACGCGGTGGGGC	0.672																																					p.D315D		Atlas-SNP	.											ZNF276_ENST00000443381,NS,carcinoma,0,2	ZNF276	70	2	0			c.C945T						PASS	.						25.0	31.0	29.0					16																	89790056		2190	4277	6467	SO:0001819	synonymous_variant	92822	exon4			CAGCGACGCGGTG	AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.945C>T	16.37:g.89790056C>T		58.0	0.0	0		80.0	23.0	0.2875	NM_001113525	Q0VGA1|Q2TBE8|Q3B7H7	Silent	SNP	ENST00000443381.2	37	CCDS45554.1	.	.	.	.	.	.	.	.	.	.	C	0.556	-0.847515	0.02651	.	.	ENSG00000158805	ENST00000446326	T	0.06528	3.29	5.55	-0.243	0.13035	.	.	.	.	.	T	0.05044	0.0135	.	.	.	0.09310	N	1	B	0.24258	0.1	B	0.11329	0.006	T	0.36237	-0.9756	8	0.48119	T	0.1	-5.262	8.8218	0.35030	0.0:0.5882:0.0:0.4118	.	112	A8K186	.	M	112	ENSP00000415999:T112M	ENSP00000415999:T112M	T	+	2	0	ZNF276	88317557	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.878000	0.28126	-0.243000	0.09653	-2.262000	0.00279	ACG	.	.	none		0.672	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422517.1	NM_152287	
MON2	23041	hgsc.bcm.edu	37	12	62936884	62936884	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:62936884C>G	ENST00000393632.2	+	20	2763	c.2372C>G	c.(2371-2373)tCt>tGt	p.S791C	RNU6-399P_ENST00000365164.1_RNA|MON2_ENST00000393629.2_Missense_Mutation_p.S791C|MON2_ENST00000552115.1_Missense_Mutation_p.S791C|MON2_ENST00000393630.3_Missense_Mutation_p.S791C|MON2_ENST00000546600.1_Missense_Mutation_p.S791C|MON2_ENST00000552738.1_Missense_Mutation_p.S768C|MON2_ENST00000280379.6_Missense_Mutation_p.S791C	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	791					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TAGGAACCATCTCTTTTTGCT	0.353																																					p.S791C		Atlas-SNP	.											.	MON2	160	.	0			c.C2372G						PASS	.						93.0	94.0	94.0					12																	62936884		2203	4299	6502	SO:0001583	missense	23041	exon20			AACCATCTCTTTT		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.2372C>G	12.37:g.62936884C>G	ENSP00000377252:p.Ser791Cys	129.0	0.0	0		122.0	42.0	0.344262	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	ENST00000393632.2	37	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553734	0.86231	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;1.42	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.73241	0.3562	L	0.49350	1.555	0.80722	D	1	P;P;P;P	0.49559	0.877;0.709;0.709;0.925	B;P;P;P	0.53313	0.431;0.518;0.723;0.634	T	0.70059	-0.4976	9	.	.	.	-18.2064	19.7314	0.96182	0.0:1.0:0.0:0.0	.	791;768;791;791	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4	.;.;.;.	C	791;791;791;791;768;791;791	ENSP00000377252:S791C;ENSP00000377250:S791C;ENSP00000280379:S791C;ENSP00000447407:S791C;ENSP00000449215:S768C;ENSP00000377249:S791C;ENSP00000446635:S791C	.	S	+	2	0	MON2	61223151	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.776000	0.85560	2.727000	0.93392	0.655000	0.94253	TCT	.	.	none		0.353	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
PCLO	27445	hgsc.bcm.edu	37	7	82583245	82583245	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:82583245G>T	ENST00000333891.9	-	5	7361	c.7024C>A	c.(7024-7026)Cac>Aac	p.H2342N	PCLO_ENST00000423517.2_Missense_Mutation_p.H2342N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GAAGGTGGGTGATCAAACACG	0.423																																					p.H2342N		Atlas-SNP	.											.	PCLO	1506	.	0			c.C7024A						PASS	.						90.0	92.0	91.0					7																	82583245		1870	4105	5975	SO:0001583	missense	27445	exon5			GTGGGTGATCAAA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.7024C>A	7.37:g.82583245G>T	ENSP00000334319:p.His2342Asn	195.0	0.0	0		195.0	23.0	0.117949	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	8.129	0.782662	0.16189	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15487	2.42;2.42	4.75	4.75	0.60458	.	.	.	.	.	T	0.10465	0.0256	N	0.08118	0	0.58432	D	0.999995	B;B	0.16396	0.017;0.017	B;B	0.13407	0.009;0.009	T	0.10823	-1.0613	9	0.87932	D	0	.	13.4843	0.61355	0.0:0.1571:0.8429:0.0	.	2342;2342	Q9Y6V0-5;Q9Y6V0-6	.;.	N	2273;2342;2342	ENSP00000334319:H2342N;ENSP00000388393:H2342N	ENSP00000334319:H2342N	H	-	1	0	PCLO	82421181	0.840000	0.29493	0.029000	0.17559	0.660000	0.38997	3.412000	0.52679	2.169000	0.68431	0.505000	0.49811	CAC	.	.	none		0.423	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
CCDC17	149483	hgsc.bcm.edu	37	1	46088711	46088711	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:46088711C>T	ENST00000528266.1	-	4	719	c.572G>A	c.(571-573)cGa>cAa	p.R191Q	CCDC17_ENST00000445048.2_Intron|CCDC17_ENST00000464739.1_5'Flank|CCDC17_ENST00000343901.2_Missense_Mutation_p.R159Q|CCDC17_ENST00000421127.2_Missense_Mutation_p.R182Q			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	191										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					TTGTAGTTCTCGAATCTCCTG	0.657																																					p.R191Q		Atlas-SNP	.											.	CCDC17	54	.	0			c.G572A						PASS	.						25.0	29.0	28.0					1																	46088711		2203	4300	6503	SO:0001583	missense	149483	exon4			AGTTCTCGAATCT		CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.572G>A	1.37:g.46088711C>T	ENSP00000432172:p.Arg191Gln	66.0	0.0	0		71.0	15.0	0.211268	NM_001114938	A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Missense_Mutation	SNP	ENST00000528266.1	37	CCDS44131.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112474	0.77210	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266	T;T;T	0.18174	2.25;2.23;2.25	5.84	-1.26	0.09376	.	0.548550	0.16334	N	0.219002	T	0.15739	0.0379	L	0.29908	0.895	0.09310	N	1	D;B;B	0.76494	0.999;0.086;0.086	P;B;B	0.58660	0.843;0.014;0.014	T	0.21075	-1.0256	10	0.19147	T	0.46	-0.7778	3.7827	0.08687	0.4497:0.2992:0.0:0.2512	.	191;182;159	Q96LX7;Q96LX7-5;F2Z395	CCD17_HUMAN;.;.	Q	182;159;191	ENSP00000389415:R182Q;ENSP00000341451:R159Q;ENSP00000432172:R191Q	ENSP00000341451:R159Q	R	-	2	0	CCDC17	45861298	0.000000	0.05858	0.244000	0.24202	0.135000	0.20990	-0.186000	0.09670	0.080000	0.16959	0.561000	0.74099	CGA	.	.	none		0.657	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386833.1	NM_152500	
ALDOC	230	hgsc.bcm.edu	37	17	26901736	26901736	+	Missense_Mutation	SNP	C	C	T	rs148239543		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:26901736C>T	ENST00000226253.4	-	5	993	c.518G>A	c.(517-519)cGt>cAt	p.R173H	ALDOC_ENST00000395321.2_Missense_Mutation_p.R173H|RP11-192H23.5_ENST00000585189.1_RNA|ALDOC_ENST00000395319.3_Missense_Mutation_p.R173H|PIGS_ENST00000308360.7_5'Flank	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	173					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					ACTGGCATAACGGGCCAGCAC	0.557											OREG0024278	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R173H		Atlas-SNP	.											ALDOC,colon,carcinoma,-1,1	ALDOC	22	1	0			c.G518A						PASS	.	C	HIS/ARG	0,4406		0,0,2203	96.0	79.0	84.0		518	5.5	1.0	17	dbSNP_134	84	1,8599	1.2+/-3.3	0,1,4299	no	missense	ALDOC	NM_005165.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	173/365	26901736	1,13005	2203	4300	6503	SO:0001583	missense	230	exon5			GCATAACGGGCCA	AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.518G>A	17.37:g.26901736C>T	ENSP00000226253:p.Arg173His	49.0	0.0	0	790	59.0	4.0	0.0677966	NM_005165	B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Missense_Mutation	SNP	ENST00000226253.4	37	CCDS11236.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.907215	0.92107	0.0	1.16E-4	ENSG00000109107	ENST00000395319;ENST00000226253;ENST00000395321	D;D;D	0.88818	-2.43;-2.43;-2.43	5.5	5.5	0.81552	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.95683	0.8596	M	0.91459	3.21	0.80722	D	1	P;D	0.76494	0.562;0.999	B;D	0.71656	0.192;0.974	D	0.96213	0.9154	10	0.87932	D	0	.	18.5367	0.91013	0.0:1.0:0.0:0.0	.	173;173	A8MVZ9;P09972	.;ALDOC_HUMAN	H	173	ENSP00000378729:R173H;ENSP00000226253:R173H;ENSP00000378731:R173H	ENSP00000226253:R173H	R	-	2	0	ALDOC	23925863	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.810000	0.86072	2.741000	0.93983	0.650000	0.86243	CGT	C|1.000;T|0.000	0.000	weak		0.557	ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255839.4		
BTG2	7832	hgsc.bcm.edu	37	1	203274810	203274810	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:203274810A>C	ENST00000290551.4	+	1	147	c.76A>C	c.(76-78)Acc>Ccc	p.T26P	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	26					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			CCTCCTGAGGACCCGGGGCTG	0.706																																					p.T26P		Atlas-SNP	.											.	BTG2	16	.	0			c.A76C						PASS	.						16.0	16.0	16.0					1																	203274810		2168	4266	6434	SO:0001583	missense	7832	exon1			CTGAGGACCCGGG		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.76A>C	1.37:g.203274810A>C	ENSP00000290551:p.Thr26Pro	105.0	0.0	0		89.0	24.0	0.269663	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	A	16.48	3.135399	0.56828	.	.	ENSG00000159388	ENST00000290551	T	0.23950	1.88	4.66	4.66	0.58398	Anti-proliferative protein (3);	0.279124	0.30085	N	0.010460	T	0.34193	0.0889	M	0.79805	2.47	0.42075	D	0.991229	B	0.30193	0.272	B	0.32724	0.151	T	0.26744	-1.0094	10	0.48119	T	0.1	-24.6279	13.0384	0.58885	1.0:0.0:0.0:0.0	.	26	P78543	BTG2_HUMAN	P	26	ENSP00000290551:T26P	ENSP00000290551:T26P	T	+	1	0	BTG2	201541433	1.000000	0.71417	0.988000	0.46212	0.822000	0.46500	5.957000	0.70323	1.962000	0.57031	0.391000	0.25812	ACC	.	.	none		0.706	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
