#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TPRX1	284355	hgsc.bcm.edu	37	19	48305613	48305624	+	In_Frame_Del	DEL	TTGGGCCTGAGA	TTGGGCCTGAGA	-	rs201007421		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	TTGGGCCTGAGA	TTGGGCCTGAGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:48305613_48305624delTTGGGCCTGAGA	ENST00000322175.3	-	2	799_810	c.644_655delTCTCAGGCCCAA	c.(643-657)atctcaggcccaaac>aac	p.ISGP215del	TPRX1_ENST00000535759.1_In_Frame_Del_p.ISGP312del|TPRX1_ENST00000543508.1_In_Frame_Del_p.ISGP205del	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	215	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gggcctgggtttgggcctgagattgggcctga	0.67																																					p.215_219del	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-Indel	.											TPRX1,NS,carcinoma,0,1	TPRX1	46	1	0			c.645_656del						PASS	.																																			SO:0001651	inframe_deletion	284355	exon2			.		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.644_655delTCTCAGGCCCAA	19.37:g.48305613_48305624delTTGGGCCTGAGA	ENSP00000323455:p.Ile215_Pro218del	32.0	0.0	0		39.0	11.0	0.282051	NM_198479	A5D8Y3|B2RPL5	In_Frame_Del	DEL	ENST00000322175.3	37	CCDS33066.1																																																																																			.	.	none		0.670	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
DSPP	1834	hgsc.bcm.edu	37	4	88537205	88537213	+	In_Frame_Del	DEL	GACAGCAGT	GACAGCAGT	-	rs143067236|rs151217478|rs551655835	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	GACAGCAGT	GACAGCAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:88537205_88537213delGACAGCAGT	ENST00000282478.7	+	4	3424_3432	c.3391_3399delGACAGCAGT	c.(3391-3399)gacagcagtdel	p.DSS1137del	DSPP_ENST00000399271.1_In_Frame_Del_p.DSS1137del|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1137	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgacagcagtgatagcagtg	0.569																																					p.1130_1133del		Atlas-Indel	.											.	DSPP	174	.	0			c.3390_3398del						PASS	.			357,1999		74,209,895						-1.1	0.0			19	1005,3537		137,731,1403	no	coding	DSPP	NM_014208.3		211,940,2298	A1A1,A1R,RR		22.1268,15.1528,19.7449				1362,5536				SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3391_3399delGACAGCAGT	4.37:g.88537205_88537213delGACAGCAGT	ENSP00000282478:p.Asp1137_Ser1139del	107.0	0.0	0		57.0	30.0	0.526316	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	37	CCDS43248.1																																																																																			.	.	none		0.569	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DUSP27	92235	hgsc.bcm.edu	37	1	167095865	167095865	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:167095865delC	ENST00000361200.2	+	6	1663	c.1497delC	c.(1495-1497)agcfs	p.S499fs	DUSP27_ENST00000271385.5_Frame_Shift_Del_p.S499fs|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Frame_Shift_Del_p.S499fs			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	499					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACGCCAAGAGCAAGAGAGAGG	0.617																																					p.S499fs		Pindel,Atlas-Indel	.											.	DUSP27	235	.	0			c.1496delG						PASS	.						48.0	46.0	47.0					1																	167095865		2203	4300	6503	SO:0001589	frameshift_variant	92235	exon5			.	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1497delC	1.37:g.167095865delC	ENSP00000354483:p.Ser499fs	155.0	0.0	.		186.0	48.0	0.258	NM_001080426	A0AUM4|Q9C074	Frame_Shift_Del	DEL	ENST00000361200.2	37	CCDS30932.1																																																																																			.	.	none		0.617	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
BTG1	694	hgsc.bcm.edu	37	12	92539174	92539180	+	Frame_Shift_Del	DEL	CTCCTGC	CTCCTGC	-	rs377174658|rs199587257|rs200623021|rs549978043		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	CTCCTGC	CTCCTGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:92539174_92539180delCTCCTGC	ENST00000256015.3	-	1	493_499	c.132_138delGCAGGAG	c.(130-138)ctgcaggagfs	p.LQE44fs	C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	44					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)	p.E46D(1)		haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CTGCCAGCAGCTCCTGCAGGCTCTGGC	0.691			T	MYC	BCLL																																p.45_47del		Pindel,Atlas-Indel	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.133_139del						PASS	.																																			SO:0001589	frameshift_variant	694	exon1			.		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.132_138delGCAGGAG	12.37:g.92539174_92539180delCTCCTGC	ENSP00000256015:p.Leu44fs	110.0	0.0	.		110.0	25.0	0.227	NM_001731	P31607	Frame_Shift_Del	DEL	ENST00000256015.3	37	CCDS9043.1																																																																																			.	.	none		0.691	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
KMT2D	8085	hgsc.bcm.edu	37	12	49445046	49445047	+	Frame_Shift_Ins	INS	-	-	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:49445046_49445047insA	ENST00000301067.7	-	10	2418_2419	c.2419_2420insT	c.(2419-2421)tccfs	p.S807fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	807	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGTCTGGGGGGACAGGTGCAAT	0.634																																					p.S807fs		Atlas-Indel	.											.	MLL2	1173	.	0			c.2420_2421insT						PASS	.																																			SO:0001589	frameshift_variant	8085	exon10			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2420dupT	12.37:g.49445047_49445047dupA	ENSP00000301067:p.Ser807fs	125.0	0.0	0		286.0	172.0	0.601399	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.634	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KIAA0125	9834	hgsc.bcm.edu	37	14	106388019	106388094	+	Splice_Site	DEL	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	-			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:106388019_106388094delCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	ENST00000449410.1	+	3	265_298	c.156_189delCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG	c.(154-189)acccagaccatcagatggcctcctcacctacccctc>ac	p.TQTIRWPPHLPL52fs	IGHD1-1_ENST00000454908.1_RNA|KIAA0125_ENST00000429431.1_Splice_Site_p.PDHQMASSPTPLQ56fs|KIAA0125_ENST00000482999.1_3'UTR			Q9NZY2	K0125_HUMAN	KIAA0125	52																	CTGTCTTGGCCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATGCCAGACCTCC	0.58																																					.		Pindel	.											.	.	.	.	0			.						PASS	.																																			SO:0001630	splice_region_variant	9834	.			.	AB019441		14q32.33	2014-04-01			ENSG00000226777	ENSG00000226777			19955	other	unknown			"""family with sequence similarity 30, member A"", ""chromosome 14 open reading frame 110"""	FAM30A, C14orf110		8590280	Standard	NR_026800		Approved	HSPC053	uc001ysq.3	Q9NZY2	OTTHUMG00000152318	ENST00000449410.1:c.157-1CCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG>-	14.37:g.106388019_106388094delCCAGACCATCAGATGGCCTCCTCACCTACCCCTCTTCAGACAGGGCCTCAGACCTAAGGCAGGAGCACCCCCTATG		109.0	0.0	.		28.0	17.0	0.607	.	C9J8W9	RNA	DEL	ENST00000449410.1	37																																																																																				.	.	none		0.580	KIAA0125-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000325876.1	NM_014792	Frame_Shift_Del
KMT2D	8085	hgsc.bcm.edu	37	12	49445040	49445041	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:49445040_49445041insG	ENST00000301067.7	-	10	2424_2425	c.2425_2426insC	c.(2425-2427)cagfs	p.Q809fs		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	809	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTCCTCAGTCTGGGGGGACAGG	0.634																																					p.Q809fs		Pindel	.											.	MLL2	1173	.	0			c.2426_2427insC						PASS	.																																			SO:0001589	frameshift_variant	8085	exon10			.	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2426dupC	12.37:g.49445046_49445046dupG	ENSP00000301067:p.Gln809fs	126.0	0.0	.		286.0	80.0	0.280	NM_003482	O14687	Frame_Shift_Ins	INS	ENST00000301067.7	37	CCDS44873.1																																																																																			.	.	none		0.634	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ELFN1	392617	hgsc.bcm.edu	37	7	1785563	1785563	+	Missense_Mutation	SNP	G	G	A	rs563858883		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:1785563G>A	ENST00000424383.2	+	3	1818	c.1331G>A	c.(1330-1332)cGg>cAg	p.R444Q	ELFN1_ENST00000561626.1_Missense_Mutation_p.R444Q|ELFN1_ENST00000541472.1_Missense_Mutation_p.R444Q			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	444					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						CGCAGGCGGCGGCGCCAGGAG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		13689	0.001		0.0	False		,,,				2504	0.0				p.R444Q		Atlas-SNP	.											.	ELFN1	22	.	0			c.G1331A						PASS	.						15.0	15.0	15.0					7																	1785563		692	1590	2282	SO:0001583	missense	392617	exon2			GGCGGCGGCGCCA		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.1331G>A	7.37:g.1785563G>A	ENSP00000456548:p.Arg444Gln	31.0	0.0	0		48.0	19.0	0.395833	NM_001128636	H3BS57	Missense_Mutation	SNP	ENST00000424383.2	37	CCDS59046.1																																																																																			.	.	none		0.662	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2	NM_001128636	
DPH6	89978	hgsc.bcm.edu	37	15	35830516	35830516	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:35830516C>T	ENST00000256538.4	-	3	297	c.271G>A	c.(271-273)Gat>Aat	p.D91N	DPH6_ENST00000440392.2_Missense_Mutation_p.D91N	NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6	91					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										TCAACCTCATCACCTTCACAT	0.378																																					p.D91N		Atlas-SNP	.											.	ATPBD4	30	.	0			c.G271A						PASS	.						238.0	207.0	218.0					15																	35830516		2201	4298	6499	SO:0001583	missense	89978	exon3			CCTCATCACCTTC		CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.271G>A	15.37:g.35830516C>T	ENSP00000256538:p.Asp91Asn	283.0	0.0	0		163.0	127.0	0.779141	NM_001141972	B3KWG1|Q96HJ6	Missense_Mutation	SNP	ENST00000256538.4	37	CCDS10043.1	.	.	.	.	.	.	.	.	.	.	C	32	5.175413	0.94807	.	.	ENSG00000134146	ENST00000256538;ENST00000440392	T;T	0.68181	0.91;-0.31	5.75	5.75	0.90469	Domain of unknown function DUF71, ATP-binding domain (2);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.87378	0.6162	M	0.93808	3.46	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.999	D	0.89087	0.3480	10	0.62326	D	0.03	-29.0226	20.312	0.98644	0.0:1.0:0.0:0.0	.	91;91	B3KWG1;Q7L8W6	.;ATBD4_HUMAN	N	91	ENSP00000256538:D91N;ENSP00000406976:D91N	ENSP00000256538:D91N	D	-	1	0	ATPBD4	33617808	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.887000	0.69751	2.880000	0.98712	0.655000	0.94253	GAT	.	.	none		0.378	DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251973.1	NM_080650	
CCP110	9738	hgsc.bcm.edu	37	16	19556216	19556216	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:19556216C>T	ENST00000381396.5	+	9	2829	c.2582C>T	c.(2581-2583)gCt>gTt	p.A861V	CCP110_ENST00000396208.2_Missense_Mutation_p.A861V|CCP110_ENST00000396212.2_Missense_Mutation_p.A861V	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	861					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						AGAGTGTTAGCTCAGGTAAAT	0.338																																					p.A861V		Atlas-SNP	.											.	CCP110	57	.	0			c.C2582T						PASS	.						106.0	105.0	105.0					16																	19556216		2197	4300	6497	SO:0001583	missense	9738	exon9			TGTTAGCTCAGGT	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2582C>T	16.37:g.19556216C>T	ENSP00000370803:p.Ala861Val	195.0	0.0	0		405.0	159.0	0.392593	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Missense_Mutation	SNP	ENST00000381396.5	37	CCDS55992.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795586	0.90453	.	.	ENSG00000103540	ENST00000396212;ENST00000381396;ENST00000396208	T;T;T	0.17370	2.28;2.29;2.28	5.48	5.48	0.80851	.	0.057778	0.64402	D	0.000002	T	0.38161	0.1030	L	0.53249	1.67	0.58432	D	0.999999	D;D	0.59767	0.986;0.986	D;D	0.67103	0.949;0.949	T	0.01757	-1.1280	10	0.39692	T	0.17	-16.6553	19.364	0.94454	0.0:1.0:0.0:0.0	.	861;861	O43303;O43303-2	CP110_HUMAN;.	V	861	ENSP00000379515:A861V;ENSP00000370803:A861V;ENSP00000379511:A861V	ENSP00000370803:A861V	A	+	2	0	CCP110	19463717	1.000000	0.71417	0.991000	0.47740	0.992000	0.81027	4.349000	0.59385	2.547000	0.85894	0.655000	0.94253	GCT	.	.	none		0.338	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
DTX1	1840	hgsc.bcm.edu	37	12	113496135	113496135	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:113496135C>T	ENST00000257600.3	+	1	641	c.138C>T	c.(136-138)caC>caT	p.H46H		NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	46	WWE 1. {ECO:0000255|PROSITE- ProRule:PRU00248}.				cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CCGTGTGCCACCACATTGAGA	0.652																																					p.H46H		Atlas-SNP	.											.	DTX1	83	.	0			c.C138T						PASS	.						106.0	92.0	97.0					12																	113496135		2203	4300	6503	SO:0001819	synonymous_variant	1840	exon1			GTGCCACCACATT	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.138C>T	12.37:g.113496135C>T		111.0	0.0	0		93.0	38.0	0.408602	NM_004416	O60630|Q9BS04	Silent	SNP	ENST00000257600.3	37	CCDS9164.1																																																																																			.	.	none		0.652	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
MLXIP	22877	hgsc.bcm.edu	37	12	122516989	122516989	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:122516989T>C	ENST00000319080.7	+	1	362	c.230T>C	c.(229-231)aTc>aCc	p.I77T						MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		CAGCAGATCATCCACAGCGGC	0.726																																					p.I77T	Esophageal Squamous(105;787 1493 16200 18566 52466)	Atlas-SNP	.											.	MLXIP	46	.	0			c.T230C						PASS	.						35.0	35.0	35.0					12																	122516989		692	1591	2283	SO:0001583	missense	22877	exon1			AGATCATCCACAG	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.230T>C	12.37:g.122516989T>C	ENSP00000312834:p.Ile77Thr	32.0	0.0	0		38.0	17.0	0.447368	NM_014938		Missense_Mutation	SNP	ENST00000319080.7	37		.	.	.	.	.	.	.	.	.	.	T	27.7	4.857990	0.91433	.	.	ENSG00000175727	ENST00000319080	T	0.22539	1.95	4.1	4.1	0.47936	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.50575	-0.8812	9	0.87932	D	0	-21.7018	12.1646	0.54123	0.0:0.0:0.0:1.0	.	77	Q9HAP2	MLXIP_HUMAN	T	77	ENSP00000312834:I77T	ENSP00000312834:I77T	I	+	2	0	MLXIP	121001372	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.191000	0.77763	1.611000	0.50210	0.379000	0.24179	ATC	.	.	none		0.726	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
