#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UHRF1BP1	54887	hgsc.bcm.edu	37	6	34803143	34803144	+	Frame_Shift_Ins	INS	-	-	CACA			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:34803143_34803144insCACA	ENST00000192788.5	+	7	913_914	c.742_743insCACA	c.(742-744)tcafs	p.-248fs	UHRF1BP1_ENST00000452449.2_Frame_Shift_Ins_p.-248fs	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1								histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						GCTGACTGACTCACAGCTCAAG	0.505																																					p.S248fs		Atlas-Indel	.											.	UHRF1BP1	102	.	0			c.742_743insCACA						PASS	.																																			SO:0001589	frameshift_variant	54887	exon7			.	AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.743_746dupCACA	6.37:g.34803144_34803147dupCACA	ENSP00000192788:p.Ser248fs	114.0	0.0	0		120.0	18.0	0.15	NM_017754	Q9NXE0	Frame_Shift_Ins	INS	ENST00000192788.5	37	CCDS43455.1																																																																																			.	.	none		0.505	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040260.1	NM_017754	
ERAP1	51752	hgsc.bcm.edu	37	5	96116871	96116871	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:96116871delT	ENST00000443439.2	-	17	2545	c.2479delA	c.(2479-2481)atafs	p.I827fs	ERAP1_ENST00000296754.3_Frame_Shift_Del_p.I827fs|ERAP1_ENST00000514604.1_5'Flank	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	827					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TGAGTTTTTATTTTATCTCCC	0.373																																					p.I827fs		Pindel,Atlas-Indel	.											.	ERAP1	59	.	0			c.2480delT						PASS	.						84.0	89.0	87.0					5																	96116871		2203	4300	6503	SO:0001589	frameshift_variant	51752	exon17			.	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2479delA	5.37:g.96116871delT	ENSP00000406304:p.Ile827fs	87.0	0.0	.		128.0	31.0	0.242	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Frame_Shift_Del	DEL	ENST00000443439.2	37	CCDS47250.1																																																																																			.	.	none		0.373	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138198372	138198376	+	Frame_Shift_Del	DEL	CTCAT	CTCAT	-	rs543150550		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	CTCAT	CTCAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:138198372_138198376delCTCAT	ENST00000237289.4	+	6	1031_1035	c.965_969delCTCAT	c.(964-969)actcatfs	p.TH322fs	TNFAIP3_ENST00000485192.1_3'UTR	NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	322	2 X approximate repeats.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CATGGCACAACTCATCTCATCAATG	0.454			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.322_323del	GBM(130;153 1739 22295 28918 47987)	Pindel,Atlas-Indel	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	c.964_968del						PASS	.																																			SO:0001589	frameshift_variant	7128	exon6			.	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.965_969delCTCAT	6.37:g.138198377_138198381delCTCAT	ENSP00000237289:p.Thr322fs	91.0	0.0	.		70.0	33.0	0.471	NM_001270508	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Frame_Shift_Del	DEL	ENST00000237289.4	37	CCDS5187.1																																																																																			.	.	none		0.454	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
NXPE2	120406	hgsc.bcm.edu	37	11	114576570	114576571	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:114576570_114576571insA	ENST00000389586.4	+	5	1186_1187	c.996_997insA	c.(997-999)aaafs	p.K333fs	NXPE2_ENST00000375475.5_Intron	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	333						integral component of membrane (GO:0016021)											GTTATACTTTGAAAAAAATGTG	0.322																																					p.L332fs		Pindel,Atlas-Indel	.											.	.	.	.	0			c.996_997insA						PASS	.																																			SO:0001589	frameshift_variant	120406	exon5			.	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.1003dupA	11.37:g.114576577_114576577dupA	ENSP00000374237:p.Lys333fs	222.0	0.0	.		256.0	60.0	0.234	NM_182495	Q2NKI8	Frame_Shift_Ins	INS	ENST00000389586.4	37	CCDS44738.1																																																																																			.	.	none		0.322	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495	
ATXN2L	11273	hgsc.bcm.edu	37	16	28845868	28845884	+	Frame_Shift_Del	DEL	TCAGCCCCGCCGATGAT	TCAGCCCCGCCGATGAT	-	rs147688158|rs367754572		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	TCAGCCCCGCCGATGAT	TCAGCCCCGCCGATGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:28845868_28845884delTCAGCCCCGCCGATGAT	ENST00000336783.4	+	18	2454_2470	c.2287_2303delTCAGCCCCGCCGATGAT	c.(2287-2304)tcagccccgccgatgatgfs	p.SAPPMM763fs	RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000395547.2_Frame_Shift_Del_p.SAPPMM763fs|ATXN2L_ENST00000564304.1_Frame_Shift_Del_p.SAPPMM769fs|ATXN2L_ENST00000340394.8_Frame_Shift_Del_p.SAPPMM763fs|ATXN2L_ENST00000570200.1_Frame_Shift_Del_p.SAPPMM763fs|ATXN2L_ENST00000325215.6_Frame_Shift_Del_p.SAPPMM763fs|ATXN2L_ENST00000382686.4_Frame_Shift_Del_p.SAPPMM763fs|ATXN2L_ENST00000565845.1_3'UTR	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	763					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						CCAGCCAGCCTCAGCCCCGCCGATGATGCAGGCCGCC	0.668																																					p.762_768del		Atlas-Indel	.											.	ATXN2L	159	.	0			c.2286_2302del						PASS	.																																			SO:0001589	frameshift_variant	11273	exon18			.		CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.2287_2303delTCAGCCCCGCCGATGAT	16.37:g.28845868_28845884delTCAGCCCCGCCGATGAT	ENSP00000338718:p.Ser763fs	34.0	0.0	0		24.0	11.0	0.458333	NM_148416	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Frame_Shift_Del	DEL	ENST00000336783.4	37	CCDS10641.1																																																																																			.	.	none		0.668	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245	
ABCC6	368	hgsc.bcm.edu	37	16	16244433	16244438	+	Splice_Site	DEL	ACCGGG	ACCGGG	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	ACCGGG	ACCGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:16244433_16244438delACCGGG	ENST00000205557.7	-	30	4429_4433	c.4400_4404delCCCGGT	c.(4399-4404)gcccgg>g	p.AR1467del		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1467	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CGGGAGCCTTACCGGGCACAGTCCAT	0.675																																					p.1467_1468del		Atlas-Indel	.											.	ABCC6	110	.	0			c.4401_4403del						PASS	.																																			SO:0001630	splice_region_variant	368	exon30			.	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4403+1CCCGGT>-	16.37:g.16244433_16244438delACCGGG		192.0	0.0	0		155.0	12.0	0.0774194	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	In_Frame_Del	DEL	ENST00000205557.7	37	CCDS10568.1																																																																																			.	.	none		0.675	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		In_Frame_Del
MANSC4	100287284	hgsc.bcm.edu	37	12	27919655	27919656	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:27919655_27919656delGT	ENST00000381273.3	-	2	305_306	c.306_307delAC	c.(304-309)acactgfs	p.L103fs		NM_001146221.1	NP_001139693.1	A6NHS7	MANS4_HUMAN	MANSC domain containing 4	103	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.					integral component of membrane (GO:0016021)				kidney(1)	1						CAGCTCTCCAGTGTTGGGCAGT	0.426																																					p.103_103del		Atlas-Indel	.											.	MANSC4	9	.	0			c.307_308del						PASS	.																																			SO:0001589	frameshift_variant	100287284	exon2			.		CCDS53770.1	12p11.22	2011-05-05			ENSG00000205693	ENSG00000205693			40023	protein-coding gene	gene with protein product							Standard	NM_001146221		Approved		uc010sjs.1	A6NHS7	OTTHUMG00000169216	ENST00000381273.3:c.306_307delAC	12.37:g.27919657_27919658delGT	ENSP00000370673:p.Leu103fs	189.0	0.0	0		152.0	28.0	0.184211	NM_001146221		Frame_Shift_Del	DEL	ENST00000381273.3	37	CCDS53770.1																																																																																			.	.	none		0.426	MANSC4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000402902.1		
MANSC4	100287284	hgsc.bcm.edu	37	12	27919648	27919652	+	Frame_Shift_Del	DEL	CTCTC	CTCTC	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	CTCTC	CTCTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:27919648_27919652delCTCTC	ENST00000381273.3	-	2	309_313	c.310_314delGAGAG	c.(310-315)gagagcfs	p.ES104fs		NM_001146221.1	NP_001139693.1	A6NHS7	MANS4_HUMAN	MANSC domain containing 4	104	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.					integral component of membrane (GO:0016021)				kidney(1)	1						TAATATGCAGCTCTCCAGTGTTGGG	0.42																																					p.104_105del		Atlas-Indel	.											.	MANSC4	9	.	0			c.311_315del						PASS	.																																			SO:0001589	frameshift_variant	100287284	exon2			.		CCDS53770.1	12p11.22	2011-05-05			ENSG00000205693	ENSG00000205693			40023	protein-coding gene	gene with protein product							Standard	NM_001146221		Approved		uc010sjs.1	A6NHS7	OTTHUMG00000169216	ENST00000381273.3:c.310_314delGAGAG	12.37:g.27919648_27919652delCTCTC	ENSP00000370673:p.Glu104fs	184.0	0.0	0		162.0	28.0	0.17284	NM_001146221		Frame_Shift_Del	DEL	ENST00000381273.3	37	CCDS53770.1																																																																																			.	.	none		0.420	MANSC4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000402902.1		
TENM4	26011	hgsc.bcm.edu	37	11	78437206	78437208	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:78437206_78437208delTGT	ENST00000278550.7	-	23	3928_3930	c.3466_3468delACA	c.(3466-3468)acadel	p.T1156del		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1156					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CCTGCAGCACTGTTGTTCTTTTT	0.433																																					p.1156_1157del		Pindel,Atlas-Indel	.											.	.	.	.	0			c.3467_3469del						PASS	.																																			SO:0001651	inframe_deletion	26011	exon23			.	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3466_3468delACA	11.37:g.78437209_78437211delTGT	ENSP00000278550:p.Thr1156del	237.0	0.0	.		255.0	39.0	0.153	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	In_Frame_Del	DEL	ENST00000278550.7	37	CCDS44688.1																																																																																			.	.	none		0.433	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
CIITA	4261	hgsc.bcm.edu	37	16	11010310	11010310	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:11010310delC	ENST00000324288.8	+	15	3189	c.3056delC	c.(3055-3057)accfs	p.T1019fs	CIITA_ENST00000381835.5_Frame_Shift_Del_p.T435fs	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	1019					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						TCCTTGGAAACCCTCAAGTGA	0.522			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																p.T1019fs		Pindel,Atlas-Indel	.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA	92	.	0			c.3055delA						PASS	.						47.0	38.0	41.0					16																	11010310		2197	4300	6497	SO:0001589	frameshift_variant	4261	exon15			.	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.3056delC	16.37:g.11010310delC	ENSP00000316328:p.Thr1019fs	76.0	0.0	.		46.0	11.0	0.239	NM_000246	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Frame_Shift_Del	DEL	ENST00000324288.8	37	CCDS10544.1																																																																																			.	.	none		0.522	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
B2M	567	hgsc.bcm.edu	37	15	45003766	45003781	+	Frame_Shift_Del	DEL	GCTGTGCTCGCGCTAC	GCTGTGCTCGCGCTAC	-	rs11553033|rs104894481|rs11553044|rs369474839|rs552741313		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	GCTGTGCTCGCGCTAC	GCTGTGCTCGCGCTAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:45003766_45003781delGCTGTGCTCGCGCTAC	ENST00000558401.1	+	1	92_107	c.22_37delGCTGTGCTCGCGCTAC	c.(22-39)gctgtgctcgcgctactcfs	p.AVLALL8fs	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Frame_Shift_Del_p.AVLALL8fs|B2M_ENST00000544417.1_Frame_Shift_Del_p.AVLALL8fs	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	8					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L15fs*41(4)|p.L13F(1)|p.A8T(1)|p.A11fs*42(1)|p.L12Q(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CGTGGCCTTAGCTGTGCTCGCGCTACTCTCTCTTTC	0.616																																					p.7_12del		Pindel,Atlas-Indel	.											B2M,NS,lymphoid_neoplasm,+1,1	B2M	99	1	8	Deletion - Frameshift(5)|Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|kidney(1)|skin(1)	c.21_36del	GRCh37	CM060840	B2M	M	rs104894481	PASS	.																																			SO:0001589	frameshift_variant	567	exon1			.	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.22_37delGCTGTGCTCGCGCTAC	15.37:g.45003766_45003781delGCTGTGCTCGCGCTAC	ENSP00000452780:p.Ala8fs	93.0	0.0	.		68.0	25.0	0.368	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Frame_Shift_Del	DEL	ENST00000558401.1	37	CCDS10113.1																																																																																			.	.	none		0.616	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
MANSC4	100287284	hgsc.bcm.edu	37	12	27919649	27919656	+	Frame_Shift_Del	DEL	TCTCCAGT	TCTCCAGT	-			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	TCTCCAGT	TCTCCAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:27919649_27919656delTCTCCAGT	ENST00000381273.3	-	2	305_312	c.306_313delACTGGAGA	c.(304-315)acactggagagcfs	p.LES103fs		NM_001146221.1	NP_001139693.1	A6NHS7	MANS4_HUMAN	MANSC domain containing 4	103	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.					integral component of membrane (GO:0016021)				kidney(1)	1						AATATGCAGCTCTCCAGTGTTGGGCAGT	0.418																																					p.103_105del		Pindel	.											.	MANSC4	9	.	0			c.307_314del						PASS	.																																			SO:0001589	frameshift_variant	100287284	exon2			.		CCDS53770.1	12p11.22	2011-05-05			ENSG00000205693	ENSG00000205693			40023	protein-coding gene	gene with protein product							Standard	NM_001146221		Approved		uc010sjs.1	A6NHS7	OTTHUMG00000169216	ENST00000381273.3:c.306_313delACTGGAGA	12.37:g.27919649_27919656delTCTCCAGT	ENSP00000370673:p.Leu103fs	187.0	0.0	.		164.0	35.0	0.213	NM_001146221		Frame_Shift_Del	DEL	ENST00000381273.3	37	CCDS53770.1																																																																																			.	.	none		0.418	MANSC4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000402902.1		
SGCE	8910	hgsc.bcm.edu	37	7	94218023	94218023	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:94218023C>T	ENST00000265735.7	-	10	1385	c.1275G>A	c.(1273-1275)caG>caA	p.Q425Q	SGCE_ENST00000428696.2_Silent_p.Q416Q|SGCE_ENST00000415788.2_Silent_p.Q461Q|SGCE_ENST00000437425.2_Silent_p.Q384Q|SGCE_ENST00000447873.1_Silent_p.Q416Q|SGCE_ENST00000445866.2_Silent_p.Q450Q	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	425					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GTTGGGGAATCTGAGTCTGAT	0.308																																					p.Q450Q		Atlas-SNP	.											.	SGCE	68	.	0			c.G1350A						PASS	.						130.0	129.0	130.0					7																	94218023		2203	4300	6503	SO:0001819	synonymous_variant	8910	exon11			GGGAATCTGAGTC	AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.1275G>A	7.37:g.94218023C>T		68.0	0.0	0		94.0	4.0	0.0425532	NM_001099401	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Silent	SNP	ENST00000265735.7	37	CCDS5637.1																																																																																			.	.	none		0.308	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		
EYS	346007	hgsc.bcm.edu	37	6	65300359	65300359	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:65300359C>G	ENST00000370621.3	-	26	5927	c.5401G>C	c.(5401-5403)Gca>Cca	p.A1801P	EYS_ENST00000503581.1_Missense_Mutation_p.A1801P|EYS_ENST00000370616.2_Missense_Mutation_p.A1801P			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1801					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATTGAAAGTGCTGGAGTTGCT	0.388																																					p.A1801P		Atlas-SNP	.											.	EYS	527	.	0			c.G5401C						PASS	.						136.0	126.0	129.0					6																	65300359		692	1590	2282	SO:0001583	missense	346007	exon26			AAAGTGCTGGAGT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5401G>C	6.37:g.65300359C>G	ENSP00000359655:p.Ala1801Pro	163.0	0.0	0		168.0	46.0	0.27381	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	7.913	0.736998	0.15574	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84730	-1.89;-1.87;-1.87	5.87	2.14	0.27477	.	.	.	.	.	T	0.46405	0.1391	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.41466	-0.9507	9	0.66056	D	0.02	.	1.4311	0.02334	0.4143:0.259:0.21:0.1168	.	1801;1801	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	P	1801	ENSP00000424243:A1801P;ENSP00000359655:A1801P;ENSP00000359650:A1801P	ENSP00000359650:A1801P	A	-	1	0	EYS	65357080	0.000000	0.05858	0.005000	0.12908	0.036000	0.12997	-0.187000	0.09656	0.132000	0.18615	-0.467000	0.05162	GCA	.	.	none		0.388	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
PLXNB3	5365	hgsc.bcm.edu	37	X	153037066	153037066	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:153037066C>T	ENST00000361971.5	+	14	2587	c.2473C>T	c.(2473-2475)Ccg>Tcg	p.P825S	PLXNB3_ENST00000538543.1_Intron|PLXNB3_ENST00000538776.1_Missense_Mutation_p.P478S|PLXNB3_ENST00000538966.1_Missense_Mutation_p.P848S|PLXNB3_ENST00000538282.1_Missense_Mutation_p.P435S	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	825	PSI 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CTTGTGCCCGCCGGGGGCTGT	0.697																																					p.P848S		Atlas-SNP	.											.	PLXNB3	208	.	0			c.C2542T						PASS	.						19.0	20.0	20.0					X																	153037066		2183	4289	6472	SO:0001583	missense	5365	exon15			TGCCCGCCGGGGG	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.2473C>T	X.37:g.153037066C>T	ENSP00000355378:p.Pro825Ser	151.0	0.0	0		79.0	17.0	0.21519	NM_001163257	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	ENST00000361971.5	37	CCDS14729.1	.	.	.	.	.	.	.	.	.	.	C	9.903	1.207288	0.22205	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000538282	T;T;T;T	0.67698	5.3;5.27;4.68;-0.28	5.11	5.11	0.69529	.	0.369273	0.25900	N	0.027580	T	0.55705	0.1937	L	0.37630	1.12	0.09310	N	0.99999	B;B;B;B	0.24132	0.004;0.098;0.071;0.001	B;B;B;B	0.28916	0.004;0.031;0.096;0.007	T	0.38457	-0.9660	10	0.07990	T	0.79	.	14.9334	0.70935	0.0:1.0:0.0:0.0	.	478;507;848;825	B7Z3H9;B7Z9A5;F5H773;Q9ULL4	.;.;.;PLXB3_HUMAN	S	848;825;478;435	ENSP00000442736:P848S;ENSP00000355378:P825S;ENSP00000445569:P478S;ENSP00000441919:P435S	ENSP00000355378:P825S	P	+	1	0	PLXNB3	152690260	0.026000	0.19158	0.068000	0.19968	0.010000	0.07245	2.416000	0.44644	2.111000	0.64477	0.529000	0.55759	CCG	.	.	none		0.697	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061063.1		
JAK3	3718	hgsc.bcm.edu	37	19	17948006	17948006	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:17948006G>A	ENST00000527670.1	-	12	1747	c.1718C>T	c.(1717-1719)gCg>gTg	p.A573V	JAK3_ENST00000458235.1_Missense_Mutation_p.A573V|JAK3_ENST00000526008.1_5'Flank|JAK3_ENST00000534444.1_Missense_Mutation_p.A573V			P52333	JAK3_HUMAN	Janus kinase 3	573	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.A573V(5)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CATCAAGCTCGCTGCTTCCAG	0.577		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.A573V		Atlas-SNP	.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	JAK3,NS,lymphoid_neoplasm,0,5	JAK3	341	5	5	Substitution - Missense(5)	haematopoietic_and_lymphoid_tissue(5)	c.C1718T						PASS	.						45.0	34.0	38.0					19																	17948006		2201	4291	6492	SO:0001583	missense	3718	exon13			AAGCTCGCTGCTT	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.1718C>T	19.37:g.17948006G>A	ENSP00000432511:p.Ala573Val	114.0	0.0	0		133.0	68.0	0.511278	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669605	0.88348	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.60920	0.15;0.15;0.15	4.17	4.17	0.49024	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.064498	0.64402	D	0.000010	T	0.68467	0.3004	L	0.52206	1.635	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.65987	0.916;0.94	T	0.72312	-0.4331	10	0.87932	D	0	-22.3785	14.3465	0.66668	0.0:0.0:1.0:0.0	.	573;573	P52333-2;P52333	.;JAK3_HUMAN	V	573	ENSP00000391676:A573V;ENSP00000432511:A573V;ENSP00000436421:A573V	ENSP00000413248:A573V	A	-	2	0	JAK3	17809006	1.000000	0.71417	0.854000	0.33618	0.985000	0.73830	8.985000	0.93487	2.316000	0.78162	0.484000	0.47621	GCG	.	.	none		0.577	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
DYSF	8291	hgsc.bcm.edu	37	2	71748030	71748030	+	Missense_Mutation	SNP	C	C	T	rs115279465	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:71748030C>T	ENST00000258104.3	+	11	1326	c.1049C>T	c.(1048-1050)gCg>gTg	p.A350V	DYSF_ENST00000409744.1_Missense_Mutation_p.A351V|DYSF_ENST00000409582.3_Missense_Mutation_p.A381V|DYSF_ENST00000394120.2_Missense_Mutation_p.A351V|DYSF_ENST00000410020.3_Missense_Mutation_p.A382V|DYSF_ENST00000429174.2_Missense_Mutation_p.A350V|DYSF_ENST00000409762.1_Missense_Mutation_p.A381V|DYSF_ENST00000409651.1_Missense_Mutation_p.A382V|DYSF_ENST00000410041.1_Missense_Mutation_p.A382V|DYSF_ENST00000413539.2_Missense_Mutation_p.A381V|DYSF_ENST00000409366.1_Missense_Mutation_p.A351V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	350					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GGGGACGAAGCGCCTGTGAGT	0.547													C|||	34	0.00678914	0.0242	0.0	5008	,	,		16178	0.002		0.0	False		,,,				2504	0.0				p.A382V		Atlas-SNP	.											DYSF_ENST00000410020,bladder,carcinoma,-1,2	DYSF	536	2	0			c.C1145T						PASS	.	C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	39,4367	43.1+/-76.7	0,39,2164	86.0	73.0	77.0		1052,1049,1049,1049,1142,1142,1142,1145,1052,1052,1145,1052,1145,1049	5.2	1.0	2	dbSNP_132	77	0,8600		0,0,4300	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	DYSF	NM_001130455.1,NM_001130976.1,NM_001130977.1,NM_001130978.1,NM_001130979.1,NM_001130980.1,NM_001130981.1,NM_001130982.1,NM_001130983.1,NM_001130984.1,NM_001130985.1,NM_001130986.1,NM_001130987.1,NM_003494.3	64,64,64,64,64,64,64,64,64,64,64,64,64,64	0,39,6464	TT,TC,CC		0.0,0.8852,0.2999	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	351/2082,350/2067,350/2088,350/2102,381/2112,381/2098,381/2119,382/2113,351/2103,351/2089,382/2099,351/2068,382/2120,350/2081	71748030	39,12967	2203	4300	6503	SO:0001583	missense	8291	exon12			ACGAAGCGCCTGT	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1049C>T	2.37:g.71748030C>T	ENSP00000258104:p.Ala350Val	207.0	0.0	0		213.0	74.0	0.347418	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	37	CCDS1918.1	16	0.007326007326007326	14	0.028455284552845527	0	0.0	1	0.0017482517482517483	1	0.0013192612137203166	C	18.71	3.681825	0.68042	0.008852	0.0	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39;-1.39;-1.39;-1.39;-1.39;-1.39;-1.39;-1.39	5.23	5.23	0.72850	C2 calcium/lipid-binding domain, CaLB (1);FerIin domain (1);	0.234979	0.43919	D	0.000501	T	0.51449	0.1675	N	0.25245	0.725	0.31618	N	0.65062	P;P;P;P;B;P;B;P;P;P;P;P;P;P	0.49559	0.775;0.775;0.775;0.648;0.423;0.622;0.423;0.925;0.775;0.633;0.797;0.648;0.775;0.812	B;B;B;B;B;B;B;P;B;B;P;B;B;P	0.49528	0.231;0.335;0.435;0.315;0.135;0.207;0.135;0.614;0.231;0.207;0.598;0.315;0.435;0.571	T	0.66015	-0.6028	10	0.20046	T	0.44	-3.0016	12.5642	0.56300	0.0:0.8325:0.1675:0.0	.	382;382;351;351;382;351;381;350;381;381;350;350;351;350	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	381;381;381;350;350;382;351;351;351;382;382	ENSP00000407046:A381V;ENSP00000387137:A381V;ENSP00000386547:A381V;ENSP00000398305:A350V;ENSP00000258104:A350V;ENSP00000386683:A382V;ENSP00000377678:A351V;ENSP00000386285:A351V;ENSP00000386512:A351V;ENSP00000386881:A382V;ENSP00000386617:A382V	ENSP00000258104:A350V	A	+	2	0	DYSF	71601538	1.000000	0.71417	0.962000	0.40283	0.318000	0.28184	4.576000	0.60915	2.663000	0.90544	0.536000	0.68110	GCG	C|0.995;T|0.005	0.005	strong		0.547	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
USP17L2	377630	hgsc.bcm.edu	37	8	11994795	11994795	+	Missense_Mutation	SNP	G	G	A	rs201012791	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:11994795G>A	ENST00000333796.3	-	1	1791	c.1475C>T	c.(1474-1476)aCg>aTg	p.T492M	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	492	Mediates interaction with SUDS3.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TGTCCGGGTCGTCGAAGAGAG	0.512													G|||	2	0.000399361	0.0008	0.0	5008	,	,		21462	0.0		0.001	False		,,,				2504	0.0				p.T492M		Atlas-SNP	.											.	USP17L2	47	.	0			c.C1475T						PASS	.	A	MET/THR	3,2647		1,1,1323	62.0	67.0	65.0		1475	-0.7	0.0	8		65	2,5746		0,2,2872	no	missense	USP17L2	NM_201402.2	81	1,3,4195	AA,AG,GG		0.0348,0.1132,0.0595	benign	492/531	11994795	5,8393	1325	2874	4199	SO:0001583	missense	377630	exon1			CGGGTCGTCGAAG	BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1475C>T	8.37:g.11994795G>A	ENSP00000333329:p.Thr492Met	293.0	0.0	0		362.0	96.0	0.265193	NM_201402		Missense_Mutation	SNP	ENST00000333796.3	37	CCDS43713.1	.	.	.	.	.	.	.	.	.	.	G	7.058	0.565875	0.13560	0.001132	3.48E-4	ENSG00000223443	ENST00000333796	T	0.11821	2.74	0.36	-0.721	0.11189	.	1.611680	0.04297	U	0.346582	T	0.12390	0.0301	.	.	.	0.09310	N	1	D	0.57571	0.98	B	0.44044	0.439	T	0.19063	-1.0317	8	0.51188	T	0.08	.	.	.	.	.	492	Q6R6M4	U17L2_HUMAN	M	492	ENSP00000333329:T492M	ENSP00000333329:T492M	T	-	2	0	USP17L2	12032204	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.296000	0.01142	-0.412000	0.07519	-0.410000	0.06199	ACG	.	.	weak		0.512	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383303.2	NM_201402	
ZNF502	91392	hgsc.bcm.edu	37	3	44762425	44762425	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:44762425G>C	ENST00000296091.4	+	4	372	c.116G>C	c.(115-117)gGg>gCg	p.G39A	ZNF502_ENST00000436624.2_Missense_Mutation_p.G39A|ZNF502_ENST00000449836.1_Missense_Mutation_p.G39A	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	39					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		GACTCATCAGGGATAGTAGTA	0.418																																					p.G39A		Atlas-SNP	.											.	ZNF502	58	.	0			c.G116C						PASS	.						73.0	75.0	74.0					3																	44762425		2203	4300	6503	SO:0001583	missense	91392	exon4			CATCAGGGATAGT	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.116G>C	3.37:g.44762425G>C	ENSP00000296091:p.Gly39Ala	87.0	0.0	0		96.0	21.0	0.21875	NM_001134440		Missense_Mutation	SNP	ENST00000296091.4	37	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398645	0.25205	.	.	ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624;ENST00000427783;ENST00000411443	T;T;T;T	0.54675	3.42;3.42;3.42;0.56	4.92	0.917	0.19380	.	.	.	.	.	T	0.22513	0.0543	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.28073	-1.0055	9	0.05620	T	0.96	-3.7166	3.6154	0.08075	0.4034:0.1908:0.4058:0.0	.	39	Q8TBZ5	ZN502_HUMAN	A	39	ENSP00000397390:G39A;ENSP00000296091:G39A;ENSP00000406469:G39A;ENSP00000401717:G39A	ENSP00000296091:G39A	G	+	2	0	ZNF502	44737429	0.002000	0.14202	0.053000	0.19242	0.051000	0.14879	0.321000	0.19558	0.668000	0.31126	0.655000	0.94253	GGG	.	.	none		0.418	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
TBC1D12	23232	hgsc.bcm.edu	37	10	96259982	96259982	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:96259982A>G	ENST00000225235.4	+	6	1527	c.1417A>G	c.(1417-1419)Agt>Ggt	p.S473G		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	473							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				TTCTAGGCGTAGTACAAGAAG	0.403																																					p.S473G		Atlas-SNP	.											TBC1D12,NS,carcinoma,-1,1	TBC1D12	51	1	0			c.A1417G						scavenged	.						128.0	115.0	119.0					10																	96259982		1839	4096	5935	SO:0001583	missense	23232	exon6			AGGCGTAGTACAA	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.1417A>G	10.37:g.96259982A>G	ENSP00000225235:p.Ser473Gly	99.0	0.0	0		75.0	3.0	0.04	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Missense_Mutation	SNP	ENST00000225235.4	37	CCDS41553.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.697073	0.48202	.	.	ENSG00000108239	ENST00000225235	T	0.57595	0.39	4.8	4.8	0.61643	Rab-GAP/TBC domain (1);	0.287488	0.39759	N	0.001273	T	0.31734	0.0806	N	0.10874	0.06	0.50039	D	0.999843	B	0.10296	0.003	B	0.06405	0.002	T	0.12400	-1.0549	10	0.19590	T	0.45	-15.3937	12.5865	0.56421	1.0:0.0:0.0:0.0	.	473	O60347	TBC12_HUMAN	G	473	ENSP00000225235:S473G	ENSP00000225235:S473G	S	+	1	0	TBC1D12	96249972	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.084000	0.57650	2.124000	0.65301	0.533000	0.62120	AGT	.	.	none		0.403	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
DPYSL5	56896	hgsc.bcm.edu	37	2	27147877	27147877	+	Silent	SNP	C	C	T	rs147434661		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:27147877C>T	ENST00000288699.6	+	3	542	c.384C>T	c.(382-384)taC>taT	p.Y128Y	DPYSL5_ENST00000401478.1_Silent_p.Y128Y	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	128					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTGTGATTACGCCCTCCACG	0.602																																					p.Y128Y		Atlas-SNP	.											.	DPYSL5	69	.	0			c.C384T						PASS	.	C		0,4406		0,0,2203	100.0	87.0	91.0		384	-3.6	1.0	2	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DPYSL5	NM_020134.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		128/565	27147877	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56896	exon3			TGATTACGCCCTC	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.384C>T	2.37:g.27147877C>T		71.0	0.0	0		105.0	34.0	0.32381	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Silent	SNP	ENST00000288699.6	37	CCDS1730.1																																																																																			C|1.000;T|0.000	0.000	weak		0.602	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
NAP1L3	4675	hgsc.bcm.edu	37	X	92928124	92928124	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:92928124G>T	ENST00000373079.3	-	1	443	c.180C>A	c.(178-180)agC>agA	p.S60R	FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.S53R|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	60	Ser-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						tgctgctgctgctgccgctgc	0.617																																					p.S60R		Atlas-SNP	.											.	NAP1L3	81	.	0			c.C180A						PASS	.						8.0	9.0	9.0					X																	92928124		1938	3702	5640	SO:0001583	missense	4675	exon1			GCTGCTGCTGCCG		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.180C>A	X.37:g.92928124G>T	ENSP00000362171:p.Ser60Arg	56.0	0.0	0		63.0	10.0	0.15873	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	G	3.522	-0.097600	0.07010	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.35048	1.33	1.57	1.57	0.23409	.	.	.	.	.	T	0.18045	0.0433	N	0.14661	0.345	0.09310	N	1	B	0.21225	0.053	B	0.13407	0.009	T	0.17137	-1.0379	9	0.28530	T	0.3	.	4.6764	0.12713	0.0:0.0:0.6303:0.3697	.	60	Q99457	NP1L3_HUMAN	R	60;53	ENSP00000362171:S60R	ENSP00000362171:S60R	S	-	3	2	NAP1L3	92814780	0.521000	0.26258	0.014000	0.15608	0.005000	0.04900	0.666000	0.25097	1.056000	0.40484	0.292000	0.19580	AGC	.	.	none		0.617	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
RSL1D1	26156	hgsc.bcm.edu	37	16	11944196	11944196	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:11944196T>C	ENST00000571133.1	-	2	257	c.185A>G	c.(184-186)gAa>gGa	p.E62G	RP11-166B2.8_ENST00000574364.1_RNA|RSL1D1_ENST00000542106.1_Intron	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	62					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						AAATAAACTTTCATTCTCATT	0.363																																					p.E62G		Atlas-SNP	.											.	RSL1D1	40	.	0			c.A185G						PASS	.						80.0	76.0	78.0					16																	11944196		2197	4300	6497	SO:0001583	missense	26156	exon2			AAACTTTCATTCT	AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.185A>G	16.37:g.11944196T>C	ENSP00000460871:p.Glu62Gly	89.0	0.0	0		101.0	5.0	0.049505	NM_015659	B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Missense_Mutation	SNP	ENST00000571133.1	37	CCDS10551.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.947427	0.73672	.	.	ENSG00000171490	ENST00000355674;ENST00000396503	T	0.52295	0.67	5.91	5.91	0.95273	Ribosomal protein L1, superfamily (1);	0.240132	0.42420	D	0.000719	T	0.69033	0.3066	M	0.80616	2.505	0.80722	D	1	P;D	0.63880	0.947;0.993	P;D	0.64687	0.849;0.928	T	0.73509	-0.3960	10	0.72032	D	0.01	-13.9832	15.1713	0.72875	0.0:0.0:0.0:1.0	.	62;62	Q32Q62;O76021	.;RL1D1_HUMAN	G	62	ENSP00000347897:E62G	ENSP00000347897:E62G	E	-	2	0	RSL1D1	11851697	0.997000	0.39634	0.850000	0.33497	0.298000	0.27526	5.671000	0.68095	2.266000	0.75297	0.454000	0.30748	GAA	.	.	none		0.363	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252059.2	NM_015659	
SLC45A1	50651	hgsc.bcm.edu	37	1	8390740	8390740	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:8390740C>T	ENST00000471889.1	+	5	1572	c.1187C>T	c.(1186-1188)cCc>cTc	p.P396L	SLC45A1_ENST00000377479.2_Missense_Mutation_p.P430L|SLC45A1_ENST00000289877.8_Missense_Mutation_p.P396L|Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000481265.1_3'UTR			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	396					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GGCAGCGTCCCCAGGCCGCCC	0.672																																					p.P396L		Atlas-SNP	.											.	SLC45A1	85	.	0			c.C1187T						PASS	.						32.0	33.0	33.0					1																	8390740		2203	4300	6503	SO:0001583	missense	50651	exon4			GCGTCCCCAGGCC	AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1187C>T	1.37:g.8390740C>T	ENSP00000418096:p.Pro396Leu	125.0	0.0	0		59.0	17.0	0.288136	NM_001080397	Q5VY46|Q5VY49	Missense_Mutation	SNP	ENST00000471889.1	37	CCDS30577.1	.	.	.	.	.	.	.	.	.	.	C	8.089	0.774143	0.16051	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	T;T;T	0.22134	2.01;1.97;2.01	4.66	4.66	0.58398	.	0.349376	0.30260	N	0.010030	T	0.22085	0.0532	M	0.64997	1.995	0.80722	D	1	P	0.40144	0.704	B	0.30495	0.116	T	0.10132	-1.0643	10	0.51188	T	0.08	-30.6706	16.5386	0.84378	0.0:1.0:0.0:0.0	.	396	Q9Y2W3	S45A1_HUMAN	L	396;430;396	ENSP00000418096:P396L;ENSP00000366699:P430L;ENSP00000289877:P396L	ENSP00000289877:P396L	P	+	2	0	SLC45A1	8313327	1.000000	0.71417	0.068000	0.19968	0.014000	0.08584	7.095000	0.76952	2.121000	0.65114	0.561000	0.74099	CCC	.	.	none		0.672	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001245.5		
SHROOM1	134549	hgsc.bcm.edu	37	5	132159799	132159799	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:132159799G>A	ENST00000378679.3	-	7	2358	c.1554C>T	c.(1552-1554)ccC>ccT	p.P518P	SHROOM1_ENST00000378676.1_Silent_p.P449P|SHROOM1_ENST00000488072.1_5'Flank|SHROOM1_ENST00000319854.3_Silent_p.P518P	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	518					actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TATTGTGAGAGGGACCTGGAG	0.597																																					p.P518P		Atlas-SNP	.											.	SHROOM1	35	.	0			c.C1554T						PASS	.						71.0	70.0	70.0					5																	132159799		2203	4300	6503	SO:0001819	synonymous_variant	134549	exon4			GTGAGAGGGACCT	AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.1554C>T	5.37:g.132159799G>A		156.0	0.0	0		221.0	39.0	0.176471	NM_133456	B7WP40|B7ZL01|Q8TDP0|Q8TF41	Silent	SNP	ENST00000378679.3	37	CCDS54902.1																																																																																			.	.	none		0.597	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133033.1	NM_133456	
ACTB	60	hgsc.bcm.edu	37	7	5568917	5568917	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:5568917C>T	ENST00000331789.5	-	3	429	c.238G>A	c.(238-240)Gac>Aac	p.D80N	ACTB_ENST00000464611.1_5'Flank|AC006483.1_ENST00000579427.1_RNA	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	80					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		TCCATGTCGTCCCAGTTGGTG	0.602																																					p.D80N		Atlas-SNP	.											.	ACTB	45	.	0			c.G238A						PASS	.						70.0	70.0	70.0					7																	5568917		2203	4300	6503	SO:0001583	missense	60	exon3			TGTCGTCCCAGTT	M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.238G>A	7.37:g.5568917C>T	ENSP00000349960:p.Asp80Asn	119.0	0.0	0		108.0	24.0	0.222222	NM_001101	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000331789.5	37	CCDS5341.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.788988	0.70337	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000432588;ENST00000443528;ENST00000417101;ENST00000414620	D;D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83;-3.83	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000005	D	0.95306	0.8477	M	0.81112	2.525	0.52501	D	0.99995	B	0.02656	0.0	B	0.21917	0.037	D	0.93780	0.7083	10	0.87932	D	0	.	15.8267	0.78711	0.0:1.0:0.0:0.0	.	80	P60709	ACTB_HUMAN	N	80;80;52;80;80;83;80	ENSP00000349960:D80N;ENSP00000407473:D80N;ENSP00000393951:D80N;ENSP00000399487:D83N;ENSP00000401032:D80N	ENSP00000349960:D80N	D	-	1	0	ACTB	5535443	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.600000	0.82769	2.312000	0.78011	0.563000	0.77884	GAC	.	.	none		0.602	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059589.4	NM_001101	
DIS3L	115752	hgsc.bcm.edu	37	15	66621332	66621332	+	Silent	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:66621332T>C	ENST00000319212.4	+	13	2276	c.2226T>C	c.(2224-2226)tcT>tcC	p.S742S	DIS3L_ENST00000319194.5_Silent_p.S659S|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	742					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGGCTGATTCTCTGGATAATG	0.493																																					p.S742S		Atlas-SNP	.											.	DIS3L	175	.	0			c.T2226C						PASS	.						131.0	135.0	134.0					15																	66621332		2201	4299	6500	SO:0001819	synonymous_variant	115752	exon13			TGATTCTCTGGAT		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.2226T>C	15.37:g.66621332T>C		91.0	0.0	0		94.0	4.0	0.0425532	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Silent	SNP	ENST00000319212.4	37	CCDS45286.1																																																																																			.	.	none		0.493	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
RIMS2	9699	hgsc.bcm.edu	37	8	104513283	104513283	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:104513283G>C	ENST00000406091.3	+	1	169	c.169G>C	c.(169-171)Gtg>Ctg	p.V57L	RP11-1C8.4_ENST00000523422.1_RNA|RP11-1C8.4_ENST00000517376.1_RNA	NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	75	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGAGCAGTCCGTGCTCAAGTA	0.647										HNSCC(12;0.0054)																											p.V57L		Atlas-SNP	.											.	RIMS2	1357	.	0			c.G169C						PASS	.						34.0	39.0	38.0					8																	104513283		1986	4141	6127	SO:0001583	missense	9699	exon1			CAGTCCGTGCTCA	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.169G>C	8.37:g.104513283G>C	ENSP00000384892:p.Val57Leu	198.0	0.0	0		197.0	68.0	0.345178	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000406091.3	37	CCDS55269.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577298	0.45902	.	.	ENSG00000176406	ENST00000504942;ENST00000406091	T;T	0.76060	-0.99;-0.99	3.76	3.76	0.43208	.	.	.	.	.	T	0.67192	0.2867	L	0.47716	1.5	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63782	-0.6559	9	0.29301	T	0.29	.	14.5166	0.67824	0.0:0.0:1.0:0.0	.	57	F8WD47	.	L	57	ENSP00000427018:V57L;ENSP00000384892:V57L	ENSP00000384892:V57L	V	+	1	0	RIMS2	104582459	0.985000	0.35326	1.000000	0.80357	0.988000	0.76386	2.166000	0.42406	1.791000	0.52520	0.462000	0.41574	GTG	.	.	none		0.647	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001100117	
GLOD4	51031	hgsc.bcm.edu	37	17	685705	685705	+	5'Flank	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:685705G>A	ENST00000301328.5	-	0	0				GLOD4_ENST00000536578.1_5'Flank|RNMTL1_ENST00000304478.4_Nonsense_Mutation_p.W29*|GLOD4_ENST00000301329.6_5'Flank			Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|prostate(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CGAGGCGCTGGGTCCGGGCGC	0.667																																					p.W29X		Atlas-SNP	.											.	RNMTL1	25	.	0			c.G87A						PASS	.						31.0	35.0	34.0					17																	685705		2203	4299	6502	SO:0001631	upstream_gene_variant	55178	exon1			GCGCTGGGTCCGG	AF177342	CCDS32520.1	17p13.3	2008-02-05	2007-03-14	2007-03-14		ENSG00000167699			14111	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 25"""	C17orf25		11642406, 12528892	Standard	NM_016080		Approved	CGI-150, HC71	uc002fru.3	Q9HC38			17.37:g.685705G>A	Exception_encountered	40.0	0.0	0		35.0	21.0	0.6	NM_018146	D3DTG9|D3DTH1|Q96B89|Q9H3J8|Q9HC37|Q9NVN1	Nonsense_Mutation	SNP	ENST00000301328.5	37		.	.	.	.	.	.	.	.	.	.	G	36	5.630251	0.96671	.	.	ENSG00000171861	ENST00000304478	.	.	.	5.5	4.51	0.55191	.	0.465011	0.25355	N	0.031276	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.268	0.43466	0.0:0.1477:0.6992:0.1531	.	.	.	.	X	29	.	.	W	+	3	0	RNMTL1	632455	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.774000	0.38573	1.410000	0.46936	0.563000	0.77884	TGG	.	.	none		0.667	GLOD4-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000437190.1	NM_016080	
TMEM229A	730130	hgsc.bcm.edu	37	7	123672815	123672815	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:123672815C>T	ENST00000455783.1	-	1	708	c.243G>A	c.(241-243)ccG>ccA	p.P81P	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	81						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						TCCGCAGGTCCGGGCTGCGGG	0.687																																					p.P81P		Atlas-SNP	.											.	TMEM229A	31	.	0			c.G243A						PASS	.						37.0	44.0	42.0					7																	123672815		692	1591	2283	SO:0001819	synonymous_variant	730130	exon1			CAGGTCCGGGCTG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.243G>A	7.37:g.123672815C>T		64.0	0.0	0		60.0	36.0	0.6	NM_001136002	A4D0X6	Silent	SNP	ENST00000455783.1	37	CCDS47694.1																																																																																			.	.	none		0.687	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
PPIB	5479	hgsc.bcm.edu	37	15	64455114	64455114	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:64455114G>A	ENST00000300026.3	-	1	290	c.72C>T	c.(70-72)ttC>ttT	p.F24F	PPIB_ENST00000558492.1_5'UTR	NM_000942.4	NP_000933.1	P23284	PPIB_HUMAN	peptidylprolyl isomerase B (cyclophilin B)	24					bone development (GO:0060348)|chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|positive regulation of multicellular organism growth (GO:0040018)|protein peptidyl-prolyl isomerization (GO:0000413)|protein stabilization (GO:0050821)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)	peptide binding (GO:0042277)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(6)	10					L-Proline(DB00172)	GCAGCAGCAGGAAGAAGACGG	0.652																																					p.F24F	GBM(105;399 1481 32889 33051 36637)	Atlas-SNP	.											.	PPIB	20	.	0			c.C72T						PASS	.						24.0	28.0	27.0					15																	64455114		2203	4300	6503	SO:0001819	synonymous_variant	5479	exon1			CAGCAGGAAGAAG		CCDS10191.1	15q21-q22	2014-09-17			ENSG00000166794	ENSG00000166794	5.2.1.8		9255	protein-coding gene	gene with protein product		123841				2000394, 20089953	Standard	NM_000942		Approved	CYPB, OI9	uc002and.3	P23284	OTTHUMG00000133018	ENST00000300026.3:c.72C>T	15.37:g.64455114G>A		172.0	0.0	0		162.0	27.0	0.166667	NM_000942	A8K534|Q6IBH5|Q9BVK5	Silent	SNP	ENST00000300026.3	37	CCDS10191.1																																																																																			.	.	none		0.652	PPIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256604.1		