ANKRD17	26057	hgsc.bcm.edu	37	4	74005713	74005713	+	Nonsense_Mutation	SNP	G	G	A	rs148961166		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:74005713G>A	ENST00000358602.4	-	15	2736	c.2620C>T	c.(2620-2622)Cga>Tga	p.R874*	ANKRD17_ENST00000514252.1_5'UTR|ANKRD17_ENST00000509867.2_Nonsense_Mutation_p.R761*|ANKRD17_ENST00000330838.6_Intron	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	874	Gln-rich.				blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGTAACTCTCGTTCTACTTTC	0.403																																					p.R874X		Atlas-SNP	.											.	ANKRD17	214	.	0			c.C2620T						PASS	.						229.0	224.0	226.0					4																	74005713		2203	4300	6503	SO:0001587	stop_gained	26057	exon15			ACTCTCGTTCTAC	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.2620C>T	4.37:g.74005713G>A	ENSP00000351416:p.Arg874*	536.0	0.0	0		464.0	131.0	0.282328	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Nonsense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753525	0.89753	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000509867;ENST00000411811	.	.	.	5.65	3.86	0.44501	.	0.000000	0.52532	D	0.000076	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8091	0.63252	0.0:0.0:0.5576:0.4424	.	.	.	.	X	874;874;761;874	.	ENSP00000351416:R874X	R	-	1	2	ANKRD17	74224577	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.761000	0.55242	0.790000	0.33803	-0.182000	0.12963	CGA	G|1.000;T|0.000	.	alt		0.403	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
KDM6A	7403	hgsc.bcm.edu	37	X	44942730	44942730	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chrX:44942730A>C	ENST00000377967.4	+	23	3351	c.3310A>C	c.(3310-3312)Act>Cct	p.T1104P	KDM6A_ENST00000543216.1_Missense_Mutation_p.T1025P|KDM6A_ENST00000382899.4_Missense_Mutation_p.T1111P|KDM6A_ENST00000536777.1_Missense_Mutation_p.T1059P	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1104	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						ACATGAGCTGACTAAACTTCC	0.398			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																p.T1104P	Colon(129;1273 1667 15230 27352 52914)	Atlas-SNP	.		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	.	KDM6A	274	.	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)	c.A3310C						PASS	.						142.0	106.0	118.0					X																	44942730		2203	4300	6503	SO:0001583	missense	7403	exon23			GAGCTGACTAAAC	AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3310A>C	X.37:g.44942730A>C	ENSP00000367203:p.Thr1104Pro	356.0	0.0	0		200.0	113.0	0.565	NM_021140	Q52LL9|Q5JVQ7	Missense_Mutation	SNP	ENST00000377967.4	37	CCDS14265.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.42|18.42	3.619989|3.619989	0.66787|0.66787	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000414389;ENST00000433797|ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	.|T;T;T;T	.|0.79247	.|-1.25;-1.25;-1.25;-1.25	5.24|5.24	5.24|5.24	0.73138|0.73138	.|Transcription factor jumonji/aspartyl beta-hydroxylase (2);	.|0.149876	.|0.64402	.|D	.|0.000018	D|D	0.82944|0.82944	0.5147|0.5147	L|L	0.60455|0.60455	1.87|1.87	0.53688|0.53688	D|D	0.999971|0.999971	.|P;P;P;P;P	.|0.51147	.|0.838;0.852;0.942;0.592;0.88	.|B;P;P;B;P	.|0.55871	.|0.202;0.474;0.786;0.239;0.623	D|D	0.84984|0.84984	0.0890|0.0890	5|10	.|0.87932	.|D	.|0	-7.075|-7.075	14.2463|14.2463	0.65990|0.65990	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|743;1111;1059;1156;1104	.|B4E0L8;F8W8R6;F5H6S1;B7ZKN5;O15550	.|.;.;.;.;KDM6A_HUMAN	A|P	701;746|801;1104;1059;1111;1025	.|ENSP00000367203:T1104P;ENSP00000437405:T1059P;ENSP00000372355:T1111P;ENSP00000443078:T1025P	.|ENSP00000334340:T801P	D|T	+|+	2|1	0|0	KDM6A|KDM6A	44827674|44827674	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.818000|5.818000	0.69236|0.69236	1.742000|1.742000	0.51746|0.51746	0.472000|0.472000	0.43445|0.43445	GAC|ACT	.	.	none		0.398	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056324.1	NM_021140	
BEGAIN	57596	hgsc.bcm.edu	37	14	101004957	101004957	+	Silent	SNP	G	G	A	rs542292676		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr14:101004957G>A	ENST00000355173.2	-	7	1202	c.1131C>T	c.(1129-1131)gcC>gcT	p.A377A	BEGAIN_ENST00000443071.2_Silent_p.A377A|BEGAIN_ENST00000556751.1_Silent_p.A313A|CTD-2062F14.3_ENST00000553301.1_lincRNA	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	377						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)				cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				GGAAGGTCTCGGCCGGGTACG	0.751																																					p.A377A	NSCLC(159;1889 2010 9965 27479 40101)	Atlas-SNP	.											.	BEGAIN	32	.	0			c.C1131T						PASS	.						7.0	9.0	9.0					14																	101004957		2048	4022	6070	SO:0001819	synonymous_variant	57596	exon7			GGTCTCGGCCGGG	BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.1131C>T	14.37:g.101004957G>A		86.0	0.0	0		334.0	28.0	0.0838323	NM_020836	Q9NPU3|Q9P282	Silent	SNP	ENST00000355173.2	37	CCDS9962.1																																																																																			.	.	none		0.751	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414329.1	NM_020836	
NACC2	138151	hgsc.bcm.edu	37	9	138903497	138903497	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:138903497G>A	ENST00000371753.1	-	5	1687	c.1629C>T	c.(1627-1629)gcC>gcT	p.A543A	NACC2_ENST00000277554.2_Silent_p.A543A			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	543					cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						GCTCGGGGGCGGCCACCTCCT	0.761																																					p.A543A		Atlas-SNP	.											.	NACC2	16	.	0			c.C1629T						PASS	.						2.0	3.0	2.0					9																	138903497		1676	3402	5078	SO:0001819	synonymous_variant	138151	exon6			GGGGGCGGCCACC	BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1629C>T	9.37:g.138903497G>A		27.0	0.0	0		34.0	12.0	0.352941	NM_144653		Silent	SNP	ENST00000371753.1	37	CCDS6993.1																																																																																			.	.	none		0.761	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055040.1	NM_144653	
ARAP2	116984	hgsc.bcm.edu	37	4	36069898	36069898	+	Silent	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:36069898A>G	ENST00000303965.4	-	33	5235	c.4746T>C	c.(4744-4746)agT>agC	p.S1582S		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1582					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CTGCTCTTGCACTCTAAAAAT	0.418																																					p.S1582S		Atlas-SNP	.											.	ARAP2	210	.	0			c.T4746C						PASS	.						41.0	45.0	44.0					4																	36069898		2200	4297	6497	SO:0001819	synonymous_variant	116984	exon33			TCTTGCACTCTAA	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.4746T>C	4.37:g.36069898A>G		67.0	0.0	0		57.0	8.0	0.140351	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	ENST00000303965.4	37	CCDS3441.1																																																																																			.	.	none		0.418	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
SPATA31E1	286234	hgsc.bcm.edu	37	9	90502053	90502053	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:90502053G>T	ENST00000325643.5	+	4	2717	c.2651G>T	c.(2650-2652)cGg>cTg	p.R884L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	884					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R884L(1)									TGGGTATCTCGGGTTGAATCT	0.562																																					p.R884L		Atlas-SNP	.											C9orf79,NS,carcinoma,-1,1	.	.	1	1	Substitution - Missense(1)	lung(1)	c.G2651T						PASS	.						43.0	41.0	42.0					9																	90502053		2203	4300	6503	SO:0001583	missense	286234	exon4			TATCTCGGGTTGA	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2651G>T	9.37:g.90502053G>T	ENSP00000322640:p.Arg884Leu	49.0	0.0	0		37.0	11.0	0.297297	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	g	5.225	0.227059	0.09916	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.03951	3.75	2.41	-3.47	0.04753	.	1.897450	0.02755	N	0.117952	T	0.04182	0.0116	L	0.29908	0.895	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.10450	0.005;0.002	T	0.41215	-0.9521	10	0.40728	T	0.16	.	4.3943	0.11355	0.5512:0.1897:0.259:0.0	.	884;536	Q6ZUB1;Q8NA33	CI079_HUMAN;.	L	884;536	ENSP00000322640:R884L	ENSP00000322640:R884L	R	+	2	0	C9orf79	89691873	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	1.059000	0.30517	-0.998000	0.03446	-0.259000	0.10710	CGG	.	.	none		0.562	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