NLRP6	171389	hgsc.bcm.edu	37	11	279844	279844	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:279844C>T	ENST00000312165.5	+	3	321	c.321C>T	c.(319-321)ctC>ctT	p.L107L	NLRP6_ENST00000534750.1_Silent_p.L107L	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	107					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGCTCGGGCTCGGCTCCGGGA	0.726																																					p.L107L		Atlas-SNP	.											.	NLRP6	4	.	0			c.C321T						PASS	.						13.0	16.0	15.0					11																	279844		2190	4294	6484	SO:0001819	synonymous_variant	171389	exon3			CGGGCTCGGCTCC	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.321C>T	11.37:g.279844C>T		38.0	0.0	0		42.0	7.0	0.166667	NM_138329	A8K9F3|E9PJZ8	Silent	SNP	ENST00000312165.5	37	CCDS7693.1																																																																																			.	.	none		0.726	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
PMEPA1	56937	hgsc.bcm.edu	37	20	56227142	56227142	+	Silent	SNP	T	T	C	rs138355480		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:56227142T>C	ENST00000341744.3	-	4	1150	c.831A>G	c.(829-831)aaA>aaG	p.K277K	PMEPA1_ENST00000395816.3_Silent_p.K227K|PMEPA1_ENST00000265626.4_Silent_p.K227K|PMEPA1_ENST00000395814.1_Silent_p.K227K|PMEPA1_ENST00000347215.4_Silent_p.K242K	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	277					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						TATCCTTCTCTTTGCTCCAGA	0.627																																					p.K277K		Atlas-SNP	.											.	PMEPA1	29	.	0			c.A831G						PASS	.	T	,,,	0,4390		0,0,2195	27.0	30.0	29.0		831,726,681,681	-6.6	0.5	20	dbSNP_134	29	1,8579		0,1,4289	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PMEPA1	NM_020182.3,NM_199169.1,NM_199170.1,NM_199171.1	,,,	0,1,6484	CC,CT,TT		0.0117,0.0,0.0077	,,,	277/288,242/253,227/238,227/238	56227142	1,12969	2195	4290	6485	SO:0001819	synonymous_variant	56937	exon4			CTTCTCTTTGCTC	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.831A>G	20.37:g.56227142T>C		95.0	0.0	0		115.0	6.0	0.0521739	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	37	CCDS13463.1																																																																																			T|1.000;C|0.000	0.000	weak		0.627	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
OR10G7	390265	hgsc.bcm.edu	37	11	123909644	123909644	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:123909644T>C	ENST00000330487.5	-	1	73	c.65A>G	c.(64-66)gAc>gGc	p.D22G		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GAGGGGGGCGTCCAGCCCTGG	0.562																																					p.D22G		Atlas-SNP	.											OR10G7,NS,carcinoma,+1,1	OR10G7	103	1	0			c.A65G						PASS	.						97.0	93.0	94.0					11																	123909644		2200	4299	6499	SO:0001583	missense	390265	exon1			GGGGCGTCCAGCC	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.65A>G	11.37:g.123909644T>C	ENSP00000329689:p.Asp22Gly	236.0	0.0	0		341.0	68.0	0.199413	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	T	10.29	1.309984	0.23821	.	.	ENSG00000182634	ENST00000330487	T	0.00438	7.42	3.38	2.25	0.28309	.	0.495982	0.18008	N	0.154666	T	0.00178	0.0005	N	0.02697	-0.525	0.27635	N	0.947893	B	0.06786	0.001	B	0.12837	0.008	T	0.30238	-0.9985	10	0.46703	T	0.11	.	6.8806	0.24170	0.0:0.1112:0.0:0.8888	.	22	Q8NGN6	O10G7_HUMAN	G	22	ENSP00000329689:D22G	ENSP00000329689:D22G	D	-	2	0	OR10G7	123414854	0.000000	0.05858	0.681000	0.30009	0.009000	0.06853	-0.093000	0.11111	0.503000	0.28060	0.455000	0.32223	GAC	.	.	none		0.562	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
RTBDN	83546	hgsc.bcm.edu	37	19	12936596	12936596	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:12936596C>T	ENST00000458671.2	-	6	766	c.614G>A	c.(613-615)cGt>cAt	p.R205H	RTBDN_ENST00000393233.2_3'UTR|RTBDN_ENST00000322912.5_Missense_Mutation_p.R237H|RTBDN_ENST00000592204.1_Missense_Mutation_p.R215H|RTBDN_ENST00000589272.1_3'UTR|CTD-2265O21.3_ENST00000588469.1_RNA	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	205						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GCTGCGGGAACGCCGGGAGGG	0.711											OREG0025275	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R237H		Atlas-SNP	.											.	RTBDN	26	.	0			c.G710A						PASS	.						17.0	17.0	17.0					19																	12936596		2199	4289	6488	SO:0001583	missense	83546	exon7			CGGGAACGCCGGG	AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.614G>A	19.37:g.12936596C>T	ENSP00000416375:p.Arg205His	123.0	0.0	0	683	131.0	53.0	0.40458	NM_031429	F1T0I8|Q9BWT5	Missense_Mutation	SNP	ENST00000458671.2	37	CCDS45994.1	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399729	0.42512	.	.	ENSG00000132026	ENST00000322912;ENST00000458671	T;T	0.58358	0.34;0.44	3.32	1.17	0.20885	.	0.665039	0.12535	N	0.460449	T	0.54515	0.1863	L	0.32530	0.975	0.09310	N	0.999993	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.939	T	0.37709	-0.9694	10	0.87932	D	0	-27.7491	4.204	0.10480	0.0:0.621:0.2441:0.1349	.	237;205	Q9BSG5-2;Q9BSG5	.;RTBDN_HUMAN	H	237;205	ENSP00000326253:R237H;ENSP00000416375:R205H	ENSP00000326253:R237H	R	-	2	0	RTBDN	12797596	0.000000	0.05858	0.012000	0.15200	0.141000	0.21300	-0.190000	0.09615	0.760000	0.33108	-0.195000	0.12781	CGT	.	.	none		0.711	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451513.1	NM_031429	
TFG	10342	hgsc.bcm.edu	37	3	100467168	100467168	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:100467168A>T	ENST00000240851.4	+	8	1336	c.996A>T	c.(994-996)caA>caT	p.Q332H	TFG_ENST00000418917.2_Missense_Mutation_p.Q328H|TFG_ENST00000481203.1_3'UTR|TFG_ENST00000490574.1_Missense_Mutation_p.Q332H|TFG_ENST00000476228.1_Missense_Mutation_p.Q328H	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	332					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)		TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						ACACTGCCCAAACTTCTCAGC	0.527			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																p.Q332H		Atlas-SNP	.		Dom	yes		3	3q11-q12	10342	TRK-fused gene		"""E, L"""	.	TFG	42	.	0			c.A996T						PASS	.						84.0	86.0	85.0					3																	100467168		2203	4300	6503	SO:0001583	missense	10342	exon8			TGCCCAAACTTCT	BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.996A>T	3.37:g.100467168A>T	ENSP00000240851:p.Gln332His	143.0	0.0	0		165.0	62.0	0.375758	NM_006070	D3DN49|G5E9V1|Q15656|Q969I2	Missense_Mutation	SNP	ENST00000240851.4	37	CCDS2939.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.92|15.92	2.976031|2.976031	0.53720|0.53720	.|.	.|.	ENSG00000114354|ENSG00000114354	ENST00000443578|ENST00000418917;ENST00000490574;ENST00000240851;ENST00000476228	.|T;T;T;T	.|0.54479	.|0.62;0.57;0.57;0.62	6.16|6.16	-2.35|-2.35	0.06684|0.06684	.|.	.|0.117044	.|0.64402	.|D	.|0.000009	T|T	0.55657|0.55657	0.1934|0.1934	L|L	0.29908|0.29908	0.895|0.895	0.53688|0.53688	D|D	0.999979|0.999979	.|D;D	.|0.64830	.|0.994;0.99	.|D;D	.|0.78314	.|0.991;0.979	T|T	0.55075|0.55075	-0.8197|-0.8197	6|10	0.87932|0.56958	D|D	0|0.05	-3.1538|-3.1538	13.2698|13.2698	0.60153|0.60153	0.5279:0.0:0.4721:0.0|0.5279:0.0:0.4721:0.0	.|.	.|328;332	.|G5E9V1;Q92734	.|.;TFG_HUMAN	I|H	328|328;332;332;328	.|ENSP00000397182:Q328H;ENSP00000419960:Q332H;ENSP00000240851:Q332H;ENSP00000417952:Q328H	ENSP00000409727:K328I|ENSP00000240851:Q332H	K|Q	+|+	2|3	0|2	TFG|TFG	101949858|101949858	0.992000|0.992000	0.36948|0.36948	0.582000|0.582000	0.28627|0.28627	0.885000|0.885000	0.51271|0.51271	0.363000|0.363000	0.20301|0.20301	-0.351000|-0.351000	0.08249|0.08249	-0.297000|-0.297000	0.09499|0.09499	AAA|CAA	.	.	none		0.527	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353242.1	NM_006070	
ABCC1	4363	hgsc.bcm.edu	37	16	16162160	16162160	+	Splice_Site	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:16162160G>A	ENST00000399410.3	+	13	1999		c.e13+1		ABCC1_ENST00000349029.5_Splice_Site|ABCC1_ENST00000399408.2_Splice_Site|ABCC1_ENST00000345148.5_Splice_Site|ABCC1_ENST00000346370.5_Splice_Site|ABCC1_ENST00000351154.5_Splice_Site	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1						arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	CATCGTGCAGGTACAGGGGGA	0.597																																					.		Atlas-SNP	.											.	ABCC1	156	.	0			c.1824+1G>A						PASS	.						142.0	131.0	134.0					16																	16162160		2003	4168	6171	SO:0001630	splice_region_variant	4363	exon13			GTGCAGGTACAGG	L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.1824+1G>A	16.37:g.16162160G>A		108.0	0.0	0		159.0	102.0	0.641509	NM_004996	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Splice_Site	SNP	ENST00000399410.3	37	CCDS42122.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967961	0.74131	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0161	0.80441	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCC1	16069661	1.000000	0.71417	0.998000	0.56505	0.738000	0.42128	9.413000	0.97351	2.108000	0.64289	0.462000	0.41574	.	.	.	none		0.597	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109701.1	NM_004996	Intron
HOXC13	3229	hgsc.bcm.edu	37	12	54333307	54333307	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:54333307A>G	ENST00000243056.3	+	1	773	c.617A>G	c.(616-618)gAc>gGc	p.D206G	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	206					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CCGCGTCACGACGCCCTCATC	0.672			T	NUP98	AML																																p.D206G		Atlas-SNP	.		Dom	yes		12	12q13.3	3229	homeo box C13		L	.	HOXC13	24	.	0			c.A617G						PASS	.						18.0	20.0	19.0					12																	54333307		2199	4291	6490	SO:0001583	missense	3229	exon1			GTCACGACGCCCT		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.617A>G	12.37:g.54333307A>G	ENSP00000243056:p.Asp206Gly	43.0	0.0	0		57.0	11.0	0.192982	NM_017410	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	ENST00000243056.3	37	CCDS8865.1	.	.	.	.	.	.	.	.	.	.	A	18.36	3.606534	0.66445	.	.	ENSG00000123364	ENST00000243056	D	0.93604	-3.25	3.16	3.16	0.36331	.	0.058843	0.64402	D	0.000003	D	0.93158	0.7821	M	0.76574	2.34	0.54753	D	0.999983	P	0.45569	0.861	P	0.46389	0.515	D	0.93361	0.6727	10	0.66056	D	0.02	.	11.3352	0.49500	1.0:0.0:0.0:0.0	.	206	P31276	HXC13_HUMAN	G	206	ENSP00000243056:D206G	ENSP00000243056:D206G	D	+	2	0	HOXC13	52619574	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	8.443000	0.90320	1.709000	0.51313	0.260000	0.18958	GAC	.	.	none		0.672	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358865.2		
EXOG	9941	hgsc.bcm.edu	37	3	38537954	38537954	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:38537954G>A	ENST00000287675.5	+	1	192	c.96G>A	c.(94-96)ggG>ggA	p.G32G	EXOG_ENST00000422077.2_Silent_p.G32G|EXOG_ENST00000358249.2_5'UTR	NM_005107.3	NP_005098.2	Q9Y2C4	EXOG_HUMAN	endo/exonuclease (5'-3'), endonuclease G-like	32					DNA catabolic process, endonucleolytic (GO:0000737)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			central_nervous_system(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	17						CGGGAGCTGGGCTCGCGGCCC	0.657											OREG0015479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G32G		Atlas-SNP	.											.	EXOG	29	.	0			c.G96A						PASS	.						45.0	46.0	45.0					3																	38537954		2203	4300	6503	SO:0001819	synonymous_variant	9941	exon1			AGCTGGGCTCGCG	AB020523	CCDS2680.1, CCDS46795.1	3p21.3	2010-05-07	2009-01-08	2009-01-08	ENSG00000157036	ENSG00000157036	3.1.30.-		3347	protein-coding gene	gene with protein product		604051	"""endonuclease G-like 1"", ""endonuclease G-like 2"""	ENDOGL1, ENDOGL2		10231028, 18187503	Standard	NM_005107		Approved	ENGL-a, ENGL, ENGL-b	uc003cih.2	Q9Y2C4	OTTHUMG00000131295	ENST00000287675.5:c.96G>A	3.37:g.38537954G>A		61.0	0.0	0	879	98.0	50.0	0.510204	NM_005107	A8K242|B4DVG2|Q3SXM9|Q9Y2C8	Silent	SNP	ENST00000287675.5	37	CCDS2680.1																																																																																			.	.	none		0.657	EXOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254063.2	NM_005107	
WNT5A	7474	hgsc.bcm.edu	37	3	55508445	55508445	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:55508445G>A	ENST00000474267.1	-	5	1125	c.604C>T	c.(604-606)Cgg>Tgg	p.R202W	WNT5A_ENST00000264634.4_Missense_Mutation_p.R202W|WNT5A_ENST00000497027.1_Missense_Mutation_p.R187W			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	202					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		ATGCGCTCCCGCTCGCGGGCG	0.682																																					p.R202W		Atlas-SNP	.											WNT5A,NS,carcinoma,+1,1	WNT5A	43	1	0			c.C604T						scavenged	.						16.0	22.0	20.0					3																	55508445		2142	4269	6411	SO:0001583	missense	7474	exon4			GCTCCCGCTCGCG	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.604C>T	3.37:g.55508445G>A	ENSP00000417310:p.Arg202Trp	149.0	2.0	0.0134228		172.0	86.0	0.5	NM_003392	A8K4A4|Q6P278	Missense_Mutation	SNP	ENST00000474267.1	37	CCDS46850.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171647	0.78452	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000536765;ENST00000497027;ENST00000482079	T;T;T;D	0.85861	-1.12;-1.12;-1.12;-2.04	4.84	1.2	0.21068	.	0.113021	0.56097	D	0.000031	D	0.92831	0.7720	M	0.93854	3.465	0.58432	D	0.999994	D	0.76494	0.999	D	0.63192	0.912	D	0.94072	0.7336	10	0.87932	D	0	.	13.9657	0.64207	0.0:0.0:0.4521:0.5478	.	202	P41221	WNT5A_HUMAN	W	202;202;113;187;187	ENSP00000417310:R202W;ENSP00000264634:R202W;ENSP00000420104:R187W;ENSP00000418184:R187W	ENSP00000264634:R202W	R	-	1	2	WNT5A	55483485	0.992000	0.36948	1.000000	0.80357	0.971000	0.66376	0.423000	0.21313	0.479000	0.27511	0.557000	0.71058	CGG	.	.	none		0.682	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350793.3	NM_003392	