ALKBH1	8846	hgsc.bcm.edu	37	14	78174250	78174250	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr14:78174250C>T	ENST00000216489.3	-	1	113	c.98G>A	c.(97-99)aGc>aAc	p.S33N	SLIRP_ENST00000557623.1_5'Flank|SLIRP_ENST00000557342.1_5'Flank|SLIRP_ENST00000557431.1_5'Flank|SLIRP_ENST00000238688.5_5'Flank	NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	33					developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CCCGGGCCGGCTCTGACGGTA	0.657																																					p.S33N		Atlas-SNP	.											.	ALKBH1	30	.	0			c.G98A						PASS	.						37.0	41.0	39.0					14																	78174250		2201	4298	6499	SO:0001583	missense	8846	exon1			GGCCGGCTCTGAC	X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.98G>A	14.37:g.78174250C>T	ENSP00000216489:p.Ser33Asn	81.0	0.0	0		93.0	4.0	0.0430108	NM_006020	Q8TAU1|Q9ULA7	Missense_Mutation	SNP	ENST00000216489.3	37	CCDS32127.1	.	.	.	.	.	.	.	.	.	.	C	17.16	3.318509	0.60524	.	.	ENSG00000100601	ENST00000216489	T	0.29655	1.56	5.96	5.05	0.67936	.	0.328069	0.36972	N	0.002319	T	0.26484	0.0647	L	0.44542	1.39	0.28458	N	0.916036	B	0.28128	0.201	B	0.23419	0.046	T	0.10405	-1.0631	10	0.24483	T	0.36	-11.9065	14.3693	0.66828	0.1594:0.8406:0.0:0.0	.	33	Q13686	ALKB1_HUMAN	N	33	ENSP00000216489:S33N	ENSP00000216489:S33N	S	-	2	0	ALKBH1	77244003	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.926000	0.48892	1.456000	0.47831	0.655000	0.94253	AGC	.	.	none		0.657	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414037.1	NM_006020	
SH3BP1	23616	hgsc.bcm.edu	37	22	38035817	38035817	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:38035817G>A	ENST00000357436.4	+	1	336	c.23G>A	c.(22-24)cGc>cAc	p.R8H	SH3BP1_ENST00000336738.5_Missense_Mutation_p.R8H|Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000442465.2_Missense_Mutation_p.R8H|SH3BP1_ENST00000599616.1_5'Flank	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	8					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CAGCTGCACCGCATGCGGCAG	0.706																																					p.R8H		Atlas-SNP	.											.	SH3BP1	41	.	0			c.G23A						PASS	.						5.0	7.0	6.0					22																	38035817		1930	3890	5820	SO:0001583	missense	23616	exon1			TGCACCGCATGCG		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.23G>A	22.37:g.38035817G>A	ENSP00000350018:p.Arg8His	75.0	0.0	0		61.0	7.0	0.114754	NM_018957	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	37	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015241	0.93404	.	.	ENSG00000100092	ENST00000357436;ENST00000336738;ENST00000442465	T;T;T	0.80653	-1.4;-1.4;-1.4	3.95	3.95	0.45737	BAR (1);	0.000000	0.47455	D	0.000234	D	0.86493	0.5946	L	0.54323	1.7	0.47621	D	0.999478	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.959	D	0.88038	0.2779	10	0.87932	D	0	.	14.2854	0.66243	0.0:0.0:1.0:0.0	.	8;8	F5GZA8;Q9Y3L3	.;3BP1_HUMAN	H	8	ENSP00000350018:R8H;ENSP00000337213:R8H;ENSP00000395126:R8H	ENSP00000337213:R8H	R	+	2	0	SH3BP1	36365763	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.636000	0.61339	2.187000	0.69744	0.609000	0.83330	CGC	.	.	none		0.706	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
ZNF189	7743	hgsc.bcm.edu	37	9	104170651	104170651	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:104170651G>A	ENST00000339664.2	+	3	730	c.601G>A	c.(601-603)Gaa>Aaa	p.E201K	ZNF189_ENST00000374861.3_Missense_Mutation_p.E187K|ZNF189_ENST00000259395.4_Missense_Mutation_p.E159K	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	201					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				TCACACTGGGGAAAGGCCCTA	0.413																																					p.E201K		Atlas-SNP	.											.	ZNF189	79	.	0			c.G601A						PASS	.						77.0	81.0	80.0					9																	104170651		2203	4300	6503	SO:0001583	missense	7743	exon3			ACTGGGGAAAGGC	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.601G>A	9.37:g.104170651G>A	ENSP00000342019:p.Glu201Lys	106.0	0.0	0		132.0	55.0	0.416667	NM_003452	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	ENST00000339664.2	37	CCDS6754.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.306653	0.81247	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.24350	1.86;1.86;1.86	4.79	4.79	0.61399	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000113	T	0.48150	0.1484	M	0.64080	1.96	0.54753	D	0.999982	D;D;D	0.71674	0.985;0.995;0.998	P;D;D	0.74023	0.807;0.931;0.982	T	0.40156	-0.9578	10	0.62326	D	0.03	.	16.1533	0.81636	0.0:0.0:1.0:0.0	.	186;187;201	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	K	187;201;159	ENSP00000363995:E187K;ENSP00000342019:E201K;ENSP00000259395:E159K	ENSP00000259395:E159K	E	+	1	0	ZNF189	103210472	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.478000	0.73596	2.941000	0.99782	0.655000	0.94253	GAA	.	.	none		0.413	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
FAM107B	83641	hgsc.bcm.edu	37	10	14816655	14816655	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:14816655G>A	ENST00000181796.2	-	1	241	c.8C>T	c.(7-9)aCg>aTg	p.T3M		NM_031453.2	NP_113641.2	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	0					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TGCTTTCCACGTGGACATGAC	0.483																																					p.T3M		Atlas-SNP	.											.	FAM107B	43	.	0			c.C8T						PASS	.						82.0	65.0	71.0					10																	14816655		2203	4300	6503	SO:0001583	missense	83641	exon1			TTCCACGTGGACA	AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000181796.2:c.8C>T	10.37:g.14816655G>A	ENSP00000181796:p.Thr3Met	103.0	0.0	0		152.0	44.0	0.289474	NM_031453	A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Missense_Mutation	SNP	ENST00000181796.2	37	CCDS7102.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672163	0.29693	.	.	ENSG00000065809	ENST00000181796	T	0.39229	1.09	5.84	1.91	0.25777	.	0.778029	0.11243	N	0.584448	T	0.20577	0.0495	N	0.14661	0.345	0.80722	D	1	B	0.31054	0.306	B	0.22152	0.038	T	0.12656	-1.0539	10	0.87932	D	0	-0.0064	2.2074	0.03939	0.2697:0.1203:0.4863:0.1237	.	3	Q9H098-2	.	M	3	ENSP00000181796:T3M	ENSP00000181796:T3M	T	-	2	0	FAM107B	14856661	0.013000	0.17824	1.000000	0.80357	0.694000	0.40290	0.028000	0.13644	0.389000	0.25086	0.650000	0.86243	ACG	.	.	none		0.483	FAM107B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356966.1	NM_031453	
MFSD3	113655	hgsc.bcm.edu	37	8	145738768	145738768	+	IGR	SNP	G	G	C	rs11342077|rs398010167|rs199605511		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:145738768G>C	ENST00000301327.4	+	0	1548				RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Splice_Site_p.R766G	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			ACCACCACCCGGCAACTGGCC	0.677																																					.		Atlas-SNP	.											.	RECQL4	75	.	0			c.2296+1C>G						PASS	.																																			SO:0001628	intergenic_variant	9401	exon15			CCACCCGGCAACT		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738768G>C		102.0	0.0	0		34.0	7.0	0.205882	NM_004260		Splice_Site	SNP	ENST00000301327.4	37	CCDS6431.1																																																																																			.	.	weak		0.677	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
KDM4E	390245	hgsc.bcm.edu	37	11	94759726	94759726	+	Silent	SNP	C	C	T	rs76354273	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:94759726C>T	ENST00000450979.2	+	1	1305	c.1005C>T	c.(1003-1005)caC>caT	p.H335H		NM_001161630.1	NP_001155102.1	B2RXH2	KDM4E_HUMAN	lysine (K)-specific demethylase 4E	335					histone H3-K9 demethylation (GO:0033169)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(1)|lung(3)	12						TCTGGAAACACAGGCAAGACT	0.512													C|||	220	0.0439297	0.0174	0.0014	5008	,	,		21472	0.1637		0.001	False		,,,				2504	0.0307				p.H335H		Atlas-SNP	.											.	KDM4E	60	.	0			c.C1005T						PASS	.	C		34,1350		0,34,658	64.0	59.0	61.0		1005	1.4	0.2	11	dbSNP_132	61	6,3176		0,6,1585	no	coding-synonymous	KDM4DL	NM_001161630.1		0,40,2243	TT,TC,CC		0.1886,2.4566,0.876		335/507	94759726	40,4526	692	1591	2283	SO:0001819	synonymous_variant	390245	exon1			GAAACACAGGCAA	BC157851	CCDS44713.1	11q21	2012-03-30	2012-03-28	2012-03-28		ENSG00000235268		"""Chromatin-modifying enzymes / K-demethylases"""	37098	protein-coding gene	gene with protein product			"""lysine (K)-specific demethylase 4D-like"""	KDM4DL		21076780	Standard	NM_001161630		Approved	JMJD2E	uc010ruf.1	B2RXH2		ENST00000450979.2:c.1005C>T	11.37:g.94759726C>T		6.0	0.0	0		12.0	6.0	0.5	NM_001161630		Silent	SNP	ENST00000450979.2	37	CCDS44713.1																																																																																			C|0.947;T|0.053	0.053	strong		0.512	KDM4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396649.1	NM_001161630	
PGR	5241	hgsc.bcm.edu	37	11	100922186	100922186	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:100922186G>T	ENST00000325455.5	-	5	3779	c.2326C>A	c.(2326-2328)Ctg>Atg	p.L776M	PGR_ENST00000263463.5_Missense_Mutation_p.L674M|PGR_ENST00000534013.1_Missense_Mutation_p.L182M	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	776	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	GCAAAATACAGCATCTGCCCA	0.333																																					p.L776M	Pancreas(124;2271 2354 21954 22882)	Atlas-SNP	.											.	PGR	115	.	0			c.C2326A						PASS	.						125.0	120.0	122.0					11																	100922186		2203	4300	6503	SO:0001583	missense	5241	exon5			AATACAGCATCTG	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2326C>A	11.37:g.100922186G>T	ENSP00000325120:p.Leu776Met	195.0	0.0	0		199.0	71.0	0.356784	NM_000926	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891764	0.52014	.	.	ENSG00000082175	ENST00000325455;ENST00000534013;ENST00000263463;ENST00000537623	D;D;D	0.97620	-4.46;-4.46;-4.46	5.24	2.36	0.29203	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	D	0.000002	D	0.98526	0.9508	M	0.93808	3.46	0.33891	D	0.637314	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99898	1.1153	10	0.87932	D	0	.	9.8858	0.41260	0.2843:0.0:0.7157:0.0	.	674;776;157	Q8TDS3;P06401;A7LQ08	.;PRGR_HUMAN;.	M	776;182;674;674	ENSP00000325120:L776M;ENSP00000436561:L182M;ENSP00000263463:L674M	ENSP00000263463:L674M	L	-	1	2	PGR	100427396	1.000000	0.71417	0.972000	0.41901	0.980000	0.70556	0.819000	0.27308	0.220000	0.20860	-0.157000	0.13467	CTG	.	.	none		0.333	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394934.1		
DHRS7B	25979	hgsc.bcm.edu	37	17	21092024	21092024	+	Splice_Site	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:21092024A>G	ENST00000395511.3	+	6	940	c.620A>G	c.(619-621)tAt>tGt	p.Y207C	DHRS7B_ENST00000581463.1_Splice_Site_p.Y27C|DHRS7B_ENST00000579303.1_Splice_Site_p.Y192C	NM_015510.4	NP_056325.2	Q6IAN0	DRS7B_HUMAN	dehydrogenase/reductase (SDR family) member 7B	207						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|pancreas(2)	7						ACATGTGTAGATGCAGCCTCC	0.547																																					p.Y207C		Atlas-SNP	.											.	DHRS7B	27	.	0			c.A620G						PASS	.						225.0	183.0	197.0					17																	21092024		2203	4300	6503	SO:0001630	splice_region_variant	25979	exon6			GTGTAGATGCAGC	BC004126	CCDS11215.1	17p12	2011-09-20				ENSG00000109016		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	24547	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 32C, member 1"""					10810093, 11230166, 19027726	Standard	NM_015510		Approved	DKFZp566O084, MGC8916, CGI-93, SDR32C1	uc002gyo.3	Q6IAN0		ENST00000395511.3:c.620-1A>G	17.37:g.21092024A>G		85.0	0.0	0		94.0	41.0	0.43617	NM_015510	B5MEF4|Q6UX59|Q9BTF9|Q9UFM6|Q9Y3A1	Missense_Mutation	SNP	ENST00000395511.3	37	CCDS11215.1	.	.	.	.	.	.	.	.	.	.	A	9.784	1.176052	0.21704	.	.	ENSG00000109016	ENST00000395511;ENST00000346603	D	0.97352	-4.35	5.28	5.28	0.74379	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.055538	0.85682	N	0.000000	D	0.98940	0.9640	H	0.97186	3.955	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	D	0.99482	1.0948	9	.	.	.	.	15.2134	0.73244	1.0:0.0:0.0:0.0	.	207	Q6IAN0	DRS7B_HUMAN	C	207	ENSP00000378887:Y207C	.	Y	+	2	0	DHRS7B	21032616	1.000000	0.71417	0.897000	0.35233	0.109000	0.19521	9.179000	0.94861	2.001000	0.58596	0.383000	0.25322	TAT	.	.	none		0.547	DHRS7B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444066.3	NM_015510	Missense_Mutation
KIF16B	55614	hgsc.bcm.edu	37	20	16360313	16360313	+	Silent	SNP	G	G	A	rs374151470		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr20:16360313G>A	ENST00000354981.2	-	19	2491	c.2334C>T	c.(2332-2334)ctC>ctT	p.L778L	KIF16B_ENST00000378003.2_Silent_p.L4L|KIF16B_ENST00000355755.3_Silent_p.L778L|KIF16B_ENST00000408042.1_Silent_p.L778L	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	778	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						CACGCCGCAGGAGCTGGATCA	0.597																																					p.L778L		Atlas-SNP	.											.	KIF16B	305	.	0			c.C2334T						PASS	.						97.0	95.0	96.0					20																	16360313		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon19			CCGCAGGAGCTGG	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2334C>T	20.37:g.16360313G>A		147.0	0.0	0		202.0	73.0	0.361386	NM_001199865	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																			.	.	alt		0.597	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
CD200	4345	hgsc.bcm.edu	37	3	112059764	112059764	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:112059764T>G	ENST00000315711.8	+	2	85	c.28T>G	c.(28-30)Ttc>Gtc	p.F10V	CD200_ENST00000473539.1_Missense_Mutation_p.F35V|CD200_ENST00000383681.3_Intron	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	10					regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				CAGGATGCCCTTCTCTCATCT	0.483																																					p.F35V		Atlas-SNP	.											.	CD200	33	.	0			c.T103G						PASS	.						153.0	126.0	135.0					3																	112059764		2203	4300	6503	SO:0001583	missense	4345	exon3			ATGCCCTTCTCTC		CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.28T>G	3.37:g.112059764T>G	ENSP00000312766:p.Phe10Val	127.0	0.0	0		94.0	24.0	0.255319	NM_001004196	B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Missense_Mutation	SNP	ENST00000315711.8	37	CCDS2965.1	.	.	.	.	.	.	.	.	.	.	T	11.59	1.685253	0.29872	.	.	ENSG00000091972	ENST00000315711;ENST00000473539	T;T	0.72505	1.05;-0.66	5.18	4.01	0.46588	.	0.230049	0.31102	N	0.008250	T	0.54351	0.1853	N	0.24115	0.695	0.47183	D	0.999341	B;B	0.23249	0.082;0.01	B;B	0.19946	0.027;0.011	T	0.51076	-0.8751	10	0.49607	T	0.09	-6.9091	9.0178	0.36182	0.0:0.0:0.1864:0.8136	.	10;35	P41217-2;P41217-3	.;.	V	10;35	ENSP00000312766:F10V;ENSP00000420298:F35V	ENSP00000312766:F10V	F	+	1	0	CD200	113542454	0.584000	0.26766	0.303000	0.25071	0.960000	0.62799	0.805000	0.27112	0.971000	0.38288	0.533000	0.62120	TTC	.	.	none		0.483	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354078.1		
RBM20	282996	hgsc.bcm.edu	37	10	112572301	112572301	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:112572301C>T	ENST00000369519.3	+	9	2204	c.2146C>T	c.(2146-2148)Cgg>Tgg	p.R716W		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	716			R -> Q (in CMD1DD). {ECO:0000269|PubMed:20590677}.		heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						ACACCACCCCCGGCAACTGGA	0.632																																					p.R716W		Atlas-SNP	.											.	RBM20	50	.	0			c.C2146T						PASS	.						53.0	69.0	64.0					10																	112572301		692	1591	2283	SO:0001583	missense	282996	exon9			CACCCCCGGCAAC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.2146C>T	10.37:g.112572301C>T	ENSP00000358532:p.Arg716Trp	65.0	0.0	0		54.0	16.0	0.296296	NM_001134363	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	C	11.95	1.790539	0.31685	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	T	0.75704	-0.96	5.75	0.337	0.15966	.	0.417679	0.21776	N	0.069282	T	0.55545	0.1927	L	0.34521	1.04	0.31765	N	0.632879	B	0.06786	0.001	B	0.01281	0.0	T	0.42932	-0.9422	10	0.31617	T	0.26	-5.8678	4.0402	0.09748	0.2624:0.4539:0.0:0.2837	.	716	Q5T481	RBM20_HUMAN	W	716	ENSP00000358532:R716W	ENSP00000358532:R716W	R	+	1	2	RBM20	112562291	0.232000	0.23762	0.973000	0.42090	0.957000	0.61999	0.480000	0.22244	-0.209000	0.10156	-0.244000	0.11960	CGG	.	.	none		0.632	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
ACSS3	79611	hgsc.bcm.edu	37	12	81472143	81472143	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:81472143G>A	ENST00000548058.1	+	1	1154	c.244G>A	c.(244-246)Gag>Aag	p.E82K	ACSS3_ENST00000261206.3_Missense_Mutation_p.E82K			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	82						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CAAAGCTGCCGAGCAGATCAG	0.617																																					p.E82K		Atlas-SNP	.											.	ACSS3	118	.	0			c.G244A						PASS	.						46.0	43.0	44.0					12																	81472143		1984	4018	6002	SO:0001583	missense	79611	exon1			GCTGCCGAGCAGA		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.244G>A	12.37:g.81472143G>A	ENSP00000449535:p.Glu82Lys	49.0	0.0	0		56.0	20.0	0.357143	NM_024560	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	G	8.471	0.857542	0.17106	.	.	ENSG00000111058	ENST00000548058;ENST00000261206	T;T	0.10960	2.82;2.82	5.03	4.11	0.48088	Acyl-CoA synthase, domain of unknown function DUF3448 (1);	0.506389	0.20979	N	0.082246	T	0.04407	0.0121	N	0.04636	-0.2	0.80722	D	1	P	0.39520	0.676	B	0.35413	0.202	T	0.49093	-0.8975	10	0.11182	T	0.66	-23.7543	11.5895	0.50938	0.0:0.3487:0.6513:0.0	.	82	Q9H6R3	ACSS3_HUMAN	K	82	ENSP00000449535:E82K;ENSP00000261206:E82K	ENSP00000261206:E82K	E	+	1	0	ACSS3	79996274	0.962000	0.33011	0.863000	0.33907	0.385000	0.30292	1.612000	0.36889	1.292000	0.44672	0.655000	0.94253	GAG	.	.	none		0.617	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
PLCB4	5332	hgsc.bcm.edu	37	20	9374297	9374297	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr20:9374297C>T	ENST00000378493.1	+	15	1401	c.1386C>T	c.(1384-1386)aaC>aaT	p.N462N	PLCB4_ENST00000278655.4_Silent_p.N462N|PLCB4_ENST00000334005.3_Silent_p.N462N|PLCB4_ENST00000414679.2_Silent_p.N462N|PLCB4_ENST00000378473.3_Silent_p.N462N|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Silent_p.N462N			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	462	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						TCATAAAAAACAAGCGGCTGA	0.393											OREG0025771	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N462N		Atlas-SNP	.											.	PLCB4	204	.	0			c.C1386T						PASS	.						60.0	62.0	61.0					20																	9374297		2203	4300	6503	SO:0001819	synonymous_variant	5332	exon16			AAAAAACAAGCGG		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1386C>T	20.37:g.9374297C>T		32.0	0.0	0	656	58.0	10.0	0.172414	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																			.	.	none		0.393	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
NPAT	4863	hgsc.bcm.edu	37	11	108044441	108044441	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:108044441G>A	ENST00000278612.8	-	13	1375	c.1270C>T	c.(1270-1272)Cag>Tag	p.Q424*	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	424					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GCCTTTTTCTGTATGCTGGTA	0.383																																					p.Q424X		Atlas-SNP	.											.	NPAT	124	.	0			c.C1270T						PASS	.						147.0	138.0	141.0					11																	108044441		1860	4091	5951	SO:0001587	stop_gained	4863	exon13			TTTTCTGTATGCT	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1270C>T	11.37:g.108044441G>A	ENSP00000278612:p.Gln424*	331.0	0.0	0		381.0	54.0	0.141732	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Nonsense_Mutation	SNP	ENST00000278612.8	37	CCDS41710.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409649	0.42715	.	.	ENSG00000149308	ENST00000278612	.	.	.	5.54	5.54	0.83059	.	0.297500	0.30989	N	0.008468	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-1.0278	12.4896	0.55893	0.0:0.0:0.8223:0.1777	.	.	.	.	X	424	.	ENSP00000278612:Q424X	Q	-	1	0	NPAT	107549651	1.000000	0.71417	0.998000	0.56505	0.034000	0.12701	3.320000	0.51991	2.765000	0.95021	0.557000	0.71058	CAG	.	.	none		0.383	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
PLEC	5339	hgsc.bcm.edu	37	8	144993567	144993567	+	Silent	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:144993567G>T	ENST00000322810.4	-	32	11002	c.10833C>A	c.(10831-10833)atC>atA	p.I3611I	PLEC_ENST00000527096.1_Silent_p.I3497I|PLEC_ENST00000398774.2_Silent_p.I3442I|PLEC_ENST00000354589.3_Silent_p.I3474I|PLEC_ENST00000354958.2_Silent_p.I3452I|PLEC_ENST00000356346.3_Silent_p.I3460I|PLEC_ENST00000357649.2_Silent_p.I3478I|PLEC_ENST00000345136.3_Silent_p.I3474I|PLEC_ENST00000436759.2_Silent_p.I3501I	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3611	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGGGGTCGATGATGCCGCCCG	0.687																																					p.I3611I		Atlas-SNP	.											PLEC_ENST00000436759,bladder,carcinoma,-2,6	PLEC	1144	6	0			c.C10833A						scavenged	.						47.0	52.0	50.0					8																	144993567		2042	4183	6225	SO:0001819	synonymous_variant	5339	exon32			GTCGATGATGCCG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10833C>A	8.37:g.144993567G>T		52.0	0.0	0		37.0	2.0	0.0540541	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.	.	none		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
NBEA	26960	hgsc.bcm.edu	37	13	35691562	35691562	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr13:35691562C>T	ENST00000400445.3	+	14	2548	c.2014C>T	c.(2014-2016)Cca>Tca	p.P672S	NBEA_ENST00000379939.2_Missense_Mutation_p.P672S|NBEA_ENST00000310336.4_Missense_Mutation_p.P672S|NBEA_ENST00000540320.1_Missense_Mutation_p.P672S	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	672					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TGGTCCCCGGCCATCACAAAA	0.269																																					p.P672S		Atlas-SNP	.											.	NBEA	340	.	0			c.C2014T						PASS	.						4.0	4.0	4.0					13																	35691562		1566	3452	5018	SO:0001583	missense	26960	exon14			CCCCGGCCATCAC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2014C>T	13.37:g.35691562C>T	ENSP00000383295:p.Pro672Ser	109.0	0.0	0		120.0	22.0	0.183333	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106573	0.77096	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	4.29	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.66548	0.2800	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.73062	-0.4101	10	0.62326	D	0.03	.	16.7133	0.85391	0.0:1.0:0.0:0.0	.	672	Q5T321	.	S	672	ENSP00000440951:P672S;ENSP00000383295:P672S;ENSP00000369271:P672S;ENSP00000308534:P672S	ENSP00000308534:P672S	P	+	1	0	NBEA	34589562	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.265000	0.78442	1.929000	0.55896	0.460000	0.39030	CCA	.	.	none		0.269	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
LGI1	9211	hgsc.bcm.edu	37	10	95552602	95552602	+	Silent	SNP	C	C	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:95552602C>A	ENST00000371418.4	+	6	866	c.606C>A	c.(604-606)ggC>ggA	p.G202G	LGI1_ENST00000542308.1_Silent_p.G154G|LGI1_ENST00000371413.3_Silent_p.G202G	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	202	LRRCT.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)	p.E205fs*9(1)		central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				ACTGCGAAGGCCCCCCAGAAT	0.418																																					p.G202G		Atlas-SNP	.											.	LGI1	69	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.C606A						PASS	.						133.0	135.0	134.0					10																	95552602		2203	4300	6503	SO:0001819	synonymous_variant	9211	exon6			CGAAGGCCCCCCA	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.606C>A	10.37:g.95552602C>A		100.0	0.0	0		134.0	61.0	0.455224	NM_005097	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Silent	SNP	ENST00000371418.4	37	CCDS7431.1																																																																																			.	.	none		0.418	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	
SCML4	256380	hgsc.bcm.edu	37	6	108070921	108070921	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:108070921C>T	ENST00000369020.3	-	3	498	c.253G>A	c.(253-255)Gtc>Atc	p.V85I	SCML4_ENST00000369021.3_Missense_Mutation_p.V56I|SCML4_ENST00000369022.2_Missense_Mutation_p.V27I	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	85					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		AAGCTGGGGACCGTGGCTGCG	0.592																																					p.V85I		Atlas-SNP	.											.	SCML4	65	.	0			c.G253A						PASS	.						73.0	77.0	76.0					6																	108070921		2203	4300	6503	SO:0001583	missense	256380	exon3			TGGGGACCGTGGC		CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.253G>A	6.37:g.108070921C>T	ENSP00000358016:p.Val85Ile	101.0	0.0	0		106.0	42.0	0.396226	NM_198081	B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	ENST00000369020.3	37	CCDS5060.2	.	.	.	.	.	.	.	.	.	.	C	1.726	-0.495425	0.04291	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.42513	0.98;0.99;0.98;0.97	5.15	-4.99	0.03010	.	0.692695	0.12891	N	0.430560	T	0.07954	0.0199	N	0.17872	0.535	0.09310	N	1	B;B;B	0.12630	0.001;0.0;0.006	B;B;B	0.11329	0.002;0.001;0.006	T	0.48896	-0.8994	10	0.02654	T	1	.	17.2554	0.87055	0.0:0.7296:0.0:0.2704	.	85;85;56	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	I	27;85;56;56	ENSP00000358018:V27I;ENSP00000358016:V85I;ENSP00000358017:V56I;ENSP00000404688:V56I	ENSP00000358016:V85I	V	-	1	0	SCML4	108177614	0.000000	0.05858	0.000000	0.03702	0.684000	0.39900	-1.014000	0.03641	-0.689000	0.05149	0.655000	0.94253	GTC	.	.	none		0.592	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041700.3	XM_171128	
AFG3L2	10939	hgsc.bcm.edu	37	18	12356754	12356754	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr18:12356754G>A	ENST00000269143.3	-	9	1334	c.1103C>T	c.(1102-1104)cCc>cTc	p.P368L		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	368					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	GGTGATGAAGGGGACATTGGC	0.502																																					p.P368L		Atlas-SNP	.											.	AFG3L2	60	.	0			c.C1103T						PASS	.						166.0	124.0	138.0					18																	12356754		2203	4300	6503	SO:0001583	missense	10939	exon9			ATGAAGGGGACAT	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.1103C>T	18.37:g.12356754G>A	ENSP00000269143:p.Pro368Leu	92.0	0.0	0		97.0	4.0	0.0412371	NM_006796	Q6P1L0	Missense_Mutation	SNP	ENST00000269143.3	37	CCDS11859.1	.	.	.	.	.	.	.	.	.	.	G	33	5.231900	0.95207	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	T	0.80824	-1.42	5.28	5.28	0.74379	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.90191	0.6934	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91042	0.4872	10	0.87932	D	0	-24.2564	19.282	0.94055	0.0:0.0:1.0:0.0	.	368	Q9Y4W6	AFG32_HUMAN	L	368;383	ENSP00000269143:P368L	ENSP00000269143:P368L	P	-	2	0	AFG3L2	12346754	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.813000	0.99286	2.631000	0.89168	0.563000	0.77884	CCC	.	.	none		0.502	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
RAX	30062	hgsc.bcm.edu	37	18	56940307	56940307	+	Missense_Mutation	SNP	G	G	T	rs2271733	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr18:56940307G>T	ENST00000334889.3	-	1	318	c.132C>A	c.(130-132)gaC>gaA	p.D44E	RAX_ENST00000256852.7_Missense_Mutation_p.D44E	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	44			D -> E (in dbSNP:rs2271733). {ECO:0000269|PubMed:14662654}.		camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GGATCCCGTCGTCCTTGGTAA	0.746													G|||	980	0.195687	0.1452	0.1571	5008	,	,		10556	0.128		0.3002	False		,,,				2504	0.2536				p.D44E	GBM(150;770 1898 17679 24325 37807)	Atlas-SNP	.											RAX,NS,carcinoma,0,1	RAX	19	1	0			c.C132A						scavenged	.	G	GLU/ASP	490,2640		39,412,1114	11.0	9.0	10.0		132	0.1	1.0	18	dbSNP_100	10	1484,4096		212,1060,1518	yes	missense	RAX	NM_013435.2	45	251,1472,2632	TT,TG,GG		26.595,15.655,22.6636	benign	44/347	56940307	1974,6736	1565	2790	4355	SO:0001583	missense	30062	exon1			CCCGTCGTCCTTG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.132C>A	18.37:g.56940307G>T	ENSP00000334813:p.Asp44Glu	1.0	1.0	1		5.0	3.0	0.6	NM_013435	Q86V11	Missense_Mutation	SNP	ENST00000334889.3	37	CCDS11972.1	453	0.20741758241758243	75	0.1524390243902439	69	0.19060773480662985	76	0.13286713286713286	233	0.3073878627968338	G	12.43	1.936984	0.34189	0.15655	0.26595	ENSG00000134438	ENST00000256852;ENST00000334889;ENST00000555288	T;D;T	0.87966	0.09;-2.32;0.09	5.56	0.117	0.14652	.	0.213892	0.50627	N	0.000107	T	0.00012	0.0000	N	0.12182	0.205	0.42455	P	0.0072349999999999914	B;B	0.22800	0.075;0.004	B;B	0.23574	0.047;0.009	T	0.06481	-1.0824	9	0.06365	T	0.9	.	0.4639	0.00520	0.2353:0.2064:0.3162:0.2421	rs2271733;rs58469971;rs2271733	44;44	Q86V11;Q9Y2V3	.;RX_HUMAN	E	44	ENSP00000256852:D44E;ENSP00000334813:D44E;ENSP00000450583:D44E	ENSP00000256852:D44E	D	-	3	2	RAX	55091287	0.002000	0.14202	0.999000	0.59377	0.992000	0.81027	-0.819000	0.04462	0.271000	0.22005	0.561000	0.74099	GAC	G|0.801;T|0.199	0.199	strong		0.746	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
PIGW	284098	hgsc.bcm.edu	37	17	34894125	34894125	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:34894125A>G	ENST00000592983.1	+	2	1755	c.1175A>G	c.(1174-1176)gAt>gGt	p.D392G	PIGW_ENST00000328396.2_Missense_Mutation_p.D392G|MYO19_ENST00000590081.1_Intron			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	392					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTACTGGGTGATATAATTTTG	0.338																																					p.D392G		Atlas-SNP	.											.	PIGW	50	.	0			c.A1175G						PASS	.						61.0	65.0	64.0					17																	34894125		2192	4296	6488	SO:0001583	missense	284098	exon2			TGGGTGATATAAT	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.1175A>G	17.37:g.34894125A>G	ENSP00000468778:p.Asp392Gly	51.0	0.0	0		57.0	25.0	0.438596	NM_178517	Q8N9G3	Missense_Mutation	SNP	ENST00000592983.1	37	CCDS11313.1	.	.	.	.	.	.	.	.	.	.	A	13.25	2.181962	0.38511	.	.	ENSG00000184886	ENST00000328396	.	.	.	5.79	4.72	0.59763	.	0.105198	0.64402	N	0.000006	T	0.41581	0.1165	N	0.16833	0.445	0.52501	D	0.999957	B	0.29162	0.235	B	0.34824	0.19	T	0.19877	-1.0292	8	.	.	.	-4.2695	10.3149	0.43732	0.922:0.0:0.078:0.0	.	392	Q7Z7B1	PIGW_HUMAN	G	392	.	.	D	+	2	0	PIGW	31968238	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.836000	0.75349	1.039000	0.40074	0.459000	0.35465	GAT	.	.	none		0.338	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451318.1	NM_178517	
OR8K5	219453	hgsc.bcm.edu	37	11	55927379	55927379	+	Nonsense_Mutation	SNP	G	G	A	rs199580379		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:55927379G>A	ENST00000313447.1	-	1	414	c.415C>T	c.(415-417)Cga>Tga	p.R139*		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				TGACACAGTCGCTGAGACATA	0.403																																					p.R139X		Atlas-SNP	.											.	OR8K5	82	.	0			c.C415T						PASS	.	G	stop/ARG	0,4402		0,0,2201	84.0	86.0	85.0		415	-0.1	0.0	11		85	5,8585	4.3+/-15.6	0,5,4290	yes	stop-gained	OR8K5	NM_001004058.2		0,5,6491	AA,AG,GG		0.0582,0.0,0.0385		139/308	55927379	5,12987	2201	4295	6496	SO:0001587	stop_gained	219453	exon1			ACAGTCGCTGAGA	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.415C>T	11.37:g.55927379G>A	ENSP00000323853:p.Arg139*	103.0	0.0	0		80.0	4.0	0.05	NM_001004058	Q6IFB5	Nonsense_Mutation	SNP	ENST00000313447.1	37	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	G	4.734	0.136431	0.09032	0.0	5.82E-4	ENSG00000181752	ENST00000313447	.	.	.	4.18	-0.0501	0.13832	.	0.217057	0.32952	N	0.005447	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1815	0.48631	0.0:0.0:0.4694:0.5306	.	.	.	.	X	139	.	ENSP00000323853:R139X	R	-	1	2	OR8K5	55683955	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-1.402000	0.02499	0.222000	0.20900	-0.612000	0.04053	CGA	.	.	weak		0.403	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058	
MUM1L1	139221	hgsc.bcm.edu	37	X	105449437	105449437	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:105449437G>A	ENST00000357175.2	+	4	661	c.12G>A	c.(10-12)gaG>gaA	p.E4E	MUM1L1_ENST00000372552.1_Silent_p.E4E|MUM1L1_ENST00000337685.2_Silent_p.E4E	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	4						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						TGGAGTCTGAGTATGTCCTAT	0.398																																					p.E4E		Atlas-SNP	.											.	MUM1L1	166	.	0			c.G12A						PASS	.						20.0	20.0	20.0					X																	105449437		1900	4117	6017	SO:0001819	synonymous_variant	139221	exon5			GTCTGAGTATGTC	AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.12G>A	X.37:g.105449437G>A		256.0	0.0	0		261.0	136.0	0.521073	NM_152423	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Silent	SNP	ENST00000357175.2	37	CCDS55469.1																																																																																			.	.	none		0.398	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423	
TRIM64C	646754	hgsc.bcm.edu	37	11	49075660	49075660	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:49075660A>G	ENST00000530230.1	-	7	949	c.950T>C	c.(949-951)aTg>aCg	p.M317T		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	317	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TTGGGGATCCATGGGTGCACT	0.507																																					p.M320T		Atlas-SNP	.											.	TRIM64C	18	.	0			c.T959C						PASS	.																																			SO:0001583	missense	646754	exon6			GGATCCATGGGTG		CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.950T>C	11.37:g.49075660A>G	ENSP00000431987:p.Met317Thr	506.0	0.0	0		505.0	136.0	0.269307	NM_001206631		Missense_Mutation	SNP	ENST00000530230.1	37		.	.	.	.	.	.	.	.	.	.	g	0.017	-1.505270	0.00992	.	.	ENSG00000214891	ENST00000530230	T	0.60171	0.21	1.55	-3.11	0.05299	.	.	.	.	.	T	0.40145	0.1105	L	0.47190	1.495	0.09310	N	1	.	.	.	.	.	.	T	0.35276	-0.9795	7	0.09843	T	0.71	.	3.3465	0.07137	0.4129:0.3395:0.0:0.2476	.	.	.	.	T	317	ENSP00000431987:M317T	ENSP00000431987:M317T	M	-	2	0	TRIM64C	49032236	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.014000	0.12656	-2.733000	0.00383	0.155000	0.16302	ATG	.	.	none		0.507	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391366.1		
CARD10	29775	hgsc.bcm.edu	37	22	37912258	37912258	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:37912258G>A	ENST00000403299.1	-	4	637	c.421C>T	c.(421-423)Cga>Tga	p.R141*	CARD10_ENST00000494166.1_5'Flank|CARD10_ENST00000251973.5_Nonsense_Mutation_p.R141*			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	141					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CGCAGCCGTCGCACCTCTGTC	0.647																																					p.R141X		Atlas-SNP	.											CARD10,NS,carcinoma,+1,1	CARD10	55	1	0			c.C421T						scavenged	.						14.0	15.0	14.0					22																	37912258		2191	4291	6482	SO:0001587	stop_gained	29775	exon3			GCCGTCGCACCTC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.421C>T	22.37:g.37912258G>A	ENSP00000384570:p.Arg141*	36.0	0.0	0		33.0	2.0	0.0606061	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Nonsense_Mutation	SNP	ENST00000403299.1	37	CCDS13948.1	.	.	.	.	.	.	.	.	.	.	G	37	6.491763	0.97612	.	.	ENSG00000100065	ENST00000403299;ENST00000251973	.	.	.	5.27	4.16	0.48862	.	0.143577	0.44483	D	0.000451	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-28.1082	11.0124	0.47669	0.0:0.0:0.5985:0.4015	.	.	.	.	X	141	.	ENSP00000251973:R141X	R	-	1	2	CARD10	36242204	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.304000	0.59104	2.610000	0.88304	0.563000	0.77884	CGA	.	.	none		0.647	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
DNAH14	127602	hgsc.bcm.edu	37	1	225332227	225332227	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:225332227G>A	ENST00000445597.2	+	18	3434	c.3434G>A	c.(3433-3435)cGa>cAa	p.R1145Q	DNAH14_ENST00000430092.1_Missense_Mutation_p.R1529Q|DNAH14_ENST00000439375.2_Missense_Mutation_p.R1529Q			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1145					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CTCACAGACCGATGCTGGCTG	0.473																																					p.R1529Q		Atlas-SNP	.											.	DNAH14	300	.	0			c.G4586A						PASS	.						112.0	94.0	100.0					1																	225332227		692	1591	2283	SO:0001583	missense	127602	exon28			CAGACCGATGCTG	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3434G>A	1.37:g.225332227G>A	ENSP00000409472:p.Arg1145Gln	96.0	0.0	0		111.0	20.0	0.18018	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		.	.	.	.	.	.	.	.	.	.	G	23.1	4.371908	0.82573	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.14516	2.5;2.5;2.5;2.5	5.31	5.31	0.75309	.	.	.	.	.	T	0.49236	0.1545	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61322	-0.7086	9	0.87932	D	0	.	18.1143	0.89546	0.0:0.0:1.0:0.0	.	1529	Q0VDD8-4	.	Q	1145;1529;1529;624	ENSP00000409472:R1145Q;ENSP00000414402:R1529Q;ENSP00000392061:R1529Q;ENSP00000332424:R624Q	ENSP00000332424:R624Q	R	+	2	0	DNAH14	223398850	1.000000	0.71417	0.007000	0.13788	0.718000	0.41266	8.074000	0.89500	2.639000	0.89480	0.508000	0.49915	CGA	.	.	none		0.473	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
FDX1L	112812	hgsc.bcm.edu	37	19	10428229	10428229	+	5'Flank	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:10428229C>T	ENST00000393708.3	-	0	0				CTD-2369P2.10_ENST00000452032.2_5'Flank|RAVER1_ENST00000293677.6_Silent_p.S724S|FDX1L_ENST00000494368.1_5'Flank|FDX1L_ENST00000541276.1_5'Flank|CTD-2369P2.12_ENST00000586529.1_Silent_p.S125S|FDX1L_ENST00000492239.1_5'Flank	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like						oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TGGGCTCGGGCGAGGGCAGCA	0.701																																					p.S724S		Atlas-SNP	.											.	RAVER1	67	.	0			c.G2172A						PASS	.						31.0	33.0	33.0					19																	10428229		2002	4163	6165	SO:0001631	upstream_gene_variant	125950	exon13			CTCGGGCGAGGGC	AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299		19.37:g.10428229C>T	Exception_encountered	89.0	0.0	0		67.0	4.0	0.0597015	NM_133452	Q8N8B8	Silent	SNP	ENST00000393708.3	37	CCDS32905.1	.	.	.	.	.	.	.	.	.	.	C	6.949	0.544861	0.13312	.	.	ENSG00000161847	ENST00000331131	.	.	.	5.15	-10.3	0.00346	.	.	.	.	.	T	0.37183	0.0994	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13361	-1.0512	7	0.54805	T	0.06	-0.625	5.394	0.16259	0.0732:0.1836:0.2306:0.5125	.	581	Q8IY67	RAVR1_HUMAN	H	581	.	ENSP00000327543:R581H	R	-	2	0	RAVER1	10289229	0.000000	0.05858	0.057000	0.19452	0.729000	0.41735	-5.027000	0.00158	-2.789000	0.00357	-2.358000	0.00240	CGC	.	.	none		0.701	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280567.2		
PBDC1	51260	hgsc.bcm.edu	37	X	75395309	75395309	+	Splice_Site	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:75395309T>C	ENST00000373358.3	+	4	361	c.158T>C	c.(157-159)cTg>cCg	p.L53P	PBDC1_ENST00000373357.3_Splice_Site_p.L53P	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	53																	GTTTCGCAGCTGATTTCATCA	0.413																																					p.L53P		Atlas-SNP	.											.	.	.	.	0			c.T158C						PASS	.						86.0	75.0	79.0					X																	75395309		2203	4300	6503	SO:0001630	splice_region_variant	51260	exon4			CGCAGCTGATTTC	BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.157-1T>C	X.37:g.75395309T>C		100.0	0.0	0		99.0	28.0	0.282828	NM_016500		Missense_Mutation	SNP	ENST00000373358.3	37	CCDS14432.1	.	.	.	.	.	.	.	.	.	.	T	19.75	3.885632	0.72410	.	.	ENSG00000102390	ENST00000373358;ENST00000373357	.	.	.	4.77	4.77	0.60923	Yst0336-like domain (1);	0.000000	0.85682	D	0.000000	T	0.81767	0.4892	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85370	0.1113	9	0.87932	D	0	-8.4595	11.3241	0.49438	0.0:0.0:0.0:1.0	.	53	Q9BVG4	CX026_HUMAN	P	53	.	ENSP00000362455:L53P	L	+	2	0	CXorf26	75311711	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.748000	0.68697	1.875000	0.54330	0.486000	0.48141	CTG	.	.	none		0.413	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057294.1	NM_016500	Missense_Mutation
PIEZO1	9780	hgsc.bcm.edu	37	16	88800422	88800422	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:88800422G>A	ENST00000301015.9	-	17	2467	c.2221C>T	c.(2221-2223)Cag>Tag	p.Q741*	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	741					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tgctcctgctgctcctcccgc	0.657																																					p.Q741X		Atlas-SNP	.											.	PIEZO1	79	.	0			c.C2221T						PASS	.						8.0	11.0	10.0					16																	88800422		688	1580	2268	SO:0001587	stop_gained	9780	exon17			CCTGCTGCTCCTC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2221C>T	16.37:g.88800422G>A	ENSP00000301015:p.Gln741*	90.0	0.0	0		73.0	38.0	0.520548	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Nonsense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.40|14.40	2.524756|2.524756	0.44969|0.44969	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|.	.|.	.|.	2.16|2.16	-0.768|-0.768	0.11013|0.11013	.|.	.|0.867490	.|0.09707	.|N	.|0.766227	T|.	0.09423|.	0.0232|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35475|.	-0.9787|.	4|.	.|0.05833	.|T	.|0.94	.|.	3.7221|3.7221	0.08460|0.08460	0.0:0.2087:0.3757:0.4157|0.0:0.2087:0.3757:0.4157	.|.	.|.	.|.	.|.	V|X	686|741	.|.	.|ENSP00000301015:Q741X	A|Q	-|-	2|1	0|0	FAM38A|FAM38A	87327923|87327923	0.002000|0.002000	0.14202|0.14202	0.002000|0.002000	0.10522|0.10522	0.002000|0.002000	0.02628|0.02628	0.136000|0.136000	0.15974|0.15974	0.144000|0.144000	0.18951|0.18951	0.462000|0.462000	0.41574|0.41574	GCA|CAG	.	.	none		0.657	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
HBS1L	10767	hgsc.bcm.edu	37	6	135358694	135358694	+	Intron	SNP	G	G	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:135358694G>C	ENST00000367837.5	-	4	637				HBS1L_ENST00000415177.2_Intron|HBS1L_ENST00000314674.3_Intron|HBS1L_ENST00000367820.2_Intron|HBS1L_ENST00000367822.5_Missense_Mutation_p.Q301E|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000367824.4_Intron|HBS1L_ENST00000367826.2_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		GAATTATTTTGAATATATAAA	0.313																																					p.Q301E		Atlas-SNP	.											.	HBS1L	75	.	0			c.C901G						PASS	.						36.0	32.0	33.0					6																	135358694		692	1590	2282	SO:0001627	intron_variant	10767	exon5			TATTTTGAATATA	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.430+2016C>G	6.37:g.135358694G>C		117.0	0.0	0		92.0	38.0	0.413043	NM_001145207	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	37	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	G	0.406	-0.915705	0.02415	.	.	ENSG00000112339	ENST00000367822	.	.	.	4.82	2.91	0.33838	.	.	.	.	.	T	0.10723	0.0262	.	.	.	0.25267	N	0.989545	B	0.28636	0.218	B	0.25291	0.059	T	0.10613	-1.0622	7	0.62326	D	0.03	.	4.5597	0.12154	0.0899:0.1409:0.6046:0.1646	.	301	Q9Y450-2	.	E	301	.	ENSP00000356796:Q301E	Q	-	1	0	HBS1L	135400387	0.001000	0.12720	0.257000	0.24404	0.077000	0.17291	0.204000	0.17335	2.382000	0.81193	0.655000	0.94253	CAA	.	.	none		0.313	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2		