PRKCD	5580	hgsc.bcm.edu	37	3	53221396	53221396	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:53221396C>T	ENST00000394729.2	+	14	1721	c.1393C>T	c.(1393-1395)Cac>Tac	p.H465Y	PRKCD_ENST00000330452.3_Missense_Mutation_p.H465Y	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	465	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	GCAGTTTCTACACAGCAAGGG	0.562																																					p.H465Y		Atlas-SNP	.											.	PRKCD	124	.	0			c.C1393T						PASS	.						122.0	119.0	120.0					3																	53221396		2203	4300	6503	SO:0001583	missense	5580	exon14			TTTCTACACAGCA		CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.1393C>T	3.37:g.53221396C>T	ENSP00000378217:p.His465Tyr	119.0	0.0	0		113.0	42.0	0.371681	NM_212539	B0KZ81|B2R834|Q15144|Q86XJ6	Missense_Mutation	SNP	ENST00000394729.2	37	CCDS2870.1	.	.	.	.	.	.	.	.	.	.	C	31	5.100681	0.94245	.	.	ENSG00000163932	ENST00000394729;ENST00000330452	D;D	0.83755	-1.76;-1.76	5.47	5.47	0.80525	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93825	0.8025	H	0.94658	3.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95242	0.8352	10	0.87932	D	0	.	18.1017	0.89508	0.0:1.0:0.0:0.0	.	465	Q05655	KPCD_HUMAN	Y	465	ENSP00000378217:H465Y;ENSP00000331602:H465Y	ENSP00000331602:H465Y	H	+	1	0	PRKCD	53196436	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	7.818000	0.86416	2.572000	0.86782	0.591000	0.81541	CAC	.	.	none		0.562	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257818.1		
LRRC75A	388341	hgsc.bcm.edu	37	17	16351219	16351219	+	Missense_Mutation	SNP	A	A	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr17:16351219A>C	ENST00000470794.1	-	3	458	c.431T>G	c.(430-432)cTc>cGc	p.L144R	C17orf76-AS1_ENST00000580770.1_RNA|FAM211A_ENST00000409083.3_Intron|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA	NM_001113567.2	NP_001107039.1														lung(1)	1						GTGGGGGCTGAGGTGGTATGT	0.657																																					p.L144R		Atlas-SNP	.											.	FAM211A	21	.	0			c.T431G						PASS	.						31.0	40.0	37.0					17																	16351219		692	1591	2283	SO:0001583	missense	388341	exon3			GGGCTGAGGTGGT																												ENST00000470794.1:c.431T>G	17.37:g.16351219A>C	ENSP00000419502:p.Leu144Arg	69.0	0.0	0		52.0	27.0	0.519231	NM_001113567		Missense_Mutation	SNP	ENST00000470794.1	37	CCDS45620.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522899	0.85600	.	.	ENSG00000181350	ENST00000470794	T	0.63744	-0.06	5.12	5.12	0.69794	.	.	.	.	.	T	0.75759	0.3893	M	0.62723	1.935	0.51482	D	0.999924	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.78494	-0.2182	9	0.87932	D	0	.	13.1626	0.59552	1.0:0.0:0.0:0.0	.	144;117	Q8NAA5;B7ZMA3	CQ076_HUMAN;.	R	144	ENSP00000419502:L144R	ENSP00000419502:L144R	L	-	2	0	C17orf76	16291944	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.285000	0.89914	2.068000	0.61886	0.402000	0.26972	CTC	.	.	none		0.657	FAM211A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130463.3		
OR51B6	390058	hgsc.bcm.edu	37	11	5372968	5372968	+	Silent	SNP	C	C	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:5372968C>A	ENST00000380219.1	+	1	231	c.231C>A	c.(229-231)ccC>ccA	p.P77P	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	77					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCACAATGCCCACAGTGCTAG	0.468																																					p.P77P		Atlas-SNP	.											.	OR51B6	53	.	0			c.C231A						PASS	.						134.0	122.0	126.0					11																	5372968		2201	4297	6498	SO:0001819	synonymous_variant	390058	exon1			AATGCCCACAGTG		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.231C>A	11.37:g.5372968C>A		122.0	0.0	0		127.0	56.0	0.440945	NM_001004750		Silent	SNP	ENST00000380219.1	37	CCDS31379.1																																																																																			.	.	none		0.468	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142960.1	NM_001004750	
C7orf65	401335	hgsc.bcm.edu	37	7	47694914	47694914	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr7:47694914G>A	ENST00000408988.2	+	1	73	c.38G>A	c.(37-39)cGg>cAg	p.R13Q		NM_001123065.1	NP_001116537.1	Q6ZTY9	CG065_HUMAN	chromosome 7 open reading frame 65	13										endometrium(1)|lung(2)	3						GAAGGAAGACGGCTCTGGCCG	0.622																																					p.R13Q		Atlas-SNP	.											.	C7orf65	18	.	0			c.G38A						PASS	.						47.0	52.0	51.0					7																	47694914		1568	3582	5150	SO:0001583	missense	401335	exon1			GAAGACGGCTCTG		CCDS43580.1	7p12.3	2009-02-11			ENSG00000221845	ENSG00000221845			34432	protein-coding gene	gene with protein product							Standard	NM_001123065		Approved	FLJ44108	uc010kyp.1	Q6ZTY9	OTTHUMG00000155550	ENST00000408988.2:c.38G>A	7.37:g.47694914G>A	ENSP00000386198:p.Arg13Gln	196.0	0.0	0		197.0	18.0	0.0913706	NM_001123065	A4D2F8	Missense_Mutation	SNP	ENST00000408988.2	37	CCDS43580.1	.	.	.	.	.	.	.	.	.	.	G	9.775	1.173730	0.21704	.	.	ENSG00000221845	ENST00000408988	.	.	.	2.48	-0.944	0.10392	.	.	.	.	.	T	0.16854	0.0405	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.20009	-1.0288	8	0.87932	D	0	.	5.4423	0.16515	0.6062:0.0:0.3938:0.0	.	13	Q6ZTY9	CG065_HUMAN	Q	13	.	ENSP00000386198:R13Q	R	+	2	0	C7orf65	47661439	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.321000	0.08018	-0.248000	0.09583	-0.123000	0.14984	CGG	.	.	none		0.622	C7orf65-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340616.1	NM_001123065	
NINL	22981	hgsc.bcm.edu	37	20	25462663	25462663	+	Missense_Mutation	SNP	T	T	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr20:25462663T>A	ENST00000278886.6	-	14	1824	c.1751A>T	c.(1750-1752)cAc>cTc	p.H584L	NINL_ENST00000422516.1_Missense_Mutation_p.H584L	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	584					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TGAGGGGCTGTGCCGGTTCTT	0.697																																					p.H584L		Atlas-SNP	.											.	NINL	148	.	0			c.A1751T						PASS	.						42.0	49.0	47.0					20																	25462663		2202	4300	6502	SO:0001583	missense	22981	exon14			GGGCTGTGCCGGT		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1751A>T	20.37:g.25462663T>A	ENSP00000278886:p.His584Leu	18.0	0.0	0		24.0	9.0	0.375	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	37	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	T	6.869	0.529744	0.13127	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.29917	1.8;1.55	4.52	-4.41	0.03590	.	1.487320	0.04044	N	0.303550	T	0.16896	0.0406	L	0.29908	0.895	0.09310	N	1	P;B	0.38370	0.628;0.276	B;B	0.33254	0.16;0.037	T	0.17137	-1.0379	10	0.11182	T	0.66	-0.0542	7.4738	0.27363	0.0:0.1375:0.235:0.6276	.	584;584	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	L	584	ENSP00000278886:H584L;ENSP00000410431:H584L	ENSP00000278886:H584L	H	-	2	0	NINL	25410663	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.352000	0.07701	-0.660000	0.05352	0.454000	0.30748	CAC	.	.	none		0.697	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
NID1	4811	hgsc.bcm.edu	37	1	236156994	236156994	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:236156994G>A	ENST00000264187.6	-	13	2788	c.2706C>T	c.(2704-2706)gaC>gaT	p.D902D	NID1_ENST00000366595.3_Silent_p.D769D	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	902	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	CCTCGCGGCCGTCGCGATCCA	0.701																																					p.D902D		Atlas-SNP	.											.	NID1	196	.	0			c.C2706T						PASS	.						20.0	20.0	20.0					1																	236156994		2199	4295	6494	SO:0001819	synonymous_variant	4811	exon13			GCGGCCGTCGCGA	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2706C>T	1.37:g.236156994G>A		94.0	0.0	0		89.0	34.0	0.382022	NM_002508	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Silent	SNP	ENST00000264187.6	37	CCDS1608.1																																																																																			.	.	none		0.701	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096647.2	NM_002508	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110582853	110582853	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:110582853C>G	ENST00000260283.4	-	2	386	c.102G>C	c.(100-102)aaG>aaC	p.K34N	ARHGAP20_ENST00000528829.1_Intron|ARHGAP20_ENST00000533353.1_Intron|ARHGAP20_ENST00000524756.1_5'Flank|ARHGAP20_ENST00000527598.1_Intron	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	34					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		TCCTCACCTTCTTGGTGCAGC	0.741																																					p.K34N		Atlas-SNP	.											ARHGAP20,brain,primitive_neuroectodermal_tumour-medulloblastoma,-1,1	ARHGAP20	150	1	0			c.G102C						scavenged	.						6.0	7.0	7.0					11																	110582853		2157	4251	6408	SO:0001583	missense	57569	exon2			CACCTTCTTGGTG	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.102G>C	11.37:g.110582853C>G	ENSP00000260283:p.Lys34Asn	35.0	1.0	0.0285714		33.0	12.0	0.363636	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	37	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.661627	0.29515	.	.	ENSG00000137727	ENST00000260283	T	0.12569	2.67	3.91	2.98	0.34508	.	0.290587	0.25186	N	0.032496	T	0.07954	0.0199	N	0.22421	0.69	0.80722	D	1	P	0.41313	0.745	B	0.35413	0.202	T	0.16867	-1.0388	10	0.59425	D	0.04	.	7.9066	0.29765	0.0:0.8768:0.0:0.1232	.	34	Q9P2F6	RHG20_HUMAN	N	34	ENSP00000260283:K34N	ENSP00000260283:K34N	K	-	3	2	ARHGAP20	110088063	1.000000	0.71417	0.995000	0.50966	0.042000	0.13812	1.072000	0.30678	1.728000	0.51552	0.555000	0.69702	AAG	.	.	none		0.741	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