KRTAP2-4	85294	hgsc.bcm.edu	37	17	39221736	39221736	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:39221736G>A	ENST00000394015.2	-	1	395	c.362C>T	c.(361-363)aCc>aTc	p.T121I		NM_033184.3	NP_149440.1	Q9BYR9	KRA24_HUMAN	keratin associated protein 2-4	121						keratin filament (GO:0045095)				skin(1)	1		Breast(137;0.000496)|Myeloproliferative disorder(1115;0.204)	STAD - Stomach adenocarcinoma(17;0.000371)			CCTGCAGGTGGTGCTGCAAGG	0.592																																					p.T121I		Atlas-SNP	.											.	KRTAP2-4	2	.	0			c.C362T						PASS	.						23.0	26.0	25.0					17																	39221736		1869	3804	5673	SO:0001583	missense	85294	exon1			CAGGTGGTGCTGC	AJ406930		17q21.2	2012-04-19			ENSG00000213417	ENSG00000213417		"""Keratin associated proteins"""	18891	protein-coding gene	gene with protein product						11279113	Standard	NM_033184		Approved	KAP2.4	uc002hvy.3	Q9BYR9	OTTHUMG00000133594	ENST00000394015.2:c.362C>T	17.37:g.39221736G>A	ENSP00000377583:p.Thr121Ile	61.0	0.0	0		53.0	22.0	0.415094	NM_033184	Q495J2	Missense_Mutation	SNP	ENST00000394015.2	37	CCDS32648.1	.	.	.	.	.	.	.	.	.	.	.	14.08	2.427347	0.43122	.	.	ENSG00000213417	ENST00000394015	.	.	.	5.58	0.192	0.15134	.	0.809286	0.09927	U	0.737644	T	0.38134	0.1029	L	0.47078	1.49	0.23813	N	0.996777	.	.	.	.	.	.	T	0.40683	-0.9550	7	0.72032	D	0.01	.	4.2698	0.10780	0.3539:0.1622:0.4839:0.0	.	.	.	.	I	121	.	ENSP00000377583:T121I	T	-	2	0	KRTAP2-4	36475262	0.990000	0.36364	0.460000	0.27093	0.971000	0.66376	0.499000	0.22546	0.044000	0.15775	0.655000	0.94253	ACC	.	.	none		0.592	KRTAP2-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257698.1	NM_033184	
BCAP29	55973	hgsc.bcm.edu	37	7	107221236	107221236	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:107221236G>A	ENST00000005259.4	+	2	358	c.19G>A	c.(19-21)Gca>Aca	p.A7T	BCAP29_ENST00000445771.2_Missense_Mutation_p.A7T|BCAP29_ENST00000379119.2_Missense_Mutation_p.A7T|BCAP29_ENST00000494086.1_Intron|BCAP29_ENST00000379117.2_Missense_Mutation_p.A7T|BCAP29_ENST00000465919.1_Intron|RP4-593H12.1_ENST00000610269.1_RNA	NM_018844.3	NP_061332.2	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein 29	7					apoptotic process (GO:0006915)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|osteoblast differentiation (GO:0001649)|protein localization to endoplasmic reticulum exit site (GO:0070973)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	14						CCAATGGGCTGCAGTGGCAAC	0.413																																					p.A7T		Atlas-SNP	.											.	BCAP29	46	.	0			c.G19A						PASS	.						104.0	93.0	97.0					7																	107221236		2203	4300	6503	SO:0001583	missense	55973	exon2			TGGGCTGCAGTGG		CCDS34730.1, CCDS34731.1	7q22.3	2012-09-20			ENSG00000075790	ENSG00000075790			24131	protein-coding gene	gene with protein product						12477932	Standard	NM_018844		Approved	BAP29, DKFZp686M2086	uc011kma.1	Q9UHQ4	OTTHUMG00000154770	ENST00000005259.4:c.19G>A	7.37:g.107221236G>A	ENSP00000005259:p.Ala7Thr	113.0	0.0	0		123.0	42.0	0.341463	NM_018844	G5E9L4|O95003	Missense_Mutation	SNP	ENST00000005259.4	37	CCDS34731.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600874	0.87055	.	.	ENSG00000075790	ENST00000005259;ENST00000445771;ENST00000479917;ENST00000421217;ENST00000457837;ENST00000379117;ENST00000473124;ENST00000379119	.	.	.	4.63	4.63	0.57726	.	0.054140	0.64402	D	0.000001	T	0.78886	0.4354	M	0.81942	2.565	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.999	D;D;D	0.68943	0.91;0.961;0.961	T	0.80379	-0.1407	9	0.48119	T	0.1	-14.1844	16.2143	0.82195	0.0:0.0:1.0:0.0	.	7;7;7	G5E9L4;C9JTE9;Q9UHQ4	.;.;BAP29_HUMAN	T	7	.	ENSP00000005259:A7T	A	+	1	0	BCAP29	107008472	1.000000	0.71417	0.932000	0.37286	0.854000	0.48673	7.886000	0.87288	2.548000	0.85928	0.655000	0.94253	GCA	.	.	none		0.413	BCAP29-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337011.2	NM_018844	
AADAC	13	hgsc.bcm.edu	37	3	151542519	151542519	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:151542519T>C	ENST00000232892.7	+	4	626	c.500T>C	c.(499-501)tTc>tCc	p.F167S	RP11-454C18.2_ENST00000483843.2_RNA|AADAC_ENST00000488869.1_Missense_Mutation_p.F167S|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	167					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTAAGGTGGTTCTTACGTAAA	0.368																																					p.F167S	Ovarian(30;839 841 2699 32801 46334)	Atlas-SNP	.											.	AADAC	49	.	0			c.T500C						PASS	.						100.0	100.0	100.0					3																	151542519		2203	4300	6503	SO:0001583	missense	13	exon4			GGTGGTTCTTACG	L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.500T>C	3.37:g.151542519T>C	ENSP00000232892:p.Phe167Ser	103.0	0.0	0		123.0	5.0	0.0406504	NM_001086	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	ENST00000232892.7	37	CCDS33877.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970163	0.53614	.	.	ENSG00000114771	ENST00000232892;ENST00000488869	T;T	0.58940	0.3;2.79	4.73	4.73	0.59995	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.76278	0.3965	M	0.81682	2.555	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.80535	-0.1339	10	0.87932	D	0	-49.2631	14.2071	0.65741	0.0:0.0:0.0:1.0	.	167	P22760	AAAD_HUMAN	S	167	ENSP00000232892:F167S;ENSP00000419620:F167S	ENSP00000232892:F167S	F	+	2	0	AADAC	153025209	1.000000	0.71417	0.780000	0.31762	0.078000	0.17371	7.000000	0.76290	1.739000	0.51704	0.472000	0.43445	TTC	.	.	none		0.368	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357883.2	NM_001086	
NAV1	89796	hgsc.bcm.edu	37	1	201779198	201779198	+	Missense_Mutation	SNP	G	G	A	rs201416032		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:201779198G>A	ENST00000367296.4	+	23	4946	c.4526G>A	c.(4525-4527)cGt>cAt	p.R1509H	NAV1_ENST00000367300.3_Missense_Mutation_p.R1449H|NAV1_ENST00000367295.1_Missense_Mutation_p.R1115H|NAV1_ENST00000367297.4_Missense_Mutation_p.R1501H|MIR1231_ENST00000408101.1_RNA|NAV1_ENST00000295624.6_Missense_Mutation_p.R1506H|NAV1_ENST00000367302.1_Missense_Mutation_p.R1462H|IPO9-AS1_ENST00000413035.1_RNA	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1509					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CCTCCTTGCCGTCGAGGTGTC	0.532																																					p.R1509H		Atlas-SNP	.											NAV1,right_upper_lobe,carcinoma,0,2	NAV1	143	2	0			c.G4526A						PASS	.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	150.0	114.0	126.0		3344,4526	5.4	1.0	1		126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	NAV1	NM_001167738.1,NM_020443.4	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	1115/1484,1509/1878	201779198	1,13005	2203	4300	6503	SO:0001583	missense	89796	exon23			CTTGCCGTCGAGG	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.4526G>A	1.37:g.201779198G>A	ENSP00000356265:p.Arg1509His	122.0	0.0	0		164.0	10.0	0.0609756	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.940056	0.73557	0.0	1.16E-4	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295	T;T;T;T;T;T	0.07444	3.2;3.19;3.19;3.19;3.2;3.19	5.38	5.38	0.77491	.	0.252855	0.38897	N	0.001527	T	0.09291	0.0229	L	0.43152	1.355	0.40705	D	0.982517	P;P	0.42248	0.774;0.774	B;B	0.33454	0.096;0.164	T	0.09037	-1.0693	10	0.52906	T	0.07	-14.844	18.7379	0.91763	0.0:0.0:1.0:0.0	.	1115;1506	Q8NEY1-5;Q8NEY1-3	.;.	H	1462;1509;1506;1501;1449;1115	ENSP00000356271:R1462H;ENSP00000356265:R1509H;ENSP00000295624:R1506H;ENSP00000356266:R1501H;ENSP00000356269:R1449H;ENSP00000356264:R1115H	ENSP00000295624:R1506H	R	+	2	0	NAV1	200045821	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.197000	0.58413	2.498000	0.84270	0.561000	0.74099	CGT	G|0.999;A|0.001	0.001	weak		0.532	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
CDH5	1003	hgsc.bcm.edu	37	16	66423409	66423409	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:66423409C>T	ENST00000341529.3	+	5	913	c.765C>T	c.(763-765)ttC>ttT	p.F255F	CDH5_ENST00000563425.2_Silent_p.F255F	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	255	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	ATGACAACTTCCCCTTCTTCA	0.612																																					p.F255F		Atlas-SNP	.											.	CDH5	111	.	0			c.C765T						PASS	.						59.0	57.0	58.0					16																	66423409		2202	4300	6502	SO:0001819	synonymous_variant	1003	exon5			CAACTTCCCCTTC	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.765C>T	16.37:g.66423409C>T		129.0	0.0	0		82.0	5.0	0.0609756	NM_001795	Q4VAI5|Q4VAI6	Silent	SNP	ENST00000341529.3	37	CCDS10804.1																																																																																			.	.	none		0.612	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ZNF285	26974	hgsc.bcm.edu	37	19	44891202	44891202	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44891202C>G	ENST00000330997.4	-	4	1269	c.1205G>C	c.(1204-1206)tGc>tCc	p.C402S	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.C402S|ZNF285_ENST00000591679.1_Missense_Mutation_p.C409S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C402S(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						ACACTCACTGCATTTGTAGGG	0.478																																					p.C402S		Atlas-SNP	.											ZNF285,NS,carcinoma,0,2	ZNF285	86	2	2	Substitution - Missense(2)	prostate(2)	c.G1205C						scavenged	.						54.0	52.0	52.0					19																	44891202		2203	4300	6503	SO:0001583	missense	26974	exon4			TCACTGCATTTGT	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1205G>C	19.37:g.44891202C>G	ENSP00000333595:p.Cys402Ser	53.0	1.0	0.0188679		52.0	4.0	0.0769231	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	C	18.75	3.689844	0.68271	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	D	0.85171	-1.95	3.36	3.36	0.38483	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93262	0.7853	M	0.91612	3.225	0.39148	D	0.962161	D;B	0.89917	1.0;0.007	D;B	0.97110	1.0;0.151	D	0.95026	0.8165	9	0.62326	D	0.03	.	13.918	0.63914	0.0:1.0:0.0:0.0	.	426;402	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	S	425;402	ENSP00000333595:C402S	ENSP00000333595:C402S	C	-	2	0	ZNF285	49583042	1.000000	0.71417	0.664000	0.29753	0.967000	0.64934	4.406000	0.59748	1.598000	0.50083	0.298000	0.19748	TGC	.	.	none		0.478	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
CSMD1	64478	hgsc.bcm.edu	37	8	3141793	3141793	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:3141793G>A	ENST00000520002.1	-	27	4584	c.4029C>T	c.(4027-4029)gaC>gaT	p.D1343D	CSMD1_ENST00000400186.3_Silent_p.D1343D|CSMD1_ENST00000542608.1_Silent_p.D1342D|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000602557.1_Silent_p.D1343D|CSMD1_ENST00000602723.1_Silent_p.D1343D|CSMD1_ENST00000537824.1_Silent_p.D1342D|CSMD1_ENST00000539096.1_Silent_p.D1342D			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1343	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCAGCAGGATGTCACTGTCCA	0.562											OREG0018505	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D1342D		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C4026T						PASS	.						99.0	107.0	104.0					8																	3141793		2131	4245	6376	SO:0001819	synonymous_variant	64478	exon26			CAGGATGTCACTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4029C>T	8.37:g.3141793G>A		51.0	0.0	0	608	64.0	22.0	0.34375	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	g	3.847	-0.032700	0.07543	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.12	4.25	0.50352	.	.	.	.	.	T	0.59074	0.2167	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56025	-0.8047	4	.	.	.	.	8.5228	0.33287	0.2323:0.0:0.7677:0.0	.	.	.	.	Y	823	.	.	H	-	1	0	CSMD1	3129200	0.999000	0.42202	0.879000	0.34478	0.348000	0.29142	0.833000	0.27504	1.165000	0.42670	-0.213000	0.12676	CAT	.	.	none		0.562	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
KCNQ3	3786	hgsc.bcm.edu	37	8	133186530	133186530	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:133186530C>T	ENST00000388996.4	-	6	1420	c.1000G>A	c.(1000-1002)Gcc>Acc	p.A334T	KCNQ3_ENST00000519445.1_Missense_Mutation_p.A334T|KCNQ3_ENST00000521134.1_Missense_Mutation_p.A214T	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	334					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GAAAAGGTGGCGGCAATCAGA	0.512																																					p.A334T		Atlas-SNP	.											.	KCNQ3	164	.	0			c.G1000A						PASS	.						125.0	82.0	96.0					8																	133186530		2166	4186	6352	SO:0001583	missense	3786	exon6			AGGTGGCGGCAAT	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.1000G>A	8.37:g.133186530C>T	ENSP00000373648:p.Ala334Thr	94.0	0.0	0		150.0	45.0	0.3	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	37	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	C	36	5.679407	0.96774	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98329	-4.87;-4.87;-4.87	4.96	4.96	0.65561	Ion transport (1);	0.055265	0.64402	D	0.000001	D	0.98232	0.9415	L	0.43757	1.38	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.69479	0.964;0.964	D	0.99859	1.1081	10	0.87932	D	0	-23.3549	17.5496	0.87872	0.0:1.0:0.0:0.0	.	334;334	E7ET42;O43525	.;KCNQ3_HUMAN	T	334;214;334;323;213	ENSP00000373648:A334T;ENSP00000429799:A214T;ENSP00000428790:A334T	ENSP00000373648:A334T	A	-	1	0	KCNQ3	133255712	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.446000	0.82766	0.563000	0.77884	GCC	.	.	none		0.512	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
ALDH9A1	223	hgsc.bcm.edu	37	1	165652258	165652258	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:165652258C>T	ENST00000354775.4	-	3	721	c.417G>A	c.(415-417)caG>caA	p.Q139Q	ALDH9A1_ENST00000538148.1_Silent_p.Q45Q|ALDH9A1_ENST00000461664.1_5'UTR	NM_000696.3	NP_000687.3	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9 family, member A1	115					carnitine biosynthetic process (GO:0045329)|cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|hormone metabolic process (GO:0042445)|kidney development (GO:0001822)|liver development (GO:0001889)|neurotransmitter biosynthetic process (GO:0042136)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	1-pyrroline dehydrogenase activity (GO:0033737)|3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|4-trimethylammoniobutyraldehyde dehydrogenase activity (GO:0047105)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|amine binding (GO:0043176)|aminobutyraldehyde dehydrogenase activity (GO:0019145)|NAD binding (GO:0051287)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	21	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					ACTCCAGGCACTGCCAGGAAA	0.512																																					p.Q139Q	Ovarian(179;1583 2014 18106 33801 42447)	Atlas-SNP	.											.	ALDH9A1	75	.	0			c.G417A						PASS	.						113.0	98.0	103.0					1																	165652258		2203	4300	6503	SO:0001819	synonymous_variant	223	exon3			CAGGCACTGCCAG	U34252	CCDS1250.2	1q22-q23	2008-02-05			ENSG00000143149	ENSG00000143149		"""Aldehyde dehydrogenases"""	412	protein-coding gene	gene with protein product		602733		ALDH7, ALDH4, ALDH9		8112751, 8786138	Standard	NM_000696		Approved	E3	uc001gdh.1	P49189	OTTHUMG00000034677	ENST00000354775.4:c.417G>A	1.37:g.165652258C>T		64.0	0.0	0		92.0	4.0	0.0434783	NM_000696	B2R6X1|B4DXY7|Q5VV90|Q6LCL1|Q9NZT7	Silent	SNP	ENST00000354775.4	37	CCDS1250.2																																																																																			.	.	none		0.512	ALDH9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083899.1		