JAKMIP3	282973	hgsc.bcm.edu	37	10	133962951	133962951	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:133962951C>T	ENST00000298622.4	+	14	2022	c.1884C>T	c.(1882-1884)caC>caT	p.H628H	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	628						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TCAGCTTCCACCACACGCCCT	0.657																																					p.H628H		Atlas-SNP	.											.	JAKMIP3	69	.	0			c.C1884T						PASS	.						71.0	51.0	58.0					10																	133962951		2184	4286	6470	SO:0001819	synonymous_variant	282973	exon14			CTTCCACCACACG	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1884C>T	10.37:g.133962951C>T		80.0	0.0	0		64.0	29.0	0.453125	NM_001105521	A6PW00|Q69YM6|Q6ZT29	Silent	SNP	ENST00000298622.4	37	CCDS44494.1																																																																																			.	.	none		0.657	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
DUSP2	1844	hgsc.bcm.edu	37	2	96810595	96810595	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:96810595A>C	ENST00000288943.4	-	2	500	c.415T>G	c.(415-417)Tgt>Ggt	p.C139G	AC012307.2_ENST00000449242.1_lincRNA	NM_004418.3	NP_004409.1	Q05923	DUS2_HUMAN	dual specificity phosphatase 2	139	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(1)|lung(2)|skin(1)	5		Ovarian(717;0.0228)				AGATCGGGACAGCAGCCCTGG	0.692																																					p.C139G		Atlas-SNP	.											.	DUSP2	20	.	0			c.T415G						PASS	.						15.0	21.0	19.0					2																	96810595		2119	4214	6333	SO:0001583	missense	1844	exon2			CGGGACAGCAGCC	L11329	CCDS2016.1	2q11	2011-06-09			ENSG00000158050	ENSG00000158050		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3068	protein-coding gene	gene with protein product		603068				7806236, 7590752, 12673251	Standard	NM_004418		Approved	PAC-1	uc002svk.4	Q05923	OTTHUMG00000130456	ENST00000288943.4:c.415T>G	2.37:g.96810595A>C	ENSP00000288943:p.Cys139Gly	84.0	0.0	0		98.0	37.0	0.377551	NM_004418	Q53T45	Missense_Mutation	SNP	ENST00000288943.4	37	CCDS2016.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.791720	0.31685	.	.	ENSG00000158050	ENST00000288943	T	0.35421	1.31	4.31	4.31	0.51392	Rhodanese-like (4);	0.305675	0.32258	N	0.006346	T	0.27933	0.0688	L	0.49778	1.585	0.35359	D	0.788057	P	0.38335	0.627	B	0.28916	0.096	T	0.47947	-0.9077	10	0.66056	D	0.02	.	9.8111	0.40824	1.0:0.0:0.0:0.0	.	139	Q05923	DUS2_HUMAN	G	139	ENSP00000288943:C139G	ENSP00000288943:C139G	C	-	1	0	DUSP2	96174322	0.132000	0.22450	0.778000	0.31720	0.171000	0.22731	3.037000	0.49775	1.812000	0.52913	0.374000	0.22700	TGT	.	.	none		0.692	DUSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252847.1	NM_004418	
GRAMD3	65983	hgsc.bcm.edu	37	5	125813449	125813449	+	Silent	SNP	C	C	T	rs375006587		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:125813449C>T	ENST00000285689.3	+	6	1013	c.552C>T	c.(550-552)aaC>aaT	p.N184N	RP11-517I3.1_ENST00000512500.1_RNA|RP11-517I3.1_ENST00000515808.1_RNA|GRAMD3_ENST00000542322.1_Silent_p.N192N|GRAMD3_ENST00000543198.1_Silent_p.N161N|GRAMD3_ENST00000515200.1_Silent_p.N161N|GRAMD3_ENST00000513040.1_Silent_p.N199N|GRAMD3_ENST00000511134.1_Silent_p.N168N|GRAMD3_ENST00000502348.1_Silent_p.N75N|GRAMD3_ENST00000544396.1_Silent_p.N80N	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	184						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		TAGTGCCAAACGCCCTGATCA	0.488																																					p.N199N		Atlas-SNP	.											.	GRAMD3	30	.	0			c.C597T						PASS	.	C	,,,,	1,4405	2.1+/-5.4	0,1,2202	114.0	116.0	115.0		597,240,576,504,552	-0.1	1.0	5		115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GRAMD3	NM_001146319.1,NM_001146320.1,NM_001146321.1,NM_001146322.1,NM_023927.2	,,,,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,,,	199/448,80/329,192/441,168/417,184/433	125813449	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	65983	exon6			GCCAAACGCCCTG	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.552C>T	5.37:g.125813449C>T		107.0	0.0	0		146.0	35.0	0.239726	NM_001146319	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Silent	SNP	ENST00000285689.3	37	CCDS4136.1																																																																																			.	.	weak		0.488	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	
CACNA1F	778	hgsc.bcm.edu	37	X	49061779	49061779	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:49061779C>T	ENST00000376265.2	-	48	5813	c.5752G>A	c.(5752-5754)Gtg>Atg	p.V1918M	SYP-AS1_ENST00000433499.1_RNA|CACNA1F_ENST00000376251.1_Missense_Mutation_p.V1853M|CACNA1F_ENST00000323022.5_Missense_Mutation_p.V1907M|AF196779.1_ENST00000583131.1_RNA	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1918					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCAGGGCCACGAAACGTGGG	0.597																																					p.V1918M		Atlas-SNP	.											.	CACNA1F	218	.	0			c.G5752A						PASS	.						65.0	39.0	47.0					X																	49061779		2203	4300	6503	SO:0001583	missense	778	exon48			GGGCCACGAAACG	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5752G>A	X.37:g.49061779C>T	ENSP00000365441:p.Val1918Met	137.0	0.0	0		137.0	65.0	0.474453	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	ENST00000376265.2	37	CCDS35253.1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297889	0.60086	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	T;T;T	0.60548	0.18;0.18;0.18	4.95	4.02	0.46733	.	0.000000	0.64402	D	0.000001	T	0.69052	0.3068	M	0.74467	2.265	0.48452	D	0.999656	D;D	0.76494	0.999;0.997	P;P	0.57057	0.812;0.654	T	0.74349	-0.3694	10	0.87932	D	0	.	12.3113	0.54929	0.1697:0.8303:0.0:0.0	.	1907;1918	F5CIQ9;O60840	.;CAC1F_HUMAN	M	1853;1907;1918	ENSP00000365427:V1853M;ENSP00000321618:V1907M;ENSP00000365441:V1918M	ENSP00000321618:V1907M	V	-	1	0	CACNA1F	48948723	0.999000	0.42202	0.915000	0.36163	0.519000	0.34347	3.722000	0.54948	2.178000	0.69098	0.529000	0.55759	GTG	.	.	none		0.597	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
PDGFB	5155	hgsc.bcm.edu	37	22	39627798	39627798	+	Silent	SNP	G	G	A	rs147036196		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:39627798G>A	ENST00000331163.6	-	4	1072	c.285C>T	c.(283-285)gcC>gcT	p.A95A	PDGFB_ENST00000381551.4_Silent_p.A80A	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	95					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)		COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					TCTTGCACTCGGCGATCATGG	0.647			T	COL1A1	DFSP								G|||	1	0.000199681	0.0008	0.0	5008	,	,		14561	0.0		0.0	False		,,,				2504	0.0				p.A95A		Atlas-SNP	.		Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	.	PDGFB	91	.	0			c.C285T						PASS	.	G	,	5,4401	11.4+/-27.6	0,5,2198	46.0	39.0	41.0		285,240	-4.0	1.0	22	dbSNP_134	41	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PDGFB	NM_002608.2,NM_033016.2	,	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	,	95/242,80/227	39627798	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	5155	exon4			GCACTCGGCGATC		CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.285C>T	22.37:g.39627798G>A		79.0	0.0	0		61.0	31.0	0.508197	NM_002608	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Silent	SNP	ENST00000331163.6	37	CCDS13987.1																																																																																			G|1.000;A|0.000	0.000	weak		0.647	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321043.1	NM_002608	
DUOX2	50506	hgsc.bcm.edu	37	15	45403769	45403769	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:45403769C>T	ENST00000603300.1	-	6	730	c.528G>A	c.(526-528)acG>acA	p.T176T	DUOXA2_ENST00000323030.5_5'Flank|DUOX2_ENST00000389039.6_Silent_p.T176T	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	176	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CCAGCCAGCCCGTCACCTGGT	0.781																																					p.T176T		Atlas-SNP	.											.	DUOX2	137	.	0			c.G528A						PASS	.						4.0	4.0	4.0					15																	45403769		1903	3798	5701	SO:0001819	synonymous_variant	50506	exon6			CCAGCCCGTCACC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.528G>A	15.37:g.45403769C>T		6.0	0.0	0		7.0	6.0	0.857143	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	ENST00000603300.1	37	CCDS10117.1																																																																																			.	.	none		0.781	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
MYCBP2	23077	hgsc.bcm.edu	37	13	77657173	77657173	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr13:77657173G>A	ENST00000544440.2	-	63	10933	c.10916C>T	c.(10915-10917)gCc>gTc	p.A3639V	MYCBP2_ENST00000407578.2_Missense_Mutation_p.A3677V|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS2_ENST00000428716.2_RNA|MYCBP2-AS1_ENST00000450627.2_RNA|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.A3639V					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTACCTCAGGGCCATTTGCTG	0.423																																					p.A3677V		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.C11030T						PASS	.						130.0	126.0	127.0					13																	77657173		2203	4300	6503	SO:0001583	missense	23077	exon63			CTCAGGGCCATTT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10916C>T	13.37:g.77657173G>A	ENSP00000444596:p.Ala3639Val	150.0	0.0	0		141.0	56.0	0.397163	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	37		.	.	.	.	.	.	.	.	.	.	G	27.0	4.795732	0.90453	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.69806	-0.43;-0.43;-0.43	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.79281	0.4419	L	0.55213	1.73	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.80879	-0.1185	10	0.87932	D	0	.	19.165	0.93553	0.0:0.0:1.0:0.0	.	3639	O75592	MYCB2_HUMAN	V	3639;3677;3639	ENSP00000349892:A3639V;ENSP00000384288:A3677V;ENSP00000444596:A3639V	ENSP00000349892:A3639V	A	-	2	0	MYCBP2	76555174	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	9.869000	0.99810	2.504000	0.84457	0.650000	0.86243	GCC	.	.	none		0.423	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
SPATA31A6	389730	hgsc.bcm.edu	37	9	43626815	43626815	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:43626815G>A	ENST00000332857.6	-	4	1900	c.1872C>T	c.(1870-1872)gaC>gaT	p.D624D	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	624					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTGGTGATTCGTCCCGAAGCT	0.547																																					p.D624D		Atlas-SNP	.											FAM75A6,NS,carcinoma,0,3	.	.	3	0			c.C1872T						scavenged	.																																			SO:0001819	synonymous_variant	389730	exon4			TGATTCGTCCCGA		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1872C>T	9.37:g.43626815G>A		46.0	1.0	0.0217391		41.0	4.0	0.097561	NM_001145196		Silent	SNP	ENST00000332857.6	37	CCDS47973.1																																																																																			A|1.000;|0.000	1.000	weak		0.547	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036987.1	NM_001145196	
PCDHB7	56129	hgsc.bcm.edu	37	5	140554429	140554429	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:140554429G>A	ENST00000231137.3	+	1	2187	c.2013G>A	c.(2011-2013)ctG>ctA	p.L671L	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	671	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCCCTACCTGCGGCTCCCGG	0.692																																					p.L671L		Atlas-SNP	.											.	PCDHB7	231	.	0			c.G2013A						PASS	.						49.0	78.0	69.0					5																	140554429		2170	4274	6444	SO:0001819	synonymous_variant	56129	exon1			CTACCTGCGGCTC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2013G>A	5.37:g.140554429G>A		73.0	0.0	0		37.0	19.0	0.513514	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			.	.	none		0.692	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PLET1	349633	hgsc.bcm.edu	37	11	112123070	112123070	+	Splice_Site	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:112123070C>T	ENST00000338832.2	-	3	719		c.e3+1			NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN							cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						AAGGAACTCACGTTTTTCTCT	0.463																																					.		Atlas-SNP	.											.	C11orf34	6	.	0			c.448+1G>A						PASS	.						153.0	131.0	138.0					11																	112123070		692	1591	2283	SO:0001630	splice_region_variant	349633	exon4			AACTCACGTTTTT																												ENST00000338832.2:c.448+1G>A	11.37:g.112123070C>T		56.0	0.0	0		84.0	33.0	0.392857	NM_001145024	Q6UQ24|Q6UQ25|Q6UQ27	Splice_Site	SNP	ENST00000338832.2	37		.	.	.	.	.	.	.	.	.	.	C	13.88	2.368899	0.42003	.	.	ENSG00000188771	ENST00000338832	.	.	.	3.77	3.77	0.43336	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4137	0.49939	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C11orf34	111628280	0.974000	0.33945	0.819000	0.32651	0.174000	0.22865	3.066000	0.50002	2.420000	0.82092	0.650000	0.86243	.	.	.	none		0.463	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			Intron
HECW2	57520	hgsc.bcm.edu	37	2	197298113	197298113	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:197298113A>G	ENST00000260983.3	-	2	217	c.35T>C	c.(34-36)gTg>gCg	p.V12A		NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	12					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TCGACGCCTCACAAAAAGCAG	0.547																																					p.V12A		Atlas-SNP	.											.	HECW2	239	.	0			c.T35C						PASS	.						63.0	58.0	60.0					2																	197298113		2203	4300	6503	SO:0001583	missense	57520	exon2			CGCCTCACAAAAA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.35T>C	2.37:g.197298113A>G	ENSP00000260983:p.Val12Ala	167.0	0.0	0		225.0	84.0	0.373333	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	A	7.043	0.563022	0.13498	.	.	ENSG00000138411	ENST00000260983;ENST00000452031;ENST00000427457	T	0.30714	1.52	5.27	5.27	0.74061	.	0.214433	0.39759	N	0.001275	T	0.26484	0.0647	L	0.51422	1.61	0.41396	D	0.987641	P	0.38767	0.646	B	0.35770	0.21	T	0.05435	-1.0885	10	0.13853	T	0.58	.	13.9092	0.63855	1.0:0.0:0.0:0.0	.	12	Q9P2P5	HECW2_HUMAN	A	12	ENSP00000260983:V12A	ENSP00000260983:V12A	V	-	2	0	HECW2	197006358	0.999000	0.42202	1.000000	0.80357	0.878000	0.50629	2.801000	0.47908	2.209000	0.71365	0.459000	0.35465	GTG	.	.	none		0.547	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
AIMP1	9255	hgsc.bcm.edu	37	4	107246152	107246152	+	5'UTR	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr4:107246152C>T	ENST00000442366.1	+	0	38				AIMP1_ENST00000358008.3_5'UTR|AIMP1_ENST00000394701.4_Missense_Mutation_p.R20C	NM_001142415.1	NP_001135887.1	Q12904	AIMP1_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 1						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|negative regulation of endothelial cell proliferation (GO:0001937)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|endometrium(2)|kidney(1)|lung(5)|skin(1)|urinary_tract(1)	11						GATTTTCTGCCGTCTCTTGGC	0.358																																					p.R20C		Atlas-SNP	.											.	AIMP1	20	.	0			c.C58T						PASS	.						42.0	41.0	41.0					4																	107246152		2202	4300	6502	SO:0001623	5_prime_UTR_variant	9255	exon2			TTCTGCCGTCTCT	U10117	CCDS3674.1, CCDS47121.1	4q24	2009-05-20	2009-05-20	2009-05-20	ENSG00000164022	ENSG00000164022			10648	protein-coding gene	gene with protein product	"""EMAP II"", ""ARS-interacting multifunctional protein 1"""	603605	"""small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)"""	SCYE1		7929199, 7545917	Standard	NM_004757		Approved	EMAPII, EMAP-2, p43	uc011cfg.2	Q12904	OTTHUMG00000131217	ENST00000442366.1:c.-15C>T	4.37:g.107246152C>T		349.0	0.0	0		295.0	69.0	0.233898	NM_001142416	B3KTR2|B4E1S7|Q6FG28|Q96CQ9	Missense_Mutation	SNP	ENST00000442366.1	37	CCDS3674.1	.	.	.	.	.	.	.	.	.	.	C	7.740	0.701160	0.15172	.	.	ENSG00000164022	ENST00000394701	T	0.26223	1.75	5.06	2.42	0.29668	.	0.253283	0.34268	U	0.004120	T	0.38401	0.1039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.11324	-1.0592	7	0.59425	D	0.04	-8.449	10.7435	0.46166	0.0:0.7985:0.0:0.2015	.	.	.	.	C	20	ENSP00000378191:R20C	ENSP00000378191:R20C	R	+	1	0	AIMP1	107465601	1.000000	0.71417	0.985000	0.45067	0.115000	0.19883	2.116000	0.41930	0.195000	0.20347	-0.964000	0.02622	CGT	.	.	none		0.358	AIMP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253961.1	NM_004757	
ZNF597	146434	hgsc.bcm.edu	37	16	3490834	3490834	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:3490834C>T	ENST00000301744.4	-	3	368	c.133G>A	c.(133-135)Gag>Aag	p.E45K	NAA60_ENST00000424546.2_5'Flank|NAA60_ENST00000608722.1_5'Flank|NAA60_ENST00000573580.1_5'Flank|NAA60_ENST00000407558.4_5'Flank	NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	45	KRAB.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TCCAAAGACTCTTTTGTACCA	0.463																																					p.E45K		Atlas-SNP	.											ZNF597,NS,carcinoma,0,1	ZNF597	41	1	0			c.G133A						scavenged	.						107.0	90.0	96.0					16																	3490834		2197	4300	6497	SO:0001583	missense	146434	exon3			AAGACTCTTTTGT	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.133G>A	16.37:g.3490834C>T	ENSP00000301744:p.Glu45Lys	65.0	0.0	0		70.0	3.0	0.0428571	NM_152457		Missense_Mutation	SNP	ENST00000301744.4	37	CCDS10505.1	.	.	.	.	.	.	.	.	.	.	C	5.452	0.268558	0.10349	.	.	ENSG00000167981	ENST00000301744	T	0.04234	3.67	4.07	3.12	0.35913	Krueppel-associated box (3);	0.418161	0.17752	N	0.163194	T	0.10337	0.0253	M	0.89095	3.005	0.09310	N	1	B	0.23937	0.094	B	0.24269	0.052	T	0.12426	-1.0548	10	0.87932	D	0	-5.0167	7.5987	0.28063	0.0:0.8832:0.0:0.1168	.	45	Q96LX8	ZN597_HUMAN	K	45	ENSP00000301744:E45K	ENSP00000301744:E45K	E	-	1	0	ZNF597	3430835	0.067000	0.21026	0.031000	0.17742	0.023000	0.10783	2.230000	0.42999	1.058000	0.40530	0.563000	0.77884	GAG	.	.	none		0.463	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251511.2	NM_152457	
SSX3	10214	hgsc.bcm.edu	37	X	48209473	48209473	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:48209473G>A	ENST00000298396.2	-	6	467	c.415C>T	c.(415-417)Ctg>Ttg	p.L139L	SSX3_ENST00000376893.3_Silent_p.L139L|SSX3_ENST00000376895.1_Silent_p.L51L	NM_021014.2	NP_066294.1	Q99909	SSX3_HUMAN	synovial sarcoma, X breakpoint 3	139					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(3)|large_intestine(1)|lung(9)	13						GGGGGGCACAGCTGTTTCCCA	0.488																																					p.L139L	Colon(37;227 826 19399 40970 48007)	Atlas-SNP	.											.	SSX3	64	.	0			c.C415T						PASS	.						251.0	230.0	237.0					X																	48209473		2203	4300	6503	SO:0001819	synonymous_variant	10214	exon6			GGCACAGCTGTTT	U90840	CCDS14291.1	Xp11.23	2009-06-17			ENSG00000165584	ENSG00000165584			11337	protein-coding gene	gene with protein product		300325				8697803, 9378559	Standard	NM_021014		Approved	CT5.3	uc004djd.1	Q99909	OTTHUMG00000021489	ENST00000298396.2:c.415C>T	X.37:g.48209473G>A		858.0	1.0	0.0011655		825.0	350.0	0.424242	NM_021014	O60223|Q5JQZ3|Q9BRW7	Silent	SNP	ENST00000298396.2	37	CCDS14291.1																																																																																			.	.	none		0.488	SSX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056486.1	NM_021014	
THG1L	54974	hgsc.bcm.edu	37	5	157161623	157161623	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:157161623C>G	ENST00000231198.7	+	3	652	c.408C>G	c.(406-408)agC>agG	p.S136R	AC026407.1_ENST00000599823.1_Missense_Mutation_p.A35P	NM_017872.3	NP_060342.2	Q9NWX6	THG1_HUMAN	tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)	136					protein homotetramerization (GO:0051289)|tRNA modification (GO:0006400)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|tRNA binding (GO:0000049)|tRNA guanylyltransferase activity (GO:0008193)			NS(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)	13	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTGCCTCCAGCTATGTGTTTT	0.458																																					p.S136R		Atlas-SNP	.											.	THG1L	31	.	0			c.C408G						PASS	.						160.0	158.0	158.0					5																	157161623		2203	4300	6503	SO:0001583	missense	54974	exon3			CTCCAGCTATGTG	AK223119	CCDS4341.1	5q33.3	2008-02-05			ENSG00000113272	ENSG00000113272			26053	protein-coding gene	gene with protein product	"""interphase cytoplasmic foci protein 45"""					11230166	Standard	XM_005265939		Approved	ICF45, FLJ11601, FLJ20546	uc003lxd.3	Q9NWX6	OTTHUMG00000130254	ENST00000231198.7:c.408C>G	5.37:g.157161623C>G	ENSP00000231198:p.Ser136Arg	203.0	0.0	0		209.0	82.0	0.392345	NM_017872	D3DQJ5|Q53G12|Q7L5R3|Q9H0S2	Missense_Mutation	SNP	ENST00000231198.7	37	CCDS4341.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940943	0.52972	.	.	ENSG00000113272	ENST00000231198;ENST00000448153	T	0.46063	0.88	5.95	3.8	0.43715	.	0.203335	0.64402	N	0.000017	T	0.54549	0.1865	M	0.83483	2.645	0.58432	D	0.999995	D	0.60160	0.987	P	0.57468	0.821	T	0.53851	-0.8380	10	0.21540	T	0.41	-19.4724	6.4975	0.22150	0.1369:0.669:0.0:0.1941	.	136	Q9NWX6	THG1_HUMAN	R	136;11	ENSP00000231198:S136R	ENSP00000231198:S136R	S	+	3	2	THG1L	157094201	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	0.323000	0.19593	0.583000	0.29574	0.650000	0.86243	AGC	.	.	none		0.458	THG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252579.2	NM_017872	
MED26	9441	hgsc.bcm.edu	37	19	16687806	16687806	+	Missense_Mutation	SNP	G	G	A	rs201182566		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:16687806G>A	ENST00000263390.3	-	3	1097	c.835C>T	c.(835-837)Cgg>Tgg	p.R279W	CTD-3222D19.2_ENST00000409035.1_Missense_Mutation_p.R287W|CTC-429P9.4_ENST00000593962.1_5'Flank	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	279	Pro-rich.				gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						CCCTCATGCCGTGAGTTCCGA	0.662																																					p.R279W		Atlas-SNP	.											MED26,colon,carcinoma,+1,1	MED26	25	1	0			c.C835T						PASS	.						31.0	33.0	32.0					19																	16687806		2203	4300	6503	SO:0001583	missense	9441	exon3			CATGCCGTGAGTT	AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.835C>T	19.37:g.16687806G>A	ENSP00000263390:p.Arg279Trp	131.0	0.0	0		103.0	18.0	0.174757	NM_004831	A1A4S3|Q0VGB6	Missense_Mutation	SNP	ENST00000263390.3	37	CCDS12347.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475948	0.44044	.	.	ENSG00000105085	ENST00000263390	.	.	.	4.74	3.61	0.41365	.	0.198170	0.41294	D	0.000907	T	0.63331	0.2502	L	0.57536	1.79	0.29237	N	0.87285	D	0.89917	1.0	D	0.87578	0.998	T	0.60801	-0.7191	9	0.72032	D	0.01	-30.7651	13.7896	0.63131	0.0:0.0:0.803:0.197	.	279	O95402	MED26_HUMAN	W	279	.	ENSP00000263390:R279W	R	-	1	2	MED26	16548806	1.000000	0.71417	1.000000	0.80357	0.129000	0.20672	2.921000	0.48852	2.194000	0.70268	0.555000	0.69702	CGG	G|0.999;A|0.001	0.001	weak		0.662	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461178.1	NM_004831	
PRG4	10216	hgsc.bcm.edu	37	1	186276981	186276981	+	Silent	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:186276981A>G	ENST00000445192.2	+	7	2175	c.2130A>G	c.(2128-2130)aaA>aaG	p.K710K	PRG4_ENST00000367485.4_Silent_p.K617K|PRG4_ENST00000367483.4_Silent_p.K669K|PRG4_ENST00000367486.3_Silent_p.K667K|PRG4_ENST00000367484.3_Intron	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	710	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTACCCCTAAAGGGACTGCTC	0.582																																					p.K710K		Atlas-SNP	.											PRG4,NS,carcinoma,0,6	PRG4	259	6	0			c.A2130G						scavenged	.						162.0	175.0	171.0					1																	186276981		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			CCCTAAAGGGACT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2130A>G	1.37:g.186276981A>G		179.0	2.0	0.0111732		198.0	10.0	0.050505	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																			.	.	none		0.582	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
BUB1B	701	hgsc.bcm.edu	37	15	40453452	40453452	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:40453452C>T	ENST00000287598.6	+	1	226	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	BUB1B_ENST00000412359.3_Silent_p.L11L|BUB1B_ENST00000560120.1_3'UTR	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	11					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		AGGGGGTGCTCTGAGGTAGGT	0.637			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																												p.L11L		Atlas-SNP	.	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	.	BUB1B	71	.	0			c.C31T						PASS	.						66.0	54.0	58.0					15																	40453452		2202	4298	6500	SO:0001819	synonymous_variant	701	exon1	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	GGTGCTCTGAGGT	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.31C>T	15.37:g.40453452C>T		91.0	0.0	0		78.0	17.0	0.217949	NM_001211	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Silent	SNP	ENST00000287598.6	37	CCDS10053.1																																																																																			.	.	none		0.637	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252122.4		
FLG2	388698	hgsc.bcm.edu	37	1	152325925	152325925	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:152325925G>A	ENST00000388718.5	-	3	4409	c.4337C>T	c.(4336-4338)aCt>aTt	p.T1446I	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1446					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGGCCATGAGTTTGTTCTTG	0.527																																					p.T1446I		Atlas-SNP	.											.	FLG2	431	.	0			c.C4337T						PASS	.						366.0	329.0	341.0					1																	152325925		2203	4300	6503	SO:0001583	missense	388698	exon3			CCATGAGTTTGTT	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4337C>T	1.37:g.152325925G>A	ENSP00000373370:p.Thr1446Ile	307.0	0.0	0		314.0	149.0	0.474522	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	37	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	G	4.655	0.121725	0.08931	.	.	ENSG00000143520	ENST00000388718	T	0.40476	1.03	3.22	-6.43	0.01926	.	.	.	.	.	T	0.11965	0.0291	M	0.68593	2.085	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13229	-1.0517	9	0.52906	T	0.07	3.444	0.1468	0.00089	0.2725:0.2261:0.1625:0.3389	.	1446	Q5D862	FILA2_HUMAN	I	1446	ENSP00000373370:T1446I	ENSP00000373370:T1446I	T	-	2	0	FLG2	150592549	0.029000	0.19370	0.000000	0.03702	0.001000	0.01503	-0.043000	0.12043	-2.658000	0.00420	-0.913000	0.02753	ACT	.	.	none		0.527	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
MED26	9441	hgsc.bcm.edu	37	19	16687805	16687805	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:16687805C>A	ENST00000263390.3	-	3	1098	c.836G>T	c.(835-837)cGg>cTg	p.R279L	CTD-3222D19.2_ENST00000409035.1_Missense_Mutation_p.R287L|CTC-429P9.4_ENST00000593962.1_5'Flank	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	279	Pro-rich.				gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						GCCCTCATGCCGTGAGTTCCG	0.667																																					p.R279L		Atlas-SNP	.											MED26,colon,carcinoma,0,1	MED26	25	1	0			c.G836T						PASS	.						30.0	32.0	32.0					19																	16687805		2203	4299	6502	SO:0001583	missense	9441	exon3			TCATGCCGTGAGT	AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.836G>T	19.37:g.16687805C>A	ENSP00000263390:p.Arg279Leu	129.0	0.0	0		102.0	17.0	0.166667	NM_004831	A1A4S3|Q0VGB6	Missense_Mutation	SNP	ENST00000263390.3	37	CCDS12347.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349489	0.41599	.	.	ENSG00000105085	ENST00000263390	.	.	.	4.74	3.69	0.42338	.	0.198170	0.41294	D	0.000907	T	0.61652	0.2364	L	0.57536	1.79	0.30471	N	0.773314	D	0.76494	0.999	D	0.79784	0.993	T	0.61797	-0.6989	9	0.28530	T	0.3	-30.7651	13.3549	0.60623	0.1589:0.8411:0.0:0.0	.	279	O95402	MED26_HUMAN	L	279	.	ENSP00000263390:R279L	R	-	2	0	MED26	16548805	1.000000	0.71417	0.997000	0.53966	0.076000	0.17211	4.328000	0.59253	0.977000	0.38444	-0.324000	0.08512	CGG	.	.	none		0.667	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461178.1	NM_004831	
P2RY8	286530	hgsc.bcm.edu	37	X	1584574	1584574	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:1584574T>A	ENST00000381297.4	-	2	1088	c.878A>T	c.(877-879)tAt>tTt	p.Y293F	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGCAAAGTAATAAACAAACGG	0.592			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.Y293F		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.A878T						PASS	.						110.0	110.0	110.0					X																	1584574		2203	4296	6499	SO:0001583	missense	286530	exon2			AAGTAATAAACAA	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.878A>T	X.37:g.1584574T>A	ENSP00000370697:p.Tyr293Phe	180.0	0.0	0		120.0	74.0	0.616667	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	t	14.85	2.658567	0.47467	.	.	ENSG00000182162	ENST00000381297	D	0.92911	-3.13	2.73	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000003	D	0.94288	0.8165	M	0.64260	1.97	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	D	0.87643	0.2523	10	0.87932	D	0	.	10.6579	0.45686	0.0:0.0:0.0:1.0	.	293	Q86VZ1	P2RY8_HUMAN	F	293	ENSP00000370697:Y293F	ENSP00000370697:Y293F	Y	-	2	0	P2RY8	1544574	1.000000	0.71417	0.971000	0.41717	0.141000	0.21300	6.181000	0.71988	0.823000	0.34589	0.230000	0.17803	TAT	.	.	none		0.592	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
TNRC6B	23112	hgsc.bcm.edu	37	22	40661027	40661027	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:40661027G>T	ENST00000454349.2	+	5	1004	c.793G>T	c.(793-795)Gct>Tct	p.A265S	TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.A265S	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	265	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						TGACCCTAAGGCTAAATCTGT	0.468																																					p.A265S		Atlas-SNP	.											.	TNRC6B	195	.	0			c.G793T						PASS	.						109.0	105.0	107.0					22																	40661027		1899	4123	6022	SO:0001583	missense	23112	exon5			CCTAAGGCTAAAT	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.793G>T	22.37:g.40661027G>T	ENSP00000401946:p.Ala265Ser	65.0	0.0	0		71.0	37.0	0.521127	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.104|8.104	0.777317|0.777317	0.16120|0.16120	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727|ENST00000446273	T;T|.	0.51574|.	0.7;0.7|.	4.93|4.93	3.77|3.77	0.43336|0.43336	.|.	0.324254|.	0.32769|.	N|.	0.005673|.	T|T	0.30008|0.30008	0.0751|0.0751	N|N	0.16903|0.16903	0.455|0.455	0.31485|0.31485	N|N	0.666686|0.666686	B;B;B|.	0.22683|.	0.044;0.005;0.073|.	B;B;B|.	0.21917|.	0.036;0.01;0.037|.	T|T	0.30822|0.30822	-0.9965|-0.9965	10|5	0.08179|.	T|.	0.78|.	-0.1419|-0.1419	10.9081|10.9081	0.47092|0.47092	0.1037:0.0:0.8963:0.0|0.1037:0.0:0.8963:0.0	.|.	265;265;265|.	Q9UPQ9;A8MYY3;Q9UPQ9-1|.	TNR6B_HUMAN;.;.|.	S|S	265|7	ENSP00000401946:A265S;ENSP00000338371:A265S|.	ENSP00000338371:A265S|.	A|R	+|+	1|3	0|2	TNRC6B|TNRC6B	38990973|38990973	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.482000|1.482000	0.35486|0.35486	0.801000|0.801000	0.34066|0.34066	0.650000|0.650000	0.86243|0.86243	GCT|AGG	.	.	none		0.468	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
PKHD1L1	93035	hgsc.bcm.edu	37	8	110495331	110495331	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:110495331G>T	ENST00000378402.5	+	57	9677	c.9573G>T	c.(9571-9573)tgG>tgT	p.W3191C		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3191					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTGTGGATTGGCAGGTAGACA	0.368										HNSCC(38;0.096)																											p.W3191C		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.G9573T						PASS	.						75.0	71.0	72.0					8																	110495331		1863	4096	5959	SO:0001583	missense	93035	exon57			GGATTGGCAGGTA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9573G>T	8.37:g.110495331G>T	ENSP00000367655:p.Trp3191Cys	83.0	0.0	0		103.0	32.0	0.31068	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129890	0.77549	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85339	-1.97;-1.97	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.94660	0.8278	H	0.94847	3.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95742	0.8784	10	0.87932	D	0	.	17.1705	0.86828	0.0:0.0:1.0:0.0	.	3191	Q86WI1	PKHL1_HUMAN	C	3191;119	ENSP00000367655:W3191C;ENSP00000437376:W119C	ENSP00000367655:W3191C	W	+	3	0	PKHD1L1	110564507	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.552000	0.82192	2.654000	0.90174	0.585000	0.79938	TGG	.	.	none		0.368	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
DNAJC13	23317	hgsc.bcm.edu	37	3	132245067	132245067	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:132245067T>C	ENST00000260818.6	+	53	6571	c.6323T>C	c.(6322-6324)cTa>cCa	p.L2108P		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	2108					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						ACTGTTGGTCTAGCCTGTGAA	0.413																																					p.L2108P		Atlas-SNP	.											.	DNAJC13	253	.	0			c.T6323C						PASS	.						118.0	112.0	114.0					3																	132245067		2203	4300	6503	SO:0001583	missense	23317	exon53			TTGGTCTAGCCTG	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.6323T>C	3.37:g.132245067T>C	ENSP00000260818:p.Leu2108Pro	98.0	0.0	0		94.0	5.0	0.0531915	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	ENST00000260818.6	37	CCDS33857.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.886801	0.51908	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.50548	0.74	5.58	5.58	0.84498	Armadillo-like helical (1);Armadillo-type fold (1);	0.233516	0.36482	N	0.002575	T	0.49847	0.1581	M	0.76838	2.35	0.80722	D	1	P	0.39131	0.661	B	0.33521	0.165	T	0.57487	-0.7803	10	0.52906	T	0.07	.	16.0439	0.80704	0.0:0.0:0.0:1.0	.	2108	O75165	DJC13_HUMAN	P	2108;755	ENSP00000260818:L2108P	ENSP00000260818:L2108P	L	+	2	0	DNAJC13	133727757	1.000000	0.71417	0.979000	0.43373	0.989000	0.77384	7.864000	0.87037	2.250000	0.74265	0.482000	0.46254	CTA	.	.	none		0.413	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
FAT1	2195	hgsc.bcm.edu	37	4	187629904	187629904	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr4:187629904A>C	ENST00000441802.2	-	2	1287	c.1078T>G	c.(1078-1080)Ttc>Gtc	p.F360V		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	360					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CCGGCTTTGAACTGTGGAGAA	0.458										HNSCC(5;0.00058)																											p.F360V	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.T1078G						PASS	.						121.0	114.0	116.0					4																	187629904		1864	4103	5967	SO:0001583	missense	2195	exon2			CTTTGAACTGTGG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1078T>G	4.37:g.187629904A>C	ENSP00000406229:p.Phe360Val	89.0	0.0	0		88.0	19.0	0.215909	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	37	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	A	9.719	1.159141	0.21454	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	T;T	0.69306	-0.39;0.54	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.50034	0.1592	N	0.17278	0.47	0.80722	D	1	P	0.43431	0.807	B	0.40940	0.344	T	0.49051	-0.8979	10	0.11485	T	0.65	.	15.4097	0.74908	1.0:0.0:0.0:0.0	.	360	Q14517	FAT1_HUMAN	V	360	ENSP00000406229:F360V;ENSP00000423736:F360V	ENSP00000260147:F360V	F	-	1	0	FAT1	187866898	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	5.956000	0.70315	2.229000	0.72834	0.482000	0.46254	TTC	.	.	none		0.458	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
HSPA2	3306	hgsc.bcm.edu	37	14	65008064	65008064	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr14:65008064C>T	ENST00000394709.1	+	2	573	c.497C>T	c.(496-498)aCg>aTg	p.T166M	HSPA2_ENST00000554883.1_3'UTR|RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.T166M			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	166					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)	p.T166M(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		GGCACCATCACGGGGCTCAAT	0.662																																					p.T166M	Pancreas(136;1211 1835 24894 31984 38227)	Atlas-SNP	.											HSPA2,NS,carcinoma,0,2	HSPA2	83	2	1	Substitution - Missense(1)	endometrium(1)	c.C497T						PASS	.						51.0	52.0	52.0					14																	65008064		2203	4300	6503	SO:0001583	missense	3306	exon1			CCATCACGGGGCT	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.497C>T	14.37:g.65008064C>T	ENSP00000378199:p.Thr166Met	87.0	0.0	0		81.0	39.0	0.481481	NM_021979	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	ENST00000394709.1	37	CCDS9766.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.772333	0.69992	.	.	ENSG00000126803	ENST00000394709;ENST00000247207	T;T	0.01015	5.44;5.44	5.18	5.18	0.71444	.	0.112431	0.38605	U	0.001623	T	0.01905	0.0060	N	0.08118	0	0.39563	D	0.969168	D	0.71674	0.998	P	0.62014	0.897	T	0.75505	-0.3294	10	0.87932	D	0	-7.4702	18.6851	0.91560	0.0:1.0:0.0:0.0	.	166	P54652	HSP72_HUMAN	M	166	ENSP00000378199:T166M;ENSP00000247207:T166M	ENSP00000247207:T166M	T	+	2	0	HSPA2	64077817	1.000000	0.71417	0.993000	0.49108	0.983000	0.72400	7.818000	0.86416	2.407000	0.81776	0.563000	0.77884	ACG	.	.	none		0.662	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280651.1		
NFKB2	4791	hgsc.bcm.edu	37	10	104160764	104160764	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:104160764G>A	ENST00000369966.3	+	18	2279	c.2029G>A	c.(2029-2031)Gga>Aga	p.G677R	NFKB2_ENST00000189444.6_Missense_Mutation_p.G677R|NFKB2_ENST00000428099.1_Missense_Mutation_p.G677R	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	677			Missing (in truncated form EB308).|Missing (in truncated form p80HT).		extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCTGGCAGCTGGACTGGGGTA	0.647			T	IGH@	B-NHL																																p.G677R		Atlas-SNP	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48	.	0			c.G2029A						PASS	.						33.0	41.0	39.0					10																	104160764		2063	4206	6269	SO:0001583	missense	4791	exon18			GCAGCTGGACTGG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.2029G>A	10.37:g.104160764G>A	ENSP00000358983:p.Gly677Arg	96.0	0.0	0		112.0	54.0	0.482143	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	g	20.4	3.990200	0.74589	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.61742	0.08;0.08;0.08	4.48	4.48	0.54585	Ankyrin repeat-containing domain (4);	0.109105	0.64402	D	0.000009	T	0.53562	0.1804	N	0.04724	-0.175	0.32550	N	0.532449	D;D	0.76494	0.999;0.999	D;D	0.75484	0.986;0.986	T	0.63377	-0.6651	10	0.52906	T	0.07	.	11.0484	0.47872	0.0869:0.0:0.9131:0.0	.	677;677	Q00653;A8K9D9	NFKB2_HUMAN;.	R	677	ENSP00000410256:G677R;ENSP00000358983:G677R;ENSP00000189444:G677R	ENSP00000189444:G677R	G	+	1	0	NFKB2	104150754	1.000000	0.71417	1.000000	0.80357	0.721000	0.41392	4.183000	0.58317	2.526000	0.85167	0.531000	0.56144	GGA	.	.	none		0.647	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056488	26056488	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:26056488C>T	ENST00000343677.2	-	1	211	c.169G>A	c.(169-171)Gtt>Att	p.V57I		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	57	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						GCCAGAGAAACTCCGCTACGC	0.572																																					p.V57I		Atlas-SNP	.											.	HIST1H1C	80	.	0			c.G169A						PASS	.						74.0	83.0	80.0					6																	26056488		2203	4300	6503	SO:0001583	missense	3006	exon1			GAGAAACTCCGCT	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.169G>A	6.37:g.26056488C>T	ENSP00000339566:p.Val57Ile	136.0	0.0	0		144.0	61.0	0.423611	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681630	0.47991	.	.	ENSG00000187837	ENST00000343677	T	0.21932	1.98	5.73	5.73	0.89815	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.135447	0.48286	D	0.000194	T	0.25195	0.0612	M	0.87682	2.9	0.58432	D	0.999992	B	0.32968	0.392	B	0.37989	0.262	T	0.02477	-1.1153	10	0.42905	T	0.14	-28.79	15.5188	0.75846	0.0:0.8523:0.1477:0.0	.	57	P16403	H12_HUMAN	I	57	ENSP00000339566:V57I	ENSP00000339566:V57I	V	-	1	0	HIST1H1C	26164467	0.879000	0.30193	0.960000	0.40013	0.011000	0.07611	1.731000	0.38135	2.861000	0.98227	0.655000	0.94253	GTT	.	.	none		0.572	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
GLIS1	148979	hgsc.bcm.edu	37	1	53980302	53980302	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:53980302C>T	ENST00000312233.2	-	7	1920	c.1354G>A	c.(1354-1356)Gat>Aat	p.D452N		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						ACATACCCATCCCGGGTGCTC	0.647																																					p.D452N		Atlas-SNP	.											.	GLIS1	52	.	0			c.G1354A						PASS	.						76.0	78.0	77.0					1																	53980302		2203	4300	6503	SO:0001583	missense	148979	exon7			ACCCATCCCGGGT	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1354G>A	1.37:g.53980302C>T	ENSP00000309653:p.Asp452Asn	143.0	0.0	0		161.0	29.0	0.180124	NM_147193		Missense_Mutation	SNP	ENST00000312233.2	37	CCDS582.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.237047	0.79800	.	.	ENSG00000174332	ENST00000312233	T	0.10573	2.86	4.97	4.97	0.65823	.	0.106321	0.41097	D	0.000949	T	0.13798	0.0334	L	0.29908	0.895	0.38952	D	0.958378	P	0.52842	0.956	P	0.50082	0.63	T	0.10132	-1.0643	10	0.23891	T	0.37	.	16.8949	0.86097	0.0:1.0:0.0:0.0	.	452	Q8NBF1	GLIS1_HUMAN	N	452	ENSP00000309653:D452N	ENSP00000309653:D452N	D	-	1	0	GLIS1	53752890	1.000000	0.71417	1.000000	0.80357	0.646000	0.38490	3.887000	0.56197	2.688000	0.91661	0.563000	0.77884	GAT	.	.	none		0.647	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
PIGP	51227	hgsc.bcm.edu	37	21	38437947	38437947	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr21:38437947T>A	ENST00000464265.1	-	4	635	c.412A>T	c.(412-414)Att>Ttt	p.I138F	PIGP_ENST00000399098.1_Missense_Mutation_p.I88F|PIGP_ENST00000329667.3_5'UTR|PIGP_ENST00000399103.1_Missense_Mutation_p.I114F|PIGP_ENST00000360525.4_Missense_Mutation_p.I114F|PIGP_ENST00000399102.1_Missense_Mutation_p.I114F	NM_153681.2	NP_710148.1	P57054	PIGP_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class P	138					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			kidney(1)|urinary_tract(1)	2		Myeloproliferative disorder(46;0.0412)				CTAATAGAAATATCTCTTAAG	0.358																																					p.I138F		Atlas-SNP	.											.	PIGP	9	.	0			c.A412T						PASS	.						143.0	139.0	140.0					21																	38437947		2203	4300	6503	SO:0001583	missense	51227	exon4			TAGAAATATCTCT	AB037162	CCDS13649.1, CCDS13650.1	21q22.2	2013-02-26	2006-06-28	2005-11-10	ENSG00000185808	ENSG00000185808	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	3046	protein-coding gene	gene with protein product	"""phosphatidylinositol-n-acetylglucosaminyltranferase subunit"""	605938	"""Down syndrome critical region gene 5"", ""phosphatidylinositol glycan, class P"""	DSCR5		10814524, 15221505	Standard	NR_028352		Approved	DCRC, DSRC	uc002yvw.1	P57054	OTTHUMG00000086653	ENST00000464265.1:c.412A>T	21.37:g.38437947T>A	ENSP00000420037:p.Ile138Phe	143.0	0.0	0		191.0	45.0	0.235602	NM_153681	B2RB18|B2RE99|B5BU92|D3DSG7|J3KR75|Q53Y28|Q96KI1|Q9NZA6	Missense_Mutation	SNP	ENST00000464265.1	37	CCDS13649.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000227	0.74818	.	.	ENSG00000185808	ENST00000464265;ENST00000360525;ENST00000399102;ENST00000399103;ENST00000399098	T;T;T;T;T	0.36340	1.26;1.26;1.26;1.26;1.26	5.52	3.01	0.34805	PIG-P (1);	0.107627	0.64402	D	0.000007	T	0.53578	0.1805	M	0.84683	2.71	0.39299	D	0.964862	P	0.49253	0.921	P	0.54210	0.745	T	0.59337	-0.7473	10	0.72032	D	0.01	-8.0575	10.1016	0.42509	0.0:0.1415:0.0:0.8585	.	138	P57054	PIGP_HUMAN	F	138;114;114;114;88	ENSP00000420037:I138F;ENSP00000353719:I114F;ENSP00000382053:I114F;ENSP00000382054:I114F;ENSP00000382049:I88F	ENSP00000353719:I114F	I	-	1	0	PIGP	37359817	0.997000	0.39634	0.999000	0.59377	0.996000	0.88848	1.091000	0.30915	0.323000	0.23307	0.533000	0.62120	ATT	.	.	none		0.358	PIGP-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194769.2	NM_153681	