ROBO1	6091	hgsc.bcm.edu	37	3	78711223	78711223	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:78711223G>T	ENST00000464233.1	-	15	2121	c.2008C>A	c.(2008-2010)Cag>Aag	p.Q670K	ROBO1_ENST00000436010.2_Missense_Mutation_p.Q631K|ROBO1_ENST00000495273.1_Missense_Mutation_p.Q634K|ROBO1_ENST00000467549.1_Missense_Mutation_p.Q634K	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	670					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGCTCTCTCTGGACCTGCTTG	0.488																																					p.Q670K		Atlas-SNP	.											.	ROBO1	833	.	0			c.C2008A						PASS	.						71.0	79.0	76.0					3																	78711223		1964	4147	6111	SO:0001583	missense	6091	exon15			CTCTCTGGACCTG	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2008C>A	3.37:g.78711223G>T	ENSP00000420321:p.Gln670Lys	110.0	0.0	0		125.0	19.0	0.152	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767033	0.90020	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.61510	0.13;0.1;0.1;0.17	5.48	4.61	0.57282	Fibronectin, type III (1);	0.000000	0.85682	D	0.000000	T	0.74891	0.3776	M	0.77616	2.38	0.58432	D	0.999996	P;D;D;D;P;P	0.69078	0.811;0.969;0.989;0.997;0.773;0.934	P;P;D;D;B;P	0.72338	0.879;0.869;0.915;0.977;0.441;0.748	T	0.76854	-0.2805	9	.	.	.	.	14.1298	0.65245	0.0724:0.0:0.9276:0.0	.	634;634;670;634;634;631	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	K	631;634;670;634;634;674	ENSP00000406043:Q631K;ENSP00000420321:Q670K;ENSP00000420637:Q634K;ENSP00000417992:Q634K	.	Q	-	1	0	ROBO1	78793913	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.850000	0.99511	1.310000	0.45006	0.555000	0.69702	CAG	.	.	none		0.488	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
PIM1	5292	hgsc.bcm.edu	37	6	37139087	37139087	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:37139087C>G	ENST00000373509.5	+	4	800	c.427C>G	c.(427-429)Ctg>Gtg	p.L143V		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	234	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	GCAAGAGGAGCTGGCCCGCAG	0.612			T	BCL6	NHL																																p.L234V		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,1	PIM1	71	1	0			c.C700G						scavenged	.						58.0	69.0	66.0					6																	37139087		2203	4300	6503	SO:0001583	missense	5292	exon4			GAGGAGCTGGCCC		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.427C>G	6.37:g.37139087C>G	ENSP00000362608:p.Leu143Val	112.0	2.0	0.0178571		104.0	41.0	0.394231	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	C	8.238	0.806101	0.16467	.	.	ENSG00000137193	ENST00000373509	T	0.65732	-0.17	4.19	3.32	0.38043	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.414587	0.22060	N	0.065197	T	0.22781	0.0550	N	0.12471	0.22	0.44123	D	0.996902	B	0.22146	0.065	B	0.31751	0.135	T	0.08289	-1.0729	10	0.31617	T	0.26	.	3.7592	0.08598	0.3065:0.5026:0.0:0.1909	.	234	P11309	PIM1_HUMAN	V	143	ENSP00000362608:L143V	ENSP00000362608:L143V	L	+	1	2	PIM1	37247065	1.000000	0.71417	1.000000	0.80357	0.432000	0.31715	2.493000	0.45320	0.981000	0.38548	-0.480000	0.04831	CTG	.	.	none		0.612	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
TSHZ1	10194	hgsc.bcm.edu	37	18	72998479	72998479	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr18:72998479G>C	ENST00000580243.1	+	2	1465	c.1117G>C	c.(1117-1119)Gag>Cag	p.E373Q	TSHZ1_ENST00000322038.5_Missense_Mutation_p.E328Q			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	373					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		AATGGCCGCAGAGGTGGCCCT	0.627																																					p.E328Q		Atlas-SNP	.											.	TSHZ1	104	.	0			c.G982C						PASS	.						77.0	84.0	82.0					18																	72998479		2203	4300	6503	SO:0001583	missense	10194	exon2			GCCGCAGAGGTGG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1117G>C	18.37:g.72998479G>C	ENSP00000464391:p.Glu373Gln	73.0	0.0	0		99.0	12.0	0.121212	NM_005786	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	ENST00000580243.1	37		.	.	.	.	.	.	.	.	.	.	G	2.206	-0.381839	0.04966	.	.	ENSG00000179981	ENST00000322038	T	0.11821	2.74	5.27	5.27	0.74061	.	0.632498	0.16025	N	0.233147	T	0.12178	0.0296	L	0.36672	1.1	0.25438	N	0.988122	B	0.23058	0.079	B	0.20384	0.029	T	0.17379	-1.0371	10	0.25751	T	0.34	-12.3326	12.2676	0.54686	0.0775:0.0:0.9225:0.0	.	373	Q6ZSZ6	TSH1_HUMAN	Q	328	ENSP00000323584:E328Q	ENSP00000323584:E328Q	E	+	1	0	TSHZ1	71127467	0.988000	0.35896	0.040000	0.18447	0.018000	0.09664	4.584000	0.60971	1.986000	0.57962	0.459000	0.35465	GAG	.	.	none		0.627	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
TET2	54790	hgsc.bcm.edu	37	4	106155165	106155165	+	Silent	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:106155165T>G	ENST00000540549.1	+	3	926	c.66T>G	c.(64-66)ccT>ccG	p.P22P	TET2_ENST00000545826.1_Silent_p.P22P|TET2_ENST00000380013.4_Silent_p.P22P|TET2_ENST00000513237.1_Silent_p.P43P|TET2_ENST00000413648.2_Silent_p.P22P|TET2_ENST00000305737.2_Silent_p.P22P|TET2_ENST00000394764.1_Silent_p.P22P			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	22					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TACCATCACCTCCCATTTGCC	0.522			"""Mis N, F"""		MDS																																p.P22P		Atlas-SNP	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	TET2,NS,haematopoietic_neoplasm,+1,1	TET2	1762	1	0			c.T66G						PASS	.						76.0	65.0	68.0					4																	106155165		2203	4300	6503	SO:0001819	synonymous_variant	54790	exon3			ATCACCTCCCATT	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.66T>G	4.37:g.106155165T>G		53.0	0.0	0		54.0	14.0	0.259259	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Silent	SNP	ENST00000540549.1	37	CCDS47120.1																																																																																			.	.	none		0.522	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
TUSC2	11334	hgsc.bcm.edu	37	3	50365502	50365502	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:50365502C>T	ENST00000232496.4	-	1	172	c.29G>A	c.(28-30)gGc>gAc	p.G10D	TUSC2_ENST00000462137.1_5'UTR	NM_007275.1	NP_009206.1	O75896	TUSC2_HUMAN	tumor suppressor candidate 2	10					cell cycle (GO:0007049)|cell maturation (GO:0048469)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|chemokine (C-C motif) ligand 5 production (GO:0071609)|inflammatory response (GO:0006954)|interleukin-15 production (GO:0032618)|natural killer cell differentiation (GO:0001779)|negative regulation of interleukin-17 production (GO:0032700)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)|phagocytosis (GO:0006909)|positive regulation of interleukin-10 production (GO:0032733)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to defense-related host reactive oxygen species production (GO:0052567)	mitochondrion (GO:0005739)				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGGCCACAGGCCCCGAGCTTT	0.731																																					p.G10D		Atlas-SNP	.											.	TUSC2	4	.	0			c.G29A						PASS	.						2.0	3.0	2.0					3																	50365502		1520	3225	4745	SO:0001583	missense	11334	exon1			CACAGGCCCCGAG	AF055479	CCDS2819.1	3p21.3	2010-09-21	2004-01-20	2004-01-21	ENSG00000114383	ENSG00000114383			17034	protein-coding gene	gene with protein product		607052	"""PDGFA associated protein 2"""	PDAP2		8780057, 11593436	Standard	NM_007275		Approved	FUS1, PAP, C3orf11	uc003czy.1	O75896	OTTHUMG00000156877	ENST00000232496.4:c.29G>A	3.37:g.50365502C>T	ENSP00000232496:p.Gly10Asp	15.0	0.0	0		24.0	12.0	0.5	NM_007275	B2R4Y9	Missense_Mutation	SNP	ENST00000232496.4	37	CCDS2819.1	.	.	.	.	.	.	.	.	.	.	C	36	5.870022	0.97049	.	.	ENSG00000114383	ENST00000232496	.	.	.	5.55	5.55	0.83447	.	0.286088	0.37906	N	0.001889	T	0.76463	0.3991	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76099	-0.3083	9	0.49607	T	0.09	-8.9261	17.0031	0.86385	0.0:1.0:0.0:0.0	.	10	O75896	TUSC2_HUMAN	D	10	.	ENSP00000232496:G10D	G	-	2	0	TUSC2	50340506	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.725000	0.61979	2.609000	0.88269	0.563000	0.77884	GGC	.	.	none		0.731	TUSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346399.1	NM_007275	