NQO1	1728	hgsc.bcm.edu	37	16	69745172	69745172	+	Missense_Mutation	SNP	G	G	A	rs148539025	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:69745172G>A	ENST00000320623.5	-	6	1043	c.532C>T	c.(532-534)Cat>Tat	p.H178Y	snoU13_ENST00000459361.1_RNA|NQO1_ENST00000439109.2_Missense_Mutation_p.H106Y|NQO1_ENST00000564043.1_Missense_Mutation_p.H157Y|NQO1_ENST00000379046.2_Missense_Mutation_p.H140Y|CTD-2033A16.1_ENST00000562696.1_RNA|NQO1_ENST00000379047.3_Missense_Mutation_p.H144Y|NQO1_ENST00000561500.1_Missense_Mutation_p.H140Y	NM_000903.2	NP_000894.1	P15559	NQO1_HUMAN	NAD(P)H dehydrogenase, quinone 1	178					aging (GO:0007568)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cellular amino acid metabolic process (GO:0006521)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|poly(A) RNA binding (GO:0044822)|superoxide dismutase activity (GO:0004784)			autonomic_ganglia(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	10					Carboplatin(DB00958)|Cisplatin(DB00515)|Dicoumarol(DB00266)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|Menadione(DB00170)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CCACAGAAATGCAGAATGCCA	0.458													G|||	3	0.000599042	0.0023	0.0	5008	,	,		21546	0.0		0.0	False		,,,				2504	0.0				p.H178Y		Atlas-SNP	.											.	NQO1	21	.	0			c.C532T						PASS	.	G	TYR/HIS,TYR/HIS,TYR/HIS	4,4392	8.1+/-20.4	0,4,2194	132.0	135.0	134.0		532,430,418	1.3	1.0	16	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	NQO1	NM_000903.2,NM_001025433.1,NM_001025434.1	83,83,83	0,5,6493	AA,AG,GG		0.0116,0.091,0.0385	benign,benign,benign	178/275,144/241,140/237	69745172	5,12991	2198	4300	6498	SO:0001583	missense	1728	exon6			AGAAATGCAGAAT	M81600	CCDS10883.1, CCDS32471.1, CCDS32472.1, CCDS67067.1	16q12-q22	2012-10-02	2001-11-30	2001-12-07	ENSG00000181019	ENSG00000181019	1.6.5.2		2874	protein-coding gene	gene with protein product		125860	"""diaphorase (NADH/NADPH) (cytochrome b-5 reductase)"""	NMOR1, DIA4		2843525	Standard	NM_001286137		Approved	DHQU, QR1, DTD	uc002exp.3	P15559	OTTHUMG00000137575	ENST00000320623.5:c.532C>T	16.37:g.69745172G>A	ENSP00000319788:p.His178Tyr	76.0	0.0	0		86.0	4.0	0.0465116	NM_000903	B2R5Y9|B4DNM7|B7ZAD1|Q86UK1	Missense_Mutation	SNP	ENST00000320623.5	37	CCDS10883.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193510	0.38707	9.1E-4	1.16E-4	ENSG00000181019	ENST00000320623;ENST00000379047;ENST00000379046;ENST00000439109	T;T;T;T	0.10099	2.91;3.15;3.15;3.15	5.41	1.26	0.21427	Flavodoxin-like fold (1);	0.392618	0.30428	N	0.009659	T	0.05823	0.0152	N	0.16478	0.41	0.32949	D	0.51943	B;B;B;B	0.18610	0.005;0.029;0.006;0.028	B;B;B;B	0.23716	0.005;0.048;0.005;0.014	T	0.36040	-0.9764	10	0.12430	T	0.62	-2.5129	9.1805	0.37138	0.3053:0.0:0.6947:0.0	.	106;140;144;178	B4DLR8;B4DNM7;B7ZAD1;P15559	.;.;.;NQO1_HUMAN	Y	178;144;140;106	ENSP00000319788:H178Y;ENSP00000368335:H144Y;ENSP00000368334:H140Y;ENSP00000398330:H106Y	ENSP00000319788:H178Y	H	-	1	0	NQO1	68302673	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	1.942000	0.40243	0.355000	0.24131	0.655000	0.94253	CAT	G|1.000;A|0.000	0.000	weak		0.458	NQO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268956.2		
RAPGEF3	10411	hgsc.bcm.edu	37	12	48144895	48144895	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:48144895C>T	ENST00000449771.2	-	6	695	c.607G>A	c.(607-609)Gaa>Aaa	p.E203K	RAPGEF3_ENST00000405493.2_Missense_Mutation_p.E161K|RAPGEF3_ENST00000549151.1_Missense_Mutation_p.E161K|RAPGEF3_ENST00000171000.4_Missense_Mutation_p.E161K|RAPGEF3_ENST00000395358.3_Missense_Mutation_p.E203K|RAPGEF3_ENST00000549347.1_5'Flank|RAPGEF3_ENST00000389212.3_Missense_Mutation_p.E203K|RAPGEF3_ENST00000548919.1_Missense_Mutation_p.E161K			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	203					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		GCCACAGCTTCGGCCAACTCC	0.657																																					p.E203K		Atlas-SNP	.											.	RAPGEF3	98	.	0			c.G607A						PASS	.						22.0	23.0	23.0					12																	48144895		2201	4292	6493	SO:0001583	missense	10411	exon6			CAGCTTCGGCCAA	AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.607G>A	12.37:g.48144895C>T	ENSP00000395708:p.Glu203Lys	91.0	0.0	0		184.0	42.0	0.228261	NM_001098531	A8K2G5|E7EQC8|O95634|Q8WVN0	Missense_Mutation	SNP	ENST00000449771.2	37	CCDS41775.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952233	0.73787	.	.	ENSG00000079337	ENST00000405493;ENST00000449771;ENST00000549151;ENST00000171000;ENST00000389211;ENST00000389212;ENST00000397089;ENST00000548919;ENST00000395358;ENST00000466322	T;T;T;T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53;2.53;2.53;2.53	4.97	4.97	0.65823	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.28632	0.0709	L	0.41710	1.295	0.80722	D	1	D;D;D	0.89917	0.977;1.0;1.0	P;D;D	0.87578	0.611;0.998;0.996	T	0.01074	-1.1460	10	0.27082	T	0.32	.	17.1887	0.86873	0.0:1.0:0.0:0.0	.	215;203;203	B7Z5J6;O95398-2;O95398	.;.;RPGF3_HUMAN	K	161;203;161;161;161;203;215;161;203;161	ENSP00000384521:E161K;ENSP00000395708:E203K;ENSP00000448619:E161K;ENSP00000171000:E161K;ENSP00000373864:E203K;ENSP00000448480:E161K;ENSP00000378764:E203K;ENSP00000446731:E161K	ENSP00000171000:E161K	E	-	1	0	RAPGEF3	46431162	1.000000	0.71417	0.914000	0.36105	0.338000	0.28826	7.125000	0.77193	2.478000	0.83669	0.561000	0.74099	GAA	.	.	none		0.657	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257848.1	NM_006105	
C6	729	hgsc.bcm.edu	37	5	41199992	41199992	+	Missense_Mutation	SNP	C	C	T	rs200213547		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:41199992C>T	ENST00000263413.3	-	4	587	c.323G>A	c.(322-324)cGt>cAt	p.R108H	C6_ENST00000337836.5_Missense_Mutation_p.R108H	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	108	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTGACTGGGACGCAAGACAGA	0.468													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16584	0.0		0.0	False		,,,				2504	0.0				p.R108H		Atlas-SNP	.											.	C6	197	.	0			c.G323A						PASS	.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	77.0	72.0	74.0		323,323	3.3	1.0	5		74	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	C6	NM_000065.2,NM_001115131.1	29,29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	108/935,108/935	41199992	2,13004	2203	4300	6503	SO:0001583	missense	729	exon4			CTGGGACGCAAGA	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.323G>A	5.37:g.41199992C>T	ENSP00000263413:p.Arg108His	95.0	0.0	0		144.0	64.0	0.444444	NM_001115131		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.240753	0.58995	2.27E-4	1.16E-4	ENSG00000039537	ENST00000337836;ENST00000263413;ENST00000417809	T;T;T	0.54279	0.58;0.58;0.58	6.02	3.34	0.38264	.	0.153716	0.56097	D	0.000026	T	0.54615	0.1869	M	0.83312	2.635	0.46849	D	0.99922	B	0.30281	0.275	B	0.31245	0.126	T	0.54964	-0.8214	10	0.66056	D	0.02	-6.8361	9.4574	0.38762	0.0:0.7151:0.0:0.2849	.	108	P13671	CO6_HUMAN	H	108	ENSP00000338861:R108H;ENSP00000263413:R108H;ENSP00000396565:R108H	ENSP00000263413:R108H	R	-	2	0	C6	41235749	0.445000	0.25657	0.999000	0.59377	0.907000	0.53573	0.370000	0.20433	0.460000	0.27045	0.650000	0.86243	CGT	.	.	weak		0.468	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
WFDC9	259240	hgsc.bcm.edu	37	20	44238795	44238795	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:44238795A>G	ENST00000326000.1	-	3	243	c.26T>C	c.(25-27)gTc>gCc	p.V9A		NM_147198.3	NP_671731.1	Q8NEX5	WFDC9_HUMAN	WAP four-disulfide core domain 9	9						extracellular region (GO:0005576)				breast(1)|large_intestine(1)|liver(1)|lung(1)|prostate(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				GATGAACATGACGAGTAGAAG	0.498																																					p.V9A		Atlas-SNP	.											.	WFDC9	10	.	0			c.T26C						PASS	.						141.0	123.0	129.0					20																	44238795		2203	4300	6503	SO:0001583	missense	259240	exon3			AACATGACGAGTA	AL031671	CCDS13362.1	20q13.12	2013-01-21			ENSG00000180205	ENSG00000180205		"""WAP four-disulfide core domain containing"""	20380	protein-coding gene	gene with protein product						12206714	Standard	NM_147198		Approved	WAP9, dJ688G8.2	uc002xoy.3	Q8NEX5	OTTHUMG00000046332	ENST00000326000.1:c.26T>C	20.37:g.44238795A>G	ENSP00000320532:p.Val9Ala	131.0	0.0	0		120.0	54.0	0.45	NM_147198	Q3MIX6|Q5TGZ8	Missense_Mutation	SNP	ENST00000326000.1	37	CCDS13362.1	.	.	.	.	.	.	.	.	.	.	A	9.066	0.995806	0.19043	.	.	ENSG00000180205	ENST00000326000	T	0.36157	1.27	3.71	-1.07	0.09968	.	0.959088	0.08545	N	0.929885	T	0.17789	0.0427	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.26224	-1.0109	9	0.27785	T	0.31	.	0.372	0.00381	0.4004:0.1899:0.2258:0.184	.	9	Q8NEX5	WFDC9_HUMAN	A	9	ENSP00000320532:V9A	ENSP00000320532:V9A	V	-	2	0	WFDC9	43672209	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.580000	0.05827	-0.234000	0.09782	-0.280000	0.10049	GTC	.	.	none		0.498	WFDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106945.1		
SUPT6H	6830	hgsc.bcm.edu	37	17	27010108	27010108	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:27010108A>G	ENST00000314616.6	+	15	2159	c.1876A>G	c.(1876-1878)Aag>Gag	p.K626E	SUPT6H_ENST00000347486.4_Missense_Mutation_p.K626E	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	626	Interaction with KDM6A. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GAAAGGTAGAAAGGTGAGCTG	0.512																																					p.K626E		Atlas-SNP	.											.	SUPT6H	165	.	0			c.A1876G						PASS	.						28.0	26.0	26.0					17																	27010108		2203	4300	6503	SO:0001583	missense	6830	exon15			GGTAGAAAGGTGA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1876A>G	17.37:g.27010108A>G	ENSP00000319104:p.Lys626Glu	56.0	0.0	0		70.0	31.0	0.442857	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.167849	0.38315	.	.	ENSG00000109111	ENST00000314616	T	0.39997	1.05	5.95	5.95	0.96441	Tex-like domain (1);	0.000000	0.85682	D	0.000000	T	0.36826	0.0981	L	0.55481	1.735	0.58432	D	0.999999	B	0.33103	0.397	B	0.28011	0.085	T	0.18053	-1.0349	10	0.33940	T	0.23	-27.6642	12.212	0.54386	0.9322:0.0:0.0678:0.0	.	626	Q7KZ85	SPT6H_HUMAN	E	626	ENSP00000319104:K626E	ENSP00000319104:K626E	K	+	1	0	SUPT6H	24034235	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.068000	0.76748	2.279000	0.76181	0.533000	0.62120	AAG	.	.	none		0.512	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
GPRIN3	285513	hgsc.bcm.edu	37	4	90170368	90170368	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr4:90170368G>A	ENST00000609438.1	-	2	1412	c.894C>T	c.(892-894)gcC>gcT	p.A298A	GPRIN3_ENST00000333209.4_Silent_p.A298A	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	298										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TCATCGTACTGGCTTCTTTGA	0.567																																					p.A298A		Atlas-SNP	.											.	GPRIN3	90	.	0			c.C894T						PASS	.						117.0	116.0	116.0					4																	90170368		2203	4300	6503	SO:0001819	synonymous_variant	285513	exon2			CGTACTGGCTTCT	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.894C>T	4.37:g.90170368G>A		141.0	0.0	0		115.0	5.0	0.0434783	NM_198281	Q8IVE4	Silent	SNP	ENST00000609438.1	37	CCDS34030.1																																																																																			.	.	none		0.567	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
H2AFY2	55506	hgsc.bcm.edu	37	10	71835546	71835546	+	Silent	SNP	C	C	T	rs373125930		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:71835546C>T	ENST00000373255.4	+	2	396	c.132C>T	c.(130-132)ggC>ggT	p.G44G		NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	44	Histone H2A.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						TCAGCGTGGGCGCCCCTGTCT	0.602																																					p.G44G		Atlas-SNP	.											.	H2AFY2	30	.	0			c.C132T						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	120.0	95.0	103.0		132	-11.8	0.0	10		103	0,8600		0,0,4300	no	coding-synonymous	H2AFY2	NM_018649.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		44/373	71835546	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55506	exon2			CGTGGGCGCCCCT	AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.132C>T	10.37:g.71835546C>T		136.0	0.0	0		162.0	73.0	0.450617	NM_018649	Q5SQT2	Silent	SNP	ENST00000373255.4	37	CCDS7296.1																																																																																			.	.	none		0.602	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048480.2	NM_018649	
ORC1	4998	hgsc.bcm.edu	37	1	52838903	52838903	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:52838903G>A	ENST00000371568.3	-	17	2754	c.2536C>T	c.(2536-2538)Cgg>Tgg	p.R846W	ORC1_ENST00000371566.1_Missense_Mutation_p.R846W	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	846	Necessary and sufficient for ORC complex assembly.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						ACGTTGAGCCGCACCCGAAGG	0.552																																					p.R846W		Atlas-SNP	.											.	ORC1	79	.	0			c.C2536T						PASS	.						102.0	107.0	105.0					1																	52838903		2203	4300	6503	SO:0001583	missense	4998	exon17			TGAGCCGCACCCG		CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.2536C>T	1.37:g.52838903G>A	ENSP00000360623:p.Arg846Trp	146.0	0.0	0		148.0	61.0	0.412162	NM_004153	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	ENST00000371568.3	37	CCDS566.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527904	0.44969	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.46819	0.86;0.86	5.25	2.27	0.28462	CDC6, C-terminal (1);	0.115966	0.56097	D	0.000023	T	0.64505	0.2604	M	0.78637	2.42	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.63537	-0.6615	10	0.87932	D	0	-16.4175	8.0772	0.30722	0.0714:0.0:0.5136:0.415	.	841;846	B7Z8H0;Q13415	.;ORC1_HUMAN	W	846	ENSP00000360623:R846W;ENSP00000360621:R846W	ENSP00000360621:R846W	R	-	1	2	ORC1	52611491	1.000000	0.71417	0.994000	0.49952	0.007000	0.05969	4.294000	0.59043	0.318000	0.23185	-0.142000	0.14014	CGG	.	.	none		0.552	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022202.1	NM_004153	