PRMT8	56341	hgsc.bcm.edu	37	12	3692249	3692249	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:3692249C>T	ENST00000382622.3	+	8	1244	c.854C>T	c.(853-855)aCg>aTg	p.T285M	PRMT8_ENST00000261252.4_Intron|PRMT8_ENST00000452611.2_Missense_Mutation_p.T276M	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	285	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			ACAGTGAAGACGGAAGAGCTA	0.517																																					p.T285M		Atlas-SNP	.											PRMT8,NS,carcinoma,-1,3	PRMT8	97	3	0			c.C854T						PASS	.						128.0	104.0	112.0					12																	3692249		2203	4300	6503	SO:0001583	missense	56341	exon8			TGAAGACGGAAGA	AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.854C>T	12.37:g.3692249C>T	ENSP00000372067:p.Thr285Met	85.0	0.0	0		102.0	22.0	0.215686	NM_019854	B2RDP0|Q8TBJ8	Missense_Mutation	SNP	ENST00000382622.3	37	CCDS8521.2	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530304	0.27387	.	.	ENSG00000111218	ENST00000452611;ENST00000382622	T;T	0.78707	-1.2;-1.2	5.4	3.57	0.40892	.	0.202156	0.52532	D	0.000070	T	0.70193	0.3196	L	0.54323	1.7	0.37506	D	0.91696	P;P	0.42649	0.786;0.68	B;B	0.39027	0.288;0.15	T	0.73588	-0.3935	10	0.46703	T	0.11	.	9.2713	0.37673	0.0:0.8267:0.0:0.1733	.	276;285	Q9NR22-2;Q9NR22	.;ANM8_HUMAN	M	276;285	ENSP00000414507:T276M;ENSP00000372067:T285M	ENSP00000372067:T285M	T	+	2	0	PRMT8	3562510	0.988000	0.35896	1.000000	0.80357	0.093000	0.18481	2.678000	0.46900	1.298000	0.44778	-0.142000	0.14014	ACG	.	.	none		0.517	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250297.2	NM_019854	
SYT7	9066	hgsc.bcm.edu	37	11	61291310	61291310	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:61291310C>T	ENST00000263846.4	-	7	1223	c.896G>A	c.(895-897)gGg>gAg	p.G299E	SYT7_ENST00000540677.1_Missense_Mutation_p.G374E|SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000542670.1_Missense_Mutation_p.G507E|SYT7_ENST00000542836.1_Missense_Mutation_p.G343E|SYT7_ENST00000535826.1_Missense_Mutation_p.G418E|SYT7_ENST00000539008.1_Missense_Mutation_p.G582E	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	299	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGATGTGCCCCCGATGTCCAT	0.597																																					p.G374E		Atlas-SNP	.											.	SYT7	39	.	0			c.G1121A						PASS	.						289.0	275.0	280.0					11																	61291310		2202	4299	6501	SO:0001583	missense	9066	exon8			GTGCCCCCGATGT	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.896G>A	11.37:g.61291310C>T	ENSP00000263846:p.Gly299Glu	224.0	0.0	0		192.0	41.0	0.213542	NM_001252065	F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	37	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233456	0.79688	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826	T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	4.48	4.48	0.54585	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.73892	0.3645	L	0.43701	1.375	0.80722	D	1	P;D	0.53151	0.948;0.958	P;P	0.59171	0.689;0.853	T	0.77702	-0.2489	10	0.72032	D	0.01	.	17.5306	0.87813	0.0:1.0:0.0:0.0	.	374;299	F5GZU9;O43581	.;SYT7_HUMAN	E	299;374;582;343;507;418	ENSP00000263846:G299E;ENSP00000444201:G374E;ENSP00000439694:G582E;ENSP00000444568:G343E;ENSP00000444019:G507E;ENSP00000437720:G418E	ENSP00000263846:G299E	G	-	2	0	SYT7	61047886	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.190000	0.50973	2.192000	0.70111	0.462000	0.41574	GGG	.	.	none		0.597	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
CUL4A	8451	hgsc.bcm.edu	37	13	113909104	113909104	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr13:113909104C>T	ENST00000375440.4	+	17	1934	c.1850C>T	c.(1849-1851)aCg>aTg	p.T617M	CUL4A_ENST00000451881.1_Missense_Mutation_p.T517M|CUL4A_ENST00000326335.4_Missense_Mutation_p.T517M|CUL4A_ENST00000375441.3_Missense_Mutation_p.T517M	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	617					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			AAAATGGCCACGGGGATAGGT	0.453																																					p.T617M		Atlas-SNP	.											CUL4A,NS,carcinoma,0,1	CUL4A	50	1	0			c.C1850T						scavenged	.						98.0	95.0	96.0					13																	113909104		2203	4300	6503	SO:0001583	missense	8451	exon17			TGGCCACGGGGAT	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1850C>T	13.37:g.113909104C>T	ENSP00000364589:p.Thr617Met	91.0	1.0	0.010989		70.0	17.0	0.242857	NM_001008895	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605273	0.66445	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.3	5.3	0.74995	Cullin, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (2);	0.000000	0.85682	D	0.000000	D	0.91730	0.7385	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.93689	0.7005	10	0.87932	D	0	-30.3978	19.3097	0.94182	0.0:1.0:0.0:0.0	.	617;617	Q13619;A8MSH7	CUL4A_HUMAN;.	M	517;517;517;617	ENSP00000364590:T517M;ENSP00000389118:T517M;ENSP00000322132:T517M;ENSP00000364589:T617M	ENSP00000322132:T517M	T	+	2	0	CUL4A	112957105	1.000000	0.71417	0.952000	0.39060	0.144000	0.21451	5.880000	0.69698	2.627000	0.88993	0.561000	0.74099	ACG	.	.	none		0.453	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
PPP2R2B	5521	hgsc.bcm.edu	37	5	145969730	145969730	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:145969730C>T	ENST00000394413.3	-	9	1682	c.1112G>A	c.(1111-1113)cGt>cAt	p.R371H	PPP2R2B_ENST00000453001.1_Missense_Mutation_p.R371H|PPP2R2B_ENST00000504198.1_Missense_Mutation_p.R377H|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.R429H|PPP2R2B_ENST00000394410.2_Missense_Mutation_p.R360H|CTB-99A3.1_ENST00000512730.1_RNA|PPP2R2B_ENST00000508545.2_Missense_Mutation_p.R360H|PPP2R2B_ENST00000394414.1_Missense_Mutation_p.R437H|PPP2R2B_ENST00000336640.6_Missense_Mutation_p.R374H|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000356826.3_Missense_Mutation_p.R371H|PPP2R2B_ENST00000394411.4_Missense_Mutation_p.R371H			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	371					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTCACATCACGCTTGGTGTT	0.512																																					p.R477H		Atlas-SNP	.											PPP2R2B_ENST00000508545,NS,haematopoietic_neoplasm,-1,4	PPP2R2B	271	4	0			c.G1430A						PASS	.						85.0	79.0	81.0					5																	145969730		2203	4300	6503	SO:0001583	missense	5521	exon10			ACATCACGCTTGG	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.1112G>A	5.37:g.145969730C>T	ENSP00000377935:p.Arg371His	117.0	0.0	0		142.0	47.0	0.330986	NM_181675	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	ENST00000394413.3	37	CCDS4284.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.607021	0.66558	.	.	ENSG00000156475	ENST00000394413;ENST00000508545;ENST00000394414;ENST00000394411;ENST00000356826;ENST00000453001;ENST00000394410;ENST00000336640;ENST00000504198;ENST00000394409	T;T;T;T;T;T;T;T;T;T	0.74315	-0.83;-0.83;1.47;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;1.47	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.115539	0.64402	D	0.000011	T	0.73249	0.3563	L	0.58669	1.825	0.80722	D	1	B;B;B;B;B;B	0.19445	0.036;0.011;0.011;0.022;0.024;0.02	B;B;B;B;B;B	0.15870	0.008;0.005;0.005;0.014;0.005;0.009	T	0.69803	-0.5046	10	0.54805	T	0.06	-2.5928	19.1301	0.93402	0.0:1.0:0.0:0.0	.	429;377;360;437;374;371	Q00005-4;Q00005-3;G3V149;Q00005-5;Q00005-2;Q00005	.;.;.;.;.;2ABB_HUMAN	H	371;360;437;371;371;371;360;374;377;429	ENSP00000377935:R371H;ENSP00000431320:R360H;ENSP00000377936:R437H;ENSP00000377933:R371H;ENSP00000349283:R371H;ENSP00000398779:R371H;ENSP00000377932:R360H;ENSP00000336591:R374H;ENSP00000421396:R377H;ENSP00000377931:R429H	ENSP00000336591:R374H	R	-	2	0	AC011357.1	145949923	1.000000	0.71417	0.973000	0.42090	0.973000	0.67179	4.465000	0.60141	2.767000	0.95098	0.655000	0.94253	CGT	.	.	none		0.512	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251893.2	NM_181678	
PTH2R	5746	hgsc.bcm.edu	37	2	209358138	209358138	+	Silent	SNP	A	A	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:209358138A>C	ENST00000272847.2	+	13	1620	c.1407A>C	c.(1405-1407)acA>acC	p.T469T	AC019185.4_ENST00000424628.1_RNA|PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	469					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	CGGCCAGCACACGCATGGTGC	0.592																																					p.T469T		Atlas-SNP	.											.	PTH2R	92	.	0			c.A1407C						PASS	.						44.0	36.0	39.0					2																	209358138		2203	4300	6503	SO:0001819	synonymous_variant	5746	exon13			CAGCACACGCATG	BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.1407A>C	2.37:g.209358138A>C		154.0	0.0	0		165.0	26.0	0.157576	NM_005048	Q8N429	Silent	SNP	ENST00000272847.2	37	CCDS2383.1																																																																																			.	.	none		0.592	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256519.2	NM_005048	
ABCA13	154664	hgsc.bcm.edu	37	7	48314897	48314897	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:48314897C>T	ENST00000435803.1	+	17	5658	c.5634C>T	c.(5632-5634)tcC>tcT	p.S1878S		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1878					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATGAAAGCTCCCGAATGGAAA	0.408																																					p.S1878S		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C5634T						PASS	.						60.0	61.0	61.0					7																	48314897		1824	4073	5897	SO:0001819	synonymous_variant	154664	exon17			AAGCTCCCGAATG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5634C>T	7.37:g.48314897C>T		144.0	0.0	0		138.0	26.0	0.188406	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.	.	none		0.408	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PAX8	7849	hgsc.bcm.edu	37	2	114004442	114004442	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:114004442G>A	ENST00000429538.3	-	3	274	c.80C>T	c.(79-81)cCg>cTg	p.P27L	AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000422956.2_RNA|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000333145.5_RNA|PAX8_ENST00000263335.7_Missense_Mutation_p.P27L|PAX8_ENST00000397647.3_Missense_Mutation_p.P27L|PAX8_ENST00000263334.5_Missense_Mutation_p.P27L|PAX8_ENST00000348715.5_Missense_Mutation_p.P27L|AC016683.6_ENST00000556070.1_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	27	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						GACCACTTCCGGCAGAGGTCT	0.622			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.P27L	Ovarian(188;7 2067 9084 29802 29892)	Atlas-SNP	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	42	.	0			c.C80T						PASS	.						33.0	38.0	37.0					2																	114004442		2100	4256	6356	SO:0001583	missense	7849	exon3			ACTTCCGGCAGAG	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.80C>T	2.37:g.114004442G>A	ENSP00000395498:p.Pro27Leu	122.0	0.0	0		168.0	71.0	0.422619	NM_013952	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504596	0.85176	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334	D;D;D;D;D	0.99709	-6.48;-6.48;-6.48;-6.48;-6.48	5.1	5.1	0.69264	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.94698	3.57	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.994;1.0;0.998;0.995	D	0.96959	0.9700	10	0.87932	D	0	.	16.0313	0.80579	0.0:0.0:1.0:0.0	.	27;27;27;27;27	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4	.;.;PAX8_HUMAN;.;.	L	27	ENSP00000263335:P27L;ENSP00000380768:P27L;ENSP00000314750:P27L;ENSP00000395498:P27L;ENSP00000263334:P27L	ENSP00000263334:P27L	P	-	2	0	PAX8	113720912	1.000000	0.71417	0.940000	0.37924	0.600000	0.36913	9.796000	0.99103	2.382000	0.81193	0.655000	0.94253	CCG	.	.	none		0.622	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
IGFBP4	3487	hgsc.bcm.edu	37	17	38612729	38612729	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:38612729G>A	ENST00000269593.4	+	4	946	c.671G>A	c.(670-672)gGc>gAc	p.G224D	IGFBP4_ENST00000542955.1_Missense_Mutation_p.G124D	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	224	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGGCAGCGTGGCAAGTGCTGG	0.627																																					p.G224D	GBM(160;940 3581 26177)	Atlas-SNP	.											.	IGFBP4	17	.	0			c.G671A						PASS	.						54.0	57.0	56.0					17																	38612729		2203	4300	6503	SO:0001583	missense	3487	exon4			AGCGTGGCAAGTG	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.671G>A	17.37:g.38612729G>A	ENSP00000269593:p.Gly224Asp	162.0	0.0	0		193.0	24.0	0.124352	NM_001552	A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	ENST00000269593.4	37	CCDS11367.1	.	.	.	.	.	.	.	.	.	.	G	32	5.110443	0.94292	.	.	ENSG00000141753	ENST00000542955;ENST00000269593	T;T	0.70282	-0.47;-0.47	5.43	5.43	0.79202	Thyroglobulin type-1 (5);	0.000000	0.85682	D	0.000000	D	0.85017	0.5601	M	0.80332	2.49	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.86889	0.2047	10	0.87932	D	0	-2.4357	17.0572	0.86537	0.0:0.0:1.0:0.0	.	224	P22692	IBP4_HUMAN	D	124;224	ENSP00000437734:G124D;ENSP00000269593:G224D	ENSP00000269593:G224D	G	+	2	0	IGFBP4	35866255	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	8.449000	0.90337	2.546000	0.85860	0.655000	0.94253	GGC	.	.	none		0.627	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
C2CD4D	100191040	hgsc.bcm.edu	37	1	151810406	151810406	+	Nonstop_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:151810406A>G	ENST00000454109.1	-	2	1645	c.1060T>C	c.(1060-1062)Tag>Cag	p.*354Q		NM_001136003.1	NP_001129475.1	B7Z1M9	C2D4D_HUMAN	C2 calcium-dependent domain containing 4D	0										skin(1)	1						GGCTCAGGCTACAGGCTGAGA	0.607																																					p.X354Q		Atlas-SNP	.											.	C2CD4D	3	.	0			c.T1060C						PASS	.						20.0	27.0	25.0					1																	151810406		691	1591	2282	SO:0001578	stop_lost	100191040	exon2			CAGGCTACAGGCT	BC171843	CCDS44224.1	1q21.3	2012-07-02			ENSG00000225556	ENSG00000225556			37210	protein-coding gene	gene with protein product	"""family with sequence similarity 148, member D"""						Standard	NM_001136003		Approved	FAM148D	uc010pdq.1	B7Z1M9	OTTHUMG00000167218	ENST00000454109.1:c.1060T>C	1.37:g.151810406A>G	ENSP00000389554:p.*354Gluext*?	113.0	0.0	0		95.0	4.0	0.0421053	NM_001136003	B2RXG8	Missense_Mutation	SNP	ENST00000454109.1	37	CCDS44224.1	.	.	.	.	.	.	.	.	.	.	A	5.152	0.213579	0.09757	.	.	ENSG00000225556	ENST00000454109	.	.	.	2.97	1.68	0.24146	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.7753	0.13176	0.7221:0.0:0.0:0.2779	.	.	.	.	Q	354	.	.	X	-	1	0	C2CD4D	150077030	0.989000	0.36119	0.867000	0.34043	0.305000	0.27757	2.091000	0.41691	1.348000	0.45733	0.379000	0.24179	TAG	.	.	none		0.607	C2CD4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393778.1	NM_001136003	
EML2	24139	hgsc.bcm.edu	37	19	46116911	46116911	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:46116911G>A	ENST00000245925.3	-	18	1762	c.1712C>T	c.(1711-1713)gCg>gTg	p.A571V	EML2_ENST00000587152.1_Missense_Mutation_p.A772V|EML2_ENST00000589876.1_Missense_Mutation_p.A571V|EML2_ENST00000536630.1_Missense_Mutation_p.A718V	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	571	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.A571V(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		AGTGCCGTCCGCCCCCTCAGA	0.572																																					p.A772V		Atlas-SNP	.											EML2,caecum,carcinoma,0,1	EML2	64	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2315T						PASS	.						113.0	94.0	100.0					19																	46116911		2203	4300	6503	SO:0001583	missense	24139	exon21			CCGTCCGCCCCCT	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1712C>T	19.37:g.46116911G>A	ENSP00000245925:p.Ala571Val	107.0	0.0	0		113.0	18.0	0.159292	NM_001193268	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	ENST00000245925.3	37	CCDS12670.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299646	0.23650	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	T;T	0.29397	1.57;2.74	4.75	2.65	0.31530	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	M	0.66439	2.03	0.52501	D	0.999954	B;B;B	0.34255	0.206;0.445;0.03	B;B;B	0.24155	0.051;0.03;0.022	T	0.15694	-1.0428	10	0.54805	T	0.06	-19.9707	8.8426	0.35151	0.1883:0.0:0.8117:0.0	.	737;718;571	B7Z3Q9;B7Z3I2;O95834	.;.;EMAL2_HUMAN	V	718;571;729	ENSP00000442365:A718V;ENSP00000245925:A571V	ENSP00000245925:A571V	A	-	2	0	EML2	50808751	0.860000	0.29831	0.756000	0.31282	0.028000	0.11728	4.029000	0.57253	1.385000	0.46445	0.563000	0.77884	GCG	.	.	none		0.572	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459608.1	NM_012155	
PABPC1	26986	hgsc.bcm.edu	37	8	101721960	101721960	+	Splice_Site	SNP	C	C	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:101721960C>A	ENST00000318607.5	-	8	2101		c.e8-1		PABPC1_ENST00000519596.1_Splice_Site|PABPC1_ENST00000519004.1_Splice_Site|AP001205.1_ENST00000579868.1_RNA|PABPC1_ENST00000522387.1_Splice_Site	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CCATCATAACCTATTAAAAAA	0.348																																					.		Atlas-SNP	.											.	PABPC1	76	.	0			c.973-1G>T						PASS	.						35.0	34.0	35.0					8																	101721960		2203	4300	6503	SO:0001630	splice_region_variant	26986	exon9			CATAACCTATTAA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.973-1G>T	8.37:g.101721960C>A		116.0	0.0	0		126.0	42.0	0.333333	NM_002568	Q15097|Q93004	Splice_Site	SNP	ENST00000318607.5	37	CCDS6289.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545658	0.45280	.	.	ENSG00000070756	ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387;ENST00000519596;ENST00000519100	.	.	.	5.06	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6976	0.57014	0.0:0.9191:0.0:0.0809	.	.	.	.	.	-1	.	.	.	-	.	.	PABPC1	101791136	1.000000	0.71417	0.998000	0.56505	0.877000	0.50540	7.706000	0.84615	2.514000	0.84764	0.655000	0.94253	.	.	.	none		0.348	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	Intron
MAGEE1	57692	hgsc.bcm.edu	37	X	75648638	75648638	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:75648638G>A	ENST00000361470.2	+	1	593	c.315G>A	c.(313-315)ctG>ctA	p.L105L		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	105						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CCTCCGTGCTGCCCACCCCCA	0.677																																					p.L105L		Atlas-SNP	.											.	MAGEE1	236	.	0			c.G315A						PASS	.						21.0	22.0	22.0					X																	75648638		2203	4299	6502	SO:0001819	synonymous_variant	57692	exon1			CGTGCTGCCCACC	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.315G>A	X.37:g.75648638G>A		166.0	0.0	0		152.0	21.0	0.138158	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	ENST00000361470.2	37	CCDS14433.1																																																																																			.	.	none		0.677	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
HYAL3	8372	hgsc.bcm.edu	37	3	50332345	50332345	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:50332345T>G	ENST00000336307.1	-	2	961	c.689A>C	c.(688-690)cAa>cCa	p.Q230P	HYAL3_ENST00000415204.1_Intron|IFRD2_ENST00000484043.1_5'Flank|IFRD2_ENST00000336089.4_5'Flank|IFRD2_ENST00000417626.2_5'Flank|HYAL3_ENST00000450982.1_Missense_Mutation_p.Q230P|HYAL3_ENST00000513170.1_Intron|IFRD2_ENST00000429673.2_5'Flank|IFRD2_ENST00000436390.1_5'Flank|HYAL3_ENST00000359051.3_Missense_Mutation_p.Q230P	NM_001200029.1|NM_003549.3	NP_001186958.1|NP_003540.2	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3	230					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV-B (GO:0071493)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)|response to virus (GO:0009615)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|lysosome (GO:0005764)	hyaluronoglucuronidase activity (GO:0033906)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(5)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCAATGCAGTTGAGTGTTGCG	0.622																																					p.Q230P		Atlas-SNP	.											.	HYAL3	34	.	0			c.A689C						PASS	.						64.0	64.0	64.0					3																	50332345		2203	4300	6503	SO:0001583	missense	8372	exon2			TGCAGTTGAGTGT	AF040710	CCDS2815.1, CCDS56259.1, CCDS56260.1, CCDS56257.1	3p21.3	2004-03-12			ENSG00000186792	ENSG00000186792			5322	protein-coding gene	gene with protein product		604038				10493834	Standard	NM_003549		Approved	LUCA-3, LUCA14, Minna14	uc021wyn.1	O43820	OTTHUMG00000156936	ENST00000336307.1:c.689A>C	3.37:g.50332345T>G	ENSP00000337425:p.Gln230Pro	208.0	0.0	0		211.0	88.0	0.417062	NM_001200030	O60540|Q8NFK2|Q8NFK3|Q8NFK4|Q96E56|Q9BRW9	Missense_Mutation	SNP	ENST00000336307.1	37	CCDS2815.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.196026	0.58126	.	.	ENSG00000186792	ENST00000359051;ENST00000336307;ENST00000450982	T;T;T	0.24908	1.83;1.83;1.83	5.26	1.71	0.24356	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.428784	0.22758	U	0.055998	T	0.42675	0.1213	M	0.88979	2.995	0.27105	N	0.962515	P;D	0.53151	0.939;0.958	P;P	0.52386	0.697;0.571	T	0.35992	-0.9766	10	0.72032	D	0.01	-2.7947	7.8275	0.29324	0.0:0.2392:0.0:0.7608	.	230;230	O43820;O43820-2	HYAL3_HUMAN;.	P	230	ENSP00000351946:Q230P;ENSP00000337425:Q230P;ENSP00000391922:Q230P	ENSP00000337425:Q230P	Q	-	2	0	HYAL3	50307349	0.000000	0.05858	0.992000	0.48379	0.932000	0.56968	-0.339000	0.07832	0.850000	0.35239	0.460000	0.39030	CAA	.	.	none		0.622	HYAL3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000346664.1	NM_003549	
LONRF3	79836	hgsc.bcm.edu	37	X	118109491	118109491	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:118109491G>A	ENST00000371628.3	+	1	779	c.748G>A	c.(748-750)Ggc>Agc	p.G250S	LONRF3_ENST00000304778.7_Missense_Mutation_p.G250S|LONRF3_ENST00000422289.2_5'Flank	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	250							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						CCGGCACGAGGGCAACCGACT	0.687																																					p.G250S		Atlas-SNP	.											.	LONRF3	138	.	0			c.G748A						PASS	.						16.0	11.0	13.0					X																	118109491		2177	4244	6421	SO:0001583	missense	79836	exon1			CACGAGGGCAACC	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.748G>A	X.37:g.118109491G>A	ENSP00000360690:p.Gly250Ser	165.0	0.0	0		147.0	24.0	0.163265	NM_001031855	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	37	CCDS35374.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.78|17.78	3.473780|3.473780	0.63737|0.63737	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000439603|ENST00000365713;ENST00000304778;ENST00000371628	.|T;T;T	.|0.80566	.|-1.39;-1.39;-1.39	4.26|4.26	4.26|4.26	0.50523|0.50523	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.87245|0.87245	0.6129|0.6129	M|M	0.86343|0.86343	2.81|2.81	0.80722|0.80722	D|D	1|1	.|P;P	.|0.47762	.|0.9;0.866	.|B;P	.|0.51701	.|0.397;0.677	D|D	0.88596|0.88596	0.3146|0.3146	6|10	.|0.44086	.|T	.|0.13	-0.604|-0.604	15.2074|15.2074	0.73190|0.73190	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|250;250	.|Q496Y0-2;Q496Y0	.|.;LONF3_HUMAN	E|S	56|250	.|ENSP00000360691:G250S;ENSP00000307732:G250S;ENSP00000360690:G250S	.|ENSP00000307732:G250S	G|G	+|+	2|1	0|0	LONRF3|LONRF3	117993519|117993519	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.909000|5.909000	0.69923|0.69923	2.122000|2.122000	0.65172|0.65172	0.529000|0.529000	0.55759|0.55759	GGG|GGC	.	.	none		0.687	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
OR2W3	343171	hgsc.bcm.edu	37	1	248059470	248059470	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:248059470C>T	ENST00000360358.3	+	1	582	c.582C>T	c.(580-582)gcC>gcT	p.A194A	OR2W3_ENST00000537741.1_Silent_p.A194A	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCACTGTGGCCATCGAAGGCA	0.597																																					p.A194A		Atlas-SNP	.											OR2W3,right_lower_lobe,carcinoma,+2,1	OR2W3	113	1	0			c.C582T						PASS	.						143.0	122.0	130.0					1																	248059470		2203	4300	6503	SO:0001819	synonymous_variant	343171	exon1			TGTGGCCATCGAA	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.582C>T	1.37:g.248059470C>T		248.0	0.0	0		298.0	64.0	0.214765	NM_001001957	Q6IF06|Q8NG86	Silent	SNP	ENST00000360358.3	37	CCDS31099.1																																																																																			.	.	none		0.597	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096861.1	NM_001001957	
USP11	8237	hgsc.bcm.edu	37	X	47092477	47092477	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:47092477C>T	ENST00000218348.3	+	1	164	c.164C>T	c.(163-165)gCg>gTg	p.A55V	USP11_ENST00000377107.2_Missense_Mutation_p.A12V	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	55					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						gctgctgctgcggcggctgtg	0.647																																					p.A55V		Atlas-SNP	.											.	USP11	93	.	0			c.C164T						PASS	.						11.0	11.0	11.0					X																	47092477		2170	4226	6396	SO:0001583	missense	8237	exon1			CTGCTGCGGCGGC	U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.164C>T	X.37:g.47092477C>T	ENSP00000218348:p.Ala55Val	120.0	0.0	0		83.0	24.0	0.289157	NM_004651	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	ENST00000218348.3	37	CCDS14277.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.151779	0.57151	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.22134	1.97;1.99	1.61	1.61	0.23674	.	0.542706	0.13946	N	0.351850	T	0.19406	0.0466	N	0.19112	0.55	0.09310	N	1	D	0.67145	0.996	P	0.54372	0.75	T	0.06679	-1.0813	10	0.66056	D	0.02	.	6.0062	0.19547	0.0:1.0:0.0:0.0	.	55	P51784	UBP11_HUMAN	V	12;55	ENSP00000366311:A12V;ENSP00000218348:A55V	ENSP00000218348:A55V	A	+	2	0	USP11	46977421	0.069000	0.21087	0.003000	0.11579	0.006000	0.05464	0.406000	0.21032	1.066000	0.40716	0.513000	0.50165	GCG	.	.	none		0.647	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_004651	
MAATS1	89876	hgsc.bcm.edu	37	3	119466110	119466110	+	Splice_Site	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:119466110G>A	ENST00000273390.5	+	15	2128	c.2051G>A	c.(2050-2052)cGc>cAc	p.R684H	RP11-169N13.4_ENST00000489428.2_RNA	NM_033364.3	NP_203528	Q7Z4T9	MAAT1_HUMAN	MYCBP-associated, testis expressed 1	520						mitochondrion (GO:0005739)											ATGGAAAGCCGGTGTGTATCA	0.388																																					p.R684H		Atlas-SNP	.											C3orf15,NS,carcinoma,+1,2	.	.	2	0			c.G2051A						scavenged	.						76.0	68.0	71.0					3																	119466110		2203	4300	6503	SO:0001630	splice_region_variant	89876	exon15			AAAGCCGGTGTGT	AB063296	CCDS2994.1	3q12-q13.3	2014-07-31	2012-12-07	2012-09-26	ENSG00000183833	ENSG00000183833			24010	protein-coding gene	gene with protein product	"""AMY-1-associating protein expressed in testis 1"", ""MYCBP-binding protein"", ""spermatogenesis associated 26"""	609910	"""chromosome 3 open reading frame 15"", ""MYCBP/AMY-1-associated, testis expressed 1"""	C3orf15		12223483, 14551891, 17967944	Standard	NM_033364		Approved	AAT1, AAT1alpha, SPATA26, CaM-IP2	uc003ede.4	Q7Z4T9	OTTHUMG00000159422	ENST00000273390.5:c.2051+1G>A	3.37:g.119466110G>A		95.0	0.0	0		56.0	3.0	0.0535714	NM_033364	A0AVK2|A8K1J9|B3KP23|B4DG52|B4DZ14|C9JUG4|Q68DX2|Q8TD41|Q96A45|Q96JE8	Missense_Mutation	SNP	ENST00000273390.5	37	CCDS2994.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.389491	0.82902	.	.	ENSG00000183833	ENST00000273390	T	0.24350	1.86	5.68	4.8	0.61643	.	0.241129	0.40222	N	0.001147	T	0.50171	0.1600	M	0.77103	2.36	0.80722	D	1	B;D;P	0.76494	0.391;0.999;0.647	B;D;B	0.65874	0.067;0.939;0.111	T	0.54589	-0.8271	10	0.54805	T	0.06	-13.3469	14.3754	0.66869	0.0707:0.0:0.9293:0.0	.	520;622;684	Q7Z4T9;Q7Z4T9-3;Q7Z4T9-7	AAT1_HUMAN;.;.	H	684	ENSP00000273390:R684H	ENSP00000273390:R684H	R	+	2	0	C3orf15	120948800	1.000000	0.71417	0.994000	0.49952	0.918000	0.54935	4.272000	0.58908	1.403000	0.46800	0.591000	0.81541	CGC	.	.	none		0.388	MAATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355222.1	NM_033364	Missense_Mutation
DGAT2L6	347516	hgsc.bcm.edu	37	X	69424867	69424867	+	Missense_Mutation	SNP	G	G	A	rs35142503		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:69424867G>A	ENST00000333026.3	+	7	1025	c.925G>A	c.(925-927)Gca>Aca	p.A309T		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	309					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						CAAGTATCACGCACTCTACAT	0.458																																					p.A309T		Atlas-SNP	.											.	DGAT2L6	40	.	0			c.G925A						PASS	.	G	THR/ALA	4,3831		0,4,1628,571	95.0	75.0	82.0		925	1.6	0.2	X	dbSNP_126	82	0,6728		0,0,2428,1872	yes	missense	DGAT2L6	NM_198512.1	58	0,4,4056,2443	AA,AG,GG,G		0.0,0.1043,0.0379	benign	309/338	69424867	4,10559	2203	4300	6503	SO:0001583	missense	347516	exon7			TATCACGCACTCT	AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.925G>A	X.37:g.69424867G>A	ENSP00000328036:p.Ala309Thr	260.0	0.0	0		297.0	49.0	0.164983	NM_198512	Q6IEE2	Missense_Mutation	SNP	ENST00000333026.3	37	CCDS14397.1	.	.	.	.	.	.	.	.	.	.	G	8.546	0.874318	0.17395	0.001043	0.0	ENSG00000184210	ENST00000333026	D	0.93547	-3.24	4.74	1.62	0.23740	.	0.774326	0.12002	N	0.508712	D	0.88640	0.6491	L	0.49455	1.56	0.21822	N	0.999526	B	0.16603	0.018	B	0.16289	0.015	T	0.73404	-0.3993	10	0.19147	T	0.46	-22.9304	7.1522	0.25616	0.3674:0.0:0.6325:0.0	rs35142503	309	Q6ZPD8	DG2L6_HUMAN	T	309	ENSP00000328036:A309T	ENSP00000328036:A309T	A	+	1	0	DGAT2L6	69341592	0.000000	0.05858	0.172000	0.22920	0.534000	0.34807	0.658000	0.24979	0.002000	0.14630	-0.192000	0.12808	GCA	G|0.987;A|0.013	0.013	weak		0.458	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057067.1	NM_198512	
SLITRK2	84631	hgsc.bcm.edu	37	X	144904787	144904787	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:144904787G>A	ENST00000370490.1	+	1	5099	c.844G>A	c.(844-846)Gtc>Atc	p.V282I	SLITRK2_ENST00000428560.2_Missense_Mutation_p.V282I|SLITRK2_ENST00000413937.2_Missense_Mutation_p.V282I|SLITRK2_ENST00000434188.2_Missense_Mutation_p.V282I|SLITRK2_ENST00000447897.2_Missense_Mutation_p.V282I			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	282					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TGACACCCACGTCCAAAGGCT	0.562																																					p.V282I		Atlas-SNP	.											.	SLITRK2	221	.	0			c.G844A						PASS	.						79.0	72.0	74.0					X																	144904787		2203	4300	6503	SO:0001583	missense	84631	exon5			ACCCACGTCCAAA	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.844G>A	X.37:g.144904787G>A	ENSP00000359521:p.Val282Ile	68.0	0.0	0		78.0	13.0	0.166667	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	37	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	4.111	0.018746	0.07959	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	5.67	-4.09	0.03951	.	0.813170	0.11203	N	0.588607	T	0.22322	0.0538	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	10	0.18710	T	0.47	-1.0238	14.6093	0.68504	0.7205:0.0:0.2795:0.0	.	282	Q9H156	SLIK2_HUMAN	I	282	ENSP00000334374:V282I;ENSP00000411681:V282I;ENSP00000359521:V282I;ENSP00000397015:V282I;ENSP00000407347:V282I;ENSP00000412010:V282I	ENSP00000334374:V282I	V	+	1	0	SLITRK2	144712479	0.000000	0.05858	0.001000	0.08648	0.837000	0.47467	-0.586000	0.05787	-1.074000	0.03132	-0.914000	0.02751	GTC	.	.	none		0.562	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
PCDHB16	57717	hgsc.bcm.edu	37	5	140564228	140564228	+	Silent	SNP	G	G	A	rs540563709		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:140564228G>A	ENST00000361016.2	+	1	3249	c.2094G>A	c.(2092-2094)tcG>tcA	p.S698S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	698					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTCGGTGTCGTCGCTCTTCC	0.697																																					p.S698S		Atlas-SNP	.											PCDHB16,colon,carcinoma,0,2	PCDHB16	159	2	0			c.G2094A						PASS	.						71.0	75.0	74.0					5																	140564228		2201	4297	6498	SO:0001819	synonymous_variant	57717	exon1			GGTGTCGTCGCTC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.2094G>A	5.37:g.140564228G>A		86.0	0.0	0		55.0	19.0	0.345455	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Silent	SNP	ENST00000361016.2	37	CCDS4251.1																																																																																			.	.	none		0.697	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
ELF1	1997	hgsc.bcm.edu	37	13	41507882	41507882	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr13:41507882C>T	ENST00000239882.3	-	9	1853	c.1539G>A	c.(1537-1539)caG>caA	p.Q513Q	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Silent_p.Q489Q	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	513					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TGCAAATGGTCTGAACATTGC	0.517																																					p.Q513Q		Atlas-SNP	.											ELF1,NS,carcinoma,-2,1	ELF1	65	1	0			c.G1539A						PASS	.						108.0	104.0	106.0					13																	41507882		2203	4300	6503	SO:0001819	synonymous_variant	1997	exon9			AATGGTCTGAACA	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1539G>A	13.37:g.41507882C>T		118.0	0.0	0		137.0	62.0	0.452555	NM_172373	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Silent	SNP	ENST00000239882.3	37	CCDS9374.1																																																																																			.	.	none		0.517	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
ANKRD53	79998	hgsc.bcm.edu	37	2	71212171	71212171	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:71212171C>T	ENST00000360589.3	+	6	1368	c.1334C>T	c.(1333-1335)gCg>gTg	p.A445V	AC007040.11_ENST00000606025.1_Intron|ANKRD53_ENST00000441349.1_3'UTR|ANKRD53_ENST00000272421.6_3'UTR|ANKRD53_ENST00000457410.1_Missense_Mutation_p.A411V	NM_001115116.1	NP_001108588.1	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53	445										endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	11						CACTGGGTGGCGCCCGTGCCG	0.652											OREG0014687	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A445V		Atlas-SNP	.											.	ANKRD53	55	.	0			c.C1334T						PASS	.						7.0	10.0	9.0					2																	71212171		683	1580	2263	SO:0001583	missense	79998	exon6			GGGTGGCGCCCGT	BC035234	CCDS1913.1, CCDS46321.1	2p13.3	2013-01-10			ENSG00000144031	ENSG00000144031		"""Ankyrin repeat domain containing"""	25691	protein-coding gene	gene with protein product							Standard	NM_024933		Approved	FLJ12056, FLJ36160	uc002shl.4	Q8N9V6	OTTHUMG00000129712	ENST00000360589.3:c.1334C>T	2.37:g.71212171C>T	ENSP00000353796:p.Ala445Val	39.0	0.0	0	1128	22.0	5.0	0.227273	NM_001115116	Q8IYP8	Missense_Mutation	SNP	ENST00000360589.3	37	CCDS46321.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669230	0.47677	.	.	ENSG00000144031	ENST00000457410;ENST00000360589	T;T	0.64085	0.01;-0.08	5.16	-0.376	0.12505	.	1.236970	0.05473	N	0.553515	T	0.40791	0.1131	L	0.29908	0.895	0.09310	N	1	P	0.49961	0.93	B	0.34873	0.191	T	0.38090	-0.9677	10	0.40728	T	0.16	-1.5817	2.8344	0.05509	0.2989:0.3228:0.2918:0.0865	.	445	Q8N9V6	ANR53_HUMAN	V	411;445	ENSP00000407004:A411V;ENSP00000353796:A445V	ENSP00000353796:A445V	A	+	2	0	ANKRD53	71065679	0.000000	0.05858	0.006000	0.13384	0.054000	0.15201	-0.783000	0.04638	0.076000	0.16826	0.561000	0.74099	GCG	.	.	none		0.652	ANKRD53-004	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330275.2	NM_024933	
GABRQ	55879	hgsc.bcm.edu	37	X	151820139	151820139	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:151820139A>C	ENST00000370306.2	+	8	1072	c.1052A>C	c.(1051-1053)tAt>tCt	p.Y351S		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	351					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TACATCAACTATCTTTTCTAC	0.507																																					p.Y351S		Atlas-SNP	.											.	GABRQ	131	.	0			c.A1052C						PASS	.						282.0	225.0	244.0					X																	151820139		2203	4300	6503	SO:0001583	missense	55879	exon8			TCAACTATCTTTT	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1052A>C	X.37:g.151820139A>C	ENSP00000359329:p.Tyr351Ser	222.0	0.0	0		289.0	47.0	0.16263	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.256619	0.80246	.	.	ENSG00000147402	ENST00000370306	D	0.87809	-2.3	5.88	4.68	0.58851	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.156200	0.30565	N	0.009347	D	0.91253	0.7243	M	0.62723	1.935	0.44337	D	0.997227	D	0.89917	1.0	D	0.83275	0.996	D	0.90553	0.4510	10	0.87932	D	0	.	9.5	0.39011	0.8398:0.0:0.0:0.1602	.	351	Q9UN88	GBRT_HUMAN	S	351	ENSP00000359329:Y351S	ENSP00000359329:Y351S	Y	+	2	0	GABRQ	151570795	1.000000	0.71417	0.740000	0.30986	0.936000	0.57629	7.438000	0.80431	0.786000	0.33708	0.486000	0.48141	TAT	.	.	none		0.507	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
BMP5	653	hgsc.bcm.edu	37	6	55659189	55659189	+	Silent	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:55659189G>T	ENST00000370830.3	-	3	1418	c.720C>A	c.(718-720)gcC>gcA	p.A240A	BMP5_ENST00000446683.2_Silent_p.A240A	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	240					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CTAAAGCTTGGGCCTTTCTTG	0.383																																					p.A240A		Atlas-SNP	.											.	BMP5	94	.	0			c.C720A						PASS	.						100.0	101.0	101.0					6																	55659189		2203	4300	6503	SO:0001819	synonymous_variant	653	exon3			AGCTTGGGCCTTT		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.720C>A	6.37:g.55659189G>T		75.0	0.0	0		52.0	9.0	0.173077	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Silent	SNP	ENST00000370830.3	37	CCDS4958.1																																																																																			.	.	none		0.383	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
RIF1	55183	hgsc.bcm.edu	37	2	152300225	152300225	+	Splice_Site	SNP	T	T	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:152300225T>G	ENST00000243326.5	+	17	2469		c.e17+2		RIF1_ENST00000430328.2_Splice_Site|RIF1_ENST00000444746.2_Splice_Site|RIF1_ENST00000453091.2_Splice_Site|RIF1_ENST00000428287.2_Splice_Site			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1						fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		ATTAATCAGGTATGAAATAAA	0.313																																					.		Atlas-SNP	.											.	RIF1	244	.	0			c.1986+2T>G						PASS	.						63.0	67.0	65.0					2																	152300225		2202	4300	6502	SO:0001630	splice_region_variant	55183	exon18			ATCAGGTATGAAA	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.1986+2T>G	2.37:g.152300225T>G		64.0	0.0	0		74.0	28.0	0.378378	NM_018151	A0AVS0|Q9NS16	Splice_Site	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762703	0.69763	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000414861;ENST00000430328	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5395	0.61666	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIF1	152008471	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	6.811000	0.75221	2.027000	0.59764	0.377000	0.23210	.	.	.	none		0.313	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254836.3		Intron
KIAA1549	57670	hgsc.bcm.edu	37	7	138602479	138602479	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:138602479C>T	ENST00000422774.1	-	2	1941	c.1893G>A	c.(1891-1893)ccG>ccA	p.P631P	KIAA1549_ENST00000242365.4_Silent_p.P581P|KIAA1549_ENST00000440172.1_Silent_p.P631P			Q9HCM3	K1549_HUMAN	KIAA1549	631	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TGAGTTCCAGCGGGGGTGTTG	0.502			O	BRAF	pilocytic astrocytoma																																p.P631P	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314	.	0			c.G1893A						PASS	.						29.0	33.0	32.0					7																	138602479		1899	4122	6021	SO:0001819	synonymous_variant	57670	exon2			TTCCAGCGGGGGT		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1893G>A	7.37:g.138602479C>T		69.0	0.0	0		71.0	11.0	0.15493	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Silent	SNP	ENST00000422774.1	37	CCDS56513.1																																																																																			.	.	none		0.502	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
SOCS1	8651	hgsc.bcm.edu	37	16	11348808	11348808	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:11348808C>T	ENST00000332029.2	-	2	678	c.528G>A	c.(526-528)gaG>gaA	p.E176E	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	176	Interaction with Elongin BC complex. {ECO:0000250}.|SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.E176fs*35(3)|p.0?(1)|p.Y64fs*1(1)|p.V171_R179del(1)|p.E176E(1)|p.R127_*212del(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						GGCGGCACAGCTCCTGCAGCG	0.731			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.E176E	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	SOCS1,lymph_node,lymphoid_neoplasm,0,1	SOCS1	84	1	8	Deletion - Frameshift(4)|Deletion - In frame(2)|Whole gene deletion(1)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(8)	c.G528A						PASS	.						7.0	7.0	7.0					16																	11348808		2131	4193	6324	SO:0001819	synonymous_variant	8651	exon2			GCACAGCTCCTGC	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.528G>A	16.37:g.11348808C>T		18.0	0.0	0		11.0	6.0	0.545455	NM_003745	O15097|Q9NSA7	Silent	SNP	ENST00000332029.2	37	CCDS10546.1																																																																																			.	.	none		0.731	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
LCMT1	51451	hgsc.bcm.edu	37	16	25186263	25186263	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:25186263A>G	ENST00000399069.3	+	10	1045	c.890A>G	c.(889-891)gAa>gGa	p.E297G	LCMT1_ENST00000572869.1_3'UTR|LCMT1_ENST00000380966.4_Missense_Mutation_p.E242G	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	297					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)								GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	CACAGGATAGAATCACTTGAA	0.428																																					p.E297G	Colon(200;565 2072 24396 47922 50898)	Atlas-SNP	.											.	LCMT1	22	.	0			c.A890G						PASS	.						57.0	55.0	56.0					16																	25186263		1850	4091	5941	SO:0001583	missense	51451	exon10			GGATAGAATCACT	AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.890A>G	16.37:g.25186263A>G	ENSP00000382021:p.Glu297Gly	90.0	0.0	0		85.0	18.0	0.211765	NM_016309	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	ENST00000399069.3	37	CCDS45445.1	.	.	.	.	.	.	.	.	.	.	A	16.74	3.207519	0.58343	.	.	ENSG00000205629	ENST00000399069;ENST00000380966;ENST00000380962	T;T	0.24350	1.86;1.86	5.15	4.04	0.47022	.	0.000000	0.85682	D	0.000000	T	0.50803	0.1637	M	0.84156	2.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.99	T	0.53337	-0.8453	10	0.87932	D	0	-25.0191	9.3407	0.38079	0.8194:0.1806:0.0:0.0	.	242;297	Q9UIC8-3;Q9UIC8	.;LCMT1_HUMAN	G	297;242;314	ENSP00000382021:E297G;ENSP00000370353:E242G	ENSP00000370349:E314G	E	+	2	0	LCMT1	25093764	1.000000	0.71417	0.875000	0.34327	0.525000	0.34531	7.428000	0.80296	0.900000	0.36469	0.533000	0.62120	GAA	.	.	none		0.428	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435747.4	NM_016309	