IMPG1	3617	hgsc.bcm.edu	37	6	76713610	76713610	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:76713610G>T	ENST00000369950.3	-	11	1382	c.1193C>A	c.(1192-1194)tCt>tAt	p.S398Y	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AACAGCAAAAGATGTGGGCAG	0.378																																					p.S398Y	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.C1193A						PASS	.						86.0	77.0	80.0					6																	76713610		2203	4300	6503	SO:0001583	missense	3617	exon11			GCAAAAGATGTGG	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.1193C>A	6.37:g.76713610G>T	ENSP00000358966:p.Ser398Tyr	51.0	0.0	0		60.0	15.0	0.25	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	37	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	8.289	0.817231	0.16607	.	.	ENSG00000112706	ENST00000369950	T	0.21734	1.99	4.32	1.36	0.22044	.	0.570121	0.16822	N	0.198108	T	0.02012	0.0063	N	0.08118	0	0.09310	N	1	P	0.46706	0.883	B	0.34722	0.188	T	0.34502	-0.9826	10	0.35671	T	0.21	.	2.3028	0.04166	0.2982:0.0:0.4574:0.2445	.	398	Q17R60	IMPG1_HUMAN	Y	398	ENSP00000358966:S398Y	ENSP00000358966:S398Y	S	-	2	0	IMPG1	76770330	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.090000	0.30902	0.138000	0.18790	0.563000	0.77884	TCT	.	.	none		0.378	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
BTG2	7832	hgsc.bcm.edu	37	1	203276238	203276238	+	Missense_Mutation	SNP	A	A	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr1:203276238A>G	ENST00000290551.4	+	2	220	c.149A>G	c.(148-150)tAc>tGc	p.Y50C	RP11-134P9.1_ENST00000457348.1_lincRNA	NM_006763.2	NP_006754.1	P78543	BTG2_HUMAN	BTG family, member 2	50					anterior/posterior pattern specification (GO:0009952)|associative learning (GO:0008306)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system neuron development (GO:0021954)|dentate gyrus development (GO:0021542)|DNA repair (GO:0006281)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of translation (GO:0017148)|neuron projection development (GO:0031175)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|protein methylation (GO:0006479)|response to electrical stimulus (GO:0051602)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|skeletal muscle cell differentiation (GO:0035914)	extracellular vesicular exosome (GO:0070062)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(75;0.203)			ACAGAGCACTACAAACACCAC	0.597																																					p.Y50C		Atlas-SNP	.											.	BTG2	16	.	0			c.A149G						PASS	.						39.0	41.0	40.0					1																	203276238		2203	4300	6503	SO:0001583	missense	7832	exon2			AGCACTACAAACA		CCDS1437.1	1q32	2008-07-18			ENSG00000159388	ENSG00000159388			1131	protein-coding gene	gene with protein product	"""B-cell translocation gene 2"", ""pheochromacytoma cell-3"", ""NGF-inducible anti-proliferative protein PC3"", ""nerve growth factor-inducible anti-proliferative"""	601597				8944033	Standard	NM_006763		Approved	PC3, TIS21, MGC126063, MGC126064	uc001gzq.3	P78543	OTTHUMG00000035834	ENST00000290551.4:c.149A>G	1.37:g.203276238A>G	ENSP00000290551:p.Tyr50Cys	75.0	0.0	0		51.0	9.0	0.176471	NM_006763	A0A024R986|Q3KR25|Q5VUT0	Missense_Mutation	SNP	ENST00000290551.4	37	CCDS1437.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.953961	0.73902	.	.	ENSG00000159388	ENST00000290551	T	0.34275	1.37	4.53	4.53	0.55603	Anti-proliferative protein (4);	0.000000	0.64402	D	0.000003	T	0.63733	0.2536	M	0.87269	2.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.71062	-0.4701	10	0.87932	D	0	-11.3369	12.8211	0.57694	1.0:0.0:0.0:0.0	.	50	P78543	BTG2_HUMAN	C	50	ENSP00000290551:Y50C	ENSP00000290551:Y50C	Y	+	2	0	BTG2	201542861	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	8.727000	0.91480	1.911000	0.55334	0.260000	0.18958	TAC	.	.	none		0.597	BTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087168.1	NM_006763	
GFPT1	2673	hgsc.bcm.edu	37	2	69565092	69565092	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr2:69565092G>A	ENST00000357308.4	-	15	1598	c.1420C>T	c.(1420-1422)Cgg>Tgg	p.R474W	GFPT1_ENST00000361060.5_Missense_Mutation_p.R456W	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	474	Isomerase.|SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						TCTGTCTCCCGTGATATGGAA	0.428																																					p.R474W		Atlas-SNP	.											.	GFPT1	38	.	0			c.C1420T						PASS	.						258.0	219.0	232.0					2																	69565092		2203	4300	6503	SO:0001583	missense	2673	exon15			TCTCCCGTGATAT		CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.1420C>T	2.37:g.69565092G>A	ENSP00000349860:p.Arg474Trp	144.0	0.0	0		100.0	32.0	0.32	NM_001244710	Q53QE6|Q9BXF8	Missense_Mutation	SNP	ENST00000357308.4	37	CCDS58713.1	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816702	0.50633	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.68624	-0.34;-0.34	5.43	-4.24	0.03777	.	0.000000	0.85682	D	0.000000	T	0.77391	0.4123	H	0.99011	4.4	0.80722	D	1	B	0.24768	0.111	B	0.24155	0.051	T	0.73905	-0.3835	10	0.87932	D	0	-16.2206	15.5538	0.76173	0.0937:0.0:0.7207:0.1856	.	456	Q06210-2	.	W	474;456	ENSP00000349860:R474W;ENSP00000354347:R456W	ENSP00000349860:R474W	R	-	1	2	GFPT1	69418596	0.827000	0.29292	0.471000	0.27229	0.985000	0.73830	0.479000	0.22228	-0.841000	0.04200	-0.266000	0.10368	CGG	.	.	none		0.428	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
OR52M1	119772	hgsc.bcm.edu	37	11	4566782	4566782	+	Missense_Mutation	SNP	C	C	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:4566782C>G	ENST00000360213.1	+	1	362	c.362C>G	c.(361-363)gCt>gGt	p.A121G		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTGCCATGGCTTTTGATCGC	0.537																																					p.A121G		Atlas-SNP	.											OR52M1,NS,haematopoietic_neoplasm,+1,3	OR52M1	53	3	0			c.C362G						PASS	.						149.0	130.0	136.0					11																	4566782		2201	4298	6499	SO:0001583	missense	119772	exon1			CCATGGCTTTTGA	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.362C>G	11.37:g.4566782C>G	ENSP00000353343:p.Ala121Gly	252.0	0.0	0		257.0	69.0	0.268482	NM_001004137		Missense_Mutation	SNP	ENST00000360213.1	37	CCDS31353.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.669144	0.88348	.	.	ENSG00000197790	ENST00000360213	T	0.55052	0.54	4.98	4.98	0.66077	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000248	T	0.75642	0.3877	M	0.89658	3.05	0.47441	D	0.999421	D	0.71674	0.998	P	0.61397	0.888	T	0.80959	-0.1149	10	0.66056	D	0.02	.	17.3425	0.87301	0.0:1.0:0.0:0.0	.	121	Q8NGK5	O52M1_HUMAN	G	121	ENSP00000353343:A121G	ENSP00000353343:A121G	A	+	2	0	OR52M1	4523358	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.560000	0.82277	2.756000	0.94617	0.650000	0.86243	GCT	.	.	none		0.537	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385847.1	NM_001004137	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37490169	37490169	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr10:37490169C>T	ENST00000602533.1	+	31	2716	c.2617C>T	c.(2617-2619)Cgt>Tgt	p.R873C	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.R873C|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.R992C			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	929					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACAGAGTCTCCGTGAGACTGT	0.274																																					p.R873C		Atlas-SNP	.											.	ANKRD30A	448	.	0			c.C2617T						PASS	.						75.0	69.0	71.0					10																	37490169		1789	4054	5843	SO:0001583	missense	91074	exon31			AGTCTCCGTGAGA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2617C>T	10.37:g.37490169C>T	ENSP00000473551:p.Arg873Cys	644.0	0.0	0		620.0	79.0	0.127419	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	c	7.328	0.618303	0.14129	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.07021	3.23;3.23	1.38	-2.76	0.05896	.	.	.	.	.	T	0.02156	0.0067	N	0.03608	-0.345	0.09310	N	1	P	0.35793	0.521	B	0.08055	0.003	T	0.39210	-0.9625	9	0.59425	D	0.04	.	1.5295	0.02532	0.3039:0.2234:0.0:0.4727	.	929	Q9BXX3	AN30A_HUMAN	C	873;992	ENSP00000354432:R873C;ENSP00000363792:R992C	ENSP00000354432:R873C	R	+	1	0	ANKRD30A	37530175	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.369000	0.20416	-0.455000	0.07054	-0.760000	0.03462	CGT	.	.	none		0.274	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
PIM1	5292	hgsc.bcm.edu	37	6	37138423	37138423	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:37138423G>A	ENST00000373509.5	+	1	445	c.72G>A	c.(70-72)aaG>aaA	p.K24K		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	115					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.K24N(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	ACGCCACCAAGCTGGCGCCCG	0.726			T	BCL6	NHL																																p.K115K		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,1	PIM1	71	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G345A						PASS	.						22.0	25.0	24.0					6																	37138423		2197	4289	6486	SO:0001819	synonymous_variant	5292	exon1			CACCAAGCTGGCG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.72G>A	6.37:g.37138423G>A		61.0	0.0	0		92.0	26.0	0.282609	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Silent	SNP	ENST00000373509.5	37	CCDS4830.1																																																																																			.	.	none		0.726	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