ACIN1	22985	hgsc.bcm.edu	37	14	23548793	23548793	+	Missense_Mutation	SNP	C	C	T	rs80007670	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:23548793C>T	ENST00000262710.1	-	6	2252	c.1925G>A	c.(1924-1926)cGt>cAt	p.R642H	ACIN1_ENST00000605057.1_Missense_Mutation_p.R584H|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000457657.1_Missense_Mutation_p.R602H|ACIN1_ENST00000555053.1_Missense_Mutation_p.R642H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	642	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		AGAACGTGAACGTGACCTTGA	0.478																																					p.R642H		Atlas-SNP	.											.	ACIN1	147	.	0			c.G1925A						PASS	.	C	HIS/ARG,HIS/ARG,HIS/ARG	6,4400	6.2+/-15.9	0,6,2197	258.0	226.0	237.0		1925,1805,1925	3.2	0.8	14	dbSNP_131	237	24,8576	11.9+/-42.8	0,24,4276	yes	missense,missense,missense	ACIN1	NM_001164814.1,NM_001164815.1,NM_014977.3	29,29,29	0,30,6473	TT,TC,CC		0.2791,0.1362,0.2307	probably-damaging,probably-damaging,probably-damaging	642/1329,602/1302,642/1342	23548793	30,12976	2203	4300	6503	SO:0001583	missense	22985	exon6			CGTGAACGTGACC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1925G>A	14.37:g.23548793C>T	ENSP00000262710:p.Arg642His	160.0	0.0	0		204.0	11.0	0.0539216	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	9	0.004120879120879121	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	4	0.005277044854881266	C	14.59	2.580077	0.46006	0.001362	0.002791	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.29917	2.39;1.55;2.39	5.05	3.18	0.36537	.	0.000000	0.40144	N	0.001165	T	0.20170	0.0485	L	0.27053	0.805	0.26413	N	0.976231	D;D;D	0.67145	0.992;0.986;0.996	P;P;P	0.51582	0.674;0.475;0.572	T	0.04440	-1.0951	10	0.59425	D	0.04	-4.3727	7.238	0.26079	0.0:0.7908:0.0:0.2092	.	642;642;602	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	642;602;642	ENSP00000262710:R642H;ENSP00000405677:R602H;ENSP00000451328:R642H	ENSP00000262710:R642H	R	-	2	0	ACIN1	22618633	0.984000	0.35163	0.847000	0.33407	0.542000	0.35054	0.703000	0.25646	0.669000	0.31146	-0.216000	0.12614	CGT	C|0.994;T|0.006	0.006	strong		0.478	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
ZNF224	7767	hgsc.bcm.edu	37	19	44605366	44605366	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44605366G>T	ENST00000336976.6	+	5	477	c.223G>T	c.(223-225)Gaa>Taa	p.E75*	AC084219.3_ENST00000591772.1_RNA	NM_013398.2	NP_037530.2	Q9NZL3	ZN224_HUMAN	zinc finger protein 224	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	19		Prostate(69;0.0435)				AATCCAAAGGGAAGGGAATTC	0.438																																					p.E75X		Atlas-SNP	.											.	ZNF224	70	.	0			c.G223T						PASS	.						115.0	106.0	109.0					19																	44605366		2203	4300	6503	SO:0001587	stop_gained	7767	exon5			CAAAGGGAAGGGA	AF187990	CCDS33046.1	19q13.2	2013-01-08	2004-02-13			ENSG00000267680		"""Zinc fingers, C2H2-type"", ""-"""	13017	protein-coding gene	gene with protein product		194555	"""zinc finger protein 255"", ""zinc finger protein 27"""	ZNF255, ZNF27			Standard	NM_013398		Approved	BMZF-2, KOX22	uc002oyh.2	Q9NZL3		ENST00000336976.6:c.223G>T	19.37:g.44605366G>T	ENSP00000337368:p.Glu75*	87.0	0.0	0		43.0	21.0	0.488372	NM_013398	A6NFW9|P17033|Q86V10|Q8IZC8|Q9UID9|Q9Y2P6	Nonsense_Mutation	SNP	ENST00000336976.6	37	CCDS33046.1	.	.	.	.	.	.	.	.	.	.	g	19.31	3.802189	0.70682	.	.	ENSG00000186019	ENST00000336976;ENST00000269981	.	.	.	1.89	-0.0148	0.13979	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	4.7134	0.12884	0.2729:0.0:0.7271:0.0	.	.	.	.	X	75	.	ENSP00000269981:E75X	E	+	1	0	ZNF224	49297206	0.001000	0.12720	0.002000	0.10522	0.020000	0.10135	-0.140000	0.10342	0.040000	0.15660	0.579000	0.79373	GAA	.	.	none		0.438	ZNF224-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460477.1	NM_013398	
MAGI2	9863	hgsc.bcm.edu	37	7	77885700	77885700	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:77885700A>G	ENST00000354212.4	-	10	1860	c.1607T>C	c.(1606-1608)gTg>gCg	p.V536A	MAGI2_ENST00000535697.1_Missense_Mutation_p.V373A|MAGI2_ENST00000522391.1_Missense_Mutation_p.V536A|MAGI2_ENST00000536571.1_Missense_Mutation_p.V368A|MAGI2_ENST00000419488.1_Missense_Mutation_p.V536A	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	536					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATTGACCATCACTGGAGGTGG	0.493																																					p.V536A		Atlas-SNP	.											.	MAGI2	246	.	0			c.T1607C						PASS	.						101.0	83.0	89.0					7																	77885700		2203	4300	6503	SO:0001583	missense	9863	exon10			ACCATCACTGGAG	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1607T>C	7.37:g.77885700A>G	ENSP00000346151:p.Val536Ala	267.0	0.0	0		278.0	124.0	0.446043	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	ENST00000354212.4	37	CCDS5594.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.751936	0.49362	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.10573	2.96;2.96;2.86;3.81;3.82	5.93	4.75	0.60458	.	0.229068	0.20981	U	0.082212	T	0.12178	0.0296	L	0.36672	1.1	0.39497	D	0.96814	P;B;B;B;B;B	0.39601	0.68;0.312;0.038;0.038;0.059;0.08	B;B;B;B;B;B	0.41412	0.356;0.356;0.02;0.02;0.064;0.025	T	0.04268	-1.0964	10	0.56958	D	0.05	.	12.5202	0.56054	0.8606:0.1394:0.0:0.0	.	373;368;536;536;536;536	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	A	536;536;536;536;368;373	ENSP00000405766:V536A;ENSP00000346151:V536A;ENSP00000428389:V536A;ENSP00000441584:V368A;ENSP00000441603:V373A	ENSP00000346151:V536A	V	-	2	0	MAGI2	77723636	0.995000	0.38212	0.998000	0.56505	0.992000	0.81027	5.314000	0.65804	1.031000	0.39867	0.454000	0.30748	GTG	.	.	none		0.493	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
RNF213	57674	hgsc.bcm.edu	37	17	78332155	78332155	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:78332155G>A	ENST00000582970.1	+	37	11073	c.10930G>A	c.(10930-10932)Gac>Aac	p.D3644N	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.D3693N|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.D1717N	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3644					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATCATTCATCGACAGAGACGG	0.542																																					p.D3644N		Atlas-SNP	.											.	RNF213	766	.	0			c.G10930A						PASS	.						104.0	86.0	92.0					17																	78332155		2203	4300	6503	SO:0001583	missense	57674	exon37			TTCATCGACAGAG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10930G>A	17.37:g.78332155G>A	ENSP00000464087:p.Asp3644Asn	121.0	0.0	0		123.0	6.0	0.0487805	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990624	0.74589	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.53206	0.63	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.72977	0.3528	M	0.84511	2.7	0.39810	D	0.972696	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.78191	-0.2300	10	0.72032	D	0.01	.	17.3431	0.87303	0.0:0.0:1.0:0.0	.	3693;1717	C9JCP4;Q63HN8	.;RN213_HUMAN	N	3644;3693;1717	ENSP00000338218:D1717N	ENSP00000338218:D1717N	D	+	1	0	RNF213	75946750	1.000000	0.71417	0.312000	0.25196	0.177000	0.22998	7.921000	0.87530	2.612000	0.88384	0.637000	0.83480	GAC	.	.	none		0.542	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
CDH5	1003	hgsc.bcm.edu	37	16	66423379	66423379	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:66423379G>A	ENST00000341529.3	+	5	883	c.735G>A	c.(733-735)ctG>ctA	p.L245L	CDH5_ENST00000563425.2_Silent_p.L245L	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	245	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CCACCGTGCTGGTCACTCTGC	0.627																																					p.L245L		Atlas-SNP	.											.	CDH5	111	.	0			c.G735A						PASS	.						64.0	62.0	63.0					16																	66423379		2202	4300	6502	SO:0001819	synonymous_variant	1003	exon5			CGTGCTGGTCACT	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.735G>A	16.37:g.66423379G>A		144.0	0.0	0		91.0	57.0	0.626374	NM_001795	Q4VAI5|Q4VAI6	Silent	SNP	ENST00000341529.3	37	CCDS10804.1																																																																																			.	.	none		0.627	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ATF7IP	55729	hgsc.bcm.edu	37	12	14578150	14578150	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:14578150A>G	ENST00000540793.1	+	1	1456	c.1301A>G	c.(1300-1302)gAa>gGa	p.E434G	ATF7IP_ENST00000536444.1_Missense_Mutation_p.E434G|ATF7IP_ENST00000544627.1_Missense_Mutation_p.E442G|ATF7IP_ENST00000261168.4_Missense_Mutation_p.E434G|ATF7IP_ENST00000543189.1_Missense_Mutation_p.E434G|ATF7IP_ENST00000541654.1_3'UTR			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	434	Glu-rich.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						GAGACAGATGAAATCATTCCT	0.338																																					p.E434G		Atlas-SNP	.											.	ATF7IP	136	.	0			c.A1301G						PASS	.						64.0	66.0	65.0					12																	14578150		2203	4300	6503	SO:0001583	missense	55729	exon2			CAGATGAAATCAT	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1301A>G	12.37:g.14578150A>G	ENSP00000444589:p.Glu434Gly	118.0	0.0	0		126.0	49.0	0.388889	NM_018179	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	ENST00000540793.1	37	CCDS8663.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.204229	0.79127	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000396279;ENST00000540793	T;T;T;T;T;T	0.36699	1.64;1.64;1.64;1.64;1.24;1.64	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000019	T	0.57242	0.2040	L	0.59436	1.845	0.47441	D	0.999429	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.992;0.998;0.998;0.999;0.999	D;D;D;D;D;D;D	0.85130	0.997;0.995;0.943;0.961;0.961;0.984;0.984	T	0.60581	-0.7235	10	0.87932	D	0	-21.0202	15.639	0.76981	1.0:0.0:0.0:0.0	.	442;434;442;434;434;434;45	B4E2A2;B4DRL6;F5GX74;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;.;MCAF1_HUMAN;.;.	G	434;434;434;442;434;434	ENSP00000261168:E434G;ENSP00000443179:E434G;ENSP00000445955:E434G;ENSP00000440440:E442G;ENSP00000379575:E434G;ENSP00000444589:E434G	ENSP00000261168:E434G	E	+	2	0	ATF7IP	14469417	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.355000	0.73041	2.140000	0.66376	0.482000	0.46254	GAA	.	.	none		0.338	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401400.1	NM_018179	
SSR1	6745	hgsc.bcm.edu	37	6	7313275	7313275	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:7313275C>T	ENST00000244763.4	-	1	165	c.79G>A	c.(79-81)Ggc>Agc	p.G27S	SSR1_ENST00000474597.1_Splice_Site_p.G27S|SSR1_ENST00000489567.1_Splice_Site_p.G27S|SSR1_ENST00000397511.2_Splice_Site_p.G27S|SSR1_ENST00000488834.1_Intron|SSR1_ENST00000479365.1_Splice_Site_p.G27S|SSR1_ENST00000462112.1_Splice_Site_p.G27S|SSR1_ENST00000534851.1_Splice_Site_p.G27S	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	27					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					CCAGCCTCACCTCTGGGGCCG	0.647																																					p.G27S		Atlas-SNP	.											.	SSR1	21	.	0			c.G79A						PASS	.						43.0	41.0	42.0					6																	7313275		2193	4282	6475	SO:0001630	splice_region_variant	6745	exon1			CCTCACCTCTGGG		CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.79+1G>A	6.37:g.7313275C>T		69.0	0.0	0		80.0	42.0	0.525	NM_003144	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Missense_Mutation	SNP	ENST00000244763.4	37	CCDS4499.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040668	0.75732	.	.	ENSG00000124783	ENST00000474597;ENST00000244763;ENST00000397511;ENST00000534851;ENST00000489567;ENST00000479365;ENST00000462112	T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0	4.32	4.32	0.51571	.	0.133138	0.49305	D	0.000157	T	0.32556	0.0833	N	0.12569	0.235	0.49915	D	0.99983	P;D;P	0.62365	0.928;0.991;0.833	P;D;P	0.68621	0.756;0.959;0.677	T	0.21895	-1.0232	9	.	.	.	.	15.7303	0.77794	0.0:1.0:0.0:0.0	.	27;27;27	C9J5W0;C9JBX5;P43307	.;.;SSRA_HUMAN	S	27	ENSP00000418617:G27S;ENSP00000244763:G27S;ENSP00000380647:G27S;ENSP00000443020:G27S;ENSP00000420730:G27S;ENSP00000417911:G27S;ENSP00000417290:G27S	.	G	-	1	0	SSR1	7258274	1.000000	0.71417	0.997000	0.53966	0.595000	0.36748	2.096000	0.41738	2.089000	0.63090	0.462000	0.41574	GGC	.	.	none		0.647	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039775.2		Missense_Mutation
POMT2	29954	hgsc.bcm.edu	37	14	77746416	77746416	+	Missense_Mutation	SNP	C	C	T	rs571330846		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:77746416C>T	ENST00000261534.4	-	17	1935	c.1733G>A	c.(1732-1734)cGc>cAc	p.R578H		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	578						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CCCTGAGAAGCGTAGGCCCTG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17795	0.0		0.0	False		,,,				2504	0.001				p.R578H		Atlas-SNP	.											POMT2,colon,carcinoma,-1,2	POMT2	47	2	0			c.G1733A						PASS	.						120.0	99.0	106.0					14																	77746416		2203	4300	6503	SO:0001583	missense	29954	exon17			GAGAAGCGTAGGC	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1733G>A	14.37:g.77746416C>T	ENSP00000261534:p.Arg578His	114.0	0.0	0		116.0	54.0	0.465517	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.3|27.3	4.815127|4.815127	0.90790|0.90790	.|.	.|.	ENSG00000009830|ENSG00000009830	ENST00000556171|ENST00000261534	.|D	.|0.92299	.|-3.01	5.67|5.67	4.79|4.79	0.61399|0.61399	.|.	.|0.051252	.|0.85682	.|N	.|0.000000	D|D	0.90113|0.90113	0.6911|0.6911	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|B	.|0.18461	.|0.028	.|B	.|0.14023	.|0.01	D|D	0.86195|0.86195	0.1615|0.1615	5|10	.|0.14656	.|T	.|0.56	-12.6745|-12.6745	14.5883|14.5883	0.68344|0.68344	0.0:0.9299:0.0:0.0701|0.0:0.9299:0.0:0.0701	.|.	.|578	.|Q9UKY4	.|POMT2_HUMAN	T|H	46|578	.|ENSP00000261534:R578H	.|ENSP00000261534:R578H	A|R	-|-	1|2	0|0	POMT2|POMT2	76816169|76816169	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.739000|0.739000	0.42172|0.42172	3.812000|3.812000	0.55628|0.55628	1.416000|1.416000	0.47057|0.47057	0.563000|0.563000	0.77884|0.77884	GCT|CGC	.	.	none		0.597	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