SARM1	23098	hgsc.bcm.edu	37	17	26708753	26708753	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:26708753C>T	ENST00000457710.3	+	2	1371	c.900C>T	c.(898-900)ctC>ctT	p.L300L	CTB-96E2.3_ENST00000591482.1_RNA|SARM1_ENST00000379061.4_3'UTR	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	334					innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TGCCGTTGCTCGACTCTAACC	0.677																																					p.L333L		Atlas-SNP	.											.	SARM1	40	.	0			c.C999T						PASS	.						11.0	13.0	12.0					17																	26708753		2134	4199	6333	SO:0001819	synonymous_variant	23098	exon3			GTTGCTCGACTCT	AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.900C>T	17.37:g.26708753C>T		40.0	0.0	0		38.0	4.0	0.105263	NM_015077	O60277|Q7LGG3|Q9NXY5	Silent	SNP	ENST00000457710.3	37																																																																																				.	.	none		0.677	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000255679.3	NM_015077	
GABRQ	55879	hgsc.bcm.edu	37	X	151820129	151820129	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:151820129T>C	ENST00000370306.2	+	8	1062	c.1042T>C	c.(1042-1044)Tac>Cac	p.Y348H		NM_018558.2	NP_061028.3	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) A receptor, theta	348					neurotransmitter transport (GO:0006836)|signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|neurotransmitter transporter activity (GO:0005326)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(9)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	52	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GGAGTATGTCTACATCAACTA	0.512																																					p.Y348H		Atlas-SNP	.											.	GABRQ	131	.	0			c.T1042C						PASS	.						320.0	251.0	274.0					X																	151820129		2203	4300	6503	SO:0001583	missense	55879	exon8			TATGTCTACATCA	U47334	CCDS14707.1	Xq28	2012-06-22	2012-02-03		ENSG00000147402	ENSG00000268089		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	14454	protein-coding gene	gene with protein product	"""GABA(A) receptor, theta"""	300349	"""gamma-aminobutyric acid (GABA) receptor, theta"""			10804200, 10449790	Standard	NM_018558		Approved	THETA	uc004ffp.1	Q9UN88	OTTHUMG00000022649	ENST00000370306.2:c.1042T>C	X.37:g.151820129T>C	ENSP00000359329:p.Tyr348His	251.0	0.0	0		305.0	47.0	0.154098	NM_018558	A6NFN1|Q32MB4|Q9NZK8	Missense_Mutation	SNP	ENST00000370306.2	37	CCDS14707.1	.	.	.	.	.	.	.	.	.	.	T	15.54	2.862737	0.51482	.	.	ENSG00000147402	ENST00000370306	D	0.85411	-1.98	5.88	4.72	0.59763	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.153676	0.30969	N	0.008512	T	0.78685	0.4322	L	0.45137	1.4	0.36846	D	0.887645	B	0.28208	0.203	B	0.32583	0.148	T	0.72174	-0.4370	10	0.16420	T	0.52	.	9.1238	0.36803	0.0:0.0866:0.0:0.9133	.	348	Q9UN88	GBRT_HUMAN	H	348	ENSP00000359329:Y348H	ENSP00000359329:Y348H	Y	+	1	0	GABRQ	151570785	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.032000	0.64140	0.837000	0.34925	0.486000	0.48141	TAC	.	.	none		0.512	GABRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058763.2	NM_018558	
CARD11	84433	hgsc.bcm.edu	37	7	2976756	2976756	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:2976756A>C	ENST00000396946.4	-	9	1659	c.1256T>G	c.(1255-1257)aTc>aGc	p.I419S		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	419					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CACCATCTCGATCCTCATCTC	0.592			Mis		DLBCL																																p.I419S		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.T1256G						PASS	.						165.0	133.0	144.0					7																	2976756		2203	4300	6503	SO:0001583	missense	84433	exon9			ATCTCGATCCTCA	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1256T>G	7.37:g.2976756A>C	ENSP00000380150:p.Ile419Ser	175.0	0.0	0		148.0	63.0	0.425676	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	A	9.722	1.159872	0.21454	.	.	ENSG00000198286	ENST00000396946	T	0.31510	1.49	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.22244	0.0536	N	0.19112	0.55	0.80722	D	1	B	0.19331	0.035	B	0.20384	0.029	T	0.03608	-1.1020	10	0.38643	T	0.18	-22.9658	14.2746	0.66173	1.0:0.0:0.0:0.0	.	419	Q9BXL7	CAR11_HUMAN	S	419	ENSP00000380150:I419S	ENSP00000380150:I419S	I	-	2	0	CARD11	2943282	1.000000	0.71417	0.252000	0.24328	0.976000	0.68499	7.318000	0.79029	1.981000	0.57761	0.459000	0.35465	ATC	.	.	none		0.592	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
STAT6	6778	hgsc.bcm.edu	37	12	57493818	57493818	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:57493818T>C	ENST00000300134.3	-	14	1893	c.1568A>G	c.(1567-1569)gAc>gGc	p.D523G	STAT6_ENST00000543873.2_Missense_Mutation_p.D523G|STAT6_ENST00000537215.2_Missense_Mutation_p.D413G|STAT6_ENST00000538913.2_Missense_Mutation_p.D413G|STAT6_ENST00000556155.1_Missense_Mutation_p.D523G|STAT6_ENST00000454075.3_Missense_Mutation_p.D523G	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	523	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						TTTGGTGAGGTCCAGGACACC	0.612																																					p.D523G		Atlas-SNP	.											.	STAT6	69	.	0			c.A1568G						PASS	.						93.0	73.0	80.0					12																	57493818		2203	4300	6503	SO:0001583	missense	6778	exon14			GTGAGGTCCAGGA	BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.1568A>G	12.37:g.57493818T>C	ENSP00000300134:p.Asp523Gly	137.0	0.0	0		152.0	56.0	0.368421	NM_001178079	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Missense_Mutation	SNP	ENST00000300134.3	37	CCDS8931.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527568	0.85706	.	.	ENSG00000166888	ENST00000300134;ENST00000535201;ENST00000538913;ENST00000543873;ENST00000556155;ENST00000537215;ENST00000454075;ENST00000542721;ENST00000542516;ENST00000555375	D;D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	4.92	4.92	0.64577	STAT transcription factor, DNA-binding (1);p53-like transcription factor, DNA-binding (1);SH2 motif (1);EF-hand-like domain (1);	0.055888	0.64402	D	0.000001	D	0.92766	0.7700	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.984;0.993	D	0.93346	0.6714	10	0.87932	D	0	-25.2637	12.5465	0.56203	0.0:0.0:0.0:1.0	.	523;523	A8K4S9;P42226	.;STAT6_HUMAN	G	523;413;413;523;523;413;523;413;523;89	ENSP00000300134:D523G;ENSP00000445409:D413G;ENSP00000438451:D523G;ENSP00000451742:D523G;ENSP00000444530:D413G;ENSP00000401486:D523G;ENSP00000450921:D89G	ENSP00000300134:D523G	D	-	2	0	STAT6	55780085	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.810000	0.86072	2.062000	0.61559	0.533000	0.62120	GAC	.	.	none		0.612	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412248.3	NM_003153	
ITPKB	3707	hgsc.bcm.edu	37	1	226925148	226925148	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:226925148G>A	ENST00000272117.3	-	1	11	c.12C>T	c.(10-12)taC>taT	p.Y4Y	ITPKB_ENST00000429204.1_Silent_p.Y4Y|ITPKB_ENST00000366784.1_Silent_p.Y4Y			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	4					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				GCGCATAGCAGTACACAGCCA	0.726																																					p.Y4Y	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.C12T						PASS	.						17.0	20.0	19.0					1																	226925148		2139	4199	6338	SO:0001819	synonymous_variant	3707	exon2			ATAGCAGTACACA	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.12C>T	1.37:g.226925148G>A		32.0	0.0	0		33.0	7.0	0.212121	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	ENST00000272117.3	37	CCDS1555.1																																																																																			.	.	none		0.726	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
AMBRA1	55626	hgsc.bcm.edu	37	11	46564251	46564251	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:46564251C>T	ENST00000458649.2	-	7	1734	c.1316G>A	c.(1315-1317)aGa>aAa	p.R439K	AMBRA1_ENST00000314845.3_Missense_Mutation_p.R349K|AMBRA1_ENST00000533727.1_Missense_Mutation_p.R349K|AMBRA1_ENST00000534300.1_Missense_Mutation_p.R439K|AMBRA1_ENST00000426438.1_Missense_Mutation_p.R439K|AMBRA1_ENST00000528950.1_Missense_Mutation_p.R439K|AMBRA1_ENST00000298834.3_Missense_Mutation_p.R439K			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	439					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GGCACTGGTTCTGGGCGGGGG	0.562																																					p.R349K		Atlas-SNP	.											.	AMBRA1	201	.	0			c.G1046A						PASS	.						67.0	67.0	67.0					11																	46564251		2201	4299	6500	SO:0001583	missense	55626	exon8			CTGGTTCTGGGCG	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1316G>A	11.37:g.46564251C>T	ENSP00000415327:p.Arg439Lys	162.0	0.0	0		172.0	38.0	0.22093	NM_001267783	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	37		.	.	.	.	.	.	.	.	.	.	C	18.52	3.642548	0.67244	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;D;T;T;T;T;T	0.84146	-1.24;-1.81;-1.08;-1.21;-1.08;-1.05;-1.21	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89339	0.6687	L	0.32530	0.975	0.58432	D	0.999992	D;D;D;D;D;D	0.64830	0.994;0.99;0.99;0.974;0.99;0.974	D;D;D;D;D;D	0.72982	0.97;0.979;0.979;0.969;0.979;0.969	D	0.89784	0.3963	10	0.72032	D	0.01	.	20.1542	0.98100	0.0:1.0:0.0:0.0	.	439;439;439;349;349;349	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	K	349;349;439;439;439;349;439;439	ENSP00000318313:R349K;ENSP00000433372:R349K;ENSP00000431926:R439K;ENSP00000410899:R439K;ENSP00000298834:R439K;ENSP00000415327:R439K;ENSP00000433945:R439K	ENSP00000298834:R439K	R	-	2	0	AMBRA1	46520827	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.172000	0.77604	2.767000	0.95098	0.563000	0.77884	AGA	.	.	none		0.562	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
CNTRL	11064	hgsc.bcm.edu	37	9	123931934	123931934	+	Missense_Mutation	SNP	G	G	T	rs376768102		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:123931934G>T	ENST00000373855.1	+	39	6376	c.6116G>T	c.(6115-6117)gGt>gTt	p.G2039V	CNTRL_ENST00000373850.1_Missense_Mutation_p.G1487V|CNTRL_ENST00000238341.5_Missense_Mutation_p.G2039V|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	2039	Required for centrosome localization.|Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GAGAAATCAGGTGAGCTGTTG	0.502																																					p.G2039V		Atlas-SNP	.											.	CNTRL	161	.	0			c.G6116T						PASS	.						94.0	96.0	95.0					9																	123931934		2203	4300	6503	SO:0001583	missense	11064	exon37			AATCAGGTGAGCT	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6116G>T	9.37:g.123931934G>T	ENSP00000362962:p.Gly2039Val	76.0	0.0	0		96.0	41.0	0.427083	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	37	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	G	2.693	-0.272727	0.05716	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000394368;ENST00000373850;ENST00000373845	T;T;T	0.30182	1.84;1.84;1.54	6.02	-1.54	0.08584	.	.	.	.	.	T	0.17916	0.0430	L	0.29908	0.895	0.19300	N	0.99998	B	0.24823	0.112	B	0.16722	0.016	T	0.19516	-1.0303	9	0.33141	T	0.24	.	5.9625	0.19307	0.4083:0.223:0.3687:0.0	.	2039	Q7Z7A1	CNTRL_HUMAN	V	2039;2039;2039;795;196;1487;721	ENSP00000362962:G2039V;ENSP00000238341:G2039V;ENSP00000362956:G1487V	ENSP00000238341:G2039V	G	+	2	0	CNTRL	122971755	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.236000	0.09003	-0.605000	0.05753	-0.150000	0.13652	GGT	.	.	alt		0.502	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
SYMPK	8189	hgsc.bcm.edu	37	19	46352062	46352062	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:46352062G>A	ENST00000245934.7	-	6	616	c.372C>T	c.(370-372)aaC>aaT	p.N124N		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	124	Interaction with HSF1.				cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TCTTCACCACGTTCACATTCT	0.552																																					p.N124N		Atlas-SNP	.											.	SYMPK	104	.	0			c.C372T						PASS	.						190.0	147.0	161.0					19																	46352062		2203	4300	6503	SO:0001819	synonymous_variant	8189	exon6			CACCACGTTCACA	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.372C>T	19.37:g.46352062G>A		218.0	0.0	0		260.0	135.0	0.519231	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	CCDS12676.2																																																																																			.	.	none		0.552	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
KRT12	3859	hgsc.bcm.edu	37	17	39021152	39021152	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:39021152A>T	ENST00000251643.4	-	3	736	c.713T>A	c.(712-714)gTg>gAg	p.V238E	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	238	Coil 1B.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CTCGTCCAGCACCCGGCGCAG	0.572																																					p.V238E		Atlas-SNP	.											.	KRT12	53	.	0			c.T713A						PASS	.						102.0	98.0	100.0					17																	39021152		2203	4300	6503	SO:0001583	missense	3859	exon3			TCCAGCACCCGGC		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.713T>A	17.37:g.39021152A>T	ENSP00000251643:p.Val238Glu	125.0	0.0	0		148.0	26.0	0.175676	NM_000223	B2R9E0	Missense_Mutation	SNP	ENST00000251643.4	37	CCDS11378.1	.	.	.	.	.	.	.	.	.	.	A	34	5.341017	0.95783	.	.	ENSG00000187242	ENST00000251643	D	0.88431	-2.38	5.96	5.96	0.96718	Filament (1);	0.000000	0.44688	D	0.000422	D	0.94961	0.8370	M	0.84585	2.705	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	D	0.95526	0.8599	10	0.87932	D	0	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	238	Q99456	K1C12_HUMAN	E	238	ENSP00000251643:V238E	ENSP00000251643:V238E	V	-	2	0	KRT12	36274678	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.193000	0.94954	2.285000	0.76669	0.533000	0.62120	GTG	.	.	none		0.572	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
PCM1	5108	hgsc.bcm.edu	37	8	17843569	17843569	+	Silent	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:17843569T>C	ENST00000519253.1	+	26	4634	c.4383T>C	c.(4381-4383)ccT>ccC	p.P1461P	PCM1_ENST00000524226.1_Silent_p.P1407P|PCM1_ENST00000327578.8_Silent_p.P160P|PCM1_ENST00000325083.8_Silent_p.P1461P			Q15154	PCM1_HUMAN	pericentriolar material 1	1461	Interaction with HAP1.				centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AACTTACTCCTAGTGAGAGCC	0.323			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																p.P1461P		Atlas-SNP	.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1	120	.	0			c.T4383C						PASS	.						85.0	82.0	83.0					8																	17843569		1842	4078	5920	SO:0001819	synonymous_variant	5108	exon26			TACTCCTAGTGAG		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.4383T>C	8.37:g.17843569T>C		100.0	0.0	0		97.0	4.0	0.0412371	NM_006197	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Silent	SNP	ENST00000519253.1	37		.	.	.	.	.	.	.	.	.	.	T	9.433	1.086118	0.20390	.	.	ENSG00000078674	ENST00000522275	.	.	.	5.05	0.866	0.19079	.	.	.	.	.	T	0.42921	0.1224	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.20773	-1.0265	4	.	.	.	-5.5681	2.3121	0.04189	0.2364:0.3965:0.2305:0.1365	.	.	.	.	P	201	.	.	L	+	2	0	PCM1	17887849	0.921000	0.31238	0.999000	0.59377	0.981000	0.71138	0.014000	0.13333	0.071000	0.16664	-0.182000	0.12963	CTA	.	.	none		0.323	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
PRAC1	84366	hgsc.bcm.edu	37	17	46799191	46799191	+	Missense_Mutation	SNP	G	G	A	rs554311327	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:46799191G>A	ENST00000290294.3	-	2	275	c.146C>T	c.(145-147)tCg>tTg	p.S49L	PRAC2_ENST00000422730.2_RNA|PRAC2_ENST00000432056.1_RNA|MIR3185_ENST00000583892.1_RNA	NM_032391.2	NP_115767.1	Q96KF2	PRAC1_HUMAN	prostate cancer susceptibility candidate 1	49						nucleus (GO:0005634)											tcggcctcccgaaattccaga	0.398													G|||	4	0.000798722	0.0	0.0043	5008	,	,		13775	0.0		0.001	False		,,,				2504	0.0				p.S49L		Atlas-SNP	.											.	PRAC	6	.	0			c.C146T						PASS	.						33.0	41.0	38.0					17																	46799191		1327	2309	3636	SO:0001583	missense	84366	exon2			CCTCCCGAAATTC	AF331165	CCDS11535.1	17q21	2013-08-29	2013-08-29	2013-08-29	ENSG00000159182	ENSG00000159182			30591	protein-coding gene	gene with protein product	"""prostate, rectum and colon"""	609819	"""chromosome 17 open reading frame 92"", ""prostate cancer susceptibility candidate"""	C17orf92, PRAC		11340635	Standard	NM_032391		Approved		uc002iny.3	Q96KF2	OTTHUMG00000159899	ENST00000290294.3:c.146C>T	17.37:g.46799191G>A	ENSP00000290294:p.Ser49Leu	171.0	0.0	0		181.0	60.0	0.331492	NM_032391		Missense_Mutation	SNP	ENST00000290294.3	37	CCDS11535.1	.	.	.	.	.	.	.	.	.	.	G	5.599	0.295270	0.10622	.	.	ENSG00000159182	ENST00000290294	T	0.58652	0.32	0.664	-1.33	0.09172	.	.	.	.	.	T	0.40815	0.1132	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33548	-0.9864	7	0.87932	D	0	.	.	.	.	.	49	Q96KF2	PRAC_HUMAN	L	49	ENSP00000290294:S49L	ENSP00000290294:S49L	S	-	2	0	PRAC	44154190	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	-0.678000	0.05209	-0.355000	0.08199	-0.752000	0.03492	TCG	.	.	none		0.398	PRAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358086.1	NM_032391	
ZNF845	91664	hgsc.bcm.edu	37	19	53855284	53855284	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:53855284G>A	ENST00000595091.1	+	5	1575	c.1356G>A	c.(1354-1356)tcG>tcA	p.S452S	ZNF845_ENST00000458035.1_Silent_p.S452S			Q96IR2	ZN845_HUMAN	zinc finger protein 845	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S452S(2)		endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						GTTTCAAATCGAACCTTGAAA	0.398																																					p.S452S		Atlas-SNP	.											ZNF845,NS,carcinoma,0,1	ZNF845	101	1	2	Substitution - coding silent(2)	prostate(1)|kidney(1)	c.G1356A						scavenged	.						26.0	24.0	25.0					19																	53855284		692	1590	2282	SO:0001819	synonymous_variant	91664	exon4			CAAATCGAACCTT	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1356G>A	19.37:g.53855284G>A		48.0	0.0	0		77.0	4.0	0.0519481	NM_138374		Silent	SNP	ENST00000595091.1	37	CCDS46170.1																																																																																			.	.	none		0.398	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
PIK3AP1	118788	hgsc.bcm.edu	37	10	98369476	98369476	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:98369476G>A	ENST00000339364.5	-	14	2282	c.2163C>T	c.(2161-2163)agC>agT	p.S721S	PIK3AP1_ENST00000371110.2_Silent_p.S543S|PIK3AP1_ENST00000371109.3_Silent_p.S320S	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	721					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		CACTTGCTGTGCTGGAGGTGC	0.572																																					p.S721S		Atlas-SNP	.											.	PIK3AP1	111	.	0			c.C2163T						PASS	.						99.0	106.0	104.0					10																	98369476		2203	4300	6503	SO:0001819	synonymous_variant	118788	exon14			TGCTGTGCTGGAG	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.2163C>T	10.37:g.98369476G>A		101.0	0.0	0		111.0	48.0	0.432432	NM_152309	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Silent	SNP	ENST00000339364.5	37	CCDS31259.1																																																																																			.	.	none		0.572	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
UBE2A	7319	hgsc.bcm.edu	37	X	118715490	118715490	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:118715490G>T	ENST00000371558.2	+	4	346	c.172G>T	c.(172-174)Gaa>Taa	p.E58*	UBE2A_ENST00000346330.3_Intron|UBE2A_ENST00000371569.5_5'UTR	NM_001282161.1|NM_003336.2|NM_181762.1	NP_001269090.1|NP_003327.2|NP_861427.1	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A	58					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|DNA repair (GO:0006281)|histone H2A ubiquitination (GO:0033522)|in utero embryonic development (GO:0001701)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of cell proliferation (GO:0008284)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|response to UV (GO:0009411)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|cytosol (GO:0005829)|HULC complex (GO:0033503)|nuclear chromatin (GO:0000790)|XY body (GO:0001741)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)	p.E58*(1)		haematopoietic_and_lymphoid_tissue(1)|lung(7)	8						ACTTACAATAGAATTCACTGA	0.299								Rad6 pathway																													p.E58X		Atlas-SNP	.											.	UBE2A	43	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G172T						PASS	.						81.0	79.0	80.0					X																	118715490		2202	4298	6500	SO:0001587	stop_gained	7319	exon4			ACAATAGAATTCA	AK223045	CCDS14580.1, CCDS14581.1	Xq24	2011-05-19	2011-05-19		ENSG00000077721	ENSG00000077721		"""Ubiquitin-conjugating enzymes E2"""	12472	protein-coding gene	gene with protein product		312180	"""ubiquitin-conjugating enzyme E2A (RAD6 homolog)"""			1559696	Standard	NM_003336		Approved	UBC2, HHR6A, RAD6A	uc004erl.3	P49459	OTTHUMG00000022275	ENST00000371558.2:c.172G>T	X.37:g.118715490G>T	ENSP00000360613:p.Glu58*	383.0	1.0	0.00261097		508.0	203.0	0.399606	NM_003336	A6NFE9|A6NGR2|A6NMF5|B2R7R9|D3DWI1|Q4TTG1|Q96FX4	Nonsense_Mutation	SNP	ENST00000371558.2	37	CCDS14580.1	.	.	.	.	.	.	.	.	.	.	G	38	7.024582	0.98010	.	.	ENSG00000077721	ENST00000371558	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-0.6356	17.9034	0.88911	0.0:0.0:1.0:0.0	.	.	.	.	X	58	.	ENSP00000360613:E58X	E	+	1	0	UBE2A	118599518	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.858000	0.99539	2.448000	0.82819	0.600000	0.82982	GAA	.	.	none		0.299	UBE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058036.1	NM_003336	
AURKAIP1	54998	hgsc.bcm.edu	37	1	1309461	1309461	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:1309461G>A	ENST00000338370.3	-	2	817	c.417C>T	c.(415-417)aaC>aaT	p.N139N	AURKAIP1_ENST00000378853.3_Silent_p.N139N|AURKAIP1_ENST00000338338.5_Silent_p.N139N|AURKAIP1_ENST00000321751.5_Silent_p.N139N|AURKAIP1_ENST00000489799.1_5'Flank			Q9NWT8	AKIP_HUMAN	aurora kinase A interacting protein 1	139					negative regulation of mitosis (GO:0045839)|positive regulation of proteolysis (GO:0045862)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|lung(2)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.82e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		ACTTGTGGTGGTTCATCTTCC	0.617																																					p.N139N		Atlas-SNP	.											.	AURKAIP1	12	.	0			c.C417T						PASS	.						101.0	100.0	100.0					1																	1309461		2203	4296	6499	SO:0001819	synonymous_variant	54998	exon3			GTGGTGGTTCATC		CCDS25.1	1p36.33	2014-02-12			ENSG00000175756	ENSG00000175756			24114	protein-coding gene	gene with protein product		609183				12244051	Standard	NM_017900		Approved	AKIP, AIP, FLJ20608	uc009vkb.1	Q9NWT8	OTTHUMG00000001413	ENST00000338370.3:c.417C>T	1.37:g.1309461G>A		63.0	0.0	0		73.0	29.0	0.39726	NM_001127230	Q5TA36|Q8TBD3	Silent	SNP	ENST00000338370.3	37	CCDS25.1																																																																																			.	.	none		0.617	AURKAIP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008273.1	NM_017900	
DRP2	1821	hgsc.bcm.edu	37	X	100509422	100509422	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:100509422C>T	ENST00000395209.3	+	18	2513	c.1986C>T	c.(1984-1986)tcC>tcT	p.S662S	DRP2_ENST00000402866.1_Silent_p.S662S|DRP2_ENST00000538510.1_Silent_p.S662S|DRP2_ENST00000541709.1_Silent_p.S584S	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	662					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						AGACCACATCCAGTGAGAACA	0.507																																					p.S662S		Atlas-SNP	.											.	DRP2	98	.	0			c.C1986T						PASS	.						110.0	81.0	90.0					X																	100509422		2203	4300	6503	SO:0001819	synonymous_variant	1821	exon18			CACATCCAGTGAG	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1986C>T	X.37:g.100509422C>T		314.0	0.0	0		351.0	67.0	0.190883	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	ENST00000395209.3	37	CCDS14480.2																																																																																			.	.	none		0.507	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
C5orf38	153571	hgsc.bcm.edu	37	5	2752510	2752510	+	Silent	SNP	G	G	A	rs181498861	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:2752510G>A	ENST00000334000.3	+	1	249	c.132G>A	c.(130-132)gcG>gcA	p.A44A	C5orf38_ENST00000505778.1_Silent_p.A44A|IRX2_ENST00000502957.1_Intron|C5orf38_ENST00000397835.4_Silent_p.A44A|IRX2_ENST00000382611.6_5'Flank|C5orf38_ENST00000457752.2_Silent_p.A44A|C5orf38_ENST00000515640.1_Silent_p.A44A|IRX2_ENST00000302057.5_5'Flank	NM_178569.2	NP_848664.1	Q86SI9	CEI_HUMAN	chromosome 5 open reading frame 38	44						extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(1)	4				GBM - Glioblastoma multiforme(108;0.205)		TACCCCTCGCGGTCCACTCCG	0.701																																					p.A44A		Atlas-SNP	.											.	C5orf38	20	.	0			c.G132A						PASS	.						14.0	16.0	15.0					5																	2752510		2199	4294	6493	SO:0001819	synonymous_variant	153571	exon1			CCTCGCGGTCCAC	AY249324	CCDS34131.1	5p15.33	2014-06-02			ENSG00000186493	ENSG00000186493			24226	protein-coding gene	gene with protein product	"""coordinated expression to IRX2"", ""IRX2 neighbor"""	610522				16515847, 16750006	Standard	XM_005248256		Approved	CEI, IRX2NB	uc003jdc.3	Q86SI9	OTTHUMG00000161741	ENST00000334000.3:c.132G>A	5.37:g.2752510G>A		58.0	0.0	0		51.0	17.0	0.333333	NM_178569		Silent	SNP	ENST00000334000.3	37	CCDS34131.1																																																																																			G|0.999;C|0.001	.	alt		0.701	C5orf38-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365956.2	NM_178569	
FNIP1	96459	hgsc.bcm.edu	37	5	131013444	131013444	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:131013444C>G	ENST00000510461.1	-	13	1566	c.1471G>C	c.(1471-1473)Gac>Cac	p.D491H	FNIP1_ENST00000511848.1_Missense_Mutation_p.D491H|FNIP1_ENST00000307954.8_Missense_Mutation_p.D446H|FNIP1_ENST00000307968.7_Missense_Mutation_p.D463H|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	491					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		GCCAACATGTCCACACTCTGA	0.398																																					p.D491H		Atlas-SNP	.											.	FNIP1	104	.	0			c.G1471C						PASS	.						128.0	124.0	125.0					5																	131013444		2203	4300	6503	SO:0001583	missense	96459	exon13			ACATGTCCACACT	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1471G>C	5.37:g.131013444C>G	ENSP00000421985:p.Asp491His	96.0	0.0	0		126.0	37.0	0.293651	NM_133372	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	37	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756687	0.89843	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.45	5.45	0.79879	.	.	.	.	.	T	0.53981	0.1830	L	0.55481	1.735	0.80722	D	1	D;D;D;P	0.89917	0.997;1.0;0.997;0.855	P;D;D;P	0.91635	0.858;0.999;0.91;0.667	T	0.53251	-0.8465	9	0.72032	D	0.01	-1.7286	19.6467	0.95778	0.0:1.0:0.0:0.0	.	491;491;463;491	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	H	463;446;251;491;491	ENSP00000309266:D463H;ENSP00000310453:D446H;ENSP00000421985:D491H;ENSP00000425619:D491H	ENSP00000310453:D446H	D	-	1	0	FNIP1	131041343	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.716000	0.92895	0.655000	0.94253	GAC	.	.	none		0.398	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
ALDH8A1	64577	hgsc.bcm.edu	37	6	135271176	135271176	+	Missense_Mutation	SNP	C	C	T	rs150345681	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:135271176C>T	ENST00000265605.2	-	1	84	c.16G>A	c.(16-18)Gca>Aca	p.A6T	ALDH8A1_ENST00000367845.2_Missense_Mutation_p.A6T|ALDH8A1_ENST00000367847.2_Missense_Mutation_p.A6T	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	6					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)	p.A6T(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		ATCAAAAGTGCGTTTGTTCCA	0.448													C|||	3	0.000599042	0.0	0.0	5008	,	,		19818	0.0		0.003	False		,,,				2504	0.0				p.A6T		Atlas-SNP	.											ALDH8A1,colon,carcinoma,0,1	ALDH8A1	68	1	1	Substitution - Missense(1)	large_intestine(1)	c.G16A						PASS	.	C	THR/ALA,THR/ALA,THR/ALA	2,4404	4.2+/-10.8	0,2,2201	103.0	103.0	103.0		16,16,16	0.7	0.0	6	dbSNP_134	103	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense,missense	ALDH8A1	NM_001193480.1,NM_022568.3,NM_170771.2	58,58,58	0,8,6495	TT,TC,CC		0.0698,0.0454,0.0615	benign,benign,benign	6/438,6/488,6/434	135271176	8,12998	2203	4300	6503	SO:0001583	missense	64577	exon1			AAAGTGCGTTTGT	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.16G>A	6.37:g.135271176C>T	ENSP00000265605:p.Ala6Thr	111.0	0.0	0		109.0	5.0	0.0458716	NM_022568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	ENST00000265605.2	37	CCDS5171.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	15.19	2.758936	0.49468	4.54E-4	6.98E-4	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.76186	-1.0;-0.99;-1.0	6.14	0.675	0.17952	.	0.376195	0.27294	N	0.020038	T	0.30293	0.0760	N	0.17082	0.46	0.09310	N	1	B;B;B	0.12013	0.003;0.005;0.003	B;B;B	0.11329	0.004;0.006;0.003	T	0.31558	-0.9939	10	0.19147	T	0.46	.	7.8484	0.29440	0.0:0.5556:0.1117:0.3328	.	6;6;6	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	T	6	ENSP00000265605:A6T;ENSP00000356819:A6T;ENSP00000356821:A6T	ENSP00000265605:A6T	A	-	1	0	ALDH8A1	135312869	0.000000	0.05858	0.000000	0.03702	0.934000	0.57294	-0.277000	0.08502	0.128000	0.18479	0.650000	0.86243	GCA	C|0.999;T|0.001	0.001	strong		0.448	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
LRP1B	53353	hgsc.bcm.edu	37	2	141259273	141259273	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:141259273G>A	ENST00000389484.3	-	55	9804	c.8833C>T	c.(8833-8835)Ctt>Ttt	p.L2945F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2945	EGF-like 11. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGACCGGAAGGTCTTGACAG	0.363										TSP Lung(27;0.18)																											p.L2945F	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.C8833T						PASS	.						112.0	115.0	114.0					2																	141259273		2203	4300	6503	SO:0001583	missense	53353	exon55			CCGGAAGGTCTTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8833C>T	2.37:g.141259273G>A	ENSP00000374135:p.Leu2945Phe	83.0	0.0	0		63.0	31.0	0.492063	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881949	0.72294	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.87887	-2.31	5.41	4.29	0.51040	Growth factor, receptor (1);EGF-like calcium-binding (1);	0.086330	0.45361	U	0.000370	D	0.83179	0.5198	M	0.73372	2.23	0.43347	D	0.995408	B	0.30664	0.289	B	0.26517	0.07	T	0.77130	-0.2701	10	0.10902	T	0.67	.	11.8149	0.52204	0.1088:0.0:0.8912:0.0	.	2945	Q9NZR2	LRP1B_HUMAN	F	2945;2883	ENSP00000374135:L2945F	ENSP00000374135:L2945F	L	-	1	0	LRP1B	140975743	1.000000	0.71417	0.996000	0.52242	0.937000	0.57800	5.559000	0.67326	1.080000	0.41073	0.585000	0.79938	CTT	.	.	none		0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TLE4	7091	hgsc.bcm.edu	37	9	82337469	82337469	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:82337469T>G	ENST00000376552.2	+	18	3108	c.2090T>G	c.(2089-2091)cTa>cGa	p.L697R	TLE4_ENST00000265284.6_Missense_Mutation_p.L672R|TLE4_ENST00000376537.4_Missense_Mutation_p.L729R|TLE4_ENST00000376520.4_Missense_Mutation_p.L729R|TLE4_ENST00000376544.3_Missense_Mutation_p.L628R|TLE4_ENST00000376534.4_Missense_Mutation_p.L334R	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	697					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						AAATACCAACTACATCTTCAT	0.488																																					p.L697R		Atlas-SNP	.											.	TLE4	187	.	0			c.T2090G						PASS	.						142.0	139.0	140.0					9																	82337469		2032	4228	6260	SO:0001583	missense	7091	exon18			ACCAACTACATCT	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.2090T>G	9.37:g.82337469T>G	ENSP00000365735:p.Leu697Arg	127.0	0.0	0		129.0	46.0	0.356589	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	37	CCDS43837.1	.	.	.	.	.	.	.	.	.	.	T	30	5.049799	0.93740	.	.	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000376534;ENST00000265284	T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.83119	0.5185	M	0.81682	2.555	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.997;1.0;1.0	D	0.85181	0.1004	10	0.87932	D	0	-13.1859	16.8222	0.85835	0.0:0.0:0.0:1.0	.	672;628;729;697	F8W6T6;Q04727-2;Q04727-3;Q04727	.;.;.;TLE4_HUMAN	R	697;628;729;729;334;672	ENSP00000365735:L697R;ENSP00000365727:L628R;ENSP00000365703:L729R;ENSP00000365720:L729R;ENSP00000365717:L334R;ENSP00000265284:L672R	ENSP00000265284:L672R	L	+	2	0	TLE4	81527289	1.000000	0.71417	0.980000	0.43619	0.992000	0.81027	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	CTA	.	.	none		0.488	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
MYO18B	84700	hgsc.bcm.edu	37	22	26164606	26164606	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:26164606G>A	ENST00000407587.2	+	4	892	c.723G>A	c.(721-723)gtG>gtA	p.V241V	MYO18B_ENST00000335473.7_Silent_p.V241V|MYO18B_ENST00000536101.1_Silent_p.V241V			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	241						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AAAGCATAGTGGGGAAGGGGC	0.637																																					p.V241V		Atlas-SNP	.											.	MYO18B	322	.	0			c.G723A						PASS	.						27.0	33.0	31.0					22																	26164606		1893	4105	5998	SO:0001819	synonymous_variant	84700	exon4			CATAGTGGGGAAG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.723G>A	22.37:g.26164606G>A		30.0	0.0	0		32.0	7.0	0.21875	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37																																																																																				.	.	none		0.637	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
CDH4	1002	hgsc.bcm.edu	37	20	60427856	60427856	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr20:60427856C>T	ENST00000360469.5	+	6	867	c.779C>T	c.(778-780)cCc>cTc	p.P260L	CDH4_ENST00000543233.1_Missense_Mutation_p.P186L	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	260	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GTGGAGAACCCCATCGACCTG	0.592																																					p.P260L		Atlas-SNP	.											.	CDH4	172	.	0			c.C779T						PASS	.						163.0	123.0	136.0					20																	60427856		2203	4300	6503	SO:0001583	missense	1002	exon6			AGAACCCCATCGA	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.779C>T	20.37:g.60427856C>T	ENSP00000353656:p.Pro260Leu	114.0	0.0	0		133.0	45.0	0.338346	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	37	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927112	0.92389	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.51817	0.69;0.69	4.76	4.76	0.60689	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.69771	0.3148	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.72802	-0.4183	9	.	.	.	.	17.758	0.88455	0.0:1.0:0.0:0.0	.	260	P55283	CADH4_HUMAN	L	260;168;186	ENSP00000353656:P260L;ENSP00000443301:P186L	.	P	+	2	0	CDH4	59861251	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.549000	0.82163	2.202000	0.70862	0.561000	0.74099	CCC	.	.	none		0.592	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
CTPS2	56474	hgsc.bcm.edu	37	X	16711587	16711587	+	Silent	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:16711587G>T	ENST00000443824.1	-	5	1205	c.462C>A	c.(460-462)atC>atA	p.I154I	CTPS2_ENST00000359276.4_Silent_p.I154I|CTPS2_ENST00000380241.3_Silent_p.I154I	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2	154					'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					GCATTCCTTCGATGTCTCCAA	0.438																																					p.I154I		Atlas-SNP	.											.	CTPS2	49	.	0			c.C462A						PASS	.						104.0	96.0	99.0					X																	16711587		2203	4300	6503	SO:0001819	synonymous_variant	56474	exon5			TCCTTCGATGTCT	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.462C>A	X.37:g.16711587G>T		188.0	0.0	0		156.0	44.0	0.282051	NM_001144002	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	Silent	SNP	ENST00000443824.1	37	CCDS14175.1																																																																																			.	.	none		0.438	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055906.1	NM_019857	
ZNF846	162993	hgsc.bcm.edu	37	19	9873975	9873975	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:9873975T>C	ENST00000397902.2	-	3	538	c.125A>G	c.(124-126)aAg>aGg	p.K42R	ZNF846_ENST00000588267.1_5'UTR|ZNF846_ENST00000586293.1_Missense_Mutation_p.K42R|ZNF846_ENST00000592859.1_Intron	NM_001077624.1	NP_001071092.1	Q147U1	ZN846_HUMAN	zinc finger protein 846	42	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22						AATGAGATTCTTGTAGTTCTC	0.413																																					p.K42R		Atlas-SNP	.											ZNF846,NS,carcinoma,0,1	ZNF846	61	1	0			c.A125G						PASS	.						109.0	114.0	113.0					19																	9873975		2202	4300	6502	SO:0001583	missense	162993	exon3			AGATTCTTGTAGT	AK097652	CCDS42496.1	19p13.2	2013-01-08			ENSG00000196605	ENSG00000196605		"""Zinc fingers, C2H2-type"", ""-"""	27260	protein-coding gene	gene with protein product							Standard	NM_001077624		Approved		uc002mmb.1	Q147U1		ENST00000397902.2:c.125A>G	19.37:g.9873975T>C	ENSP00000380999:p.Lys42Arg	54.0	0.0	0		95.0	4.0	0.0421053	NM_001077624	A8K0H1|B3KUP1	Missense_Mutation	SNP	ENST00000397902.2	37	CCDS42496.1	.	.	.	.	.	.	.	.	.	.	.	0.313	-0.966567	0.02232	.	.	ENSG00000196605	ENST00000397902	T	0.01516	4.81	2.17	-1.17	0.09648	Krueppel-associated box (4);	.	.	.	.	T	0.01156	0.0038	N	0.13168	0.305	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.48547	-0.9026	8	.	.	.	.	5.7018	0.17887	0.0:0.5061:0.0:0.4938	.	42	Q147U1	ZN846_HUMAN	R	42	ENSP00000380999:K42R	.	K	-	2	0	ZNF846	9734975	0.001000	0.12720	0.313000	0.25210	0.740000	0.42216	0.078000	0.14761	-0.400000	0.07656	0.421000	0.28195	AAG	.	.	none		0.413	ZNF846-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450253.1	NM_001077624	
PLXNC1	10154	hgsc.bcm.edu	37	12	94543629	94543629	+	Silent	SNP	C	C	T	rs560001465	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:94543629C>T	ENST00000258526.4	+	1	1131	c.882C>T	c.(880-882)ctC>ctT	p.L294L		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	294	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						GCCGCCTGCTCCTCTCCTCCA	0.746													C|||	4	0.000798722	0.0	0.0	5008	,	,		13674	0.0		0.0	False		,,,				2504	0.0041				p.L294L		Atlas-SNP	.											.	PLXNC1	135	.	0			c.C882T						PASS	.						5.0	7.0	6.0					12																	94543629		2040	4096	6136	SO:0001819	synonymous_variant	10154	exon1			CCTGCTCCTCTCC	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.882C>T	12.37:g.94543629C>T		9.0	0.0	0		9.0	6.0	0.666667	NM_005761	Q59H25	Silent	SNP	ENST00000258526.4	37	CCDS9049.1																																																																																			.	.	none		0.746	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
MBD1	4152	hgsc.bcm.edu	37	18	47799097	47799097	+	Silent	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr18:47799097A>G	ENST00000591416.1	-	15	2159	c.1728T>C	c.(1726-1728)atT>atC	p.I576I	MBD1_ENST00000590208.1_Silent_p.I576I|MBD1_ENST00000585672.1_Silent_p.I526I|MBD1_ENST00000588937.1_Silent_p.I507I|MBD1_ENST00000398495.2_Silent_p.I537I|MBD1_ENST00000436910.1_Silent_p.I507I|MBD1_ENST00000585595.1_Silent_p.I601I|MBD1_ENST00000347968.3_Silent_p.I520I|MBD1_ENST00000398488.1_Silent_p.I474I|MBD1_ENST00000587605.1_Silent_p.I474I|MBD1_ENST00000591535.1_Silent_p.I507I|MBD1_ENST00000424334.2_Silent_p.I627I|MBD1_ENST00000269471.5_Silent_p.I507I|MBD1_ENST00000457839.2_Silent_p.I601I|MBD1_ENST00000382948.5_Silent_p.I576I|MBD1_ENST00000353909.3_Silent_p.I527I|MBD1_ENST00000349085.2_Silent_p.I474I|MBD1_ENST00000269468.5_Silent_p.I576I|MBD1_ENST00000339998.6_Intron|MBD1_ENST00000398493.1_Silent_p.I520I			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	576	TRD.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						CCAGGCTGAAAATCTCCGTGA	0.577																																					p.I601I		Atlas-SNP	.											.	MBD1	228	.	0			c.T1803C						PASS	.						141.0	146.0	144.0					18																	47799097		2203	4300	6503	SO:0001819	synonymous_variant	4152	exon16			GCTGAAAATCTCC	Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1728T>C	18.37:g.47799097A>G		114.0	0.0	0		105.0	27.0	0.257143	NM_001204137	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Silent	SNP	ENST00000591416.1	37	CCDS11943.1																																																																																			.	.	none		0.577	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255926.3	NM_015846	
CRISPLD1	83690	hgsc.bcm.edu	37	8	75898242	75898242	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:75898242A>T	ENST00000262207.4	+	2	488	c.20A>T	c.(19-21)gAg>gTg	p.E7V	CRISPLD1_ENST00000519798.1_3'UTR	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	7					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			ACCGCGCGGGAGTGGCTCAGA	0.463																																					p.E7V		Atlas-SNP	.											.	CRISPLD1	94	.	0			c.A20T						PASS	.						139.0	150.0	146.0					8																	75898242		2203	4300	6503	SO:0001583	missense	83690	exon2			CGCGGGAGTGGCT	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.20A>T	8.37:g.75898242A>T	ENSP00000262207:p.Glu7Val	58.0	0.0	0		79.0	19.0	0.240506	NM_031461	B2RA60|B7Z929	Missense_Mutation	SNP	ENST00000262207.4	37	CCDS6219.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.583707	0.46006	.	.	ENSG00000121005	ENST00000262207;ENST00000520277	T;T	0.60299	0.2;1.85	5.37	5.37	0.77165	.	0.261213	0.39985	N	0.001208	T	0.48519	0.1504	L	0.47716	1.5	0.80722	D	1	B	0.20671	0.047	B	0.19946	0.027	T	0.41787	-0.9489	10	0.25751	T	0.34	.	10.6874	0.45852	0.9261:0.0:0.0738:0.0	.	7	Q9H336	CRLD1_HUMAN	V	7	ENSP00000262207:E7V;ENSP00000430504:E7V	ENSP00000262207:E7V	E	+	2	0	CRISPLD1	76060797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.642000	0.54367	2.254000	0.74563	0.460000	0.39030	GAG	.	.	none		0.463	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379117.1	NM_031461	
ZNF462	58499	hgsc.bcm.edu	37	9	109691621	109691621	+	Missense_Mutation	SNP	G	G	A	rs376844260		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:109691621G>A	ENST00000277225.5	+	3	5717	c.5428G>A	c.(5428-5430)Gtc>Atc	p.V1810I	ZNF462_ENST00000457913.1_Missense_Mutation_p.V1810I|ZNF462_ENST00000441147.2_Missense_Mutation_p.V655I			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1810					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V1810I(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CTTCACGGCCGTCTATGCAGA	0.547																																					p.V1810I		Atlas-SNP	.											ZNF462,NS,carcinoma,0,1	ZNF462	322	1	1	Substitution - Missense(1)	breast(1)	c.G5428A						PASS	.	G	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	92.0	94.0	93.0		5428	5.1	1.0	9		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF462	NM_021224.4	29	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	1810/2507	109691621	2,13004	2203	4300	6503	SO:0001583	missense	58499	exon3			ACGGCCGTCTATG	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.5428G>A	9.37:g.109691621G>A	ENSP00000277225:p.Val1810Ile	80.0	0.0	0		100.0	20.0	0.2	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166219	0.38217	2.27E-4	1.16E-4	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.05319	3.46;3.89;4.01;4.01	5.97	5.07	0.68467	.	0.110994	0.64402	N	0.000008	T	0.02727	0.0082	N	0.04508	-0.205	0.80722	D	1	P;B	0.39748	0.686;0.016	B;B	0.26094	0.066;0.008	T	0.60016	-0.7345	10	0.19590	T	0.45	.	15.0554	0.71910	0.068:0.0:0.932:0.0	.	1810;1810	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	I	1810;1810;693;655	ENSP00000277225:V1810I;ENSP00000414570:V1810I;ENSP00000363818:V693I;ENSP00000397306:V655I	ENSP00000277225:V1810I	V	+	1	0	ZNF462	108731442	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	5.989000	0.70587	1.524000	0.49035	0.591000	0.81541	GTC	.	.	weak		0.547	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