SMEK1	55671	hgsc.bcm.edu	37	14	91937274	91937274	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr14:91937274G>A	ENST00000554943.1	-	10	1682	c.1567C>T	c.(1567-1569)Cat>Tat	p.H523Y	SMEK1_ENST00000555462.1_Missense_Mutation_p.H284Y|SMEK1_ENST00000554684.1_Missense_Mutation_p.H510Y|SMEK1_ENST00000337238.4_Missense_Mutation_p.H510Y|SMEK1_ENST00000428424.2_Missense_Mutation_p.H284Y			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	523					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TGGTAGGTATGGTGCTCCACA	0.353																																					p.H510Y		Atlas-SNP	.											.	SMEK1	94	.	0			c.C1528T						PASS	.						108.0	110.0	110.0					14																	91937274		2203	4300	6503	SO:0001583	missense	55671	exon11			AGGTATGGTGCTC	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1567C>T	14.37:g.91937274G>A	ENSP00000450883:p.His523Tyr	117.0	0.0	0		132.0	46.0	0.348485	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	37		.	.	.	.	.	.	.	.	.	.	G	15.55	2.866703	0.51588	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390	D;D;D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59;-3.59;-3.59	5.6	4.71	0.59529	Armadillo-like helical (1);Armadillo-type fold (1);	0.045903	0.85682	D	0.000000	D	0.97698	0.9245	M	0.90198	3.095	0.80722	D	1	P;D;D	0.89917	0.701;1.0;1.0	B;D;D	0.97110	0.201;0.999;1.0	D	0.98583	1.0651	10	0.87932	D	0	-16.6192	16.5223	0.84320	0.0:0.131:0.869:0.0	.	284;523;510	Q6IN85-4;Q6IN85;Q6IN85-2	.;P4R3A_HUMAN;.	Y	510;510;284;523;284;510	ENSP00000450864:H510Y;ENSP00000337125:H510Y;ENSP00000392704:H284Y;ENSP00000450883:H523Y;ENSP00000450891:H284Y;ENSP00000452596:H510Y	ENSP00000337125:H510Y	H	-	1	0	SMEK1	91007027	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	9.869000	0.99810	1.346000	0.45694	-0.182000	0.12963	CAT	.	.	none		0.353	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
RMND5B	64777	hgsc.bcm.edu	37	5	177565199	177565199	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr5:177565199C>T	ENST00000515098.1	+	4	430	c.79C>T	c.(79-81)Cgg>Tgg	p.R27W	RMND5B_ENST00000542098.1_Intron|RMND5B_ENST00000313386.4_Missense_Mutation_p.R27W			Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog B (S. cerevisiae)	27										endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	17	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCACTGTGAGCGGAGCCTGGA	0.672																																					p.R27W		Atlas-SNP	.											.	RMND5B	37	.	0			c.C79T						PASS	.						58.0	47.0	50.0					5																	177565199		2203	4300	6503	SO:0001583	missense	64777	exon3			TGTGAGCGGAGCC	BC009911	CCDS4431.1, CCDS75382.1	5q35.3	2012-07-20			ENSG00000145916	ENSG00000145916			26181	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog B"""					12975309	Standard	NM_022762		Approved	FLJ22318, GID2, GID2B	uc003mim.3	Q96G75	OTTHUMG00000130897	ENST00000515098.1:c.79C>T	5.37:g.177565199C>T	ENSP00000420875:p.Arg27Trp	136.0	0.0	0		142.0	44.0	0.309859	NM_022762	Q1HE27|Q6UVY7|Q9H6F6	Missense_Mutation	SNP	ENST00000515098.1	37	CCDS4431.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.127598	0.56721	.	.	ENSG00000145916	ENST00000313386;ENST00000515098;ENST00000502814;ENST00000507457;ENST00000508647	.	.	.	5.44	4.49	0.54785	.	0.139173	0.48286	D	0.000200	T	0.27278	0.0669	N	0.08118	0	0.80722	D	1	D	0.56521	0.976	B	0.38712	0.28	T	0.33369	-0.9871	9	0.87932	D	0	-11.477	14.4961	0.67688	0.157:0.843:0.0:0.0	.	27	Q96G75	RMD5B_HUMAN	W	27	.	ENSP00000320623:R27W	R	+	1	2	RMND5B	177497805	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	3.103000	0.50298	2.533000	0.85409	0.563000	0.77884	CGG	.	.	none		0.672	RMND5B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373542.1	NM_022762	
KIF25	3834	hgsc.bcm.edu	37	6	168440827	168440827	+	Missense_Mutation	SNP	G	G	A	rs148907230	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:168440827G>A	ENST00000443060.2	+	7	968	c.577G>A	c.(577-579)Gcg>Acg	p.A193T	KIF25_ENST00000354419.2_Missense_Mutation_p.A193T|KIF25_ENST00000351261.3_Missense_Mutation_p.A193T			Q9UIL4	KIF25_HUMAN	kinesin family member 25	193	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CCTGGTGCACGCGGATTCCTC	0.572													G|||	2	0.000399361	0.0008	0.0	5008	,	,		19153	0.0		0.0	False		,,,				2504	0.001				p.A193T		Atlas-SNP	.											.	KIF25	75	.	0			c.G577A						PASS	.	G	THR/ALA,THR/ALA	0,4406		0,0,2203	85.0	74.0	78.0		577,577	3.6	0.0	6	dbSNP_134	78	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense	KIF25	NM_005355.3,NM_030615.2	58,58	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging	193/333,193/385	168440827	3,13003	2203	4300	6503	SO:0001583	missense	3834	exon6			GTGCACGCGGATT	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.577G>A	6.37:g.168440827G>A	ENSP00000388878:p.Ala193Thr	41.0	0.0	0		49.0	14.0	0.285714	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	37	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479459	0.44044	0.0	3.49E-4	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.75477	-0.94;-0.94;-0.94	3.56	3.56	0.40772	Kinesin, motor domain (5);	0.256528	0.30879	N	0.008681	T	0.56381	0.1981	L	0.55743	1.74	0.26415	N	0.976198	P;B	0.42357	0.777;0.169	B;B	0.41691	0.364;0.046	T	0.53136	-0.8481	10	0.52906	T	0.07	-14.4088	10.5163	0.44892	0.0:0.0:1.0:0.0	.	193;193	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	T	193	ENSP00000388878:A193T;ENSP00000346401:A193T;ENSP00000252688:A193T	ENSP00000252688:A193T	A	+	1	0	KIF25	168183676	0.242000	0.23868	0.012000	0.15200	0.007000	0.05969	1.256000	0.32921	1.821000	0.53095	0.411000	0.27672	GCG	G|1.000;A|0.000	0.000	weak		0.572	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
PLXNB3	5365	hgsc.bcm.edu	37	X	153039097	153039097	+	Missense_Mutation	SNP	C	C	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chrX:153039097C>A	ENST00000361971.5	+	19	3322	c.3208C>A	c.(3208-3210)Cca>Aca	p.P1070T	PLXNB3_ENST00000538776.1_Missense_Mutation_p.P723T|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538966.1_Missense_Mutation_p.P1093T|PLXNB3_ENST00000538282.1_Missense_Mutation_p.P680T	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1070	IPT/TIG 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GGACCCACAGCCAAGGAGGAG	0.697																																					p.P1093T		Atlas-SNP	.											.	PLXNB3	208	.	0			c.C3277A						PASS	.						10.0	10.0	10.0					X																	153039097		2157	4225	6382	SO:0001583	missense	5365	exon20			CCACAGCCAAGGA	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3208C>A	X.37:g.153039097C>A	ENSP00000355378:p.Pro1070Thr	61.0	0.0	0		46.0	29.0	0.630435	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.835091	0.32421	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.66460	5.36;5.32;4.73;-0.21	4.62	3.75	0.43078	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.818716	0.10553	N	0.661165	T	0.57548	0.2061	M	0.68593	2.085	0.09310	N	1	P;B;P	0.38922	0.651;0.375;0.514	B;B;B	0.36922	0.198;0.236;0.079	T	0.46925	-0.9156	10	0.06891	T	0.86	.	5.9284	0.19124	0.0:0.6995:0.19:0.1105	.	723;1093;1070	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	T	1093;1070;723;680	ENSP00000442736:P1093T;ENSP00000355378:P1070T;ENSP00000445569:P723T;ENSP00000441919:P680T	ENSP00000355378:P1070T	P	+	1	0	PLXNB3	152692291	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.402000	0.20965	0.740000	0.32651	0.436000	0.28706	CCA	.	.	none		0.697	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
PIM1	5292	hgsc.bcm.edu	37	6	37138950	37138950	+	Missense_Mutation	SNP	G	G	C	rs562319987		TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr6:37138950G>C	ENST00000373509.5	+	4	663	c.290G>C	c.(289-291)aGc>aCc	p.S97T		NM_001243186.1|NM_002648.3	NP_001230115.1|NP_002639.1	P11309	PIM1_HUMAN	Pim-1 proto-oncogene, serine/threonine kinase	188					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|hyaluronan metabolic process (GO:0030212)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|manganese ion binding (GO:0030145)|protein serine/threonine kinase activity (GO:0004674)|ribosomal small subunit binding (GO:0043024)|transcription factor binding (GO:0008134)	p.S97N(2)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(17)|large_intestine(4)|lung(3)|prostate(2)|skin(2)	30			OV - Ovarian serous cystadenocarcinoma(102;0.241)		Adenosine monophosphate(DB00131)	AAGAAGGTGAGCTCGGGTTTC	0.647			T	BCL6	NHL																																p.S188T		Atlas-SNP	.		Dom	yes		6	6p21.2	5292	pim-1 oncogene		L	PIM1,NS,lymphoid_neoplasm,0,5	PIM1	71	5	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.G563C						scavenged	.						82.0	91.0	88.0					6																	37138950		2203	4300	6503	SO:0001583	missense	5292	exon4			AGGTGAGCTCGGG		CCDS4830.1	6p21	2014-06-25	2014-06-25		ENSG00000137193	ENSG00000137193			8986	protein-coding gene	gene with protein product		164960	"""pim-1 oncogene"""	PIM			Standard	NM_002648		Approved		uc003onk.3	P11309	OTTHUMG00000016426	ENST00000373509.5:c.290G>C	6.37:g.37138950G>C	ENSP00000362608:p.Ser97Thr	67.0	1.0	0.0149254		77.0	6.0	0.0779221	NM_001243186	Q38RT9|Q5T7H7|Q96RG3	Missense_Mutation	SNP	ENST00000373509.5	37	CCDS4830.1	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709883	0.30322	.	.	ENSG00000137193	ENST00000373509	T	0.14640	2.49	4.14	4.14	0.48551	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.123358	0.56097	D	0.000035	T	0.06462	0.0166	L	0.48935	1.535	0.47037	D	0.99929	B	0.13145	0.007	B	0.18263	0.021	T	0.12811	-1.0533	10	0.16896	T	0.51	.	16.5618	0.84568	0.0:0.0:1.0:0.0	.	188	P11309	PIM1_HUMAN	T	97	ENSP00000362608:S97T	ENSP00000362608:S97T	S	+	2	0	PIM1	37246928	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.570000	0.82390	2.283000	0.76528	0.549000	0.68633	AGC	.	.	none		0.647	PIM1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043903.1		