LITAF	9516	hgsc.bcm.edu	37	16	11650529	11650529	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:11650529G>A	ENST00000571688.1	-	2	288	c.58C>T	c.(58-60)Cct>Tct	p.P20S	LITAF_ENST00000574703.1_Missense_Mutation_p.P20S|LITAF_ENST00000574763.1_Missense_Mutation_p.P20S|LITAF_ENST00000413364.2_Missense_Mutation_p.P20S|LITAF_ENST00000571976.1_Missense_Mutation_p.P20S|LITAF_ENST00000570904.1_Missense_Mutation_p.P20S|LITAF_ENST00000572255.1_Intron|LITAF_ENST00000571459.1_Missense_Mutation_p.P20S|LITAF_ENST00000576036.1_Missense_Mutation_p.P20S|LITAF_ENST00000381810.3_Missense_Mutation_p.P20S|LITAF_ENST00000339430.5_Missense_Mutation_p.P20S	NM_001136472.1	NP_001129944.1	Q99732	LITAF_HUMAN	lipopolysaccharide-induced TNF factor	20					aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of cytokine production (GO:0001817)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			endometrium(1)|large_intestine(1)|liver(1)|lung(3)|skin(1)	7						TAGGATGGAGGTGCGGATGGT	0.532																																					p.P20S		Atlas-SNP	.											.	LITAF	16	.	0			c.C58T						PASS	.						95.0	87.0	90.0					16																	11650529		2197	4300	6497	SO:0001583	missense	9516	exon2			ATGGAGGTGCGGA	AB034747	CCDS32386.1, CCDS45411.1	16p13.3-p12	2014-09-17							16841	protein-coding gene	gene with protein product		603795				9305847, 10200294	Standard	NM_004862		Approved	PIG7, SIMPLE, FLJ38636, TP53I7	uc002dbb.3	Q99732		ENST00000571688.1:c.58C>T	16.37:g.11650529G>A	ENSP00000459533:p.Pro20Ser	177.0	0.0	0		309.0	40.0	0.12945	NM_001136473	D3DUG1|G5E9K0|Q05DW0|Q9C0L6	Missense_Mutation	SNP	ENST00000571688.1	37	CCDS32386.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316524	0.60524	.	.	ENSG00000189067	ENST00000339430;ENST00000413364;ENST00000381810	D;D;D	0.93189	-2.45;-3.18;-2.52	5.63	5.63	0.86233	.	0.065688	0.64402	D	0.000010	D	0.95579	0.8563	L	0.52364	1.645	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.996	D	0.95558	0.8627	10	0.59425	D	0.04	-23.8973	17.2034	0.86912	0.0:0.0:1.0:0.0	.	20;20;20	Q99732-2;G5E9K0;Q99732	.;.;LITAF_HUMAN	S	20	ENSP00000340118:P20S;ENSP00000397958:P20S;ENSP00000371231:P20S	ENSP00000340118:P20S	P	-	1	0	LITAF	11558030	1.000000	0.71417	0.451000	0.26982	0.146000	0.21551	5.921000	0.70028	2.652000	0.90054	0.655000	0.94253	CCT	.	.	none		0.532	LITAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436794.2	NM_004862	
SMC5	23137	hgsc.bcm.edu	37	9	72897468	72897468	+	Missense_Mutation	SNP	G	G	A	rs115131883		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:72897468G>A	ENST00000361138.5	+	7	1008	c.950G>A	c.(949-951)cGt>cAt	p.R317H		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	317					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						GAAAACGAGCGTCACAATTTG	0.343													G|||	1	0.000199681	0.0	0.0	5008	,	,		16784	0.0		0.001	False		,,,				2504	0.0				p.R317H		Atlas-SNP	.											.	SMC5	96	.	0			c.G950A						PASS	.						80.0	79.0	79.0					9																	72897468		2203	4300	6503	SO:0001583	missense	23137	exon7			ACGAGCGTCACAA	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.950G>A	9.37:g.72897468G>A	ENSP00000354957:p.Arg317His	257.0	0.0	0		247.0	103.0	0.417004	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Missense_Mutation	SNP	ENST00000361138.5	37	CCDS6632.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	8.955	0.969095	0.18659	.	.	ENSG00000198887	ENST00000361138	T	0.18016	2.24	5.61	5.61	0.85477	RecF/RecN/SMC (1);	0.276654	0.37715	N	0.001971	T	0.12689	0.0308	N	0.19112	0.55	0.09310	N	1	D	0.64830	0.994	P	0.49192	0.602	T	0.23226	-1.0194	10	0.15952	T	0.53	-11.1893	7.1841	0.25789	0.1378:0.0:0.7171:0.1451	.	317	Q8IY18	SMC5_HUMAN	H	317	ENSP00000354957:R317H	ENSP00000354957:R317H	R	+	2	0	SMC5	72087288	0.357000	0.24938	0.463000	0.27130	0.326000	0.28443	2.392000	0.44433	2.804000	0.96469	0.650000	0.86243	CGT	G|1.000;A|0.000	0.000	strong		0.343	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
RRAS2	22800	hgsc.bcm.edu	37	11	14300971	14300971	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:14300971C>T	ENST00000256196.4	-	6	841		c.e6-1		RRAS2_ENST00000414023.2_Splice_Site|RRAS2_ENST00000532814.1_Splice_Site|RRAS2_ENST00000545643.1_Splice_Site|RRAS2_ENST00000534746.1_Splice_Site|RRAS2_ENST00000529237.1_Splice_Site|RRAS2_ENST00000526063.1_Splice_Site|RRAS2_ENST00000537760.1_Splice_Site			P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2						osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|endometrium(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	12				Epithelial(150;0.203)		TTGAAATTTCCTGTAAGATAA	0.343																																					.		Atlas-SNP	.											.	RRAS2	29	.	0			c.528-1G>A						PASS	.						121.0	117.0	118.0					11																	14300971		2200	4294	6494	SO:0001630	splice_region_variant	22800	exon7			AATTTCCTGTAAG	M31468	CCDS7814.1, CCDS44544.1, CCDS53603.1	11p15.2	2014-05-09			ENSG00000133818	ENSG00000133818			17271	protein-coding gene	gene with protein product		600098				2108320, 8052619	Standard	NM_012250		Approved	TC21	uc001mlf.4	P62070	OTTHUMG00000165756	ENST00000256196.4:c.528-1G>A	11.37:g.14300971C>T		124.0	0.0	0		107.0	5.0	0.046729	NM_012250	B2R9Z3|B7Z5Z2|B7Z6C4|B7Z7H6|P17082	Splice_Site	SNP	ENST00000256196.4	37	CCDS7814.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871523	0.51695	.	.	ENSG00000133818	ENST00000537760;ENST00000545643;ENST00000414023;ENST00000529237;ENST00000256196;ENST00000534746;ENST00000526063;ENST00000532814;ENST00000531807	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3437	0.98782	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RRAS2	14257547	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	7.760000	0.85248	2.821000	0.97095	0.555000	0.69702	.	.	.	none		0.343	RRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386035.1	NM_012250	Intron
KCNT1	57582	hgsc.bcm.edu	37	9	138671231	138671231	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:138671231C>T	ENST00000263604.3	+	24	2699	c.2699C>T	c.(2698-2700)aCg>aTg	p.T900M	KCNT1_ENST00000491806.2_Missense_Mutation_p.T886M|KCNT1_ENST00000487664.1_Missense_Mutation_p.T874M|KCNT1_ENST00000488444.2_Missense_Mutation_p.T900M|KCNT1_ENST00000298480.5_Missense_Mutation_p.T919M|KCNT1_ENST00000371757.2_Missense_Mutation_p.T919M|KCNT1_ENST00000486577.2_Missense_Mutation_p.T878M|KCNT1_ENST00000490355.2_Missense_Mutation_p.T898M			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	900					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AGCATCACCACGGAGCTCACC	0.622																																					p.T919M		Atlas-SNP	.											.	KCNT1	139	.	0			c.C2756T						PASS	.						149.0	146.0	147.0					9																	138671231		2203	4300	6503	SO:0001583	missense	57582	exon24			TCACCACGGAGCT	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2699C>T	9.37:g.138671231C>T	ENSP00000263604:p.Thr900Met	92.0	0.0	0		101.0	46.0	0.455446	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	C	19.41	3.821619	0.71028	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	3.77	3.77	0.43336	.	0.000000	0.85682	U	0.000000	D	0.86994	0.6067	M	0.81497	2.545	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.978;0.978;0.994;0.978	D	0.88055	0.2790	10	0.54805	T	0.06	-30.3053	12.6769	0.56899	0.1657:0.8343:0.0:0.0	.	886;919;874;900	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	M	874;919;919;878;886;900;898;900	ENSP00000417851:T874M;ENSP00000298480:T919M;ENSP00000360822:T919M;ENSP00000263604:T900M	ENSP00000263604:T900M	T	+	2	0	KCNT1	137811052	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.830000	0.69324	1.778000	0.52293	0.455000	0.32223	ACG	.	.	none		0.622	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
SFXN5	94097	hgsc.bcm.edu	37	2	73215387	73215387	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:73215387C>T	ENST00000272433.2	-	10	755	c.625G>A	c.(625-627)Gcc>Acc	p.A209T	SFXN5_ENST00000474528.1_5'UTR|SFXN5_ENST00000410065.1_Splice_Site_p.G209R	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5	209					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CAGGTCTTACCTACAGCAGGG	0.572																																					p.A209T		Atlas-SNP	.											.	SFXN5	31	.	0			c.G625A						PASS	.						107.0	92.0	97.0					2																	73215387		2203	4300	6503	SO:0001630	splice_region_variant	94097	exon10			TCTTACCTACAGC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.625+1G>A	2.37:g.73215387C>T		61.0	0.0	0		91.0	4.0	0.043956	NM_144579	A8K116|Q494Y3|Q53T29	Missense_Mutation	SNP	ENST00000272433.2	37	CCDS1922.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	27.7|27.7|27.7	4.856674|4.856674|4.856674	0.91433|0.91433|0.91433	.|.|.	.|.|.	ENSG00000144040|ENSG00000144040|ENSG00000144040	ENST00000272433|ENST00000410065|ENST00000411783	T|T|.	0.36157|0.30714|.	1.27|1.52|.	5.39|5.39|5.39	4.5|4.5|4.5	0.54988|0.54988|0.54988	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.66973|0.66973|0.66973	0.2844|0.2844|0.2844	M|M|M	0.82193|0.82193|0.82193	2.58|2.58|2.58	0.30785|0.30785|0.30785	N|N|N	0.741602|0.741602|0.741602	D|P|.	0.55605|0.42584|.	0.972|0.784|.	P|B|.	0.55303|0.42522|.	0.773|0.39|.	T|T|T	0.69262|0.69262|0.69262	-0.5191|-0.5191|-0.5191	9|8|5	.|.|.	.|.|.	.|.|.	-17.7252|-17.7252|-17.7252	11.478|11.478|11.478	0.50310|0.50310|0.50310	0.0:0.9128:0.0:0.0872|0.0:0.9128:0.0:0.0872|0.0:0.9128:0.0:0.0872	.|.|.	209|209|.	Q8TD22|B8ZZJ6|.	SFXN5_HUMAN|.|.	T|R|K	209|209|198	ENSP00000272433:A209T|ENSP00000387076:G209R|.	.|.|.	A|G|R	-|-|-	1|1|2	0|0|0	SFXN5|SFXN5|SFXN5	73068895|73068895|73068895	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.994000|0.994000|0.994000	0.84299|0.84299|0.84299	4.673000|4.673000|4.673000	0.61604|0.61604|0.61604	2.699000|2.699000|2.699000	0.92147|0.92147|0.92147	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCC|GGA|AGG	.	.	none		0.572	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251991.1	NM_144579	Missense_Mutation
UBXN11	91544	hgsc.bcm.edu	37	1	26608867	26608867	+	Missense_Mutation	SNP	C	C	A	rs193142354		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:26608867C>A	ENST00000374222.1	-	16	1950	c.1486G>T	c.(1486-1488)Ggt>Tgt	p.G496C	UBXN11_ENST00000374221.3_Missense_Mutation_p.G496C|UBXN11_ENST00000357089.4_Missense_Mutation_p.G463C|UBXN11_ENST00000374223.1_Missense_Mutation_p.G253C|UBXN11_ENST00000314675.7_Missense_Mutation_p.G376C|UBXN11_ENST00000374217.2_Missense_Mutation_p.G463C			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						ggaccgggaccgggactgggg	0.721																																					p.G496C		Atlas-SNP	.											UBXN11,colon,carcinoma,0,2	UBXN11	54	2	1	Deletion - In frame(1)	ovary(1)	c.G1486T						scavenged	.						25.0	29.0	28.0					1																	26608867		1765	4016	5781	SO:0001583	missense	91544	exon16			CGGGACCGGGACT	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1486G>T	1.37:g.26608867C>A	ENSP00000363339:p.Gly496Cys	26.0	2.0	0.0769231		26.0	7.0	0.269231	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	261	0.11950549450549451	72	0.14634146341463414	35	0.09668508287292818	16	0.027972027972027972	138	0.1820580474934037	A	8.132	0.783217	0.16189	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.23950	1.88;1.96;2.3;2.24;2.24;2.3	.	.	.	.	.	.	.	.	T	0.00073	0.0002	N	0.22421	0.69	0.58432	P	2.9999999999752447E-6	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;P	0.65323	0.934;0.934;0.934;0.861	T	0.12578	-1.0542	7	0.66056	D	0.02	.	6.1326	0.20213	0.0:0.6805:0.3194:0.0	.	463;458;376;496	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	C	376;253;463;496;496;463	ENSP00000324721:G376C;ENSP00000363340:G253C;ENSP00000349601:G463C;ENSP00000363338:G496C;ENSP00000363339:G496C;ENSP00000363334:G463C	ENSP00000324721:G376C	G	-	1	0	UBXN11	26481454	0.000000	0.05858	0.121000	0.21740	0.128000	0.20619	-1.193000	0.03049	0.392000	0.25172	0.391000	0.25812	GGT	C|0.880;A|0.120	0.120	strong		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
DST	667	hgsc.bcm.edu	37	6	56374517	56374517	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:56374517A>G	ENST00000361203.3	-	69	17982	c.17975T>C	c.(17974-17976)tTg>tCg	p.L5992S	DST_ENST00000244364.6_Missense_Mutation_p.L3689S|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.L4015S|DST_ENST00000370754.5_Missense_Mutation_p.L6281S|DST_ENST00000340834.4_5'UTR|DST_ENST00000370769.4_Missense_Mutation_p.L6103S|DST_ENST00000370788.2_Missense_Mutation_p.L3906S|DST_ENST00000446842.2_Missense_Mutation_p.L5777S			Q03001	DYST_HUMAN	dystonin	5993					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTTTCATACAACGGCTGTAG	0.428																																					p.L3689S		Atlas-SNP	.											.	DST	1427	.	0			c.T11066C						PASS	.						118.0	109.0	112.0					6																	56374517		1872	4115	5987	SO:0001583	missense	667	exon55			TCATACAACGGCT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17975T>C	6.37:g.56374517A>G	ENSP00000354508:p.Leu5992Ser	219.0	0.0	0		239.0	94.0	0.393305	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	A	11.64	1.698379	0.30142	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000537444	T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.76	5.76	0.90799	.	0.185737	0.24242	N	0.040256	T	0.25827	0.0629	N	0.04880	-0.145	0.28311	N	0.922675	D;B;B;B;B	0.53745	0.962;0.201;0.104;0.016;0.007	P;B;B;B;B	0.58077	0.832;0.2;0.059;0.034;0.01	T	0.14200	-1.0481	9	0.08179	T	0.78	.	16.0663	0.80878	1.0:0.0:0.0:0.0	.	4015;6103;6281;6101;3689	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	S	3689;6281;6103;4015;5777;3906;5992;105	ENSP00000244364:L3689S;ENSP00000359790:L6281S;ENSP00000359805:L6103S;ENSP00000400883:L4015S;ENSP00000393645:L5777S;ENSP00000359824:L3906S;ENSP00000354508:L5992S	ENSP00000244364:L3689S	L	-	2	0	DST	56482476	0.160000	0.22878	0.882000	0.34594	0.831000	0.47069	3.609000	0.54117	2.196000	0.70406	0.533000	0.62120	TTG	.	.	none		0.428	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