QRSL1	55278	hgsc.bcm.edu	37	6	107100238	107100238	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:107100238G>A	ENST00000369046.4	+	6	816	c.712G>A	c.(712-714)Gat>Aat	p.D238N	QRSL1_ENST00000369044.1_Missense_Mutation_p.D238N	NM_018292.4	NP_060762.3			glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1											endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		CAGATGTGTGGATGATGCAGC	0.383																																					p.D238N	NSCLC(192;2127 2142 11668 26277 49545)	Atlas-SNP	.											.	QRSL1	30	.	0			c.G712A						PASS	.						103.0	95.0	98.0					6																	107100238		2203	4300	6503	SO:0001583	missense	55278	exon6			TGTGTGGATGATG	AK001851	CCDS5057.1	6q21	2014-08-04			ENSG00000130348	ENSG00000130348			21020	protein-coding gene	gene with protein product	"""glutamyl-tRNA(Gln) amidotransferase, subunit A"""					11230166, 19805282	Standard	NM_018292		Approved	GatA, FLJ10989, FLJ12189, DKFZP564C1278, FLJ13447	uc003prm.3	Q9H0R6	OTTHUMG00000015301	ENST00000369046.4:c.712G>A	6.37:g.107100238G>A	ENSP00000358042:p.Asp238Asn	203.0	0.0	0		212.0	44.0	0.207547	NM_018292		Missense_Mutation	SNP	ENST00000369046.4	37	CCDS5057.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399837	0.62177	.	.	ENSG00000130348	ENST00000369046;ENST00000369044	T;T	0.64260	0.56;-0.09	5.93	5.93	0.95920	.	0.262307	0.42548	D	0.000688	T	0.57227	0.2039	M	0.71581	2.175	0.45172	D	0.998186	B;B	0.21821	0.02;0.061	B;B	0.27608	0.071;0.081	T	0.55068	-0.8198	10	0.46703	T	0.11	-19.3649	20.3495	0.98807	0.0:0.0:1.0:0.0	.	238;238	Q9H0R6;Q9H0R6-2	GATA_HUMAN;.	N	238	ENSP00000358042:D238N;ENSP00000358040:D238N	ENSP00000358040:D238N	D	+	1	0	QRSL1	107206931	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.726000	0.47302	2.814000	0.96858	0.591000	0.81541	GAT	.	.	none		0.383	QRSL1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041667.1	NM_018292	
NCOA3	8202	hgsc.bcm.edu	37	20	46265035	46265035	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr20:46265035C>T	ENST00000371998.3	+	12	2096	c.1905C>T	c.(1903-1905)tcC>tcT	p.S635S	NCOA3_ENST00000372004.3_Silent_p.S635S|NCOA3_ENST00000341724.6_Silent_p.S645S|NCOA3_ENST00000371997.3_Silent_p.S645S			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	635	Ser-rich.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GGGGTCATTCCTCCTTGACCA	0.473																																					p.S645S		Atlas-SNP	.											.	NCOA3	156	.	0			c.C1935T						PASS	.						79.0	71.0	74.0					20																	46265035		2203	4300	6503	SO:0001819	synonymous_variant	8202	exon12			TCATTCCTCCTTG	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.1905C>T	20.37:g.46265035C>T		104.0	0.0	0		123.0	22.0	0.178862	NM_001174088	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			.	.	none		0.473	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
SLC25A37	51312	hgsc.bcm.edu	37	8	23429088	23429088	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:23429088C>A	ENST00000519973.1	+	4	935	c.737C>A	c.(736-738)gCc>gAc	p.A246D	FP15737_ENST00000399967.3_5'Flank	NM_016612.2	NP_057696.2	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25 (mitochondrial iron transporter), member 37	246					iron ion homeostasis (GO:0055072)|mitochondrial iron ion transport (GO:0048250)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	iron ion transmembrane transporter activity (GO:0005381)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CTGGCCGGGGCCCTCGCCGCG	0.652																																					p.A246D		Atlas-SNP	.											.	SLC25A37	27	.	0			c.C737A						PASS	.						25.0	29.0	28.0					8																	23429088		1913	4111	6024	SO:0001583	missense	51312	exon4			CCGGGGCCCTCGC	AF495725	CCDS47828.1	8p21.2	2013-05-22	2012-03-29		ENSG00000147454	ENSG00000147454		"""Solute carriers"""	29786	protein-coding gene	gene with protein product	"""mitoferrin"""	610387	"""solute carrier family 25, member 37"""			16511496	Standard	XM_006716352		Approved	MSCP, MFRN, MFRN1	uc003xdo.3	Q9NYZ2	OTTHUMG00000163865	ENST00000519973.1:c.737C>A	8.37:g.23429088C>A	ENSP00000429200:p.Ala246Asp	56.0	0.0	0		57.0	32.0	0.561404	NM_016612	A2RU93|Q53FT7|Q69YJ8|Q969S1|Q9P0J2	Missense_Mutation	SNP	ENST00000519973.1	37	CCDS47828.1	.	.	.	.	.	.	.	.	.	.	C	30	5.055259	0.93793	.	.	ENSG00000147454	ENST00000519973	D	0.81821	-1.54	5.8	5.8	0.92144	Mitochondrial carrier domain (2);	0.046862	0.85682	D	0.000000	D	0.93973	0.8070	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.95648	0.8704	10	0.72032	D	0.01	1.0198	18.6148	0.91299	0.0:1.0:0.0:0.0	.	246	Q9NYZ2	MFRN1_HUMAN	D	246	ENSP00000429200:A246D	ENSP00000429200:A246D	A	+	2	0	SLC25A37	23485033	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.473000	0.81007	2.740000	0.93945	0.650000	0.86243	GCC	.	.	none		0.652	SLC25A37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376039.1	NM_016612	
C14orf37	145407	hgsc.bcm.edu	37	14	58598352	58598352	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr14:58598352T>C	ENST00000267485.7	-	4	1903	c.1709A>G	c.(1708-1710)gAa>gGa	p.E570G	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	570						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						AATGCTGGGTTCCCCCACCAT	0.493																																					p.E570G		Atlas-SNP	.											C14orf37,NS,carcinoma,-1,1	C14orf37	87	1	0			c.A1709G						PASS	.						114.0	107.0	109.0					14																	58598352		2203	4300	6503	SO:0001583	missense	145407	exon4			CTGGGTTCCCCCA		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1709A>G	14.37:g.58598352T>C	ENSP00000267485:p.Glu570Gly	111.0	0.0	0		110.0	40.0	0.363636	NM_001001872	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	ENST00000267485.7	37	CCDS32089.1	.	.	.	.	.	.	.	.	.	.	T	5.939	0.357220	0.11239	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.18338	2.22	5.78	-2.62	0.06152	.	1.333660	0.04700	N	0.415699	T	0.10252	0.0251	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.26400	0.039;0.148;0.039;0.039	B;B;B;B	0.24394	0.023;0.053;0.023;0.023	T	0.28038	-1.0056	10	0.32370	T	0.25	0.0768	4.1407	0.10191	0.2759:0.0:0.3626:0.3615	.	608;570;570;570	B4DMS4;Q86TY3-2;A8K990;Q86TY3	.;.;.;CN037_HUMAN	G	570;608	ENSP00000267485:E570G	ENSP00000267485:E570G	E	-	2	0	C14orf37	57668105	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.036000	0.13819	-0.865000	0.04073	-0.219000	0.12488	GAA	.	.	none		0.493	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872	
BLVRB	645	hgsc.bcm.edu	37	19	40964385	40964385	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:40964385G>A	ENST00000263368.4	-	2	298	c.147C>T	c.(145-147)caC>caT	p.H49H	BLVRB_ENST00000595483.1_Silent_p.H49H	NM_000713.2	NP_000704.1	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase (NADPH))	49					heme catabolic process (GO:0042167)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	biliverdin reductase activity (GO:0004074)|riboflavin reductase (NADPH) activity (GO:0042602)			large_intestine(3)|lung(3)	6			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		Riboflavin(DB00140)	CCACTACCACGTGGGCCGGCC	0.637																																					p.H49H		Atlas-SNP	.											.	BLVRB	12	.	0			c.C147T						PASS	.																																			SO:0001819	synonymous_variant	645	exon2			TACCACGTGGGCC	D26308	CCDS33029.1	19q13.1-q13.2	2011-09-14				ENSG00000090013	1.3.1.24, 1.5.1.30	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	1063	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 43U, member 1"""	600941	"""Flavin reductase"""	FLR		7656592, 19027726	Standard	NM_000713		Approved	SDR43U1	uc002onw.2	P30043		ENST00000263368.4:c.147C>T	19.37:g.40964385G>A		84.0	0.0	0		92.0	51.0	0.554348	NM_000713	A6NKD8|B2R5C6|P32078|P53005|Q32LZ2	Silent	SNP	ENST00000263368.4	37	CCDS33029.1																																																																																			.	.	none		0.637	BLVRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462563.1		
PCDHB4	56131	hgsc.bcm.edu	37	5	140503797	140503797	+	Silent	SNP	C	C	T	rs561916518		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:140503797C>T	ENST00000194152.1	+	1	2217	c.2217C>T	c.(2215-2217)agC>agT	p.S739S		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	739					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGACGTAAGCGGCACCGGGA	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		14549	0.0		0.001	False		,,,				2504	0.0				p.S739S		Atlas-SNP	.											.	PCDHB4	177	.	0			c.C2217T						PASS	.						84.0	96.0	92.0					5																	140503797		2203	4300	6503	SO:0001819	synonymous_variant	56131	exon1			CGTAAGCGGCACC	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.2217C>T	5.37:g.140503797C>T		100.0	0.0	0		81.0	4.0	0.0493827	NM_018938	Q4V761	Silent	SNP	ENST00000194152.1	37	CCDS4246.1																																																																																			.	.	none		0.622	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
EBLN1	340900	hgsc.bcm.edu	37	10	22498749	22498749	+	Missense_Mutation	SNP	A	A	T	rs2478476	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:22498749A>T	ENST00000422359.2	-	1	201	c.164T>A	c.(163-165)gTc>gAc	p.V55D		NM_001199938.1	NP_001186867.1	P0CF75	EBLN1_HUMAN	endogenous Bornavirus-like nucleoprotein 1	55																	TTTTTCAATGACCTTAACATC	0.418													T|||	5002	0.998802	0.9992	0.9957	5008	,	,		18594	1.0		0.998	False		,,,				2504	1.0				p.V55D		Atlas-SNP	.											.	.	.	.	0			c.T164A						PASS	.																																			SO:0001583	missense	340900	exon1			TCAATGACCTTAA	AA813437	CCDS60498.1	10p12.31	2013-01-30			ENSG00000223601	ENSG00000223601			39430	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 1"""	613249				20054395, 20686665	Standard	NM_001199938		Approved		uc021pob.1	P0CF75	OTTHUMG00000017801	ENST00000422359.2:c.164T>A	10.37:g.22498749A>T	ENSP00000473842:p.Val55Asp	0.0	0.0	.		4.0	4.0	1	NM_001199938	S4R316	Missense_Mutation	SNP	ENST00000422359.2	37																																																																																				A|0.001;T|0.999	0.999	strong		0.418	EBLN1-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047154.3	NM_001199938	
CCDC87	55231	hgsc.bcm.edu	37	11	66359191	66359191	+	Silent	SNP	A	A	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:66359191A>T	ENST00000333861.3	-	1	1363	c.1296T>A	c.(1294-1296)acT>acA	p.T432T	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	432					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TAAGCTTCAAAGTAATGGTCA	0.552																																					p.T432T		Atlas-SNP	.											.	CCDC87	83	.	0			c.T1296A						PASS	.						38.0	43.0	41.0					11																	66359191		2200	4295	6495	SO:0001819	synonymous_variant	55231	exon1			CTTCAAAGTAATG	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1296T>A	11.37:g.66359191A>T		54.0	0.0	0		75.0	25.0	0.333333	NM_018219	Q8NE76	Silent	SNP	ENST00000333861.3	37	CCDS8145.1																																																																																			.	.	none		0.552	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219	
REL	5966	hgsc.bcm.edu	37	2	61147230	61147230	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:61147230T>A	ENST00000295025.8	+	8	1228	c.908T>A	c.(907-909)cTg>cAg	p.L303Q	REL_ENST00000394479.3_Missense_Mutation_p.L303Q	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	303					cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			TTCCAGAAACTGTGCCAGGAT	0.289			A		Hodgkin Lymphoma																																p.L303Q		Atlas-SNP	.		Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	.	REL	48	.	0			c.T908A						PASS	.						79.0	80.0	80.0					2																	61147230		2203	4300	6503	SO:0001583	missense	5966	exon8			AGAAACTGTGCCA	M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.908T>A	2.37:g.61147230T>A	ENSP00000295025:p.Leu303Gln	403.0	0.0	0		444.0	163.0	0.367117	NM_002908	Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	ENST00000295025.8	37	CCDS1864.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.188258	0.57909	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.48522	0.81;0.81	5.49	5.49	0.81192	Immunoglobulin E-set (1);	0.423339	0.21659	N	0.071053	T	0.63319	0.2501	L	0.59436	1.845	0.42356	D	0.992391	D;D	0.89917	0.999;1.0	D;D	0.71184	0.956;0.972	T	0.63427	-0.6640	10	0.46703	T	0.11	-42.4869	13.2498	0.60045	0.0:0.0:0.0:1.0	.	303;303	Q17RU2;Q04864	.;REL_HUMAN	Q	303	ENSP00000295025:L303Q;ENSP00000377989:L303Q	ENSP00000295025:L303Q	L	+	2	0	REL	61000734	0.935000	0.31712	0.991000	0.47740	0.502000	0.33828	4.438000	0.59961	2.213000	0.71641	0.397000	0.26171	CTG	.	.	none		0.289	REL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251576.3	NM_002908	
NEUROD1	4760	hgsc.bcm.edu	37	2	182543437	182543437	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:182543437C>A	ENST00000295108.3	-	2	608	c.151G>T	c.(151-153)Gac>Tac	p.D51Y	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	51					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.D51Y(1)		endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CTCAGTGAGTCCTCCTCTGCG	0.562																																					p.D51Y		Atlas-SNP	.											NEUROD1,NS,carcinoma,0,1	NEUROD1	67	1	1	Substitution - Missense(1)	lung(1)	c.G151T						PASS	.						133.0	103.0	113.0					2																	182543437		2203	4300	6503	SO:0001583	missense	4760	exon2			GTGAGTCCTCCTC	U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.151G>T	2.37:g.182543437C>A	ENSP00000295108:p.Asp51Tyr	133.0	0.0	0		187.0	70.0	0.374332	NM_002500	B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	ENST00000295108.3	37	CCDS2283.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070590	0.76301	.	.	ENSG00000162992	ENST00000295108	D	0.95588	-3.75	5.9	5.9	0.94986	.	0.281498	0.32503	N	0.006008	D	0.91885	0.7431	L	0.40543	1.245	0.58432	D	0.999998	P	0.49090	0.919	B	0.34779	0.189	D	0.92806	0.6260	10	0.62326	D	0.03	-0.0043	17.7728	0.88497	0.0:1.0:0.0:0.0	.	51	Q13562	NDF1_HUMAN	Y	51	ENSP00000295108:D51Y	ENSP00000295108:D51Y	D	-	1	0	NEUROD1	182251682	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.332000	0.43903	2.788000	0.95919	0.650000	0.86243	GAC	.	.	none		0.562	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255792.2	NM_002500	
GLTSCR1L	23506	hgsc.bcm.edu	37	6	42797411	42797411	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:42797411A>T	ENST00000314073.5	+	6	1516	c.1340A>T	c.(1339-1341)aAc>aTc	p.N447I	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.N447I			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	447																	TTGAACAGAAACTCTTCCAAC	0.478																																					p.N447I		Atlas-SNP	.											KIAA0240,NS,carcinoma,-1,1	.	.	1	0			c.A1340T						PASS	.						179.0	175.0	177.0					6																	42797411		2203	4300	6503	SO:0001583	missense	23506	exon5			ACAGAAACTCTTC	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1340A>T	6.37:g.42797411A>T	ENSP00000313933:p.Asn447Ile	73.0	0.0	0		89.0	46.0	0.516854	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	37	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.424540	0.43020	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.48836	0.8;0.8	5.87	0.737	0.18314	.	0.368457	0.28730	N	0.014329	T	0.18635	0.0447	L	0.44542	1.39	0.40580	D	0.981383	B;P;P	0.40834	0.226;0.631;0.73	B;B;B	0.37304	0.176;0.165;0.246	T	0.02391	-1.1166	10	0.41790	T	0.15	-5.3689	6.926	0.24416	0.6928:0.1162:0.191:0.0	.	447;447;447	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	I	447	ENSP00000313933:N447I;ENSP00000377723:N447I	ENSP00000313933:N447I	N	+	2	0	KIAA0240	42905389	0.975000	0.34042	0.824000	0.32777	0.974000	0.67602	1.117000	0.31234	0.190000	0.20209	0.533000	0.62120	AAC	.	.	none		0.478	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
ANKHD1	54882	hgsc.bcm.edu	37	5	139917069	139917069	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:139917069C>T	ENST00000360839.2	+	31	7277	c.7123C>T	c.(7123-7125)Cga>Tga	p.R2375*	ANKHD1-EIF4EBP3_ENST00000532219.1_Nonsense_Mutation_p.R2375*|ANKHD1_ENST00000544120.1_Nonsense_Mutation_p.R699*|ANKHD1_ENST00000297183.6_Nonsense_Mutation_p.R2375*	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2375						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGACTGGCCCGAATTCGGCA	0.552																																					p.R2375X		Atlas-SNP	.											.	ANKHD1	233	.	0			c.C7123T						PASS	.						98.0	92.0	94.0					5																	139917069		2203	4300	6503	SO:0001587	stop_gained	54882	exon31			CTGGCCCGAATTC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.7123C>T	5.37:g.139917069C>T	ENSP00000354085:p.Arg2375*	153.0	0.0	0		162.0	65.0	0.401235	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Nonsense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	39|39	7.365931|7.365931	0.98238|0.98238	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996;ENSG00000254996	ENST00000435794;ENST00000432301|ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000433049;ENST00000544120;ENST00000532219;ENST00000437495	.|.	.|.	.|.	6.08|6.08	5.19|5.19	0.71726|0.71726	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.36991|.	0.0987|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35748|.	-0.9776|.	3|.	.|0.02654	.|T	.|1	.|.	14.9548|14.9548	0.71104|0.71104	0.2808:0.7192:0.0:0.0|0.2808:0.7192:0.0:0.0	.|.	.|.	.|.	.|.	L|X	865;766|2375;2375;2392;1048;914;699;2375;403	.|.	.|ENSP00000396882:R403X	P|R	+|+	2|1	0|2	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139897253|139897253	0.993000|0.993000	0.37304|0.37304	0.999000|0.999000	0.59377|0.59377	0.992000|0.992000	0.81027|0.81027	3.195000|3.195000	0.51013|0.51013	1.523000|1.523000	0.49018|0.49018	0.591000|0.591000	0.81541|0.81541	CCG|CGA	.	.	none		0.552	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
SLC25A17	10478	hgsc.bcm.edu	37	22	41188619	41188619	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:41188619A>C	ENST00000435456.2	-	4	377	c.244T>G	c.(244-246)Tat>Gat	p.Y82D	SLC25A17_ENST00000491545.1_5'UTR|SLC25A17_ENST00000544408.1_Missense_Mutation_p.Y45D|SLC25A17_ENST00000542412.1_Intron	NM_006358.2	NP_006349.1	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17	82	Necessary for targeting to peroxisomes and interaction with PEX19.				ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|cellular lipid metabolic process (GO:0044255)|coenzyme A transmembrane transport (GO:0035349)|FAD transmembrane transport (GO:0035350)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|fatty acid transport (GO:0015908)|NAD transport (GO:0043132)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|chaperone binding (GO:0051087)|coenzyme A transmembrane transporter activity (GO:0015228)|FAD transmembrane transporter activity (GO:0015230)|FMN transmembrane transporter activity (GO:0044610)|NAD transporter activity (GO:0051724)			central_nervous_system(1)|large_intestine(4)|lung(2)|skin(1)	8						gtgtagaaatagacaaaattg	0.433																																					p.Y82D		Atlas-SNP	.											.	SLC25A17	25	.	0			c.T244G						PASS	.						75.0	73.0	74.0					22																	41188619		2203	4300	6503	SO:0001583	missense	10478	exon4			AGAAATAGACAAA	Y12860	CCDS14005.1, CCDS74868.1	22q13.2	2013-05-22	2002-08-29		ENSG00000100372	ENSG00000100372		"""Solute carriers"""	10987	protein-coding gene	gene with protein product	"""peroxisomal membrane protein (34kD)"""	606795	"""solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kD), member 17"""			9874197	Standard	NM_006358		Approved	PMP34	uc003azc.3	O43808	OTTHUMG00000151139	ENST00000435456.2:c.244T>G	22.37:g.41188619A>C	ENSP00000390722:p.Tyr82Asp	150.0	0.0	0		161.0	38.0	0.236025	NM_006358	A8KA59|Q5TFL0|Q9UGW8|Q9UGY7	Missense_Mutation	SNP	ENST00000435456.2	37	CCDS14005.1	.	.	.	.	.	.	.	.	.	.	A	8.423	0.846912	0.17034	.	.	ENSG00000100372	ENST00000435456;ENST00000544408;ENST00000434185	T;T;T	0.80123	-1.34;-1.34;-1.34	1.83	1.83	0.25207	Mitochondrial carrier domain (2);	0.065605	0.64402	D	0.000006	D	0.89705	0.6792	M	0.93241	3.395	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	D	0.88155	0.2853	10	0.72032	D	0.01	-27.4517	5.7627	0.18209	1.0:0.0:0.0:0.0	.	45;82	B4DU97;O43808	.;PM34_HUMAN	D	82;45;65	ENSP00000390722:Y82D;ENSP00000438355:Y45D;ENSP00000404200:Y65D	ENSP00000394539:Y82D	Y	-	1	0	SLC25A17	39518565	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.290000	0.43531	1.108000	0.41662	0.327000	0.21459	TAT	.	.	none		0.433	SLC25A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321487.1	NM_006358	
PRKD1	5587	hgsc.bcm.edu	37	14	30046446	30046446	+	Nonstop_Mutation	SNP	A	A	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr14:30046446A>T	ENST00000331968.5	-	18	2966	c.2737T>A	c.(2737-2739)Tga>Aga	p.*913R	PRKD1_ENST00000415220.2_Nonstop_Mutation_p.*921R	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	0					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GATGGAACTCAGAGGATGCTG	0.443																																					p.X913R		Atlas-SNP	.											.	PRKD1	316	.	0			c.T2737A						PASS	.						99.0	87.0	91.0					14																	30046446		2203	4300	6503	SO:0001578	stop_lost	5587	exon18			GAACTCAGAGGAT		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2737T>A	14.37:g.30046446A>T		212.0	0.0	0		205.0	49.0	0.239024	NM_002742	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	37	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.076302	0.76415	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	.	.	.	R	913;921	.	.	X	-	1	0	PRKD1	29116197	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.300000	0.96151	2.308000	0.77769	0.533000	0.62120	TGA	.	.	none		0.443	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
IDNK	414328	hgsc.bcm.edu	37	9	86258428	86258428	+	Silent	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:86258428T>C	ENST00000376419.4	+	5	301	c.297T>C	c.(295-297)gaT>gaC	p.D99D	IDNK_ENST00000405990.3_3'UTR|IDNK_ENST00000454393.1_Silent_p.D142D|IDNK_ENST00000376417.4_Missense_Mutation_p.W85R|IDNK_ENST00000277124.8_Silent_p.D53D	NM_001001551.3	NP_001001551.2	Q5T6J7	GNTK_HUMAN	idnK, gluconokinase homolog (E. coli)	99					D-gluconate catabolic process (GO:0046177)		ATP binding (GO:0005524)|gluconokinase activity (GO:0046316)										AAGGAAAAGATGGTGTAGCTC	0.493																																					p.D99D		Atlas-SNP	.											C9orf103,colon,carcinoma,+2,1	.	.	1	0			c.T297C						PASS	.						80.0	80.0	80.0					9																	86258428		2203	4300	6503	SO:0001819	synonymous_variant	414328	exon5			AAAAGATGGTGTA	BC036421	CCDS35048.1, CCDS35048.2, CCDS59134.1	9q21.32	2012-03-30	2012-03-30	2012-03-30	ENSG00000148057	ENSG00000148057			31367	protein-coding gene	gene with protein product		611343	"""chromosome 9 open reading frame 103"""	C9orf103			Standard	NM_001001551		Approved	bA522I20.2	uc004amu.3	Q5T6J7	OTTHUMG00000020105	ENST00000376419.4:c.297T>C	9.37:g.86258428T>C		116.0	0.0	0		152.0	31.0	0.203947	NM_001001551	A5PLN6|Q5T6J6	Silent	SNP	ENST00000376419.4	37	CCDS35048.2	.	.	.	.	.	.	.	.	.	.	T	6.660	0.490211	0.12702	.	.	ENSG00000148057	ENST00000376417	.	.	.	5.53	-7.14	0.01527	.	.	.	.	.	T	0.24547	0.0595	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39354	-0.9618	5	0.87932	D	0	-7.5855	1.0152	0.01505	0.2267:0.2169:0.3482:0.2082	.	.	.	.	R	85	.	ENSP00000365599:W85R	W	+	1	0	C9orf103	85448248	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.065000	0.11617	-1.401000	0.02058	-1.262000	0.01453	TGG	.	.	none		0.493	IDNK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052837.2	NM_001001551	
PON3	5446	hgsc.bcm.edu	37	7	95025645	95025645	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:95025645C>T	ENST00000265627.5	-	1	28	c.18G>A	c.(16-18)gcG>gcA	p.A6A	PON3_ENST00000427422.1_Silent_p.A6A|PON3_ENST00000475439.1_5'Flank|PON1_ENST00000542556.1_Silent_p.A6A|PON3_ENST00000451904.1_Silent_p.A6A	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	6					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	GCAGGACCAGCGCCACGAGCT	0.672																																					p.A6A		Atlas-SNP	.											PON3,NS,carcinoma,-1,1	PON3	59	1	0			c.G18A						PASS	.						97.0	87.0	91.0					7																	95025645		2203	4300	6503	SO:0001819	synonymous_variant	5446	exon1			GACCAGCGCCACG	L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.18G>A	7.37:g.95025645C>T		72.0	0.0	0		47.0	9.0	0.191489	NM_000940	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Silent	SNP	ENST00000265627.5	37	CCDS5639.1																																																																																			.	.	none		0.672	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333007.1	NM_000940	
EIF3D	8664	hgsc.bcm.edu	37	22	36907798	36907798	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:36907798C>T	ENST00000216190.8	-	14	1755	c.1385G>A	c.(1384-1386)cGc>cAc	p.R462H	EIF3D_ENST00000541106.1_Missense_Mutation_p.R413H|EIF3D_ENST00000478547.1_5'Flank|EIF3D_ENST00000405442.1_Missense_Mutation_p.R462H	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						GATGACGTGGCGTGAGGAGTC	0.532											OREG0026522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R462H		Atlas-SNP	.											.	EIF3D	37	.	0			c.G1385A						PASS	.						98.0	72.0	81.0					22																	36907798		2203	4300	6503	SO:0001583	missense	8664	exon14			ACGTGGCGTGAGG	U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1385G>A	22.37:g.36907798C>T	ENSP00000216190:p.Arg462His	180.0	0.0	0	866	194.0	90.0	0.463918	NM_003753		Missense_Mutation	SNP	ENST00000216190.8	37	CCDS13930.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166071	0.78339	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442;ENST00000426531;ENST00000458572	.	.	.	6.07	5.04	0.67666	.	0.044401	0.85682	D	0.000000	T	0.47673	0.1458	L	0.39326	1.205	0.80722	D	1	B;P	0.38565	0.162;0.637	B;B	0.31547	0.017;0.132	T	0.45323	-0.9269	9	0.34782	T	0.22	-13.3282	17.384	0.87411	0.0:0.8752:0.1248:0.0	.	413;462	B4DVY1;O15371	.;EIF3D_HUMAN	H	462;447;413;462;115;149	.	ENSP00000216190:R462H	R	-	2	0	EIF3D	35237744	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	7.129000	0.77225	1.554000	0.49487	0.655000	0.94253	CGC	.	.	none		0.532	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319026.1		
IL4R	3566	hgsc.bcm.edu	37	16	27373599	27373599	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:27373599T>C	ENST00000395762.2	+	11	1185	c.926T>C	c.(925-927)cTc>cCc	p.L309P	IL4R_ENST00000170630.2_Missense_Mutation_p.L309P|IL4R_ENST00000543915.2_Missense_Mutation_p.L309P|IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000380922.3_Missense_Mutation_p.L294P	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	309					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						CTTACCAAGCTCTTGCCCTGT	0.468																																					p.L309P		Atlas-SNP	.											.	IL4R	70	.	0			c.T926C						PASS	.						84.0	93.0	90.0					16																	27373599		2197	4300	6497	SO:0001583	missense	3566	exon11			CCAAGCTCTTGCC	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.926T>C	16.37:g.27373599T>C	ENSP00000379111:p.Leu309Pro	128.0	0.0	0		129.0	21.0	0.162791	NM_000418	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657837	0.67586	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	4.8	4.8	0.61643	.	0.430475	0.18627	N	0.135694	T	0.37019	0.0988	M	0.62723	1.935	0.48087	D	0.999589	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.991;0.991	T	0.08289	-1.0729	10	0.62326	D	0.03	-23.6721	10.7721	0.46330	0.0:0.0:0.0:1.0	.	294;309;309	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	P	309;309;294;309	ENSP00000379111:L309P;ENSP00000441667:L309P;ENSP00000370309:L294P;ENSP00000170630:L309P	ENSP00000170630:L309P	L	+	2	0	IL4R	27281100	1.000000	0.71417	0.980000	0.43619	0.957000	0.61999	3.498000	0.53302	1.801000	0.52704	0.533000	0.62120	CTC	.	.	none		0.468	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
ZNF101	94039	hgsc.bcm.edu	37	19	19790525	19790525	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:19790525C>T	ENST00000592502.1	+	4	837	c.727C>T	c.(727-729)Cat>Tat	p.H243Y	ZNF101_ENST00000444249.2_3'UTR|ZNF101_ENST00000415784.2_Missense_Mutation_p.H123Y			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						ATTTCAAATTCATGTTAGAAC	0.358																																					p.H243Y		Atlas-SNP	.											.	ZNF101	43	.	0			c.C727T						PASS	.						31.0	32.0	32.0					19																	19790525		2203	4300	6503	SO:0001583	missense	94039	exon4			CAAATTCATGTTA	AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.727C>T	19.37:g.19790525C>T	ENSP00000468049:p.His243Tyr	50.0	0.0	0		54.0	13.0	0.240741	NM_033204	C9JU83|Q0VDG9	Missense_Mutation	SNP	ENST00000592502.1	37	CCDS32971.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923897	0.73213	.	.	ENSG00000181896	ENST00000318110;ENST00000415440;ENST00000415784	D;D	0.86769	-2.17;-2.17	0.235	0.235	0.15431	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93569	0.7947	M	0.93763	3.455	0.30664	N	0.754114	D	0.89917	1.0	D	0.91635	0.999	D	0.87769	0.2604	8	.	.	.	.	6.2532	0.20859	0.0:0.9997:0.0:3.0E-4	.	243	Q8IZC7	ZN101_HUMAN	Y	243;243;123	ENSP00000319716:H243Y;ENSP00000400952:H123Y	.	H	+	1	0	ZNF101	19651525	0.996000	0.38824	0.884000	0.34674	0.883000	0.51084	5.267000	0.65530	0.308000	0.22923	0.313000	0.20887	CAT	.	.	none		0.358	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460559.1	NM_033204	
MYH6	4624	hgsc.bcm.edu	37	14	23865523	23865523	+	Missense_Mutation	SNP	C	C	T	rs535438755		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr14:23865523C>T	ENST00000356287.3	-	19	2428	c.2399G>A	c.(2398-2400)cGc>cAc	p.R800H	MYH6_ENST00000405093.3_Missense_Mutation_p.R800H			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	800	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GAACTCAATGCGCATGAGCTG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		18438	0.0		0.0	False		,,,				2504	0.001				p.R800H		Atlas-SNP	.											MYH6,NS,carcinoma,-1,1	MYH6	274	1	0			c.G2399A						PASS	.						101.0	89.0	93.0					14																	23865523		2203	4300	6503	SO:0001583	missense	4624	exon20			TCAATGCGCATGA	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2399G>A	14.37:g.23865523C>T	ENSP00000348634:p.Arg800His	121.0	0.0	0		136.0	63.0	0.463235	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	37	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	20.4	3.991779	0.74703	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.77098	-1.07;-1.07	4.78	4.78	0.61160	.	.	.	.	.	D	0.91915	0.7440	H	0.96365	3.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.72075	0.976	D	0.94612	0.7805	9	0.87932	D	0	.	18.1704	0.89743	0.0:1.0:0.0:0.0	.	800	P13533	MYH6_HUMAN	H	800	ENSP00000386041:R800H;ENSP00000348634:R800H	ENSP00000348634:R800H	R	-	2	0	MYH6	22935363	1.000000	0.71417	1.000000	0.80357	0.200000	0.23975	7.522000	0.81844	2.382000	0.81193	0.650000	0.86243	CGC	.	.	none		0.577	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
XIRP2	129446	hgsc.bcm.edu	37	2	168107691	168107691	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:168107691G>T	ENST00000409195.1	+	9	9878	c.9789G>T	c.(9787-9789)agG>agT	p.R3263S	XIRP2_ENST00000295237.9_Missense_Mutation_p.R3263S|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.R3041S|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3088					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGGAAATCAGGAAAGTGGAGA	0.423																																					p.R3263S		Atlas-SNP	.											.	XIRP2	914	.	0			c.G9789T						PASS	.						70.0	66.0	67.0					2																	168107691		1908	4138	6046	SO:0001583	missense	129446	exon9			AATCAGGAAAGTG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9789G>T	2.37:g.168107691G>T	ENSP00000386840:p.Arg3263Ser	76.0	0.0	0		108.0	10.0	0.0925926	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	8.433	0.849012	0.17034	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02656	4.21;4.21;4.21	5.61	4.73	0.59995	.	0.251797	0.42053	D	0.000767	T	0.04003	0.0112	L	0.56769	1.78	0.34058	D	0.656942	P;P;P	0.46142	0.651;0.763;0.873	B;B;B	0.39660	0.084;0.173;0.306	T	0.40961	-0.9535	10	0.39692	T	0.17	-11.0608	8.8487	0.35186	0.17:0.0:0.83:0.0	.	3088;3088;3041	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	S	3263;3263;3041;677	ENSP00000386840:R3263S;ENSP00000295237:R3263S;ENSP00000387255:R3041S	ENSP00000295237:R3263S	R	+	3	2	XIRP2	167815937	0.962000	0.33011	0.852000	0.33557	0.171000	0.22731	1.442000	0.35046	1.504000	0.48704	0.460000	0.39030	AGG	.	.	none		0.423	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
CDC42BPG	55561	hgsc.bcm.edu	37	11	64594201	64594201	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:64594201C>T	ENST00000342711.5	-	35	4454	c.4455G>A	c.(4453-4455)gaG>gaA	p.E1485E		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						GCCGCAACGCCTCGGAGAAGC	0.711																																					p.E1485E		Atlas-SNP	.											.	CDC42BPG	101	.	0			c.G4455A						PASS	.						11.0	15.0	14.0					11																	64594201		2184	4250	6434	SO:0001819	synonymous_variant	55561	exon35			CAACGCCTCGGAG	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.4455G>A	11.37:g.64594201C>T		49.0	0.0	0		16.0	10.0	0.625	NM_017525		Silent	SNP	ENST00000342711.5	37	CCDS31601.1																																																																																			.	.	none		0.711	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
CHD4	1108	hgsc.bcm.edu	37	12	6710854	6710854	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:6710854G>A	ENST00000357008.2	-	5	680	c.517C>T	c.(517-519)Cga>Tga	p.R173*	CHD4_ENST00000309577.6_Nonsense_Mutation_p.R173*|CHD4_ENST00000544484.1_Nonsense_Mutation_p.R170*|CHD4_ENST00000544040.1_Nonsense_Mutation_p.R166*	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	173					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						GTGAGGGTTCGATAATCCTCC	0.488																																					p.R173X	Colon(32;586 792 4568 16848 45314)	Atlas-SNP	.											CHD4_ENST00000357008,NS,malignant_melanoma,0,3	CHD4	539	3	0			c.C517T						scavenged	.						274.0	278.0	277.0					12																	6710854		2203	4300	6503	SO:0001587	stop_gained	1108	exon5			GGGTTCGATAATC	X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.517C>T	12.37:g.6710854G>A	ENSP00000349508:p.Arg173*	174.0	1.0	0.00574713		221.0	75.0	0.339367	NM_001273	Q8IXZ5	Nonsense_Mutation	SNP	ENST00000357008.2	37	CCDS8552.1	.	.	.	.	.	.	.	.	.	.	G	37	6.145184	0.97324	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464;ENST00000545942	.	.	.	5.87	5.87	0.94306	.	0.228496	0.32081	N	0.006603	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-0.807	16.49	0.84198	0.0:0.0:0.8686:0.1314	.	.	.	.	X	170;166;173;173;147;173	.	ENSP00000312419:R173X	R	-	1	2	CHD4	6581115	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.382000	0.79729	2.774000	0.95407	0.650000	0.86243	CGA	.	.	none		0.488	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001273	
LAMA5	3911	hgsc.bcm.edu	37	20	60892438	60892438	+	Missense_Mutation	SNP	C	C	T	rs373181217		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr20:60892438C>T	ENST00000252999.3	-	55	7540	c.7474G>A	c.(7474-7476)Gca>Aca	p.A2492T		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2492	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AGCTGCTGTGCGTGGGCCTCG	0.701																																					p.A2492T		Atlas-SNP	.											.	LAMA5	268	.	0			c.G7474A						PASS	.		THR/ALA	1,4311		0,1,2155	13.0	16.0	15.0		7474	3.5	0.8	20		15	1,8509		0,1,4254	no	missense	LAMA5	NM_005560.3	58	0,2,6409	TT,TC,CC		0.0118,0.0232,0.0156	probably-damaging	2492/3696	60892438	2,12820	2156	4255	6411	SO:0001583	missense	3911	exon55			GCTGTGCGTGGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7474G>A	20.37:g.60892438C>T	ENSP00000252999:p.Ala2492Thr	39.0	0.0	0		25.0	9.0	0.36	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	c	25.3	4.629064	0.87560	2.32E-4	1.18E-4	ENSG00000130702	ENST00000252999	T	0.39592	1.07	3.54	3.54	0.40534	.	0.000000	0.85682	U	0.000000	T	0.64349	0.2590	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.71227	-0.4655	10	0.72032	D	0.01	.	14.7386	0.69437	0.0:1.0:0.0:0.0	.	2492	O15230	LAMA5_HUMAN	T	2492	ENSP00000252999:A2492T	ENSP00000252999:A2492T	A	-	1	0	LAMA5	60325833	1.000000	0.71417	0.833000	0.33012	0.717000	0.41224	7.039000	0.76544	1.522000	0.49001	0.436000	0.28706	GCA	.	.	weak		0.701	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
PDZD7	79955	hgsc.bcm.edu	37	10	102778029	102778029	+	Missense_Mutation	SNP	T	T	G	rs555444131	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:102778029T>G	ENST00000370215.3	-	9	1574	c.1349A>C	c.(1348-1350)gAg>gCg	p.E450A		NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	450						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCCGACTTCTCCTTCTTCCG	0.667																																					p.E450A		Atlas-SNP	.											.	PDZD7	101	.	0			c.A1349C						PASS	.						42.0	42.0	42.0					10																	102778029		2203	4300	6503	SO:0001583	missense	79955	exon9			GACTTCTCCTTCT	AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.1349A>C	10.37:g.102778029T>G	ENSP00000359234:p.Glu450Ala	122.0	0.0	0		110.0	45.0	0.409091	NM_001195263	D5FJ77|Q8N321	Missense_Mutation	SNP	ENST00000370215.3	37	CCDS31269.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.844861	0.51164	.	.	ENSG00000186862	ENST00000393462;ENST00000370215	T	0.14266	2.52	3.98	2.75	0.32379	.	1.878030	0.03231	N	0.179010	T	0.14184	0.0343	L	0.34521	1.04	0.33421	D	0.579826	B;B	0.30406	0.278;0.122	B;B	0.30572	0.057;0.117	T	0.23547	-1.0185	10	0.62326	D	0.03	.	8.9983	0.36066	0.0:0.0:0.1856:0.8144	.	450;450	Q9H5P4;Q9H5P4-2	PDZD7_HUMAN;.	A	450	ENSP00000359234:E450A	ENSP00000359234:E450A	E	-	2	0	PDZD7	102768019	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.560000	0.53763	1.661000	0.50771	0.418000	0.28097	GAG	.	.	none		0.667	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049883.1	NM_024895	
ZSCAN32	54925	hgsc.bcm.edu	37	16	3434848	3434848	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:3434848T>C	ENST00000396852.4	-	6	1152	c.845A>G	c.(844-846)cAg>cGg	p.Q282R	ZSCAN32_ENST00000439568.2_5'UTR|ZSCAN32_ENST00000422427.2_Missense_Mutation_p.Q70R|ZSCAN32_ENST00000304926.3_Missense_Mutation_p.Q70R|ZSCAN32_ENST00000574940.1_Missense_Mutation_p.Q282R|ZSCAN32_ENST00000396846.3_Missense_Mutation_p.Q282R|ZSCAN32_ENST00000573830.1_5'UTR	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32	282	KRAB.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)										CTGGCTGTTCTGCTGACAGGT	0.532																																					p.Q70R		Atlas-SNP	.											.	.	.	.	0			c.A209G						PASS	.						104.0	110.0	108.0					16																	3434848		2197	4300	6497	SO:0001583	missense	54925	exon5			CTGTTCTGCTGAC	AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.845A>G	16.37:g.3434848T>C	ENSP00000380061:p.Gln282Arg	160.0	0.0	0		128.0	31.0	0.242188	NM_017810	B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	Missense_Mutation	SNP	ENST00000396852.4	37		.	.	.	.	.	.	.	.	.	.	T	0.032	-1.329858	0.01298	.	.	ENSG00000140987	ENST00000304926;ENST00000396852;ENST00000396846;ENST00000422427	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	3.68	-0.497	0.12023	.	1.118750	0.07237	U	0.863657	T	0.09379	0.0231	N	0.00517	-1.405	0.09310	N	1	B;B;B	0.21606	0.002;0.058;0.058	B;B;B	0.22880	0.005;0.042;0.025	T	0.30119	-0.9989	10	0.02654	T	1	.	7.606	0.28103	0.0:0.1686:0.0:0.8314	.	70;70;282	B4DR24;Q9NX65;Q6WMU8	.;ZN434_HUMAN;.	R	70;282;282;70	ENSP00000302502:Q70R;ENSP00000380061:Q282R;ENSP00000380057:Q282R;ENSP00000407312:Q70R	ENSP00000302502:Q70R	Q	-	2	0	ZNF434	3374849	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-0.014000	0.12656	-0.454000	0.07066	-0.912000	0.02778	CAG	.	.	none		0.532	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000251509.2	NM_017810	
NAP1L3	4675	hgsc.bcm.edu	37	X	92928107	92928107	+	Missense_Mutation	SNP	C	C	A	rs62635803		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:92928107C>A	ENST00000373079.3	-	1	460	c.197G>T	c.(196-198)gGc>gTc	p.G66V	FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.G59V|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	66	Ser-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						gctagtgctgccgctgctgct	0.612													C|||	27	0.00715232	0.0204	0.0	3775	,	,		7467	0.0		0.0	False		,,,				2504	0.0				p.G66V		Atlas-SNP	.											.	NAP1L3	81	.	0			c.G197T						PASS	.	C	VAL/GLY	81,3313		1,68,11,1394,457	8.0	9.0	9.0		197	0.9	0.1	X	dbSNP_129	9	0,5910		0,0,0,2185,1540	yes	missense	NAP1L3	NM_004538.5	109	1,68,11,3579,1997	AA,AC,A,CC,C		0.0,2.3866,0.8706	probably-damaging	66/507	92928107	81,9223	1931	3725	5656	SO:0001583	missense	4675	exon1			GTGCTGCCGCTGC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.197G>T	X.37:g.92928107C>A	ENSP00000362171:p.Gly66Val	59.0	0.0	0		68.0	14.0	0.205882	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	12	0.007233273056057866	9	0.01859504132231405	0	0.0	0	0.0	0	0.0	C	3.961	-0.010248	0.07727	0.023866	0.0	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.29142	1.58	0.913	0.913	0.19354	.	0.385153	0.26231	N	0.025574	T	0.06234	0.0161	N	0.14661	0.345	0.32519	N	0.536487	B	0.30482	0.281	B	0.22753	0.041	T	0.26155	-1.0111	9	0.12766	T	0.61	.	.	.	.	.	66	Q99457	NP1L3_HUMAN	V	66;59	ENSP00000362171:G66V	ENSP00000362171:G66V	G	-	2	0	NAP1L3	92814763	0.001000	0.12720	0.051000	0.19133	0.018000	0.09664	0.098000	0.15189	0.718000	0.32166	0.292000	0.19580	GGC	C|0.992;A|0.008	0.008	strong		0.612	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
SAP130	79595	hgsc.bcm.edu	37	2	128758026	128758026	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:128758026C>T	ENST00000259235.3	-	8	1079	c.950G>A	c.(949-951)aGg>aAg	p.R317K	SAP130_ENST00000259234.6_Missense_Mutation_p.R291K|SAP130_ENST00000357702.5_Missense_Mutation_p.R317K	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	317					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		CAAGGTTGGCCTACTGAAAAG	0.428																																					p.R317K		Atlas-SNP	.											.	SAP130	169	.	0			c.G950A						PASS	.						155.0	135.0	141.0					2																	128758026		2203	4300	6503	SO:0001583	missense	79595	exon8			GTTGGCCTACTGA	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.950G>A	2.37:g.128758026C>T	ENSP00000259235:p.Arg317Lys	77.0	0.0	0		86.0	20.0	0.232558	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	37	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543573	0.86022	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.65523	0.2699	L	0.29908	0.895	0.80722	D	1	D;D	0.67145	0.996;0.99	D;D	0.76071	0.987;0.979	T	0.57911	-0.7729	9	0.16896	T	0.51	-20.9485	19.5036	0.95105	0.0:1.0:0.0:0.0	.	317;317	B7ZLM3;Q9H0E3	.;SP130_HUMAN	K	317;317;291	.	ENSP00000259234:R291K	R	-	2	0	SAP130	128474496	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.105000	0.77031	2.672000	0.90937	0.650000	0.86243	AGG	.	.	none		0.428	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