ARSE	415	hgsc.bcm.edu	37	X	2873470	2873470	+	Silent	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chrX:2873470G>A	ENST00000381134.3	-	4	360	c.294C>T	c.(292-294)taC>taT	p.Y98Y	ARSE_ENST00000545496.1_Silent_p.Y123Y|ARSE_ENST00000496095.1_5'Flank|ARSE_ENST00000540563.1_Silent_p.Y53Y	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	98					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ATCGCACAGGGTATCTGCCCG	0.498																																					p.Y98Y		Atlas-SNP	.											.	ARSE	43	.	0			c.C294T						PASS	.						106.0	69.0	82.0					X																	2873470		2203	4300	6503	SO:0001819	synonymous_variant	415	exon4			CACAGGGTATCTG	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.294C>T	X.37:g.2873470G>A		159.0	0.0	0		117.0	55.0	0.470085	NM_000047	Q53FT2|Q53FU8	Silent	SNP	ENST00000381134.3	37	CCDS14122.1																																																																																			.	.	none		0.498	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
MMRN1	22915	hgsc.bcm.edu	37	4	90856769	90856769	+	Missense_Mutation	SNP	G	G	C			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:90856769G>C	ENST00000394980.1	+	7	2257	c.1938G>C	c.(1936-1938)atG>atC	p.M646I	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Missense_Mutation_p.M646I|MMRN1_ENST00000508372.1_Missense_Mutation_p.M388I			Q13201	MMRN1_HUMAN	multimerin 1	646					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CTTATGATATGGAGATCCTTC	0.363																																					p.M646I		Atlas-SNP	.											.	MMRN1	174	.	0			c.G1938C						PASS	.						76.0	73.0	74.0					4																	90856769		2203	4300	6503	SO:0001583	missense	22915	exon6			TGATATGGAGATC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1938G>C	4.37:g.90856769G>C	ENSP00000378431:p.Met646Ile	106.0	0.0	0		106.0	20.0	0.188679	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	ENST00000394980.1	37	CCDS3635.1	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410361	0.62399	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.73363	-0.48;-0.48;-0.74	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.85435	0.5696	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	D	0.85759	0.1348	10	0.56958	D	0.05	.	19.3191	0.94231	0.0:0.0:1.0:0.0	.	646	Q13201	MMRN1_HUMAN	I	646;646;388	ENSP00000378431:M646I;ENSP00000264790:M646I;ENSP00000426461:M388I	ENSP00000264790:M646I	M	+	3	0	MMRN1	91075792	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.326000	0.72905	2.718000	0.92993	0.655000	0.94253	ATG	.	.	none		0.363	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
IDO2	169355	hgsc.bcm.edu	37	8	39872937	39872937	+	Missense_Mutation	SNP	A	A	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:39872937A>T	ENST00000389060.4	+	10	1040	c.1040A>T	c.(1039-1041)cAc>cTc	p.H347L	IDO2_ENST00000343295.4_3'UTR|IDO2_ENST00000502986.2_Missense_Mutation_p.H360L			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	347					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						CGGAGCTATCACATCACCATG	0.547																																					p.H360L		Atlas-SNP	.											.	IDO2	78	.	0			c.A1079T						PASS	.						80.0	79.0	80.0					8																	39872937		2080	4202	6282	SO:0001583	missense	169355	exon11			GCTATCACATCAC	AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.1040A>T	8.37:g.39872937A>T	ENSP00000426447:p.His347Leu	94.0	0.0	0		87.0	32.0	0.367816	NM_194294	A4UD41	Missense_Mutation	SNP	ENST00000389060.4	37		.	.	.	.	.	.	.	.	.	.	A	23.8	4.459110	0.84317	.	.	ENSG00000188676	ENST00000502986;ENST00000389060	D;D	0.93712	-3.27;-3.27	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.97742	0.9259	H	0.95504	3.68	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.98886	1.0771	9	.	.	.	.	15.5325	0.75974	1.0:0.0:0.0:0.0	.	360;347	F5H5G0;Q6ZQW0	.;I23O2_HUMAN	L	360;347	ENSP00000443432:H360L;ENSP00000426447:H347L	.	H	+	2	0	IDO2	39992094	1.000000	0.71417	0.999000	0.59377	0.717000	0.41224	6.577000	0.74027	2.252000	0.74401	0.533000	0.62120	CAC	.	.	none		0.547	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294	
APOL5	80831	hgsc.bcm.edu	37	22	36122574	36122574	+	Silent	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr22:36122574C>T	ENST00000249044.2	+	3	459	c.459C>T	c.(457-459)atC>atT	p.I153I		NM_030642.1	NP_085145.1	Q9BWW9	APOL5_HUMAN	apolipoprotein L, 5	153					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|skin(2)|urinary_tract(1)	19						TCATGAACATCCTGGGTTTGG	0.567																																					p.I153I		Atlas-SNP	.											.	APOL5	45	.	0			c.C459T						PASS	.						66.0	67.0	67.0					22																	36122574		2203	4300	6503	SO:0001819	synonymous_variant	80831	exon3			GAACATCCTGGGT	AY014878	CCDS13920.1	22q12.3	2013-01-24			ENSG00000128313	ENSG00000128313		"""Apolipoproteins"""	14869	protein-coding gene	gene with protein product		607255				11374903	Standard	NM_030642		Approved	APOLV	uc003aof.3	Q9BWW9	OTTHUMG00000150588	ENST00000249044.2:c.459C>T	22.37:g.36122574C>T		113.0	0.0	0		109.0	27.0	0.247706	NM_030642	Q5TFL9|Q9UGW5	Silent	SNP	ENST00000249044.2	37	CCDS13920.1																																																																																			.	.	none		0.567	APOL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318979.1	NM_030642	
SLC5A8	160728	hgsc.bcm.edu	37	12	101603483	101603483	+	Silent	SNP	G	G	A	rs147835898	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr12:101603483G>A	ENST00000536262.2	-	1	702	c.144C>T	c.(142-144)ggC>ggT	p.G48G		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TTCTGCGGCCGCCCATCAGGA	0.652																																					p.G48G	GBM(60;420 1056 13605 22380 47675)	Atlas-SNP	.											.	SLC5A8	102	.	0			c.C144T						PASS	.						45.0	42.0	43.0					12																	101603483		2203	4300	6503	SO:0001819	synonymous_variant	160728	exon1			GCGGCCGCCCATC	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.144C>T	12.37:g.101603483G>A		22.0	0.0	0		24.0	10.0	0.416667	NM_145913		Silent	SNP	ENST00000536262.2	37	CCDS9080.1																																																																																			G|0.999;T|0.001	.	alt		0.652	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
MAML3	55534	hgsc.bcm.edu	37	4	140811088	140811088	+	Missense_Mutation	SNP	T	T	C	rs544518608|rs58287721	byFrequency	TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:140811088T>C	ENST00000509479.2	-	2	2358	c.1502A>G	c.(1501-1503)cAg>cGg	p.Q501R	MAML3_ENST00000327122.5_Missense_Mutation_p.Q345R|MAML3_ENST00000398940.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					ctgctgctgctgctgctgctg	0.532																																					p.Q501R		Atlas-SNP	.											.	MAML3	192	.	0			c.A1502G						PASS	.						18.0	26.0	23.0					4																	140811088		2141	4284	6425	SO:0001583	missense	55534	exon2			TGCTGCTGCTGCT	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1502A>G	4.37:g.140811088T>C	ENSP00000421180:p.Gln501Arg	82.0	0.0	0		96.0	15.0	0.15625	NM_018717		Missense_Mutation	SNP	ENST00000509479.2	37	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	T	7.066	0.567353	0.13560	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	T;T	0.47869	0.83;0.83	3.5	0.541	0.17168	.	0.000000	0.51477	D	0.000093	T	0.26484	0.0647	N	0.19112	0.55	0.80722	D	1	B	0.31655	0.334	B	0.26202	0.067	T	0.04946	-1.0916	10	0.48119	T	0.1	.	7.8092	0.29221	0.0:0.0:0.4022:0.5978	.	501	Q96JK9	MAML3_HUMAN	R	501;345	ENSP00000421180:Q501R;ENSP00000313316:Q345R	ENSP00000313316:Q345R	Q	-	2	0	MAML3	141030538	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	2.071000	0.41500	0.332000	0.23536	0.329000	0.21502	CAG	.	.	none		0.532	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