TBC1D3	729873	hgsc.bcm.edu	37	17	36339597	36339597	+	Missense_Mutation	SNP	G	G	T	rs373252714		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:36339597G>T	ENST00000354664.4	-	13	1216	c.1060C>A	c.(1060-1062)Cag>Aag	p.Q354K	TBC1D3_ENST00000519532.1_Missense_Mutation_p.Q332K|TBC1D3_ENST00000537432.1_Missense_Mutation_p.Q354K|TBC1D3_ENST00000339023.4_3'UTR	NM_001123391.2	NP_001116863.2	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3	354				Q -> K (in Ref. 2; CAB66794). {ECO:0000305}.		plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGGTCCCCCTGCTTTCTTGTT	0.592																																					p.Q354K		Atlas-SNP	.											TBC1D3_ENST00000537432,NS,carcinoma,0,4	TBC1D3F	14	4	0			c.C1060A						scavenged	.																																			SO:0001583	missense	84218	exon13			CCCCCTGCTTTCT		CCDS45658.1	17q12	2014-09-16			ENSG00000274611	ENSG00000274419			19031	protein-coding gene	gene with protein product	"""prostate cancer gene 17"""	607741				12604796, 12359748, 16863688	Standard	NM_001123391		Approved	TBC1D3A, DKFZp434P2235, PRC17	uc002hoo.2	Q8IZP1	OTTHUMG00000188487	ENST00000354664.4:c.1060C>A	17.37:g.36339597G>T	ENSP00000346691:p.Gln354Lys	5.0	0.0	0		9.0	5.0	0.555556	NM_032258	A6NGX2|A8K007|Q6DCB4|Q9H0B9|Q9UDD4	Missense_Mutation	SNP	ENST00000354664.4	37	CCDS45658.1	.	.	.	.	.	.	.	.	.	.	-	0.004	-2.271786	0.00257	.	.	ENSG00000197681	ENST00000518551;ENST00000354664;ENST00000431880;ENST00000519532;ENST00000537432	T;T;T;T	0.13901	3.07;3.1;2.55;3.1	0.109	0.109	0.14578	.	0.201240	0.41097	N	0.000949	T	0.07818	0.0196	N	0.05280	-0.08	0.80722	D	1	P;D;D	0.58970	0.836;0.984;0.977	B;P;P	0.53224	0.325;0.633;0.721	T	0.17379	-1.0371	9	0.02654	T	1	.	.	.	.	.	354;354;332	A8K007;Q8IZP1;F6U074	.;TBC3A_HUMAN;.	K	398;354;104;332;354	ENSP00000428847:Q398K;ENSP00000346691:Q354K;ENSP00000429926:Q332K;ENSP00000439621:Q354K	ENSP00000346691:Q354K	Q	-	1	0	TBC1D3	33593403	0.793000	0.28825	0.049000	0.19019	0.051000	0.14879	0.961000	0.29267	0.181000	0.19994	0.184000	0.17185	CAG	.	.	weak		0.592	TBC1D3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378681.1	NM_001123391	
FAM47C	442444	hgsc.bcm.edu	37	X	37028314	37028314	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chrX:37028314C>T	ENST00000358047.3	+	1	1883	c.1831C>T	c.(1831-1833)Cca>Tca	p.P611S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	611										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CCCGGAGCCTCCAGAGACTCG	0.647																																					p.P611S		Atlas-SNP	.											.	FAM47C	267	.	0			c.C1831T						PASS	.						22.0	25.0	24.0					X																	37028314		2186	4274	6460	SO:0001583	missense	442444	exon1			GAGCCTCCAGAGA	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1831C>T	X.37:g.37028314C>T	ENSP00000367913:p.Pro611Ser	178.0	0.0	0		227.0	94.0	0.414097	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	37	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	-	12.85	2.061132	0.36373	.	.	ENSG00000198173	ENST00000358047	T	0.22134	1.97	1.02	0.0439	0.14224	.	.	.	.	.	T	0.22898	0.0553	M	0.80183	2.485	0.09310	N	1	P	0.50710	0.938	B	0.41202	0.35	T	0.15009	-1.0452	9	0.42905	T	0.14	.	5.3242	0.15896	0.0:0.7636:0.0:0.2364	.	611	Q5HY64	FA47C_HUMAN	S	611	ENSP00000367913:P611S	ENSP00000367913:P611S	P	+	1	0	FAM47C	36938235	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.449000	0.21744	-0.043000	0.13513	-0.457000	0.05445	CCA	.	.	none		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
GAD2	2572	hgsc.bcm.edu	37	10	26508109	26508109	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:26508109C>T	ENST00000376261.3	+	4	927	c.424C>T	c.(424-426)Ctc>Ttc	p.L142F	GAD2_ENST00000259271.3_Missense_Mutation_p.L142F|GAD2_ENST00000376248.1_Missense_Mutation_p.L28F	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	142					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TAATGAGCTTCTCCAAGAATA	0.343																																					p.L142F		Atlas-SNP	.											.	GAD2	116	.	0			c.C424T						PASS	.						100.0	105.0	103.0					10																	26508109		2203	4300	6503	SO:0001583	missense	2572	exon4			GAGCTTCTCCAAG	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.424C>T	10.37:g.26508109C>T	ENSP00000365437:p.Leu142Phe	81.0	0.0	0		87.0	4.0	0.045977	NM_000818	Q9UD87	Missense_Mutation	SNP	ENST00000376261.3	37	CCDS7149.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328723	0.60743	.	.	ENSG00000136750	ENST00000376261;ENST00000259271;ENST00000428517;ENST00000376248	T;T;T;T	0.59906	0.23;0.23;0.23;1.13	5.61	5.61	0.85477	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.70762	0.3261	L	0.53671	1.685	0.80722	D	1	D;B	0.89917	1.0;0.288	D;B	0.91635	0.999;0.12	T	0.62751	-0.6788	10	0.09843	T	0.71	-15.2362	19.6436	0.95767	0.0:1.0:0.0:0.0	.	142;142	Q4G154;Q05329	.;DCE2_HUMAN	F	142;142;142;28	ENSP00000365437:L142F;ENSP00000259271:L142F;ENSP00000390434:L142F;ENSP00000365424:L28F	ENSP00000259271:L142F	L	+	1	0	GAD2	26548115	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.666000	0.68059	2.621000	0.88768	0.650000	0.86243	CTC	.	.	none		0.343	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
PRAMEF11	440560	hgsc.bcm.edu	37	1	12887686	12887686	+	Silent	SNP	T	T	C	rs59802947	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:12887686T>C	ENST00000535591.1	-	3	366	c.171A>G	c.(169-171)agA>agG	p.R57R		NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11	57					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.R57R(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						GAAGTTTCCATCTCCTGTGGG	0.468													.|||	5	0.000998403	0.0008	0.0	5008	,	,		21622	0.001		0.0	False		,,,				2504	0.0031				p.R57R		Atlas-SNP	.											PRAMEF11,NS,carcinoma,0,1	PRAMEF11	72	1	1	Substitution - coding silent(1)	endometrium(1)	c.A171G						scavenged	.																																			SO:0001819	synonymous_variant	440560	exon3			TTTCCATCTCCTG	AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.171A>G	1.37:g.12887686T>C		41.0	0.0	0		53.0	5.0	0.0943396	NM_001146344		Silent	SNP	ENST00000535591.1	37	CCDS53268.1																																																																																			T|0.986;C|0.014	0.014	strong		0.468	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_496341	
CYP2J2	1573	hgsc.bcm.edu	37	1	60381646	60381646	+	Missense_Mutation	SNP	C	C	T	rs11572242	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:60381646C>T	ENST00000371204.3	-	2	380	c.337G>A	c.(337-339)Gtg>Atg	p.V113M	CYP2J2_ENST00000492633.1_5'Flank	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	113			V -> M (in dbSNP:rs11572242).		arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)	p.V113M(1)		NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	ATAGGGGTCACGGGGCGGTTC	0.428													C|||	3	0.000599042	0.0008	0.0029	5008	,	,		19082	0.0		0.0	False		,,,				2504	0.0				p.V113M		Atlas-SNP	.											CYP2J2,colon,carcinoma,0,1	CYP2J2	34	1	1	Substitution - Missense(1)	large_intestine(1)	c.G337A						PASS	.						108.0	110.0	110.0					1																	60381646		2203	4300	6503	SO:0001583	missense	1573	exon2			GGGTCACGGGGCG	BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.337G>A	1.37:g.60381646C>T	ENSP00000360247:p.Val113Met	88.0	0.0	0		128.0	44.0	0.34375	NM_000775	B2RD33|Q8TF13	Missense_Mutation	SNP	ENST00000371204.3	37	CCDS613.1	3	0.0013736263736263737	1	0.0020325203252032522	2	0.0055248618784530384	0	0.0	0	0.0	C	7.417	0.635998	0.14386	.	.	ENSG00000134716	ENST00000371204	T	0.69040	-0.37	5.8	-11.6	0.00059	.	3.755470	0.00166	N	0.000010	T	0.40372	0.1114	N	0.25789	0.76	0.09310	N	1	P	0.38020	0.615	B	0.36186	0.219	T	0.56275	-0.8006	10	0.44086	T	0.13	.	10.2805	0.43537	0.0643:0.5248:0.2124:0.1986	rs11572242;rs52814181;rs11572242	113	P51589	CP2J2_HUMAN	M	113	ENSP00000360247:V113M	ENSP00000360247:V113M	V	-	1	0	CYP2J2	60154234	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.110000	0.00150	-3.492000	0.00153	-2.084000	0.00378	GTG	C|0.998;T|0.002	0.002	strong		0.428	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775	
MICU1	10367	hgsc.bcm.edu	37	10	74183072	74183072	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:74183072G>A	ENST00000361114.5	-	9	1087	c.991C>T	c.(991-993)Cta>Tta	p.L331L	MICU1_ENST00000398763.4_Silent_p.L133L|MICU1_ENST00000401998.3_Silent_p.L331L|MICU1_ENST00000398761.4_Silent_p.L333L|MICU1_ENST00000418483.2_Silent_p.L133L	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	331					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TAGGCAAGTAGCATGCCACCA	0.512																																					p.L331L		Atlas-SNP	.											.	.	.	.	0			c.C991T						PASS	.						104.0	96.0	99.0					10																	74183072		2000	4197	6197	SO:0001819	synonymous_variant	10367	exon9			CAAGTAGCATGCC	Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.991C>T	10.37:g.74183072G>A		136.0	0.0	0		149.0	54.0	0.362416	NM_001195518	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Silent	SNP	ENST00000361114.5	37	CCDS55715.1																																																																																			.	.	none		0.512	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048586.1	NM_006077	
ZNF285	26974	hgsc.bcm.edu	37	19	44891217	44891217	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:44891217T>C	ENST00000330997.4	-	4	1254	c.1190A>G	c.(1189-1191)gAg>gGg	p.E397G	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000544719.2_Missense_Mutation_p.E397G|ZNF285_ENST00000591679.1_Missense_Mutation_p.E404G	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	397					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E397G(2)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GTAGGGCTTCTCTCCAGTGTG	0.483																																					p.E397G		Atlas-SNP	.											ZNF285,NS,carcinoma,0,2	ZNF285	86	2	2	Substitution - Missense(2)	prostate(2)	c.A1190G						scavenged	.						57.0	56.0	57.0					19																	44891217		2203	4300	6503	SO:0001583	missense	26974	exon4			GGCTTCTCTCCAG	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1190A>G	19.37:g.44891217T>C	ENSP00000333595:p.Glu397Gly	53.0	0.0	0		57.0	4.0	0.0701754	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	37	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.812415	0.70912	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.27557	1.66	3.36	3.36	0.38483	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53012	0.1770	M	0.75150	2.29	0.34602	D	0.716652	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.933	T	0.67393	-0.5682	9	0.87932	D	0	.	11.1099	0.48226	0.0:0.0:0.0:1.0	.	421;397	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	G	420;397	ENSP00000333595:E397G	ENSP00000333595:E397G	E	-	2	0	ZNF285	49583057	1.000000	0.71417	0.745000	0.31077	0.941000	0.58515	7.429000	0.80309	1.308000	0.44962	0.248000	0.18094	GAG	.	.	none		0.483	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
BRSK2	9024	hgsc.bcm.edu	37	11	1467077	1467077	+	Missense_Mutation	SNP	C	C	T	rs368418167		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:1467077C>T	ENST00000528841.1	+	12	1550	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M	BRSK2_ENST00000308219.9_Missense_Mutation_p.T389M|BRSK2_ENST00000526678.1_Missense_Mutation_p.T389M|BRSK2_ENST00000528710.1_Missense_Mutation_p.T329M|BRSK2_ENST00000382179.1_Missense_Mutation_p.T435M|BRSK2_ENST00000308230.5_Missense_Mutation_p.T389M|BRSK2_ENST00000531197.1_Missense_Mutation_p.T389M|BRSK2_ENST00000544817.1_Missense_Mutation_p.T84M			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	389					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		CTCAGCGTGACGGACGGCGGC	0.701																																					p.T435M		Atlas-SNP	.											.	BRSK2	97	.	0			c.C1304T						PASS	.	C	MET/THR	0,4342		0,0,2171	35.0	45.0	42.0		1166	3.7	0.9	11		42	1,8531		0,1,4265	no	missense	BRSK2	NM_003957.2	81	0,1,6436	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging	389/669	1467077	1,12873	2171	4266	6437	SO:0001583	missense	9024	exon12			GCGTGACGGACGG	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1166C>T	11.37:g.1467077C>T	ENSP00000432000:p.Thr389Met	43.0	0.0	0		61.0	32.0	0.52459	NM_001256630	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	ENST00000528841.1	37	CCDS58107.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.732292	0.89482	0.0	1.17E-4	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817	T;T;T;T;T;T;T;T	0.73469	-0.75;1.82;-0.7;1.82;-0.7;1.82;-0.59;0.76	4.71	3.73	0.42828	Protein kinase-like domain (1);	0.000000	0.85682	U	0.000000	D	0.83792	0.5331	M	0.65975	2.015	0.51767	D	0.999935	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.994;1.0;0.998;0.992	D	0.85738	0.1335	10	0.66056	D	0.02	.	14.2379	0.65938	0.0:0.8498:0.1502:0.0	.	389;435;389;389;389	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	M	389;389;389;389;389;329;435;84	ENSP00000310697:T389M;ENSP00000431152:T389M;ENSP00000310805:T389M;ENSP00000432000:T389M;ENSP00000433370:T389M;ENSP00000433235:T329M;ENSP00000371614:T435M;ENSP00000445168:T84M	ENSP00000310697:T389M	T	+	2	0	BRSK2	1423653	1.000000	0.71417	0.920000	0.36463	0.942000	0.58702	5.583000	0.67484	2.182000	0.69389	0.462000	0.41574	ACG	.	.	weak		0.701	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393033.1	NM_003957	
DOCK1	1793	hgsc.bcm.edu	37	10	129209114	129209114	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:129209114G>T	ENST00000280333.6	+	43	4400	c.4291G>T	c.(4291-4293)Gtg>Ttg	p.V1431L		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1431	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TTTTTACAGGGTGAACGAGGT	0.438																																					p.V1431L		Atlas-SNP	.											.	DOCK1	188	.	0			c.G4291T						PASS	.						73.0	69.0	70.0					10																	129209114		1875	4103	5978	SO:0001583	missense	1793	exon43			TACAGGGTGAACG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4291G>T	10.37:g.129209114G>T	ENSP00000280333:p.Val1431Leu	70.0	0.0	0		60.0	23.0	0.383333	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	37		.	.	.	.	.	.	.	.	.	.	G	22.4	4.288809	0.80914	.	.	ENSG00000150760	ENST00000280333	T	0.17370	2.28	4.9	4.9	0.64082	.	0.062614	0.64402	D	0.000006	T	0.40839	0.1133	M	0.69523	2.12	0.54753	D	0.999989	P;D;P	0.63046	0.898;0.992;0.772	P;D;B	0.64237	0.542;0.923;0.326	T	0.19844	-1.0293	10	0.51188	T	0.08	.	18.3037	0.90172	0.0:0.0:1.0:0.0	.	1431;1497;1431	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	L	1431	ENSP00000280333:V1431L	ENSP00000280333:V1431L	V	+	1	0	DOCK1	129099104	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.097000	0.64542	2.546000	0.85860	0.655000	0.94253	GTG	.	.	none		0.438	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