TNFAIP8	25816	hgsc.bcm.edu	37	5	118728686	118728686	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:118728686G>A	ENST00000503646.1	+	3	895	c.207G>A	c.(205-207)gaG>gaA	p.E69E	TNFAIP8_ENST00000274456.6_Silent_p.E59E|TNFAIP8_ENST00000415806.2_3'UTR|TNFAIP8_ENST00000513374.1_Silent_p.E81E|TNFAIP8_ENST00000504642.1_Silent_p.E71E|TNFAIP8_ENST00000504771.2_Silent_p.E69E			O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	69					defense response to Gram-positive bacterium (GO:0050830)|interleukin-1 beta production (GO:0032611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		AGGAGGCAGAGAAGATCATCA	0.428																																					p.E69E		Atlas-SNP	.											.	TNFAIP8	12	.	0			c.G207A						PASS	.						70.0	67.0	68.0					5																	118728686		2021	4191	6212	SO:0001819	synonymous_variant	25816	exon2			GGCAGAGAAGATC	AF070671	CCDS47257.1, CCDS47258.1, CCDS68933.1	5q23.1	2008-02-05			ENSG00000145779	ENSG00000145779			17260	protein-coding gene	gene with protein product		612111				10233894, 10644768	Standard	NM_001286813		Approved	GG2-1, MDC-3.13, SCC-S2	uc003ksi.3	O95379	OTTHUMG00000162949	ENST00000503646.1:c.207G>A	5.37:g.118728686G>A		149.0	0.0	0		170.0	54.0	0.317647	NM_014350	B3KMH1|B3KMI2|B7Z713|Q9P1Q1|Q9UER5|Q9UP47	Silent	SNP	ENST00000503646.1	37	CCDS47258.1																																																																																			.	.	none		0.428	TNFAIP8-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000371134.2	NM_014350	
LRRC15	131578	hgsc.bcm.edu	37	3	194080325	194080325	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:194080325C>G	ENST00000347624.3	-	2	1533	c.1448G>C	c.(1447-1449)aGt>aCt	p.S483T	LRRC15_ENST00000428839.1_Missense_Mutation_p.S489T|LRRC15_ENST00000439944.2_Missense_Mutation_p.S489T	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	483					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TTCTGGGTAACTAGGCACCTC	0.532																																					p.S489T		Atlas-SNP	.											.	LRRC15	137	.	0			c.G1466C						PASS	.						162.0	151.0	155.0					3																	194080325		2203	4300	6503	SO:0001583	missense	131578	exon3			GGGTAACTAGGCA	AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1448G>C	3.37:g.194080325C>G	ENSP00000306276:p.Ser483Thr	291.0	0.0	0		242.0	55.0	0.227273	NM_001135057	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	37	CCDS3306.1	.	.	.	.	.	.	.	.	.	.	C	0.557	-0.846990	0.02651	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.56941	0.43;0.45;0.45	5.24	-0.0103	0.13997	.	1.652070	0.03016	N	0.150004	T	0.37544	0.1007	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.17592	-1.0364	10	0.13470	T	0.59	.	10.0974	0.42484	0.253:0.3793:0.3677:0.0	.	483;489	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	T	483;489;489	ENSP00000306276:S483T;ENSP00000389128:S489T;ENSP00000413707:S489T	ENSP00000306276:S483T	S	-	2	0	LRRC15	195561620	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.283000	0.08433	-0.217000	0.10033	-0.309000	0.09137	AGT	.	.	none		0.532	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2		
ITPKB	3707	hgsc.bcm.edu	37	1	226924388	226924388	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:226924388C>G	ENST00000272117.3	-	1	771	c.772G>C	c.(772-774)Gag>Cag	p.E258Q	ITPKB_ENST00000429204.1_Missense_Mutation_p.E258Q|ITPKB_ENST00000366784.1_Missense_Mutation_p.E258Q			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	258					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				ATACCCTTCTCCATCCTTACA	0.597																																					p.E258Q	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.G772C						PASS	.						49.0	48.0	49.0					1																	226924388		2203	4300	6503	SO:0001583	missense	3707	exon2			CCTTCTCCATCCT	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.772G>C	1.37:g.226924388C>G	ENSP00000272117:p.Glu258Gln	110.0	0.0	0		134.0	62.0	0.462687	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	ENST00000272117.3	37	CCDS1555.1	.	.	.	.	.	.	.	.	.	.	C	16.57	3.159960	0.57368	.	.	ENSG00000143772	ENST00000272117;ENST00000429204;ENST00000366784	T;T;T	0.35973	1.32;1.32;1.28	4.6	3.68	0.42216	.	0.263808	0.27064	N	0.021114	T	0.23014	0.0556	N	0.24115	0.695	0.27144	N	0.961579	P	0.50443	0.935	B	0.42245	0.381	T	0.06588	-1.0818	10	0.21014	T	0.42	-16.2733	10.3145	0.43729	0.0:0.905:0.0:0.095	.	258	P27987	IP3KB_HUMAN	Q	258	ENSP00000272117:E258Q;ENSP00000411152:E258Q;ENSP00000355748:E258Q	ENSP00000272117:E258Q	E	-	1	0	ITPKB	224991011	0.888000	0.30383	0.751000	0.31187	0.218000	0.24690	1.098000	0.31000	1.137000	0.42214	0.561000	0.74099	GAG	.	.	none		0.597	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
TIAM2	26230	hgsc.bcm.edu	37	6	155577707	155577707	+	Missense_Mutation	SNP	G	G	A	rs116807909	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:155577707G>A	ENST00000461783.3	+	29	5831	c.4558G>A	c.(4558-4560)Gag>Aag	p.E1520K	TIAM2_ENST00000528391.2_Missense_Mutation_p.E864K|TIAM2_ENST00000275246.7_Missense_Mutation_p.E445K|TIAM2_ENST00000367174.2_Missense_Mutation_p.E896K|TIAM2_ENST00000456877.2_Missense_Mutation_p.E832K|TIAM2_ENST00000318981.5_Missense_Mutation_p.E1520K|TIAM2_ENST00000360366.4_Missense_Mutation_p.E1544K|RP11-477D19.2_ENST00000435295.1_RNA|TIAM2_ENST00000456144.1_Missense_Mutation_p.E1549K|TIAM2_ENST00000529824.2_Missense_Mutation_p.E1549K			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1520					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GGACTCTGACGAGGGCAGCTT	0.597													G|||	3	0.000599042	0.0023	0.0	5008	,	,		17970	0.0		0.0	False		,,,				2504	0.0				p.E1520K		Atlas-SNP	.											.	TIAM2	161	.	0			c.G4558A						PASS	.	G	LYS/GLU,LYS/GLU,	11,4395	17.9+/-39.9	0,11,2192	35.0	38.0	37.0		1333,4558,	5.9	1.0	6	dbSNP_132	37	0,8598		0,0,4299	yes	missense,missense,utr-3	TIAM2,TFB1M	NM_001010927.2,NM_012454.3,NM_016020.3	56,56,	0,11,6491	AA,AG,GG		0.0,0.2497,0.0846	benign,benign,	445/627,1520/1702,	155577707	11,12993	2203	4299	6502	SO:0001583	missense	26230	exon26			TCTGACGAGGGCA		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.4558G>A	6.37:g.155577707G>A	ENSP00000437188:p.Glu1520Lys	175.0	0.0	0		183.0	85.0	0.464481	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	18.40	3.615581	0.66672	0.002497	0.0	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391;ENST00000275246	T;T;T;T;T;T;T;T;T	0.08546	3.56;3.5;3.56;3.39;3.56;3.5;3.38;3.38;3.08	5.86	5.86	0.93980	.	0.351137	0.32357	N	0.006205	T	0.04497	0.0123	L	0.59436	1.845	0.37039	D	0.897031	P;P;P;P	0.52061	0.95;0.937;0.854;0.896	B;B;B;B	0.38296	0.154;0.27;0.27;0.139	T	0.43147	-0.9409	10	0.10377	T	0.69	.	18.3756	0.90435	0.0:0.0:1.0:0.0	.	864;1549;1544;1520	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	K	1520;1766;1549;1520;896;1544;1549;832;864;445	ENSP00000437188:E1520K;ENSP00000407746:E1549K;ENSP00000327315:E1520K;ENSP00000356142:E896K;ENSP00000353528:E1544K;ENSP00000433348:E1549K;ENSP00000407183:E832K;ENSP00000435335:E864K;ENSP00000275246:E445K	ENSP00000275246:E445K	E	+	1	0	TIAM2	155619399	1.000000	0.71417	0.994000	0.49952	0.865000	0.49528	6.868000	0.75516	2.780000	0.95670	0.585000	0.79938	GAG	G|0.998;A|0.002	0.002	strong		0.597	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
CELA3B	23436	hgsc.bcm.edu	37	1	22304901	22304901	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:22304901G>A	ENST00000337107.6	+	2	102	c.83G>A	c.(82-84)cGc>cAc	p.R28H	RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	28					cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						CCTTCCAGCCGCGTTGTCAAT	0.612																																					p.R28H		Atlas-SNP	.											.	CELA3B	24	.	0			c.G83A						PASS	.						166.0	103.0	124.0					1																	22304901		2203	4300	6503	SO:0001583	missense	23436	exon2			CCAGCCGCGTTGT	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.83G>A	1.37:g.22304901G>A	ENSP00000338369:p.Arg28His	232.0	0.0	0		239.0	45.0	0.188285	NM_007352	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Missense_Mutation	SNP	ENST00000337107.6	37	CCDS219.1	.	.	.	.	.	.	.	.	.	.	G	37	6.058413	0.97246	.	.	ENSG00000219073	ENST00000337107;ENST00000374666	T;T	0.23552	1.9;1.9	5.1	5.1	0.69264	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.000000	0.85682	D	0.000000	T	0.53158	0.1779	M	0.78049	2.395	0.36974	D	0.893974	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.984	T	0.64588	-0.6372	10	0.87932	D	0	-47.2794	16.0019	0.80301	0.0:0.0:1.0:0.0	.	28;28	B1AQ52;P08861	.;CEL3B_HUMAN	H	28;44	ENSP00000338369:R28H;ENSP00000363798:R44H	ENSP00000338369:R28H	R	+	2	0	CELA3B	22177488	0.998000	0.40836	0.262000	0.24481	0.821000	0.46438	8.940000	0.92958	2.375000	0.81037	0.650000	0.86243	CGC	.	.	none		0.612	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
CCDC64	92558	hgsc.bcm.edu	37	12	120518805	120518805	+	Missense_Mutation	SNP	G	G	A	rs373363052		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:120518805G>A	ENST00000397558.2	+	7	1423	c.1423G>A	c.(1423-1425)Gac>Aac	p.D475N	CCDC64_ENST00000257583.4_Missense_Mutation_p.D172N|CCDC64_ENST00000446727.2_Missense_Mutation_p.D146N	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	475					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGGGACCGCGACGAGGCCAT	0.438																																					p.D475N		Atlas-SNP	.											.	CCDC64	40	.	0			c.G1423A						PASS	.	G	ASN/ASP	0,4044		0,0,2022	70.0	79.0	76.0		1423	5.3	1.0	12		76	1,8361		0,1,4180	no	missense	CCDC64	NM_207311.2	23	0,1,6202	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	475/574	120518805	1,12405	2022	4181	6203	SO:0001583	missense	92558	exon7			GACCGCGACGAGG	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1423G>A	12.37:g.120518805G>A	ENSP00000380690:p.Asp475Asn	33.0	0.0	0		29.0	9.0	0.310345	NM_207311	A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	ENST00000397558.2	37	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	G	35	5.417810	0.96092	0.0	1.2E-4	ENSG00000135127	ENST00000397558;ENST00000446727;ENST00000548673;ENST00000257583	T;T;T	0.04862	3.56;3.6;3.54	5.32	5.32	0.75619	.	529.136000	0.00166	N	0.000000	T	0.35038	0.0918	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.00699	-1.1604	10	0.87932	D	0	-12.8386	18.9942	0.92806	0.0:0.0:1.0:0.0	.	172;146;475	B4DWL0;B4DNE7;Q6ZP65	.;.;BICR1_HUMAN	N	475;146;193;172	ENSP00000380690:D475N;ENSP00000399658:D146N;ENSP00000447477:D193N	ENSP00000257583:D172N	D	+	1	0	CCDC64	119003188	1.000000	0.71417	0.955000	0.39395	0.944000	0.59088	9.731000	0.98807	2.492000	0.84095	0.561000	0.74099	GAC	.	.	weak		0.438	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000403390.2	NM_207311	
KCNK1	3775	hgsc.bcm.edu	37	1	233802348	233802348	+	Silent	SNP	C	C	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr1:233802348C>G	ENST00000366621.3	+	2	531	c.363C>G	c.(361-363)ggC>ggG	p.G121G	KCNK1_ENST00000472190.1_3'UTR|KCNK1_ENST00000366620.1_Silent_p.G5G	NM_002245.3	NP_002236.1	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	121					potassium ion transport (GO:0006813)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	11		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)	CAGGTTATGGCCACACCGTGC	0.502																																					p.G121G		Atlas-SNP	.											KCNK1,colon,carcinoma,+1,1	KCNK1	36	1	0			c.C363G						PASS	.						166.0	119.0	135.0					1																	233802348		2203	4300	6503	SO:0001819	synonymous_variant	3775	exon2			TTATGGCCACACC	U33632	CCDS1599.1	1q42-q43	2012-03-07			ENSG00000135750	ENSG00000135750		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6272	protein-coding gene	gene with protein product		601745				8661042, 16382106	Standard	NM_002245		Approved	K2p1.1, DPK, TWIK-1	uc010pxo.1	O00180	OTTHUMG00000037923	ENST00000366621.3:c.363C>G	1.37:g.233802348C>G		239.0	0.0	0		230.0	108.0	0.469565	NM_002245	Q13307|Q5T5E8	Silent	SNP	ENST00000366621.3	37	CCDS1599.1																																																																																			.	.	none		0.502	KCNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092565.1	NM_002245	
MAML3	55534	hgsc.bcm.edu	37	4	140811099	140811099	+	Splice_Site	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr4:140811099C>T	ENST00000398940.1	-	1	107	c.108G>A	c.(106-108)caG>caA	p.Q36Q	MAML3_ENST00000327122.5_Silent_p.Q341Q|MAML3_ENST00000509479.2_Silent_p.Q497Q					mastermind-like 3 (Drosophila)									p.Q497Q(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.542																																					p.Q497Q		Atlas-SNP	.											MAML3_ENST00000509479,caecum,carcinoma,0,12	MAML3	192	12	2	Substitution - coding silent(2)	prostate(2)	c.G1491A						scavenged	.						13.0	19.0	17.0					4																	140811099		2117	4226	6343	SO:0001630	splice_region_variant	55534	exon2			CTGCTGCTGCTGC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000398940.1:c.108+1G>A	4.37:g.140811099C>T		86.0	2.0	0.0232558		94.0	4.0	0.0425532	NM_018717		Silent	SNP	ENST00000398940.1	37																																																																																				.	.	none		0.542	MAML3-202	KNOWN	basic	protein_coding	protein_coding			Silent
PRKD1	5587	hgsc.bcm.edu	37	14	30046591	30046591	+	Silent	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr14:30046591A>G	ENST00000331968.5	-	18	2821	c.2592T>C	c.(2590-2592)agT>agC	p.S864S	PRKD1_ENST00000415220.2_Silent_p.S872S	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	864					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TCAGGTCATCACTTTCATGGG	0.498																																					p.S864S		Atlas-SNP	.											.	PRKD1	316	.	0			c.T2592C						PASS	.						145.0	128.0	134.0					14																	30046591		2203	4300	6503	SO:0001819	synonymous_variant	5587	exon18			GTCATCACTTTCA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2592T>C	14.37:g.30046591A>G		199.0	0.0	0		189.0	37.0	0.195767	NM_002742	A6NL64|B2RAF6	Silent	SNP	ENST00000331968.5	37	CCDS9637.1																																																																																			.	.	none		0.498	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
ZNF816	125893	hgsc.bcm.edu	37	19	53456125	53456125	+	Silent	SNP	G	G	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:53456125G>C	ENST00000357666.4	-	4	369	c.69C>G	c.(67-69)cgC>cgG	p.R23R	ZNF816_ENST00000535506.1_Silent_p.R23R|ZNF321P_ENST00000391777.3_Silent_p.R23R|ZNF816_ENST00000434371.2_Silent_p.R23R|ZNF816_ENST00000444460.2_Silent_p.R23R|ZNF816_ENST00000270457.4_Silent_p.R23R|ZNF816_ENST00000438970.2_Silent_p.R23R|ZNF816_ENST00000391786.2_Intron	NM_001031665.2	NP_001026835.1	Q0VGE8	ZN816_HUMAN	zinc finger protein 816	23					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(10)|lung(9)|stomach(1)|urinary_tract(2)	27						TGAAAGTCAAGCGTCCCTAAA	0.408																																					p.R23R		Atlas-SNP	.											.	ZNF816	73	.	0			c.C69G						PASS	.						85.0	93.0	90.0					19																	53456125		2203	4300	6503	SO:0001819	synonymous_variant	125893	exon3			AGTCAAGCGTCCC	BC063805	CCDS33096.1	19q13.41	2013-01-08	2010-07-23	2010-07-23		ENSG00000180257		"""Zinc fingers, C2H2-type"", ""-"""	26995	protein-coding gene	gene with protein product			"""zinc finger protein 816A"""	ZNF816A			Standard	NM_001031665		Approved		uc002qam.2	Q0VGE8		ENST00000357666.4:c.69C>G	19.37:g.53456125G>C		43.0	0.0	0		49.0	14.0	0.285714	NM_001202457	A8K7H5|Q3KR39|Q659B3	Silent	SNP	ENST00000357666.4	37	CCDS33096.1	.	.	.	.	.	.	.	.	.	.	g	1.272	-0.612855	0.03690	.	.	ENSG00000180257	ENST00000332302	T	0.42513	0.97	1.84	0.498	0.16908	.	.	.	.	.	T	0.42245	0.1194	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39482	-0.9612	6	0.72032	D	0.01	.	8.3219	0.32134	0.0:0.3546:0.6454:0.0	.	.	.	.	V	59	ENSP00000333199:L59V	ENSP00000333199:L59V	L	-	1	0	ZNF816	58147937	0.000000	0.05858	0.011000	0.14972	0.541000	0.35023	-0.031000	0.12287	0.003000	0.14656	0.305000	0.20034	CTT	.	.	none		0.408	ZNF816-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396132.1	NM_001031665	
SKP1	6500	hgsc.bcm.edu	37	5	133494195	133494195	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:133494195C>T	ENST00000353411.6	-	5	590	c.407G>A	c.(406-408)cGc>cAc	p.R136H	SKP1_ENST00000517625.1_Missense_Mutation_p.R136H|SKP1_ENST00000521216.1_Missense_Mutation_p.R136H|SKP1_ENST00000522855.1_Missense_Mutation_p.R136H|SKP1_ENST00000522552.1_Missense_Mutation_p.R136H	NM_170679.2	NP_733779.1	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1	136	Interaction with the F-box domain of F- box proteins. {ECO:0000250}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H2A monoubiquitination (GO:0035518)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul7-RING ubiquitin ligase complex (GO:0031467)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAAGGTCTTGCGAATCTCCTC	0.408																																					p.R136H		Atlas-SNP	.											SKP1,colon,carcinoma,-1,1	SKP1	10	1	0			c.G407A						scavenged	.						156.0	152.0	153.0					5																	133494195		2203	4300	6503	SO:0001583	missense	6500	exon5			GTCTTGCGAATCT	U33760	CCDS4171.1, CCDS4172.1	5q31	2011-11-18	2007-11-13	2007-11-13	ENSG00000113558	ENSG00000113558			10899	protein-coding gene	gene with protein product		601434	"""S-phase kinase-associated protein 1A (p19A)"""	SKP1A		7553852, 8646875	Standard	NM_006930		Approved	EMC19, OCP2, TCEB1L, MGC34403, OCP-II, p19A	uc003kzc.4	P63208	OTTHUMG00000129117	ENST00000353411.6:c.407G>A	5.37:g.133494195C>T	ENSP00000231487:p.Arg136His	145.0	1.0	0.00689655		132.0	45.0	0.340909	NM_170679	D3DQ97|D3DQ98|P34991|Q8TAY2	Missense_Mutation	SNP	ENST00000353411.6	37	CCDS4171.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405507	0.83230	.	.	ENSG00000113558	ENST00000353411;ENST00000522552;ENST00000521216;ENST00000517625;ENST00000522855;ENST00000328392;ENST00000519321	T;T;T;T;T;T;T	0.59364	0.34;0.29;0.27;0.34;0.34;0.29;0.27	5.06	5.06	0.68205	SKP1 component, dimerisation (2);BTB/POZ fold (1);	0.000000	0.85682	U	0.000000	T	0.75968	0.3922	H	0.95151	3.63	0.80722	D	1	B;B;D	0.59357	0.072;0.048;0.985	B;B;P	0.47528	0.038;0.005;0.549	D	0.85050	0.0928	10	0.66056	D	0.02	-0.7947	18.7998	0.92011	0.0:1.0:0.0:0.0	.	136;136;136	E5RJR5;P63208-2;P63208	.;.;SKP1_HUMAN	H	136	ENSP00000231487:R136H;ENSP00000429472:R136H;ENSP00000431067:R136H;ENSP00000429961:R136H;ENSP00000429686:R136H;ENSP00000331708:R136H;ENSP00000429415:R136H	ENSP00000331708:R136H	R	-	2	0	SKP1	133522094	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.214000	0.77958	2.522000	0.85027	0.563000	0.77884	CGC	.	.	none		0.408	SKP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251162.2	NM_170679	
LAP3	51056	hgsc.bcm.edu	37	4	17606285	17606285	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr4:17606285T>C	ENST00000226299.4	+	11	1529	c.1255T>C	c.(1255-1257)Ttc>Ctc	p.F419L	LAP3_ENST00000606142.1_Missense_Mutation_p.F388L|AC006160.5_ENST00000511010.1_RNA|LAP3_ENST00000503467.1_3'UTR	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	419					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						GAACAAACTCTTCGAGGTAGG	0.418																																					p.F419L		Atlas-SNP	.											.	LAP3	50	.	0			c.T1255C						PASS	.						107.0	101.0	103.0					4																	17606285		2203	4300	6503	SO:0001583	missense	51056	exon11			AAACTCTTCGAGG	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.1255T>C	4.37:g.17606285T>C	ENSP00000226299:p.Phe419Leu	114.0	0.0	0		107.0	39.0	0.364486	NM_015907	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Missense_Mutation	SNP	ENST00000226299.4	37	CCDS3422.1	.	.	.	.	.	.	.	.	.	.	T	9.660	1.143920	0.21205	.	.	ENSG00000002549	ENST00000226299;ENST00000513105	T;T	0.39229	1.09;1.14	5.84	3.41	0.39046	Peptidase M17, leucyl aminopeptidase, C-terminal (1);	0.261443	0.44097	N	0.000492	T	0.12689	0.0308	N	0.00707	-1.245	0.29001	N	0.887486	B	0.27416	0.178	B	0.30495	0.116	T	0.31052	-0.9957	10	0.09338	T	0.73	-2.9227	8.5381	0.33375	0.0:0.2084:0.0:0.7916	.	419	P28838	AMPL_HUMAN	L	419;189	ENSP00000226299:F419L;ENSP00000424724:F189L	ENSP00000226299:F419L	F	+	1	0	LAP3	17215383	1.000000	0.71417	0.216000	0.23742	0.270000	0.26580	5.560000	0.67332	0.473000	0.27368	-0.290000	0.09829	TTC	.	.	none		0.418	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1		
NLRX1	79671	hgsc.bcm.edu	37	11	119045894	119045894	+	Missense_Mutation	SNP	C	C	T	rs574477974		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:119045894C>T	ENST00000409109.1	+	6	2169	c.1582C>T	c.(1582-1584)Cgt>Tgt	p.R528C	NLRX1_ENST00000525863.1_Missense_Mutation_p.R528C|NLRX1_ENST00000292199.2_Missense_Mutation_p.R528C|NLRX1_ENST00000409991.1_Missense_Mutation_p.R528C|NLRX1_ENST00000409265.4_Missense_Mutation_p.R528C	NM_001282144.1	NP_001269073.1	Q86UT6	NLRX1_HUMAN	NLR family member X1	528	Required for interaction with MAVS.				innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|viral process (GO:0016032)	mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)			cervix(1)|endometrium(2)|kidney(2)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	22	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GCTCGTGGGCCGTGTTGGGGA	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18271	0.0		0.0	False		,,,				2504	0.001				p.R528C		Atlas-SNP	.											.	NLRX1	128	.	0			c.C1582T						PASS	.						145.0	132.0	136.0					11																	119045894		2200	4295	6495	SO:0001583	missense	79671	exon6			GTGGGCCGTGTTG	AB094095	CCDS8416.1	11q23.3	2007-02-07			ENSG00000160703	ENSG00000160703		"""Nucleotide-binding domain and leucine rich repeat containing"""	29890	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat containing X1"", ""NOD-like receptor X1"", ""NLR family, X1"""	611947				12766759	Standard	XM_005271669		Approved	NOD9, CLR11.3	uc001pvw.3	Q86UT6	OTTHUMG00000154476	ENST00000409109.1:c.1582C>T	11.37:g.119045894C>T	ENSP00000387334:p.Arg528Cys	130.0	0.0	0		125.0	5.0	0.04	NM_024618	A8K6Q1|B3KPK2|B3KTA2|Q7RTR3|Q96D51|Q9H724	Missense_Mutation	SNP	ENST00000409109.1	37	CCDS8416.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.703299	0.30232	.	.	ENSG00000160703	ENST00000409991;ENST00000292199;ENST00000409265;ENST00000409109;ENST00000525863	T;T;T;T;T	0.73047	-0.6;-0.6;-0.71;-0.6;-0.71	5.62	4.7	0.59300	.	0.188113	0.38217	N	0.001762	T	0.53610	0.1807	N	0.19112	0.55	0.42859	D	0.994101	B;B	0.19706	0.038;0.005	B;B	0.12156	0.007;0.002	T	0.53851	-0.8380	10	0.87932	D	0	.	8.1864	0.31341	0.2513:0.6692:0.0:0.0795	.	528;528	Q86UT6-2;Q86UT6	.;NLRX1_HUMAN	C	528	ENSP00000386851:R528C;ENSP00000292199:R528C;ENSP00000386858:R528C;ENSP00000387334:R528C;ENSP00000433442:R528C	ENSP00000292199:R528C	R	+	1	0	NLRX1	118551104	1.000000	0.71417	0.993000	0.49108	0.759000	0.43091	4.547000	0.60712	1.346000	0.45694	0.561000	0.74099	CGT	.	.	none		0.607	NLRX1-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335403.1	NM_170722	
PPP1R42	286187	hgsc.bcm.edu	37	8	67922976	67922976	+	Missense_Mutation	SNP	C	C	T	rs200466525	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr8:67922976C>T	ENST00000324682.5	-	5	670	c.526G>A	c.(526-528)Gtt>Att	p.V176I	PPP1R42_ENST00000517834.1_5'Flank|PPP1R42_ENST00000522909.1_Missense_Mutation_p.V176I	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	176					regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										TGGTTGTCAACGGCTATGAGC	0.284													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		16546	0.0		0.0	False		,,,				2504	0.0				p.V176I		Atlas-SNP	.											.	PPP1R42	2	.	0			c.G526A						PASS	.						75.0	74.0	75.0					8																	67922976		2203	4297	6500	SO:0001583	missense	286187	exon5			TGTCAACGGCTAT	BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.526G>A	8.37:g.67922976C>T	ENSP00000315035:p.Val176Ile	83.0	0.0	0		63.0	20.0	0.31746	NM_001013626		Missense_Mutation	SNP	ENST00000324682.5	37	CCDS34902.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	14.75	2.629273	0.46944	.	.	ENSG00000178125	ENST00000522909;ENST00000421742;ENST00000324682	T;T	0.37058	2.25;1.22	5.83	4.06	0.47325	.	0.157823	0.56097	N	0.000040	T	0.20170	0.0485	N	0.04746	-0.17	0.27969	N	0.936469	B	0.23442	0.085	B	0.25987	0.065	T	0.13764	-1.0497	10	0.37606	T	0.19	-4.3848	12.6376	0.56692	0.0:0.8663:0.0:0.1337	.	176	Q7Z4L9-2	.	I	176	ENSP00000429721:V176I;ENSP00000315035:V176I	ENSP00000315035:V176I	V	-	1	0	LRRC67	68085530	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.529000	0.53532	0.838000	0.34948	-0.194000	0.12790	GTT	C|1.000;T|0.000	0.000	strong		0.284	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380034.2	NM_001013626	
RPL3	6122	hgsc.bcm.edu	37	22	39714450	39714450	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr22:39714450C>T	ENST00000216146.4	-	2	324	c.151G>A	c.(151-153)Gct>Act	p.A51T	SNORD43_ENST00000583861.1_RNA|RPL3_ENST00000465618.1_5'UTR|RPL3_ENST00000401609.1_5'UTR	NM_000967.3|NM_001033853.1	NP_000958.1|NP_001029025.1	P39023	RL3_HUMAN	ribosomal protein L3	51					cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(4)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Melanoma(58;0.04)				Homoharringtonine(DB04865)	GTCATGCCAGCCTTGTATCCC	0.577																																					p.A51T		Atlas-SNP	.											.	RPL3	29	.	0			c.G151A						PASS	.						77.0	72.0	74.0					22																	39714450		2203	4300	6503	SO:0001583	missense	6122	exon2			TGCCAGCCTTGTA	AB007166	CCDS13988.1	22q13	2011-04-06			ENSG00000100316	ENSG00000100316		"""L ribosomal proteins"""	10332	protein-coding gene	gene with protein product		604163				2891103, 9582194	Standard	NM_000967		Approved	L3	uc003axi.3	P39023	OTTHUMG00000151079	ENST00000216146.4:c.151G>A	22.37:g.39714450C>T	ENSP00000346001:p.Ala51Thr	70.0	0.0	0		90.0	21.0	0.233333	NM_001033853	B2RDV9|Q15548|Q5I0G0	Missense_Mutation	SNP	ENST00000216146.4	37	CCDS13988.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.552848|5.552848	0.96501|0.96501	.|.	.|.	ENSG00000100316|ENSG00000100316	ENST00000216146;ENST00000453303|ENST00000427905	T;T|.	0.25749|.	1.78;1.78|.	4.68|4.68	4.68|4.68	0.58851|0.58851	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);|.	0.051981|.	0.85682|.	D|.	0.000000|.	D|D	0.90280|0.90280	0.6960|0.6960	H|H	0.98111|0.98111	4.15|4.15	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.94293|0.94293	0.7530|0.7530	10|5	0.87932|.	D|.	0|.	.|.	17.6103|17.6103	0.88050|0.88050	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	51;51|.	P39023;B3KS36|.	RL3_HUMAN;.|.	T|D	51;78|82	ENSP00000346001:A51T;ENSP00000415198:A78T|.	ENSP00000346001:A51T|.	A|G	-|-	1|2	0|0	RPL3|RPL3	38044396|38044396	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	4.464000|4.464000	0.60134|0.60134	2.150000|2.150000	0.67090|0.67090	0.455000|0.455000	0.32223|0.32223	GCT|GGC	.	.	none		0.577	RPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321196.1	NM_000967	
MUC2	4583	hgsc.bcm.edu	37	11	1092929	1092929	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:1092929C>T	ENST00000441003.2	+	30	4775	c.4748C>T	c.(4747-4749)tCg>tTg	p.S1583L	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.S1584L|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accccaacatcgacacccatc	0.632																																					p.S1583L		Atlas-SNP	.											MUC2_ENST00000441003,rectum,carcinoma,+1,4	MUC2	614	4	0			c.C4748T						scavenged	.						78.0	115.0	102.0					11																	1092929		1918	3556	5474	SO:0001583	missense	4583	exon30			CAACATCGACACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4748C>T	11.37:g.1092929C>T	ENSP00000415183:p.Ser1583Leu	111.0	1.0	0.00900901		105.0	9.0	0.0857143	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	4.659	0.122508	0.08931	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13538	2.58;3.12	1.75	-1.21	0.09524	.	3.022220	0.02729	U	0.114829	T	0.09202	0.0227	.	.	.	0.09310	N	1	B	0.22541	0.071	B	0.10450	0.005	T	0.31336	-0.9947	9	0.29301	T	0.29	.	6.8082	0.23788	0.6899:0.3101:0.0:0.0	.	1583	E7EUV1	.	L	1583;1584	ENSP00000415183:S1583L;ENSP00000351956:S1584L	ENSP00000351956:S1584L	S	+	2	0	MUC2	1082929	0.156000	0.22821	0.002000	0.10522	0.037000	0.13140	2.746000	0.47467	0.075000	0.16796	0.121000	0.15741	TCG	.	.	none		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
SOCS1	8651	hgsc.bcm.edu	37	16	11349329	11349329	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:11349329C>T	ENST00000332029.2	-	2	157	c.7G>A	c.(7-9)Gca>Aca	p.A3T	RMI2_ENST00000572173.1_Intron	NM_003745.1	NP_003736.1	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	3					cellular response to amino acid stimulus (GO:0071230)|cytokine-mediated signaling pathway (GO:0019221)|fat cell differentiation (GO:0045444)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein phosphorylation (GO:0001932)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)	insulin-like growth factor receptor binding (GO:0005159)|kinase inhibitor activity (GO:0019210)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)	p.0?(1)|p.A3T(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(66)|lung(3)	71						TGGTTGTGTGCTACCATCCTA	0.697			"""F, O"""		"""Hodgkin Lymphoma, PMBL"""																																p.A3T	Colon(177;456 3548 27231)	Atlas-SNP	.		Rec	yes		16	16p13.13	8651	suppressor of cytokine signaling 1		L	SOCS1,NS,lymphoid_neoplasm,0,2	SOCS1	84	2	2	Substitution - Missense(1)|Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(2)	c.G7A						scavenged	.						6.0	7.0	6.0					16																	11349329		1898	3954	5852	SO:0001583	missense	8651	exon2			TGTGTGCTACCAT	U88326	CCDS10546.1	16p13.13	2013-02-14			ENSG00000185338	ENSG00000185338		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19383	protein-coding gene	gene with protein product		603597				7796808, 9266833	Standard	NM_003745		Approved	SOCS-1, SSI-1, JAB, TIP3, Cish1	uc002dar.1	O15524	OTTHUMG00000129792	ENST00000332029.2:c.7G>A	16.37:g.11349329C>T	ENSP00000329418:p.Ala3Thr	16.0	2.0	0.125		12.0	8.0	0.666667	NM_003745	O15097|Q9NSA7	Missense_Mutation	SNP	ENST00000332029.2	37	CCDS10546.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891903	0.72524	.	.	ENSG00000185338	ENST00000332029	T	0.27104	1.69	3.27	3.27	0.37495	.	0.182614	0.47455	D	0.000237	T	0.15825	0.0381	N	0.08118	0	0.44871	D	0.997889	D	0.55385	0.971	P	0.44772	0.46	T	0.09530	-1.0670	10	0.46703	T	0.11	-4.6538	13.6611	0.62368	0.0:1.0:0.0:0.0	.	3	O15524	SOCS1_HUMAN	T	3	ENSP00000329418:A3T	ENSP00000329418:A3T	A	-	1	0	SOCS1	11256830	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.316000	0.65815	1.668000	0.50843	0.491000	0.48974	GCA	.	.	none		0.697	SOCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252018.1		
PCDHB1	29930	hgsc.bcm.edu	37	5	140432615	140432615	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr5:140432615G>A	ENST00000306549.3	+	1	1637	c.1560G>A	c.(1558-1560)atG>atA	p.M520I		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	520	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGAGAACCATGGATTATGAGG	0.433																																					p.M520I		Atlas-SNP	.											.	PCDHB1	148	.	0			c.G1560A						PASS	.						76.0	77.0	77.0					5																	140432615		2203	4300	6503	SO:0001583	missense	29930	exon1			AACCATGGATTAT	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1560G>A	5.37:g.140432615G>A	ENSP00000307234:p.Met520Ile	94.0	0.0	0		143.0	62.0	0.433566	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601493	0.28534	.	.	ENSG00000171815	ENST00000306549	T	0.47177	0.85	6.11	5.24	0.73138	Cadherin (5);Cadherin-like (1);	0.000000	0.53938	D	0.000046	T	0.32704	0.0838	N	0.17674	0.51	0.35001	D	0.755995	B	0.02656	0.0	B	0.06405	0.002	T	0.38585	-0.9654	10	0.62326	D	0.03	.	10.0729	0.42343	0.0:0.1218:0.5105:0.3678	.	520	Q9Y5F3	PCDB1_HUMAN	I	520	ENSP00000307234:M520I	ENSP00000307234:M520I	M	+	3	0	PCDHB1	140412799	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.839000	0.48207	1.579000	0.49836	0.655000	0.94253	ATG	.	.	none		0.433	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PPP2R5B	5526	hgsc.bcm.edu	37	11	64699058	64699058	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:64699058C>T	ENST00000164133.2	+	10	1595	c.973C>T	c.(973-975)Cca>Tca	p.P325S		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	325					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CAAATACTGGCCAAAAACCTG	0.597																																					p.P325S		Atlas-SNP	.											.	PPP2R5B	47	.	0			c.C973T						PASS	.						41.0	38.0	39.0					11																	64699058		2201	4297	6498	SO:0001583	missense	5526	exon10			TACTGGCCAAAAA	L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.973C>T	11.37:g.64699058C>T	ENSP00000164133:p.Pro325Ser	40.0	0.0	0		47.0	25.0	0.531915	NM_006244	Q13853	Missense_Mutation	SNP	ENST00000164133.2	37	CCDS8085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.729428|4.729428	0.89390|0.89390	.|.	.|.	ENSG00000068971|ENSG00000068971	ENST00000359279|ENST00000164133;ENST00000527441	.|.	.|.	.|.	4.53|4.53	4.53|4.53	0.55603|0.55603	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83367|0.83367	0.5239|0.5239	M|M	0.90595|0.90595	3.13|3.13	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.64410	.|0.925	D|D	0.87185|0.87185	0.2230|0.2230	6|9	0.09338|0.87932	T|D	0.73|0	-8.6715|-8.6715	15.1517|15.1517	0.72706|0.72706	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|325	.|Q15173	.|2A5B_HUMAN	V|S	350|325	.|.	ENSP00000352225:A350V|ENSP00000164133:P325S	A|P	+|+	2|1	0|0	PPP2R5B|PPP2R5B	64455634|64455634	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.549000|5.549000	0.67261|0.67261	2.509000|2.509000	0.84616|0.84616	0.462000|0.462000	0.41574|0.41574	GCC|CCA	.	.	none		0.597	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385465.1	NM_006244	
PLA2G4C	8605	hgsc.bcm.edu	37	19	48558246	48558246	+	Missense_Mutation	SNP	C	C	T	rs370150895		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr19:48558246C>T	ENST00000599921.1	-	15	1675	c.1318G>A	c.(1318-1320)Gag>Aag	p.E440K	PLA2G4C_ENST00000413144.2_Missense_Mutation_p.E440K|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.E450K|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.E440K			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	440	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		AGCTCAGCCTCTTCTACTTGG	0.537																																					p.E450K		Atlas-SNP	.											.	PLA2G4C	76	.	0			c.G1348A						PASS	.	C	LYS/GLU,LYS/GLU,LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	93.0	94.0	94.0		1348,1318,1318	-0.4	0.0	19		94	0,8600		0,0,4300	no	missense,missense,missense	PLA2G4C	NM_001159322.1,NM_001159323.1,NM_003706.2	56,56,56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,benign	450/552,440/528,440/542	48558246	2,13004	2203	4300	6503	SO:0001583	missense	8605	exon15			CAGCCTCTTCTAC	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1318G>A	19.37:g.48558246C>T	ENSP00000469473:p.Glu440Lys	138.0	0.0	0		145.0	77.0	0.531034	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	37	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	C	2.940	-0.219120	0.06101	4.54E-4	0.0	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.04317	3.65;3.65	3.19	-0.385	0.12470	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.170328	0.37809	U	0.001933	T	0.03783	0.0107	L	0.41236	1.265	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.003	T	0.35400	-0.9790	10	0.41790	T	0.15	-12.1445	5.3436	0.15996	0.0:0.5724:0.0:0.4276	.	450;440	B4DI40;Q9UP65	.;PA24C_HUMAN	K	440	ENSP00000346228:E440K;ENSP00000400036:E440K	ENSP00000346228:E440K	E	-	1	0	PLA2G4C	53250058	0.011000	0.17503	0.002000	0.10522	0.020000	0.10135	0.887000	0.28254	0.033000	0.15463	-0.474000	0.04947	GAG	.	.	weak		0.537	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
FNBP4	23360	hgsc.bcm.edu	37	11	47744591	47744591	+	Silent	SNP	A	A	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:47744591A>T	ENST00000263773.5	-	15	2754	c.2742T>A	c.(2740-2742)ccT>ccA	p.P914P		NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	914	Pro-rich.					nucleus (GO:0005634)		p.P914P(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						gtggtggtggaggaggaggag	0.463																																					p.P914P		Atlas-SNP	.											FNBP4,NS,carcinoma,0,1	FNBP4	99	1	1	Substitution - coding silent(1)	endometrium(1)	c.T2742A						PASS	.						15.0	15.0	15.0					11																	47744591		1997	4159	6156	SO:0001819	synonymous_variant	23360	exon15			TGGTGGAGGAGGA	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.2742T>A	11.37:g.47744591A>T		48.0	0.0	0		53.0	4.0	0.0754717	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	ENST00000263773.5	37	CCDS41644.1																																																																																			.	.	none		0.463	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
KMT2D	8085	hgsc.bcm.edu	37	12	49427679	49427679	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:49427679C>T	ENST00000301067.7	-	39	10808	c.10809G>A	c.(10807-10809)caG>caA	p.Q3603Q	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3603	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3603Q(1)|p.Q3333Q(1)									gctgctgctgctgttgttgct	0.582																																					p.Q3603Q		Atlas-SNP	.											MLL2_ENST00000301067,NS,carcinoma,0,2	MLL2	1173	2	2	Substitution - coding silent(2)	endometrium(2)	c.G10809A						scavenged	.						10.0	10.0	10.0					12																	49427679		2174	4260	6434	SO:0001819	synonymous_variant	8085	exon39			CTGCTGCTGTTGT	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10809G>A	12.37:g.49427679C>T		54.0	0.0	0		44.0	3.0	0.0681818	NM_003482	O14687	Silent	SNP	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.582	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
UNC45B	146862	hgsc.bcm.edu	37	17	33504529	33504529	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:33504529C>T	ENST00000268876.5	+	17	2258	c.2161C>T	c.(2161-2163)Cgg>Tgg	p.R721W	UNC45B_ENST00000433649.1_Missense_Mutation_p.R719W|UNC45B_ENST00000591048.1_Missense_Mutation_p.R640W|UNC45B_ENST00000394570.2_Missense_Mutation_p.R719W|UNC45B_ENST00000378449.1_Missense_Mutation_p.R640W	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	721					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				TGAGGTGGTGCGGCCCCTTGT	0.542																																					p.R721W		Atlas-SNP	.											UNC45B,NS,carcinoma,-1,2	UNC45B	133	2	0			c.C2161T						PASS	.						44.0	30.0	35.0					17																	33504529		2201	4293	6494	SO:0001583	missense	146862	exon17			GTGGTGCGGCCCC	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.2161C>T	17.37:g.33504529C>T	ENSP00000268876:p.Arg721Trp	83.0	0.0	0		101.0	41.0	0.405941	NM_173167	Q495Q8|Q495Q9	Missense_Mutation	SNP	ENST00000268876.5	37	CCDS11292.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502276	0.64298	.	.	ENSG00000141161	ENST00000394570;ENST00000268876;ENST00000433649;ENST00000378449	T;T;T	0.51325	3.54;1.52;0.71	5.3	3.21	0.36854	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	M	0.92923	3.36	0.51482	D	0.999929	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	T	0.79729	-0.1681	10	0.87932	D	0	-29.8644	12.8752	0.57986	0.4433:0.5567:0.0:0.0	.	640;719;721	Q8IWX7-2;Q8IWX7-3;Q8IWX7	.;.;UN45B_HUMAN	W	721;721;719;640	ENSP00000268876:R721W;ENSP00000412840:R719W;ENSP00000367710:R640W	ENSP00000268876:R721W	R	+	1	2	UNC45B	30528642	0.984000	0.35163	1.000000	0.80357	0.787000	0.44495	1.138000	0.31491	0.725000	0.32318	0.563000	0.77884	CGG	.	.	none		0.542	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256458.2	NM_173167	
AR	367	hgsc.bcm.edu	37	X	66905872	66905872	+	Missense_Mutation	SNP	G	G	A	rs137852569		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:66905872G>A	ENST00000374690.3	+	3	2313	c.1789G>A	c.(1789-1791)Gcc>Acc	p.A597T	AR_ENST00000396044.3_Missense_Mutation_p.A597T|AR_ENST00000504326.1_Missense_Mutation_p.A597T|AR_ENST00000396043.2_Missense_Mutation_p.A65T|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	596	Interaction with HIPK3. {ECO:0000250}.|Interaction with LPXN.		S -> G (in PAIS; high dissociation rate; associated with P-617 in a PAIS patient; partially restores DNA-binding activity of P-617 mutant receptors). {ECO:0000269|PubMed:1316540}.|S -> T (in a patient with severe hypospadias). {ECO:0000269|PubMed:10092153}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GTACCTGTGCGCCAGCAGAAA	0.413									Androgen Insensitivity Syndrome																												p.A597T		Atlas-SNP	.											.	AR	249	.	0			c.G1789A	GRCh37	CM920071	AR	M	rs137852569	PASS	.						106.0	93.0	97.0					X																	66905872		2203	4300	6503	SO:0001583	missense	367	exon3	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CTGTGCGCCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1789G>A	X.37:g.66905872G>A	ENSP00000363822:p.Ala597Thr	60.0	0.0	0		59.0	4.0	0.0677966	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	37	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214457	0.58452	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000396043	D;D;D;D	0.97209	-4.29;-4.29;-4.29;-4.29	5.32	4.47	0.54385	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.97155	0.9070	L	0.45352	1.415	0.80722	D	1	P;P;D;B	0.89917	0.881;0.881;1.0;0.343	B;B;D;B	0.97110	0.175;0.175;1.0;0.076	D	0.97171	0.9844	10	0.87932	D	0	.	10.6719	0.45764	0.0936:0.0:0.9064:0.0	.	597;597;65;596	E7EVX6;D3YPQ2;F1D8N5;P10275	.;.;.;ANDR_HUMAN	T	407;597;597;597;65	ENSP00000363822:A597T;ENSP00000421155:A597T;ENSP00000379359:A597T;ENSP00000379358:A65T	ENSP00000363822:A597T	A	+	1	0	AR	66822597	1.000000	0.71417	0.987000	0.45799	0.102000	0.19082	9.050000	0.93843	1.228000	0.43614	-0.306000	0.09157	GCC	.	.	weak		0.413	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
BEST3	144453	hgsc.bcm.edu	37	12	70087575	70087575	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:70087575G>A	ENST00000330891.5	-	4	586	c.360C>T	c.(358-360)caC>caT	p.H120H	BEST3_ENST00000553096.1_Silent_p.H14H|BEST3_ENST00000476098.1_De_novo_Start_OutOfFrame|BEST3_ENST00000551160.1_Silent_p.H14H|BEST3_ENST00000393365.1_Silent_p.H14H|BEST3_ENST00000266661.4_Silent_p.H14H|BEST3_ENST00000331471.4_Silent_p.H120H|BEST3_ENST00000533674.1_5'UTR	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	120					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GCAGGCGCCCGTGCTCGTCGC	0.532																																					p.H120H		Atlas-SNP	.											.	BEST3	129	.	0			c.C360T						PASS	.						103.0	89.0	93.0					12																	70087575		2203	4300	6503	SO:0001819	synonymous_variant	144453	exon4			GCGCCCGTGCTCG	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.360C>T	12.37:g.70087575G>A		138.0	0.0	0		162.0	60.0	0.37037	NM_032735	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Silent	SNP	ENST00000330891.5	37	CCDS8992.2																																																																																			.	.	none		0.532	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313908.2	NM_152439	