MUC5B	727897	hgsc.bcm.edu	37	11	1268741	1268741	+	Missense_Mutation	SNP	C	C	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:1268741C>T	ENST00000529681.1	+	31	10689	c.10631C>T	c.(10630-10632)aCa>aTa	p.T3544I	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T3547I	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3544	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCACAGCCACACCCAGCAAG	0.692																																					p.T3544I		Atlas-SNP	.											.	MUC5B	473	.	0			c.C10631T						PASS	.						65.0	100.0	88.0					11																	1268741		2085	4208	6293	SO:0001583	missense	727897	exon31			CAGCCACACCCAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10631C>T	11.37:g.1268741C>T	ENSP00000436812:p.Thr3544Ile	195.0	0.0	0		181.0	46.0	0.254144	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	C	6.567	0.472919	0.12461	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.19806	2.12;2.35	2.4	-2.44	0.06502	.	.	.	.	.	T	0.31827	0.0809	L	0.47716	1.5	0.09310	N	1	D;D	0.69078	0.967;0.997	P;P	0.60789	0.835;0.879	T	0.31194	-0.9952	9	0.87932	D	0	.	11.534	0.50626	0.0:0.5071:0.4929:0.0	.	4072;3547	A7Y9J9;E9PBJ0	.;.	I	3544;3547;3516;3449	ENSP00000436812:T3544I;ENSP00000415793:T3547I	ENSP00000343037:T3516I	T	+	2	0	MUC5B	1225317	0.000000	0.05858	0.002000	0.10522	0.095000	0.18619	-0.017000	0.12590	-0.588000	0.05882	0.297000	0.19635	ACA	.	.	none		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TLN1	7094	hgsc.bcm.edu	37	9	35720844	35720844	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr9:35720844G>A	ENST00000314888.9	-	11	1524	c.1171C>T	c.(1171-1173)Ctc>Ttc	p.L391F	TLN1_ENST00000540444.1_Missense_Mutation_p.L391F	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	391	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with LAYN. {ECO:0000250}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCGGCAATGAGCTGTGCAATC	0.512																																					p.L391F		Atlas-SNP	.											.	TLN1	185	.	0			c.C1171T						PASS	.						163.0	137.0	146.0					9																	35720844		2203	4300	6503	SO:0001583	missense	7094	exon11			CAATGAGCTGTGC	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.1171C>T	9.37:g.35720844G>A	ENSP00000316029:p.Leu391Phe	59.0	0.0	0		59.0	9.0	0.152542	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	G	35	5.425854	0.96131	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.73897	-0.79;-0.79	5.71	5.71	0.89125	FERM domain (1);Pleckstrin homology-type (1);Insulin receptor substrate-1, PTB (1);	0.000000	0.85682	D	0.000000	D	0.89054	0.6606	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90327	0.4349	10	0.87932	D	0	-10.4026	19.8677	0.96824	0.0:0.0:1.0:0.0	.	391	Q9Y490	TLN1_HUMAN	F	391	ENSP00000316029:L391F;ENSP00000442981:L391F	ENSP00000316029:L391F	L	-	1	0	TLN1	35710844	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.753000	0.68736	2.709000	0.92574	0.655000	0.94253	CTC	.	.	none		0.512	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
ANKRD50	57182	hgsc.bcm.edu	37	4	125631534	125631534	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr4:125631534T>G	ENST00000504087.1	-	2	1170	c.133A>C	c.(133-135)Aat>Cat	p.N45H	ANKRD50_ENST00000515641.1_Intron	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	45				N -> D (in Ref. 1; BAF83757). {ECO:0000305}.						NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						ACAGCACTATTGCAGCAGTTA	0.473																																					p.N45H		Atlas-SNP	.											.	ANKRD50	136	.	0			c.A133C						PASS	.						98.0	96.0	97.0					4																	125631534		2203	4300	6503	SO:0001583	missense	57182	exon2			CACTATTGCAGCA	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.133A>C	4.37:g.125631534T>G	ENSP00000425658:p.Asn45His	95.0	0.0	0		93.0	32.0	0.344086	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490934	0.26774	.	.	ENSG00000151458	ENST00000504087	T	0.18810	2.19	5.23	2.64	0.31445	.	0.603815	0.16483	N	0.212469	T	0.09247	0.0228	N	0.08118	0	0.48511	D	0.99966	B	0.02656	0.0	B	0.01281	0.0	T	0.15093	-1.0449	10	0.59425	D	0.04	.	3.1162	0.06375	0.1441:0.0817:0.1406:0.6336	.	45	Q9ULJ7	ANR50_HUMAN	H	45	ENSP00000425658:N45H	ENSP00000425658:N45H	N	-	1	0	ANKRD50	125850984	0.969000	0.33509	0.683000	0.30040	0.990000	0.78478	1.272000	0.33109	0.382000	0.24878	0.459000	0.35465	AAT	.	.	none		0.473	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
FAM19A1	407738	hgsc.bcm.edu	37	3	68055837	68055837	+	Missense_Mutation	SNP	G	G	T			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr3:68055837G>T	ENST00000478136.1	+	2	558	c.68G>T	c.(67-69)tGc>tTc	p.C23F	FAM19A1_ENST00000496687.1_Missense_Mutation_p.C23F	NM_213609.3	NP_998774.2	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A1	23						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	7		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		ATGCTACTCTGCCATGGATCC	0.502																																					p.C23F		Atlas-SNP	.											.	FAM19A1	58	.	0			c.G68T						PASS	.						229.0	223.0	225.0					3																	68055837		2106	4240	6346	SO:0001583	missense	407738	exon2			TACTCTGCCATGG	AY325114	CCDS54606.1	3p14.1	2005-01-20			ENSG00000183662	ENSG00000183662			21587	protein-coding gene	gene with protein product						15028294	Standard	NM_213609		Approved	TAFA-1	uc003dnd.3	Q7Z5A9	OTTHUMG00000158745	ENST00000478136.1:c.68G>T	3.37:g.68055837G>T	ENSP00000418575:p.Cys23Phe	154.0	0.0	0		196.0	64.0	0.326531	NM_213609	A8K0V3|Q8TCL8	Missense_Mutation	SNP	ENST00000478136.1	37	CCDS54606.1	.	.	.	.	.	.	.	.	.	.	.	14.30	2.493413	0.44352	.	.	ENSG00000183662	ENST00000478136;ENST00000496687	.	.	.	6.17	6.17	0.99709	.	0.181406	0.37178	N	0.002215	T	0.63165	0.2488	L	0.29908	0.895	0.51482	D	0.999929	P	0.51240	0.943	P	0.58013	0.831	T	0.51942	-0.8641	9	0.18276	T	0.48	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	23	Q7Z5A9	F19A1_HUMAN	F	23	.	ENSP00000418575:C23F	C	+	2	0	FAM19A1	68138527	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.074000	0.89500	2.941000	0.99782	0.655000	0.94253	TGC	.	.	none		0.502	FAM19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352004.1	NM_213609	
TNKS	8658	hgsc.bcm.edu	37	8	9567708	9567708	+	Missense_Mutation	SNP	T	T	G			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr8:9567708T>G	ENST00000310430.6	+	11	1753	c.1727T>G	c.(1726-1728)gTt>gGt	p.V576G	TNKS_ENST00000518281.1_Missense_Mutation_p.V339G|TNKS_ENST00000520408.1_Missense_Mutation_p.V576G	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	576					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		GTCATGGAAGTTCTGCATAAG	0.488																																					p.V576G		Atlas-SNP	.											.	TNKS	198	.	0			c.T1727G						PASS	.						67.0	62.0	63.0					8																	9567708		2203	4300	6503	SO:0001583	missense	8658	exon11			TGGAAGTTCTGCA	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.1727T>G	8.37:g.9567708T>G	ENSP00000311579:p.Val576Gly	163.0	0.0	0		122.0	29.0	0.237705	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	37	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.720979	0.89205	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000518281	T;T;T	0.65916	-0.18;-0.18;-0.18	5.53	5.53	0.82687	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.77445	0.4131	M	0.70787	2.145	0.80722	D	1	D;P	0.71674	0.998;0.607	D;P	0.72982	0.979;0.589	T	0.77558	-0.2543	10	0.41790	T	0.15	.	15.6624	0.77197	0.0:0.0:0.0:1.0	.	576;576	E7EWY6;O95271	.;TNKS1_HUMAN	G	576;576;339	ENSP00000428299:V576G;ENSP00000311579:V576G;ENSP00000429890:V339G	ENSP00000311579:V576G	V	+	2	0	TNKS	9605118	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.022000	0.88759	2.095000	0.63458	0.533000	0.62120	GTT	.	.	none		0.488	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
DNHD1	144132	hgsc.bcm.edu	37	11	6561152	6561152	+	Missense_Mutation	SNP	G	G	A			TCGA-FA-A82F-01A-11D-A382-10	TCGA-FA-A82F-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	5ebd77cf-f8b7-4164-9d3c-dac8c78331ef	089c6a18-5963-41a2-8224-5793318db837	g.chr11:6561152G>A	ENST00000527990.2	+	16	3467	c.3467G>A	c.(3466-3468)cGg>cAg	p.R1156Q	DNHD1_ENST00000254579.6_Missense_Mutation_p.R1156Q			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1156					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GAGACTATACGGCGGTTGCAG	0.587																																					p.R1156Q		Atlas-SNP	.											.	DNHD1	198	.	0			c.G3467A						PASS	.						44.0	49.0	47.0					11																	6561152		692	1591	2283	SO:0001583	missense	144132	exon18			CTATACGGCGGTT	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.3467G>A	11.37:g.6561152G>A	ENSP00000436180:p.Arg1156Gln	83.0	0.0	0		84.0	25.0	0.297619	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	G	5.646	0.303779	0.10678	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.61040	0.14;0.14	5.57	-3.68	0.04463	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.27241	0.0668	N	0.08118	0	0.09310	N	1	B	0.18741	0.03	B	0.09377	0.004	T	0.22695	-1.0209	9	0.12766	T	0.61	.	5.6098	0.17398	0.5358:0.0:0.235:0.2292	.	1156	Q96M86	DNHD1_HUMAN	Q	1156	ENSP00000254579:R1156Q;ENSP00000436180:R1156Q	ENSP00000254579:R1156Q	R	+	2	0	DNHD1	6517728	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.491000	0.06474	-0.308000	0.08792	-0.221000	0.12465	CGG	.	.	none		0.587	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