DACH1	1602	hgsc.bcm.edu	37	13	72440219	72440219	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr13:72440219G>C	ENST00000359684.2	-	1	688	c.689C>G	c.(688-690)aCg>aGg	p.T230R	DACH1_ENST00000354591.4_Missense_Mutation_p.T230R|DACH1_ENST00000313174.7_Missense_Mutation_p.T230R|DACH1_ENST00000305425.4_Missense_Mutation_p.T230R			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	230	DACHbox-N.|Interaction with SIX6 and HDAC3. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)	p.T230fs*6(1)		NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GGTGTAGACCGTATGCAAGCC	0.617																																					p.T230R		Atlas-SNP	.											.	DACH1	123	.	1	Deletion - Frameshift(1)	lung(1)	c.C689G						PASS	.						79.0	85.0	83.0					13																	72440219		2070	4222	6292	SO:0001583	missense	1602	exon1			TAGACCGTATGCA	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.689C>G	13.37:g.72440219G>C	ENSP00000352712:p.Thr230Arg	149.0	0.0	0		133.0	66.0	0.496241	NM_080759	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	37		.	.	.	.	.	.	.	.	.	.	G	18.36	3.606479	0.66445	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	4.08	4.08	0.47627	.	0.000000	0.85682	D	0.000000	D	0.91012	0.7173	M	0.80982	2.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.92697	0.6171	10	0.87932	D	0	-6.469	15.8733	0.79141	0.0:0.0:1.0:0.0	.	228;228;228	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	R	230	ENSP00000304994:T230R;ENSP00000318506:T230R;ENSP00000346604:T230R;ENSP00000352712:T230R	ENSP00000304994:T230R	T	-	2	0	DACH1	71338220	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.144000	0.94629	1.803000	0.52742	0.313000	0.20887	ACG	.	.	none		0.617	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056385	26056385	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:26056385C>T	ENST00000343677.2	-	1	314	c.272G>A	c.(271-273)gGc>gAc	p.G91D		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	91	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						CACCAGAGTGCCCTTGCTCAC	0.542																																					p.G91D		Atlas-SNP	.											.	HIST1H1C	80	.	0			c.G272A						PASS	.						111.0	115.0	114.0					6																	26056385		2203	4300	6503	SO:0001583	missense	3006	exon1			AGAGTGCCCTTGC	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.272G>A	6.37:g.26056385C>T	ENSP00000339566:p.Gly91Asp	171.0	0.0	0		188.0	87.0	0.462766	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	37	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.696243	0.68386	.	.	ENSG00000187837	ENST00000343677	T	0.59083	0.29	5.63	5.63	0.86233	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.107097	0.64402	D	0.000006	T	0.79902	0.4526	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83425	0.0035	10	0.87932	D	0	-22.419	19.032	0.92961	0.0:1.0:0.0:0.0	.	91	P16403	H12_HUMAN	D	91	ENSP00000339566:G91D	ENSP00000339566:G91D	G	-	2	0	HIST1H1C	26164364	1.000000	0.71417	1.000000	0.80357	0.311000	0.27955	5.879000	0.69690	2.814000	0.96858	0.655000	0.94253	GGC	.	.	none		0.542	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
CYP2C19	1557	hgsc.bcm.edu	37	10	96580331	96580331	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr10:96580331G>A	ENST00000371321.3	+	6	980	c.898G>A	c.(898-900)Gag>Aag	p.E300K	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	300					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	AGCTGGGACAGAGACAACAAG	0.428																																					p.E300K		Atlas-SNP	.											.	CYP2C19	88	.	0			c.G898A						PASS	.						193.0	174.0	181.0					10																	96580331		2203	4300	6503	SO:0001583	missense	1557	exon6			GGGACAGAGACAA	M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.898G>A	10.37:g.96580331G>A	ENSP00000360372:p.Glu300Lys	103.0	0.0	0		102.0	30.0	0.294118	NM_000769	P33259|Q8WZB1|Q8WZB2|Q9UCD4	Missense_Mutation	SNP	ENST00000371321.3	37	CCDS7436.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.796723	0.50208	.	.	ENSG00000165841	ENST00000371321	T	0.17213	2.29	3.95	3.95	0.45737	.	0.074405	0.51477	U	0.000091	T	0.47488	0.1448	M	0.92604	3.325	0.29808	N	0.831907	D	0.89917	1.0	D	0.69654	0.965	T	0.56768	-0.7924	10	0.87932	D	0	.	11.4092	0.49915	0.0:0.0:1.0:0.0	.	300	P33261	CP2CJ_HUMAN	K	300	ENSP00000360372:E300K	ENSP00000360372:E300K	E	+	1	0	CYP2C19	96570321	1.000000	0.71417	0.996000	0.52242	0.192000	0.23643	5.180000	0.65048	2.016000	0.59253	0.400000	0.26472	GAG	.	.	none		0.428	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049490.1	NM_000769	
PMPCA	23203	hgsc.bcm.edu	37	9	139306549	139306549	+	Missense_Mutation	SNP	A	A	G	rs367845329		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:139306549A>G	ENST00000371717.3	+	2	181	c.172A>G	c.(172-174)Aca>Gca	p.T58A	SDCCAG3_ENST00000357365.3_5'Flank|PMPCA_ENST00000371720.1_Missense_Mutation_p.T58A|SDCCAG3_ENST00000371725.3_5'Flank|PMPCA_ENST00000399219.3_5'UTR|SDCCAG3_ENST00000298537.7_5'Flank	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	58					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		TGTTTTTGCTACAGTTGATGG	0.473																																					p.T58A		Atlas-SNP	.											.	PMPCA	29	.	0			c.A172G						PASS	.	A	ALA/THR	0,4406		0,0,2203	177.0	163.0	167.0		172	3.3	0.8	9		167	1,8599	1.2+/-3.3	0,1,4299	no	missense	PMPCA	NM_015160.1	58	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	58/526	139306549	1,13005	2203	4300	6503	SO:0001583	missense	23203	exon2			TTTGCTACAGTTG	D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.172A>G	9.37:g.139306549A>G	ENSP00000360782:p.Thr58Ala	268.0	0.0	0		288.0	72.0	0.25	NM_015160	B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	ENST00000371717.3	37	CCDS35180.1	.	.	.	.	.	.	.	.	.	.	A	8.346	0.829805	0.16749	0.0	1.16E-4	ENSG00000165688	ENST00000371720;ENST00000371717	T	0.11821	2.74	4.46	3.31	0.37934	.	0.246395	0.41396	D	0.000886	T	0.09158	0.0226	L	0.28556	0.865	0.80722	D	1	B;B	0.13145	0.007;0.001	B;B	0.09377	0.004;0.002	T	0.21245	-1.0251	10	0.20046	T	0.44	.	8.9219	0.35617	0.8332:0.0:0.0:0.1668	.	58;58	B4DRK5;Q10713	.;MPPA_HUMAN	A	58	ENSP00000360782:T58A	ENSP00000360782:T58A	T	+	1	0	PMPCA	138426370	0.602000	0.26916	0.813000	0.32504	0.911000	0.54048	1.358000	0.34102	0.670000	0.31165	-0.368000	0.07277	ACA	.	.	weak		0.473	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055054.1	NM_015160	
CTR9	9646	hgsc.bcm.edu	37	11	10777233	10777233	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr11:10777233G>T	ENST00000361367.2	+	4	819	c.393G>T	c.(391-393)ttG>ttT	p.L131F		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	131					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AGAACCATTTGTTGGGAAGAG	0.383																																					p.L131F		Atlas-SNP	.											.	CTR9	94	.	0			c.G393T						PASS	.						139.0	136.0	137.0					11																	10777233		2201	4294	6495	SO:0001583	missense	9646	exon4			CCATTTGTTGGGA	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.393G>T	11.37:g.10777233G>T	ENSP00000355013:p.Leu131Phe	139.0	0.0	0		116.0	48.0	0.413793	NM_014633	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	37	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536972	0.45176	.	.	ENSG00000198730	ENST00000361367;ENST00000524523	T;T	0.78707	-1.2;1.12	5.97	2.57	0.30868	Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	M	0.77820	2.39	0.80722	D	1	P	0.40834	0.73	B	0.31547	0.132	T	0.64474	-0.6399	10	0.19590	T	0.45	-8.2928	8.3402	0.32239	0.1941:0.0:0.6841:0.1217	.	131	Q6PD62	CTR9_HUMAN	F	131;118	ENSP00000355013:L131F;ENSP00000431458:L118F	ENSP00000355013:L131F	L	+	3	2	CTR9	10733809	1.000000	0.71417	1.000000	0.80357	0.420000	0.31355	1.477000	0.35431	0.814000	0.34374	0.591000	0.81541	TTG	.	.	none		0.383	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
OPN1LW	5956	hgsc.bcm.edu	37	X	153421999	153421999	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:153421999G>A	ENST00000369951.4	+	5	1035	c.975G>A	c.(973-975)atG>atA	p.M325I		NM_020061.4	NP_064445.2	P04000	OPSR_HUMAN	opsin 1 (cone pigments), long-wave-sensitive	325					phototransduction, visible light (GO:0007603)|positive regulation of cytokinesis (GO:0032467)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	15	all_cancers(53;1.83e-16)|all_epithelial(53;2.73e-10)|all_lung(58;6.39e-07)|Lung NSC(58;8.37e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ATGTCTTTATGAACCGGCAGG	0.522																																					p.M325I		Atlas-SNP	.											.	OPN1LW	87	.	0			c.G975A						PASS	.						160.0	162.0	161.0					X																	153421999		2193	4268	6461	SO:0001583	missense	5956	exon5			CTTTATGAACCGG	Z68193	CCDS14742.1	Xq28	2013-01-08	2008-04-16		ENSG00000102076	ENSG00000102076		"""GPCR / Class A : Opsin receptors"""	9936	protein-coding gene	gene with protein product	"""cone dystrophy 5 (X-linked)"""	300822	"""color blindness, protan"", ""red cone photoreceptor pigment"""	CBBM, RCP, CBP			Standard	NM_020061		Approved	COD5	uc004fjz.4	P04000	OTTHUMG00000034295	ENST00000369951.4:c.975G>A	X.37:g.153421999G>A	ENSP00000358967:p.Met325Ile	409.0	0.0	0		464.0	71.0	0.153017	NM_020061		Missense_Mutation	SNP	ENST00000369951.4	37	CCDS14742.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940464	0.73557	.	.	ENSG00000102076	ENST00000369951	T	0.37752	1.18	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.66781	0.2824	M	0.89601	3.045	0.58432	D	0.999999	D	0.65815	0.995	D	0.77004	0.989	T	0.75909	-0.3151	10	0.87932	D	0	.	15.5112	0.75782	0.0:0.0:1.0:0.0	.	325	P04000	OPSR_HUMAN	I	325	ENSP00000358967:M325I	ENSP00000358967:M325I	M	+	3	0	OPN1LW	153075193	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.384000	0.66225	1.989000	0.58080	0.436000	0.28706	ATG	.	.	none		0.522	OPN1LW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082839.2	NM_020061	
SERINC3	10955	hgsc.bcm.edu	37	20	43129937	43129937	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr20:43129937G>A	ENST00000342374.4	-	9	1217	c.1060C>T	c.(1060-1062)Cgc>Tgc	p.R354C	SERINC3_ENST00000255175.1_Missense_Mutation_p.R354C|SERINC3_ENST00000541235.1_Missense_Mutation_p.R299C	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3	354					phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			GTGGAAGTGCGGATGCTGGAA	0.493																																					p.R354C		Atlas-SNP	.											.	SERINC3	42	.	0			c.C1060T						PASS	.						95.0	78.0	84.0					20																	43129937		2203	4300	6503	SO:0001583	missense	10955	exon9			AAGTGCGGATGCT	U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.1060C>T	20.37:g.43129937G>A	ENSP00000340243:p.Arg354Cys	78.0	0.0	0		103.0	50.0	0.485437	NM_006811	B4DUE9|O43717|Q9BR33	Missense_Mutation	SNP	ENST00000342374.4	37	CCDS13333.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.618830	0.87460	.	.	ENSG00000132824	ENST00000411544;ENST00000255175;ENST00000342374;ENST00000538937;ENST00000541235	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.4	4.45	0.53987	.	0.143233	0.64402	N	0.000004	T	0.50871	0.1641	M	0.92970	3.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	T	0.64330	-0.6433	10	0.72032	D	0.01	.	14.1243	0.65210	0.0719:0.0:0.9281:0.0	.	354;354	Q53GK8;Q13530	.;SERC3_HUMAN	C	93;354;354;321;299	ENSP00000414197:R93C;ENSP00000255175:R354C;ENSP00000340243:R354C;ENSP00000440966:R299C	ENSP00000255175:R354C	R	-	1	0	SERINC3	42563351	1.000000	0.71417	0.991000	0.47740	0.968000	0.65278	9.480000	0.97931	1.506000	0.48736	0.563000	0.77884	CGC	.	.	none		0.493	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080544.3	NM_006811	
GTF2H5	404672	hgsc.bcm.edu	37	6	158613139	158613139	+	Nonsense_Mutation	SNP	C	C	T	rs121434364		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:158613139C>T	ENST00000607778.1	+	3	244	c.166C>T	c.(166-168)Cga>Tga	p.R56*		NM_207118.2	NP_997001.1	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5	56					cellular response to gamma radiation (GO:0071480)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, preincision complex assembly (GO:0006294)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription elongation from RNA polymerase I promoter (GO:0006362)	core TFIIH complex (GO:0000439)|nucleolus (GO:0005730)	rDNA binding (GO:0000182)						Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		CCTCCAGGAGCGAGTGGGTGA	0.403								Nucleotide excision repair (NER)																													p.R56X		Atlas-SNP	.											.	GTF2H5	1	.	0			c.C166T	GRCh37	CM041784	GTF2H5	M	rs121434364	PASS	.						104.0	97.0	99.0					6																	158613139		2203	4300	6503	SO:0001587	stop_gained	404672	exon3			CAGGAGCGAGTGG	AK055106	CCDS5256.1	6q25.3	2014-09-17	2004-07-15	2004-07-16		ENSG00000272047		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	21157	protein-coding gene	gene with protein product	"""DNA repair syndrome trichothiodystrophy group A"""	608780	"""chromosome 6 open reading frame 175"", ""trichothiodystrophy"""	C6orf175, TTD		15220921	Standard	NM_207118		Approved	FLJ30544, bA120J8.2, TTD-A, TFB5, TFIIH, TTDA	uc003qrd.3	Q6ZYL4		ENST00000607778.1:c.166C>T	6.37:g.158613139C>T	ENSP00000476100:p.Arg56*	201.0	0.0	0		173.0	87.0	0.50289	NM_207118	Q0P5V8	Nonsense_Mutation	SNP	ENST00000607778.1	37	CCDS5256.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150837	0.78001	.	.	ENSG00000185068	ENST00000438073	.	.	.	6.06	5.15	0.70609	.	0.056997	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-1.3438	7.5749	0.27931	0.1988:0.7139:0.0:0.0873	.	.	.	.	X	56	.	ENSP00000415032:R56X	R	+	1	2	GTF2H5	158533127	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	3.192000	0.50989	1.482000	0.48325	-0.355000	0.07637	CGA	.	.	weak		0.403	GTF2H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042865.2	NM_207118	
ABCA3	21	hgsc.bcm.edu	37	16	2338028	2338028	+	Splice_Site	SNP	G	G	A	rs76519389	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:2338028G>A	ENST00000301732.5	-	21	3703	c.3003C>T	c.(3001-3003)ctC>ctT	p.L1001L	ABCA3_ENST00000382381.3_Splice_Site_p.L943L	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1001					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	GCCCCTTACCGAGCACCTCGC	0.667													G|||	4	0.000798722	0.0023	0.0	5008	,	,		14175	0.0		0.0	False		,,,				2504	0.001				p.L1001L		Atlas-SNP	.											.	ABCA3	176	.	0			c.C3003T						PASS	.	G		2,4394		0,2,2196	22.0	23.0	23.0		3003	-1.2	1.0	16	dbSNP_131	23	0,8598		0,0,4299	yes	coding-synonymous-near-splice	ABCA3	NM_001089.2		0,2,6495	AA,AG,GG		0.0,0.0455,0.0154		1001/1705	2338028	2,12992	2198	4299	6497	SO:0001630	splice_region_variant	21	exon21			CTTACCGAGCACC	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.3004+1C>T	16.37:g.2338028G>A		27.0	0.0	0		20.0	8.0	0.4	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1																																																																																			G|1.000;A|0.000	0.000	strong		0.667	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	Silent
NKAIN2	154215	hgsc.bcm.edu	37	6	124676480	124676480	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr6:124676480G>C	ENST00000368417.1	+	3	320	c.260G>C	c.(259-261)gGg>gCg	p.G87A	NKAIN2_ENST00000545433.1_Missense_Mutation_p.G72A|NKAIN2_ENST00000368416.1_Missense_Mutation_p.G87A|NKAIN2_ENST00000476571.1_3'UTR|NKAIN2_ENST00000546092.1_Missense_Mutation_p.G87A	NM_001040214.1	NP_001035304.1	Q5VXU1	NKAI2_HUMAN	Na+/K+ transporting ATPase interacting 2	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|large_intestine(3)|lung(12)|skin(2)	19				GBM - Glioblastoma multiforme(226;0.104)		TTGGAGGCTGGGGACCTCTCA	0.423																																					p.G87A		Atlas-SNP	.											.	NKAIN2	34	.	0			c.G260C						PASS	.						246.0	223.0	231.0					6																	124676480		2203	4300	6503	SO:0001583	missense	154215	exon3			AGGCTGGGGACCT	AB070452	CCDS34526.1	6q21	2008-02-05	2007-10-04	2007-10-04	ENSG00000188580	ENSG00000188580		"""Na+/K+ transporting ATPase interacting"""	16443	protein-coding gene	gene with protein product		609758	"""T-cell lymphoma breakpoint associated target 1"""	TCBA1		17606467	Standard	XM_005266833		Approved	FAM77B	uc003pzo.3	Q5VXU1	OTTHUMG00000015500	ENST00000368417.1:c.260G>C	6.37:g.124676480G>C	ENSP00000357402:p.Gly87Ala	283.0	0.0	0		234.0	116.0	0.495726	NM_153355	Q8IYR4|Q8TF67	Missense_Mutation	SNP	ENST00000368417.1	37	CCDS34526.1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094672	0.56075	.	.	ENSG00000188580	ENST00000368416;ENST00000368417;ENST00000546092;ENST00000539866;ENST00000545433	T;T;T;T	0.38077	1.16;1.16;1.16;1.16	5.74	4.86	0.63082	.	0.382836	0.29100	N	0.013152	T	0.30727	0.0774	M	0.80746	2.51	0.54753	D	0.999985	B;B;B;P	0.38473	0.082;0.452;0.294;0.633	B;B;B;B	0.36289	0.088;0.211;0.132;0.221	T	0.35276	-0.9795	10	0.59425	D	0.04	0.1499	16.0861	0.81049	0.0:0.0:0.8649:0.1351	.	87;86;87;87	F5GY48;Q5VXU1-3;Q5VXU1;Q5VXU1-2	.;.;NKAI2_HUMAN;.	A	87;87;87;86;72	ENSP00000357401:G87A;ENSP00000357402:G87A;ENSP00000440287:G87A;ENSP00000437798:G72A	ENSP00000357401:G87A	G	+	2	0	NKAIN2	124718179	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.421000	0.90259	1.410000	0.46936	0.650000	0.86243	GGG	.	.	none		0.423	NKAIN2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042057.1	NM_001040214	
SEC22C	9117	hgsc.bcm.edu	37	3	42610481	42610481	+	Missense_Mutation	SNP	C	C	G	rs141431943		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:42610481C>G	ENST00000264454.3	-	2	201	c.58G>C	c.(58-60)Gcc>Ccc	p.A20P	SEC22C_ENST00000273156.7_Missense_Mutation_p.A20P|SEC22C_ENST00000493107.1_5'UTR|SEC22C_ENST00000423701.2_Missense_Mutation_p.A20P|SEC22C_ENST00000536332.1_5'UTR|SEC22C_ENST00000417572.1_Missense_Mutation_p.A20P			Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C (S. cerevisiae)	20	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)	3				KIRC - Kidney renal clear cell carcinoma(284;0.222)		TCAGTAGAGGCTGAGAGGGGC	0.517																																					p.A20P		Atlas-SNP	.											.	SEC22C	27	.	0			c.G58C						PASS	.						74.0	72.0	72.0					3																	42610481		2203	4300	6503	SO:0001583	missense	9117	exon2			TAGAGGCTGAGAG	AF039568	CCDS2699.1, CCDS2700.1, CCDS56246.1	3p24.3-p22.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000093183	ENSG00000093183			16828	protein-coding gene	gene with protein product		604028	"""SEC22 vesicle trafficking protein-like 3 (S. cerevisiae)"""	SEC22L3		9501016, 11001058	Standard	NM_004206		Approved	MGC13261, MGC5373	uc003clj.3	Q9BRL7	OTTHUMG00000131797	ENST00000264454.3:c.58G>C	3.37:g.42610481C>G	ENSP00000264454:p.Ala20Pro	178.0	0.0	0		168.0	30.0	0.178571	NM_001201584	O95152|Q68CX3|Q6UW18	Missense_Mutation	SNP	ENST00000264454.3	37	CCDS2700.1	.	.	.	.	.	.	.	.	.	.	C	32	5.146526	0.94603	.	.	ENSG00000093183	ENST00000423701;ENST00000273156;ENST00000417572;ENST00000264454;ENST00000456515;ENST00000450981;ENST00000416880;ENST00000420163	T;T;T;T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81;1.81;1.81;1.81	5.41	5.41	0.78517	Longin (2);Longin-like (1);	0.000000	0.85682	D	0.000000	T	0.59418	0.2192	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.66670	-0.5865	10	0.87932	D	0	-10.4295	19.1881	0.93653	0.0:1.0:0.0:0.0	.	20;20;20	Q9BRL7-3;Q9BRL7;Q9BRL7-2	.;SC22C_HUMAN;.	P	20	ENSP00000414576:A20P;ENSP00000273156:A20P;ENSP00000407564:A20P;ENSP00000264454:A20P;ENSP00000391170:A20P;ENSP00000397170:A20P;ENSP00000391957:A20P;ENSP00000408242:A20P	ENSP00000264454:A20P	A	-	1	0	SEC22C	42585485	1.000000	0.71417	0.946000	0.38457	0.871000	0.50021	7.246000	0.78247	2.522000	0.85027	0.655000	0.94253	GCC	C|1.000;T|0.000	.	alt		0.517	SEC22C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254734.1	NM_004206	
USP17L10	100287144	hgsc.bcm.edu	37	4	9212697	9212697	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr4:9212697C>T	ENST00000417945.1	+	1	315	c.315C>T	c.(313-315)gcC>gcT	p.A105A	USP17L13_ENST00000421288.2_Intron	NM_001256852.1	NP_001243781.1	C9JJH3	U17LA_HUMAN	ubiquitin specific peptidase 17-like family member 10	105	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)										CGCCACTTGCCAACTACATGC	0.557																																					p.A105A		Atlas-SNP	.											.	.	.	.	0			c.C315T						PASS	.																																			SO:0001819	synonymous_variant	100287144	exon1			ACTTGCCAACTAC		CCDS59454.1	4p16.1	2014-02-12	2012-10-09		ENSG00000231396	ENSG00000231396			44438	protein-coding gene	gene with protein product							Standard	NM_001256852		Approved		uc031sdg.1	C9JJH3	OTTHUMG00000160160	ENST00000417945.1:c.315C>T	4.37:g.9212697C>T		20.0	0.0	0		19.0	10.0	0.526316	NM_001256852		Silent	SNP	ENST00000417945.1	37	CCDS59454.1																																																																																			.	.	none		0.557	USP17L10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359428.1	NM_001256852	
SH3GL3	6457	hgsc.bcm.edu	37	15	84287010	84287010	+	Missense_Mutation	SNP	G	G	A	rs376114446		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:84287010G>A	ENST00000427482.2	+	9	1321	c.1015G>A	c.(1015-1017)Gtg>Atg	p.V339M	SH3GL3_ENST00000535412.1_3'UTR|SH3GL3_ENST00000324537.5_Missense_Mutation_p.V347M|SH3GL3_ENST00000434347.1_Missense_Mutation_p.V347M|SH3GL3_ENST00000564054.1_3'UTR|AC087738.1_ENST00000411248.1_RNA	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	339	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						CATTAATTACGTGGAAGTGAT	0.393																																					p.V339M		Atlas-SNP	.											SH3GL3_ENST00000427482,NS,carcinoma,0,2	SH3GL3	91	2	0			c.G1015A						PASS	.	G	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	106.0	94.0	98.0		1015	5.6	1.0	15		98	0,8600		0,0,4300	no	missense	SH3GL3	NM_003027.3	21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	339/348	84287010	1,13005	2203	4300	6503	SO:0001583	missense	6457	exon9			AATTACGTGGAAG	AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.1015G>A	15.37:g.84287010G>A	ENSP00000391372:p.Val339Met	79.0	0.0	0		80.0	14.0	0.175	NM_003027	O43553|O43554	Missense_Mutation	SNP	ENST00000427482.2	37	CCDS10325.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950836	0.92660	2.27E-4	0.0	ENSG00000140600	ENST00000427482;ENST00000324537;ENST00000434347	T;T;T	0.55234	0.53;0.53;0.53	5.57	5.57	0.84162	Src homology-3 domain (4);	0.264468	0.37483	N	0.002070	D	0.82697	0.5093	H	0.96805	3.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	D	0.88419	0.3027	10	0.87932	D	0	-31.8197	18.5386	0.91019	0.0:0.0:1.0:0.0	.	339;347	Q99963;Q99963-3	SH3G3_HUMAN;.	M	339;347;347	ENSP00000391372:V339M;ENSP00000320092:V347M;ENSP00000397871:V347M	ENSP00000320092:V347M	V	+	1	0	SH3GL3	82078014	1.000000	0.71417	0.979000	0.43373	0.986000	0.74619	9.300000	0.96151	2.612000	0.88384	0.655000	0.94253	GTG	.	.	weak		0.393	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347797.1	NM_003027	
IQCA1	79781	hgsc.bcm.edu	37	2	237374287	237374287	+	Missense_Mutation	SNP	G	G	A	rs35814876	byFrequency	TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr2:237374287G>A	ENST00000409907.3	-	6	1061	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	IQCA1_ENST00000431676.2_Missense_Mutation_p.R263W|IQCA1_ENST00000309507.5_Missense_Mutation_p.R259W	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	263							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						ACCTCATTCCGCAGGCGGTCC	0.448													G|||	4	0.000798722	0.0	0.0014	5008	,	,		19395	0.0		0.002	False		,,,				2504	0.001				p.R270W		Atlas-SNP	.											IQCA1_ENST00000409907,NS,carcinoma,+1,4	IQCA1	170	4	0			c.C808T						scavenged	.	G	TRP/ARG	4,3850		0,4,1923	131.0	119.0	123.0		787	1.3	0.0	2	dbSNP_126	123	21,8257		0,21,4118	yes	missense	IQCA1	NM_024726.3	101	0,25,6041	AA,AG,GG		0.2537,0.1038,0.2061	probably-damaging	263/823	237374287	25,12107	1927	4139	6066	SO:0001583	missense	79781	exon6			CATTCCGCAGGCG	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.787C>T	2.37:g.237374287G>A	ENSP00000387347:p.Arg263Trp	202.0	1.0	0.00495049		255.0	40.0	0.156863	NM_001270585	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	ENST00000409907.3	37	CCDS46549.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.73|15.73	2.918853|2.918853	0.52546|0.52546	0.001038|0.001038	0.002537|0.002537	ENSG00000132321|ENSG00000132321	ENST00000418802|ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	.|D;D;D	.|0.96041	.|-3.86;-3.89;-3.89	5.37|5.37	1.31|1.31	0.21738|0.21738	.|.	.|0.120895	.|0.37393	.|N	.|0.002106	D|D	0.97770|0.97770	0.9268|0.9268	M|M	0.88906|0.88906	2.99|2.99	0.09310|0.09310	N|N	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.995;0.998	D|D	0.94404|0.94404	0.7625|0.7625	5|10	.|0.87932	.|D	.|0	.|.	15.7632|15.7632	0.78103|0.78103	0.0:0.0:0.3887:0.6113|0.0:0.0:0.3887:0.6113	rs35814876|rs35814876	.|263;270;263	.|E7EWQ0;E9PH78;Q86XH1	.|.;.;IQCA1_HUMAN	V|W	281|263;270;259;263;259	.|ENSP00000387347:R263W;ENSP00000311951:R259W;ENSP00000407213:R263W	.|ENSP00000254653:R263W	A|R	-|-	2|1	0|2	IQCA1|IQCA1	237039026|237039026	0.017000|0.017000	0.18338|0.18338	0.022000|0.022000	0.16811|0.16811	0.026000|0.026000	0.11368|0.11368	0.527000|0.527000	0.22987|0.22987	-0.043000|-0.043000	0.13513|0.13513	0.563000|0.563000	0.77884|0.77884	GCG|CGG	G|0.986;A|0.014	0.014	weak		0.448	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
CA10	56934	hgsc.bcm.edu	37	17	49713329	49713329	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:49713329A>G	ENST00000285273.4	-	8	1787	c.676T>C	c.(676-678)Tat>Cat	p.Y226H	CA10_ENST00000340813.6_Missense_Mutation_p.Y232H|CA10_ENST00000570565.1_Missense_Mutation_p.Y151H|CA10_ENST00000442502.2_Missense_Mutation_p.Y226H|CA10_ENST00000571918.1_5'UTR|CA10_ENST00000451037.2_Missense_Mutation_p.Y226H	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	226					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	GTCTCTGGATATAGTTCCTCT	0.388																																					p.Y226H		Atlas-SNP	.											.	CA10	84	.	0			c.T676C						PASS	.						114.0	109.0	110.0					17																	49713329		2203	4300	6503	SO:0001583	missense	56934	exon8			CTGGATATAGTTC	AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.676T>C	17.37:g.49713329A>G	ENSP00000285273:p.Tyr226His	97.0	0.0	0		93.0	4.0	0.0430108	NM_001082534	B2R7J0|B4DGL6	Missense_Mutation	SNP	ENST00000285273.4	37	CCDS32684.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.021686	0.93462	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	6.16	6.16	0.99307	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.79569	0.4468	L	0.59436	1.845	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.994	D;D;P	0.76071	0.987;0.987;0.873	T	0.81070	-0.1099	10	0.87932	D	0	.	15.9872	0.80168	1.0:0.0:0.0:0.0	.	226;232;151	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	H	226;226;226;232	ENSP00000390666:Y226H;ENSP00000285273:Y226H;ENSP00000405388:Y226H;ENSP00000340363:Y232H	ENSP00000285273:Y226H	Y	-	1	0	CA10	47068328	1.000000	0.71417	0.985000	0.45067	0.985000	0.73830	9.157000	0.94714	2.367000	0.80283	0.528000	0.53228	TAT	.	.	none		0.388	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000437480.1	NM_020178	
SEMA6D	80031	hgsc.bcm.edu	37	15	48063877	48063877	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr15:48063877G>A	ENST00000316364.5	+	19	3556	c.3117G>A	c.(3115-3117)agG>agA	p.R1039R	SEMA6D_ENST00000389433.2_Silent_p.R1020R|SEMA6D_ENST00000389432.2_Silent_p.R996R|SEMA6D_ENST00000536845.2_Silent_p.R1039R|SEMA6D_ENST00000558014.1_Silent_p.R977R|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000354744.4_Silent_p.R983R|SEMA6D_ENST00000358066.4_Silent_p.R977R|SEMA6D_ENST00000389428.3_Silent_p.R964R|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000537942.1_Silent_p.R977R	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	1039					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		CTCTTCCTAGGACGGGACTAA	0.512																																					p.R1039R		Atlas-SNP	.											.	SEMA6D	322	.	0			c.G3117A						PASS	.						167.0	165.0	165.0					15																	48063877		2198	4297	6495	SO:0001819	synonymous_variant	80031	exon19			TCCTAGGACGGGA	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.3117G>A	15.37:g.48063877G>A		146.0	0.0	0		146.0	8.0	0.0547945	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	37	CCDS32225.1																																																																																			.	.	none		0.512	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
BRINP1	1620	hgsc.bcm.edu	37	9	121929513	121929513	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr9:121929513G>A	ENST00000265922.3	-	8	2596	c.2135C>T	c.(2134-2136)cCg>cTg	p.P712L	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	712			P -> T (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.P712L(1)									GGGTTTCCCCGGGGCCACAGG	0.557																																					p.P712L		Atlas-SNP	.											DBC1,rectum,carcinoma,0,4	DBC1	194	4	1	Substitution - Missense(1)	kidney(1)	c.C2135T						PASS	.						86.0	94.0	91.0					9																	121929513		2203	4300	6503	SO:0001583	missense	1620	exon8			TTCCCCGGGGCCA	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.2135C>T	9.37:g.121929513G>A	ENSP00000265922:p.Pro712Leu	189.0	0.0	0		226.0	79.0	0.349558	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.531209	0.64972	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.19250	2.16	5.64	4.73	0.59995	.	0.100848	0.64402	D	0.000001	T	0.23727	0.0574	M	0.61703	1.905	0.80722	D	1	P	0.35433	0.501	B	0.28011	0.085	T	0.07121	-1.0789	10	0.87932	D	0	-22.0002	16.2315	0.82344	0.0:0.0:0.8659:0.1341	.	712	O60477	DBC1_HUMAN	L	712	ENSP00000265922:P712L	ENSP00000265922:P712L	P	-	2	0	DBC1	120969334	1.000000	0.71417	0.961000	0.40146	0.998000	0.95712	7.234000	0.78134	1.508000	0.48769	0.585000	0.79938	CCG	.	.	none		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
NELL2	4753	hgsc.bcm.edu	37	12	44915940	44915940	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:44915940C>T	ENST00000429094.2	-	18	2522	c.2018G>A	c.(2017-2019)cGa>cAa	p.R673Q	NELL2_ENST00000452445.2_Missense_Mutation_p.R673Q|NELL2_ENST00000395487.2_Missense_Mutation_p.R672Q|NELL2_ENST00000437801.2_Missense_Mutation_p.R723Q|NELL2_ENST00000333837.4_Missense_Mutation_p.R696Q|NELL2_ENST00000549027.1_Missense_Mutation_p.R672Q|NELL2_ENST00000551601.1_Missense_Mutation_p.R625Q	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	673	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GACCATCCGTCGACACATAAC	0.438																																					p.R723Q		Atlas-SNP	.											NELL2_ENST00000437801,colon,carcinoma,-1,2	NELL2	286	2	0			c.G2168A						scavenged	.						95.0	87.0	90.0					12																	44915940		2203	4300	6503	SO:0001583	missense	4753	exon19			ATCCGTCGACACA	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2018G>A	12.37:g.44915940C>T	ENSP00000390680:p.Arg673Gln	52.0	0.0	0		64.0	3.0	0.046875	NM_001145107	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	37	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940970	0.73557	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801	D;T;T;T;D;T;D	0.81821	-1.5;-1.47;-1.18;-1.47;-1.5;-1.43;-1.54	5.7	4.81	0.61882	von Willebrand factor, type C (2);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.70937	0.3281	L	0.53617	1.68	0.58432	D	0.999997	P;P;B;B;B	0.42827	0.539;0.791;0.056;0.009;0.258	B;B;B;B;B	0.28232	0.024;0.087;0.018;0.005;0.053	T	0.69978	-0.4998	10	0.21014	T	0.42	-9.7144	14.8365	0.70187	0.0:0.931:0.0:0.069	.	696;723;625;673;672	B7Z2U7;B7Z9U3;F8VVB6;Q99435;Q96JS2	.;.;.;NELL2_HUMAN;.	Q	672;673;625;673;672;696;723	ENSP00000378866:R672Q;ENSP00000390680:R673Q;ENSP00000449332:R625Q;ENSP00000394612:R673Q;ENSP00000447927:R672Q;ENSP00000327988:R696Q;ENSP00000416341:R723Q	ENSP00000327988:R696Q	R	-	2	0	NELL2	43202207	1.000000	0.71417	0.973000	0.42090	0.938000	0.57974	7.814000	0.86154	1.405000	0.46838	0.650000	0.86243	CGA	.	.	none		0.438	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
CUX1	1523	hgsc.bcm.edu	37	7	101845432	101845432	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr7:101845432T>C	ENST00000292535.7	+	18	2893	c.2855T>C	c.(2854-2856)gTt>gCt	p.V952A	CUX1_ENST00000556210.1_Missense_Mutation_p.V794A|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.V850A|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000550008.2_Missense_Mutation_p.V896A|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.V930A|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.V963A	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	952					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						ACCCGGCAGGTTAAGGAAAAG	0.587																																					p.V963A		Atlas-SNP	.											.	CUX1	253	.	0			c.T2888C						PASS	.						93.0	99.0	97.0					7																	101845432		2203	4300	6503	SO:0001583	missense	1523	exon18			GGCAGGTTAAGGA	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2855T>C	7.37:g.101845432T>C	ENSP00000292535:p.Val952Ala	125.0	0.0	0		96.0	4.0	0.0416667	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	37	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704680	0.68615	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.71461	-0.55;-0.52;-0.55;-0.57;-0.52;-0.53	5.29	5.29	0.74685	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.162599	0.40554	N	0.001077	T	0.77955	0.4208	M	0.75615	2.305	0.80722	D	1	P;D	0.55385	0.78;0.971	P;P	0.50934	0.471;0.654	T	0.81908	-0.0717	10	0.87932	D	0	-24.5424	15.2336	0.73411	0.0:0.0:0.0:1.0	.	952;963	P39880;P39880-3	CUX1_HUMAN;.	A	963;952;930;896;850;794	ENSP00000353401:V963A;ENSP00000292535:V952A;ENSP00000446630:V930A;ENSP00000447373:V896A;ENSP00000450125:V850A;ENSP00000451558:V794A	ENSP00000292535:V952A	V	+	2	0	CUX1	101632152	1.000000	0.71417	0.955000	0.39395	0.969000	0.65631	7.698000	0.84413	2.010000	0.58986	0.533000	0.62120	GTT	.	.	none		0.587	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
GRN	2896	hgsc.bcm.edu	37	17	42430050	42430050	+	Missense_Mutation	SNP	C	C	T	rs63750116		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr17:42430050C>T	ENST00000053867.3	+	13	1728	c.1666C>T	c.(1666-1668)Cgc>Tgc	p.R556C	GRN_ENST00000589265.1_Missense_Mutation_p.R399C	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	556					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TGCTGATCGGCGCCACTGCTG	0.682																																					p.R556C		Atlas-SNP	.											.	GRN	51	.	0			c.C1666T						PASS	.						62.0	65.0	64.0					17																	42430050		2203	4300	6503	SO:0001583	missense	2896	exon13			GATCGGCGCCACT	M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.1666C>T	17.37:g.42430050C>T	ENSP00000053867:p.Arg556Cys	51.0	0.0	0		62.0	30.0	0.483871	NM_002087	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	ENST00000053867.3	37	CCDS11483.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388125	0.82902	.	.	ENSG00000030582	ENST00000053867;ENST00000357351;ENST00000393566	T	0.72725	-0.68	5.53	4.52	0.55395	Granulin (3);	0.909924	0.09476	N	0.797014	T	0.82148	0.4974	M	0.78801	2.425	0.09310	N	0.999999	D	0.76494	0.999	D	0.67725	0.953	T	0.68765	-0.5322	10	0.39692	T	0.17	-19.1959	9.4761	0.38873	0.1587:0.6877:0.1536:0.0	rs63750116	556	P28799	GRN_HUMAN	C	556;401;376	ENSP00000053867:R556C	ENSP00000053867:R556C	R	+	1	0	GRN	39785576	0.000000	0.05858	0.021000	0.16686	0.641000	0.38312	0.559000	0.23485	2.599000	0.87857	0.561000	0.74099	CGC	.	.	weak		0.682	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457766.1	NM_002087	
CHTF18	63922	hgsc.bcm.edu	37	16	840179	840179	+	Silent	SNP	C	C	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr16:840179C>T	ENST00000262315.9	+	5	672	c.609C>T	c.(607-609)ggC>ggT	p.G203G	CHTF18_ENST00000455171.2_Silent_p.G231G|RPUSD1_ENST00000561734.1_5'Flank|RPUSD1_ENST00000007264.2_5'Flank|RPUSD1_ENST00000565809.1_5'Flank|CHTF18_ENST00000317063.6_Silent_p.G400G|RPUSD1_ENST00000567114.1_5'Flank|CHTF18_ENST00000491530.1_3'UTR	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	203					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCCCACAGGGCTCTCTCCTCC	0.657																																					p.G203G		Atlas-SNP	.											.	CHTF18	52	.	0			c.C609T						PASS	.						32.0	36.0	35.0					16																	840179		2048	4196	6244	SO:0001819	synonymous_variant	63922	exon5			ACAGGGCTCTCTC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.609C>T	16.37:g.840179C>T		108.0	0.0	0		91.0	23.0	0.252747	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Silent	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	C	6.013	0.370712	0.11409	.	.	ENSG00000127586	ENST00000426047	.	.	.	4.9	-2.96	0.05547	.	.	.	.	.	T	0.20210	0.0486	.	.	.	0.19945	N	0.999945	.	.	.	.	.	.	T	0.28522	-1.0041	4	.	.	.	-9.3545	3.1824	0.06589	0.3147:0.2606:0.0:0.4247	.	.	.	.	F	99	.	.	L	+	1	0	CHTF18	780180	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.736000	0.04882	-0.299000	0.08909	-0.455000	0.05494	CTC	.	.	none		0.657	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
PITX2	5308	hgsc.bcm.edu	37	4	111539469	111539469	+	Missense_Mutation	SNP	C	C	T	rs149181425		TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr4:111539469C>T	ENST00000354925.2	-	7	2471	c.766G>A	c.(766-768)Gcg>Acg	p.A256T	PITX2_ENST00000556049.1_5'Flank|RP11-380D23.2_ENST00000503456.1_lincRNA|PITX2_ENST00000306732.3_Missense_Mutation_p.A263T|PITX2_ENST00000355080.5_Missense_Mutation_p.A210T|PITX2_ENST00000394598.2_Missense_Mutation_p.A256T|PITX2_ENST00000394595.3_3'UTR	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	256					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GTCGGCACCGCGGAATTCAGC	0.592																																					p.A263T		Atlas-SNP	.											.	PITX2	73	.	0			c.G787A						PASS	.						45.0	49.0	48.0					4																	111539469		2203	4300	6503	SO:0001583	missense	5308	exon3			GCACCGCGGAATT	U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.766G>A	4.37:g.111539469C>T	ENSP00000347004:p.Ala256Thr	146.0	0.0	0		162.0	40.0	0.246914	NM_000325	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	37	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315299	0.60524	.	.	ENSG00000164093	ENST00000306732;ENST00000394598;ENST00000355080;ENST00000354925;ENST00000511837	D;D;D;D;D	0.93366	-2.86;-2.99;-3.13;-2.99;-3.21	5.68	4.84	0.62591	.	0.267779	0.42548	D	0.000699	D	0.91334	0.7267	L	0.54908	1.71	0.80722	D	1	P;B;P;P	0.48162	0.802;0.104;0.906;0.701	B;B;B;B	0.42738	0.355;0.016;0.283;0.396	D	0.89846	0.4006	10	0.33141	T	0.24	.	14.5613	0.68140	0.0:0.9297:0.0:0.0703	.	210;210;256;263	A8K6C6;Q99697-3;Q99697;Q99697-2	.;.;PITX2_HUMAN;.	T	263;256;210;256;256	ENSP00000304169:A263T;ENSP00000378097:A256T;ENSP00000347192:A210T;ENSP00000347004:A256T;ENSP00000421454:A256T	ENSP00000304169:A263T	A	-	1	0	PITX2	111758918	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.818000	0.86416	1.405000	0.46838	0.655000	0.94253	GCG	C|1.000;A|0.000	.	alt		0.592	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2		
UBQLN2	29978	hgsc.bcm.edu	37	X	56591532	56591532	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chrX:56591532T>C	ENST00000338222.5	+	1	1507	c.1226T>C	c.(1225-1227)aTg>aCg	p.M409T		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	409					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						GCTGCACAGATGATGCTGAAT	0.527																																					p.M409T	Esophageal Squamous(104;218 1492 6022 10838 28884)	Atlas-SNP	.											.	UBQLN2	55	.	0			c.T1226C						PASS	.						39.0	33.0	35.0					X																	56591532		2203	4300	6503	SO:0001583	missense	29978	exon1			CACAGATGATGCT	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.1226T>C	X.37:g.56591532T>C	ENSP00000345195:p.Met409Thr	117.0	0.0	0		131.0	57.0	0.435115	NM_013444	O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	ENST00000338222.5	37	CCDS14374.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.004951	0.35415	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	D	0.85088	-1.94	4.73	4.73	0.59995	Heat shock chaperonin-binding (1);	0.145633	0.49916	D	0.000140	D	0.84028	0.5382	M	0.80616	2.505	0.47245	D	0.999362	P;P	0.42649	0.786;0.61	B;B	0.37451	0.25;0.191	D	0.85805	0.1376	10	0.59425	D	0.04	-10.2918	11.3192	0.49410	0.0:0.0:0.0:1.0	.	409;409	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	T	409	ENSP00000345195:M409T	ENSP00000345195:M409T	M	+	2	0	UBQLN2	56608257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.816000	0.86201	1.874000	0.54306	0.481000	0.45027	ATG	.	.	none		0.527	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444	
SEMA5B	54437	hgsc.bcm.edu	37	3	122632728	122632728	+	Silent	SNP	G	G	A			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr3:122632728G>A	ENST00000357599.3	-	15	2495	c.2109C>T	c.(2107-2109)tgC>tgT	p.C703C	SEMA5B_ENST00000451055.2_Silent_p.C757C|SEMA5B_ENST00000195173.4_Silent_p.C703C	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	703	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.			C -> F (in Ref. 2; AAQ88491). {ECO:0000305}.	cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TCTTGCCCACGCAGATGCGGC	0.657																																					p.C757C		Atlas-SNP	.											.	SEMA5B	303	.	0			c.C2271T						PASS	.						49.0	53.0	51.0					3																	122632728		2203	4299	6502	SO:0001819	synonymous_variant	54437	exon15			GCCCACGCAGATG	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2109C>T	3.37:g.122632728G>A		143.0	0.0	0		80.0	38.0	0.475	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	ENST00000357599.3	37	CCDS35491.1																																																																																			.	.	none		0.657	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
SYT10	341359	hgsc.bcm.edu	37	12	33579301	33579301	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8041-01A-11D-2210-10	TCGA-FF-8041-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fa676301-902f-473f-8313-5bff34ae549a	d3ef8780-62a6-4dbb-ab8f-3e7122632efc	g.chr12:33579301G>T	ENST00000228567.3	-	2	577	c.281C>A	c.(280-282)aCt>aAt	p.T94N	SYT10_ENST00000535526.1_5'UTR|SYT10_ENST00000567656.1_5'Flank	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	94					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TGGAAGCGTAGTGATGTTGGA	0.423																																					p.T94N		Atlas-SNP	.											.	SYT10	109	.	0			c.C281A						PASS	.						91.0	90.0	90.0					12																	33579301		2203	4300	6503	SO:0001583	missense	341359	exon2			AGCGTAGTGATGT	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.281C>A	12.37:g.33579301G>T	ENSP00000228567:p.Thr94Asn	113.0	0.0	0		135.0	21.0	0.155556	NM_198992	Q495U2	Missense_Mutation	SNP	ENST00000228567.3	37	CCDS8732.1	.	.	.	.	.	.	.	.	.	.	G	0.496	-0.873133	0.02570	.	.	ENSG00000110975	ENST00000228567	T	0.46451	0.87	4.1	-2.4	0.06583	.	0.459403	0.18019	N	0.154304	T	0.21468	0.0517	N	0.19112	0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.09378	-1.0677	10	0.36615	T	0.2	.	6.502	0.22174	0.0:0.3531:0.4103:0.2366	.	94	Q6XYQ8	SYT10_HUMAN	N	94	ENSP00000228567:T94N	ENSP00000228567:T94N	T	-	2	0	SYT10	33470568	0.000000	0.05858	0.000000	0.03702	0.174000	0.22865	-0.030000	0.12308	-0.492000	0.06687	-0.147000	0.13772	ACT	.	.	none		0.423	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403222.1	NM_198992	