KRTAP10-2	386679	hgsc.bcm.edu	37	21	45970774	45970774	+	Missense_Mutation	SNP	G	G	A	rs76536096|rs67692969|rs71199610	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:45970774G>A	ENST00000391621.1	-	1	614	c.568C>T	c.(568-570)Cct>Tct	p.P190S	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron|KRTAP10-2_ENST00000498210.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2	190	22 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						CAGCAGACAGGCTTGCAGCAG	0.607																																					p.P190S		Atlas-SNP	.											.	KRTAP10-2	21	.	0			c.C568T						PASS	.						110.0	112.0	111.0					21																	45970774		2192	4279	6471	SO:0001583	missense	386679	exon1			AGACAGGCTTGCA	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.568C>T	21.37:g.45970774G>A	ENSP00000375479:p.Pro190Ser	95.0	0.0	0		201.0	12.0	0.0597015	NM_198693	Q70LJ5	Missense_Mutation	SNP	ENST00000391621.1	37	CCDS42955.1	.	.	.	.	.	.	.	.	.	.	g	9.523	1.108901	0.20714	.	.	ENSG00000205445	ENST00000391621	T	0.01705	4.68	3.28	0.222	0.15288	.	.	.	.	.	T	0.02083	0.0065	L	0.49455	1.56	0.09310	N	1	B	0.26672	0.156	B	0.24394	0.053	T	0.42310	-0.9459	9	0.62326	D	0.03	.	4.9369	0.13944	0.2108:0.1755:0.6137:0.0	.	190	P60368	KR102_HUMAN	S	190	ENSP00000375479:P190S	ENSP00000375479:P190S	P	-	1	0	KRTAP10-2	44795202	0.105000	0.21958	0.000000	0.03702	0.002000	0.02628	1.284000	0.33249	-0.177000	0.10690	0.462000	0.41574	CCT	G|0.917;A|0.083	0.083	strong		0.607	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128027.1		
DGKB	1607	hgsc.bcm.edu	37	7	14378196	14378196	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:14378196C>A	ENST00000403951.2	-	23	2488	c.2069G>T	c.(2068-2070)gGg>gTg	p.G690V	DGKB_ENST00000399322.3_Missense_Mutation_p.G690V|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000402815.1_Missense_Mutation_p.G689V|DGKB_ENST00000407950.1_Missense_Mutation_p.G682V|DGKB_ENST00000444700.2_Missense_Mutation_p.G671V|DGKB_ENST00000406247.3_Missense_Mutation_p.G690V|DGKB_ENST00000258767.5_Missense_Mutation_p.G690V			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	690					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.G690V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TTTGTCAGACCCTTTTTTCTC	0.398																																					p.G690V		Atlas-SNP	.											DGKB,NS,carcinoma,0,1	DGKB	166	1	1	Substitution - Missense(1)	lung(1)	c.G2069T						PASS	.						192.0	177.0	182.0					7																	14378196		1852	4091	5943	SO:0001583	missense	1607	exon22			TCAGACCCTTTTT	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2069G>T	7.37:g.14378196C>A	ENSP00000385780:p.Gly690Val	156.0	0.0	0		180.0	64.0	0.355556	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387379	0.25031	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.80480	-1.3;-1.3;-1.3;-1.3;-1.3;-1.29;-1.38	5.5	4.62	0.57501	Diacylglycerol kinase, accessory domain (2);	0.442134	0.23977	N	0.042716	T	0.65439	0.2691	N	0.17082	0.46	0.48975	D	0.999736	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.08055	0.003;0.002;0.002;0.0	T	0.58875	-0.7559	10	0.29301	T	0.29	.	10.1713	0.42911	0.0:0.8495:0.0:0.1505	.	689;671;690;690	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	V	690;690;690;689;682;671;690	ENSP00000385780:G690V;ENSP00000382260:G690V;ENSP00000258767:G690V;ENSP00000384909:G689V;ENSP00000385031:G682V;ENSP00000388451:G671V;ENSP00000386066:G690V	ENSP00000258767:G690V	G	-	2	0	DGKB	14344721	0.684000	0.27642	0.995000	0.50966	0.989000	0.77384	1.375000	0.34295	1.313000	0.45069	0.650000	0.86243	GGG	.	.	none		0.398	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
SUMO2	6613	hgsc.bcm.edu	37	17	73177275	73177275	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:73177275G>A	ENST00000420826.2	-	2	178	c.30C>T	c.(28-30)gtC>gtT	p.V10V	SUMO2_ENST00000578238.1_5'UTR|SUMO2_ENST00000314523.7_Silent_p.V10V	NM_006937.3	NP_008868.3			small ubiquitin-like modifier 2											NS(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					TCTCAGTCTTGACTCCTTCCT	0.378																																					p.V10V		Atlas-SNP	.											.	SUMO2	4	.	0			c.C30T						PASS	.						32.0	35.0	34.0					17																	73177275		2195	4297	6492	SO:0001819	synonymous_variant	6613	exon2			AGTCTTGACTCCT		CCDS45773.1, CCDS45774.1	17q25	2013-06-05	2013-06-05	2004-05-19	ENSG00000188612	ENSG00000188612			11125	protein-coding gene	gene with protein product		603042	"""SMT3 (suppressor of mif two 3, yeast) homolog 2"", ""SMT3 suppressor of mif two 3 homolog 2 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)"""	SMT3H2		8630065	Standard	NM_006937		Approved	SMT3B	uc002jne.3	P61956		ENST00000420826.2:c.30C>T	17.37:g.73177275G>A		131.0	0.0	0		115.0	60.0	0.521739	NM_006937		Silent	SNP	ENST00000420826.2	37	CCDS45774.1																																																																																			.	.	none		0.378	SUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446614.1	NM_006937	
PLXNA4	91584	hgsc.bcm.edu	37	7	132174144	132174144	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:132174144C>T	ENST00000359827.3	-	3	2240	c.1278G>A	c.(1276-1278)acG>acA	p.T426T	PLXNA4_ENST00000423507.2_Silent_p.T426T|PLXNA4_ENST00000321063.4_Silent_p.T426T|PLXNA4_ENST00000378539.5_Silent_p.T426T			Q9HCM2	PLXA4_HUMAN	plexin A4	426	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CCCTGTCCTCCGTGAAGACGG	0.512																																					p.T426T		Atlas-SNP	.											.	PLXNA4	873	.	0			c.G1278A						PASS	.						115.0	94.0	101.0					7																	132174144		2203	4300	6503	SO:0001819	synonymous_variant	91584	exon3			GTCCTCCGTGAAG	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1278G>A	7.37:g.132174144C>T		109.0	0.0	0		132.0	57.0	0.431818	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	37	CCDS43646.1																																																																																			.	.	none		0.512	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
SFSWAP	6433	hgsc.bcm.edu	37	12	132198771	132198771	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:132198771A>G	ENST00000261674.4	+	2	515	c.374A>G	c.(373-375)gAg>gGg	p.E125G	SFSWAP_ENST00000541286.1_Missense_Mutation_p.E125G	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	125					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						TTGCTTGAGGAGGAGGCAAGG	0.393																																					p.E125G		Atlas-SNP	.											.	SFSWAP	69	.	0			c.A374G						PASS	.						98.0	83.0	88.0					12																	132198771		2203	4300	6503	SO:0001583	missense	6433	exon2			TTGAGGAGGAGGC	U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.374A>G	12.37:g.132198771A>G	ENSP00000261674:p.Glu125Gly	59.0	0.0	0		92.0	4.0	0.0434783	NM_001261411	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	ENST00000261674.4	37	CCDS9273.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.400017	0.62177	.	.	ENSG00000061936	ENST00000261674;ENST00000544623;ENST00000541286	T;T	0.24538	1.85;1.85	5.84	4.68	0.58851	Splicing factor, suppressor of white apricot (1);	0.048341	0.85682	D	0.000000	T	0.53658	0.1810	M	0.85197	2.74	0.80722	D	1	P;P	0.41673	0.699;0.759	P;P	0.60609	0.565;0.877	T	0.57329	-0.7830	10	0.66056	D	0.02	-35.4576	13.2516	0.60055	0.8674:0.1325:0.0:0.0	.	125;125	F5H6B8;Q12872	.;SFSWA_HUMAN	G	125;62;125	ENSP00000261674:E125G;ENSP00000437738:E125G	ENSP00000261674:E125G	E	+	2	0	SFSWAP	130764724	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.361000	0.79497	1.017000	0.39495	0.533000	0.62120	GAG	.	.	none		0.393	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399276.1	NM_004592	
MLF1	4291	hgsc.bcm.edu	37	3	158289125	158289125	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:158289125C>T	ENST00000355893.5	+	1	174	c.36C>T	c.(34-36)gaC>gaT	p.D12D	MLF1_ENST00000469452.1_5'UTR|MLF1_ENST00000497004.1_3'UTR|MLF1_ENST00000392822.3_5'UTR|MLF1_ENST00000471745.1_5'UTR|MLF1_ENST00000484955.1_5'UTR|MLF1_ENST00000359117.5_5'UTR|RP11-538P18.2_ENST00000475981.1_RNA|MLF1_ENST00000478894.2_5'UTR|RP11-538P18.2_ENST00000479233.1_RNA|MLF1_ENST00000482628.1_5'UTR	NM_022443.4	NP_071888.1	P58340	MLF1_HUMAN	myeloid leukemia factor 1	12					cell cycle arrest (GO:0007050)|myeloid progenitor cell differentiation (GO:0002318)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)			large_intestine(3)	3		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			TTGAGGATGACCCCTTCTTCT	0.542			T	NPM1	AML																																p.D12D		Atlas-SNP	.		Dom	yes		3	3q25.1	4291	myeloid leukemia factor 1		L	.	MLF1	62	.	0			c.C36T						PASS	.						58.0	59.0	58.0					3																	158289125		2203	4300	6503	SO:0001819	synonymous_variant	4291	exon1			GGATGACCCCTTC	L49054	CCDS3182.1, CCDS46945.1, CCDS56286.1, CCDS56287.1, CCDS56288.1	3q25	2008-07-18			ENSG00000178053	ENSG00000178053			7125	protein-coding gene	gene with protein product	"""myeloid leukemia factor 1 variant 1"", ""myeloid leukemia factor 1 variant 2"", ""myeloid leukemia factor 1 variant 3"""	601402				8570204	Standard	NM_022443		Approved		uc003fcb.3	P58340	OTTHUMG00000158775	ENST00000355893.5:c.36C>T	3.37:g.158289125C>T		223.0	0.0	0		276.0	120.0	0.434783	NM_022443	E9PEU9|Q2TLE3|Q2TLE5|Q8N8F8|Q96MH1	Silent	SNP	ENST00000355893.5	37	CCDS3182.1	.	.	.	.	.	.	.	.	.	.	C	3.726	-0.056610	0.07362	.	.	ENSG00000178053	ENST00000498592	T	0.44083	0.93	4.0	-2.07	0.07276	.	.	.	.	.	T	0.47060	0.1425	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51942	-0.8641	6	0.87932	D	0	.	8.357	0.32335	0.0:0.3789:0.0:0.6211	.	.	.	.	I	2	ENSP00000419636:T2I	ENSP00000419636:T2I	T	+	2	0	MLF1	159771819	0.450000	0.25697	0.841000	0.33234	0.072000	0.16883	-1.082000	0.03400	-0.346000	0.08312	-0.379000	0.06801	ACC	.	.	none		0.542	MLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352164.3	NM_022443	
DGKB	1607	hgsc.bcm.edu	37	7	14217692	14217692	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:14217692C>A	ENST00000403951.2	-	24	2629	c.2210G>T	c.(2209-2211)gGc>gTc	p.G737V	DGKB_ENST00000399322.3_Missense_Mutation_p.G737V|DGKB_ENST00000402815.1_Missense_Mutation_p.G736V|DGKB_ENST00000407950.1_Missense_Mutation_p.G729V|DGKB_ENST00000444700.2_Missense_Mutation_p.G718V|DGKB_ENST00000406247.3_Missense_Mutation_p.G737V|DGKB_ENST00000258767.5_Missense_Mutation_p.G737V			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	737					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.G737V(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						CAGCCGCCGGCCAGCACTTTT	0.502																																					p.G737V		Atlas-SNP	.											DGKB,NS,carcinoma,0,1	DGKB	166	1	1	Substitution - Missense(1)	lung(1)	c.G2210T						PASS	.						62.0	71.0	68.0					7																	14217692		2108	4277	6385	SO:0001583	missense	1607	exon23			CGCCGGCCAGCAC	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.2210G>T	7.37:g.14217692C>A	ENSP00000385780:p.Gly737Val	62.0	0.0	0		48.0	17.0	0.354167	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	37	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637047	0.87760	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.8	5.8	0.92144	Diacylglycerol kinase, accessory domain (2);	0.000000	0.85682	D	0.000000	T	0.75133	0.3808	M	0.93241	3.395	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.79108	0.991;0.99;0.987;0.992	T	0.81297	-0.0996	10	0.87932	D	0	.	19.6455	0.95775	0.0:1.0:0.0:0.0	.	736;718;737;737	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	V	737;737;737;736;729;718;737	ENSP00000385780:G737V;ENSP00000382260:G737V;ENSP00000258767:G737V;ENSP00000384909:G736V;ENSP00000385031:G729V;ENSP00000388451:G718V;ENSP00000386066:G737V	ENSP00000258767:G737V	G	-	2	0	DGKB	14184217	1.000000	0.71417	0.994000	0.49952	0.937000	0.57800	5.812000	0.69194	2.739000	0.93911	0.561000	0.74099	GGC	.	.	none		0.502	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
RP1L1	94137	hgsc.bcm.edu	37	8	10470003	10470003	+	Silent	SNP	C	C	T	rs200772091		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:10470003C>T	ENST00000382483.3	-	4	1828	c.1605G>A	c.(1603-1605)tcG>tcA	p.S535S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	535					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGCTGGCTGACGAGTCCGAAG	0.692																																					p.S535S		Atlas-SNP	.											.	RP1L1	453	.	0			c.G1605A						PASS	.	C		0,4096		0,0,2048	39.0	47.0	45.0		1605	-5.8	0.0	8		45	2,8346		0,2,4172	no	coding-synonymous	RP1L1	NM_178857.5		0,2,6220	TT,TC,CC		0.024,0.0,0.0161		535/2401	10470003	2,12442	2048	4174	6222	SO:0001819	synonymous_variant	94137	exon4			GGCTGACGAGTCC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1605G>A	8.37:g.10470003C>T		42.0	0.0	0		38.0	13.0	0.342105	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	ENST00000382483.3	37	CCDS43708.1																																																																																			C|0.999;T|0.001	0.001	weak		0.692	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
TESK1	7016	hgsc.bcm.edu	37	9	35608460	35608460	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr9:35608460G>A	ENST00000336395.5	+	9	1204	c.954G>A	c.(952-954)ctG>ctA	p.L318L	CD72_ENST00000490239.1_5'Flank|TESK1_ENST00000498522.1_3'UTR|MIR4667_ENST00000578933.1_RNA	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	318					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGGAGCAGCTGCCTGAGCCAG	0.587																																					p.L318L		Atlas-SNP	.											TESK1,NS,neuroblastoma,0,1	TESK1	46	1	0			c.G954A						PASS	.						57.0	54.0	55.0					9																	35608460		2203	4300	6503	SO:0001819	synonymous_variant	7016	exon9			GCAGCTGCCTGAG	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.954G>A	9.37:g.35608460G>A		60.0	0.0	0		68.0	30.0	0.441176	NM_006285	Q8IXZ8	Silent	SNP	ENST00000336395.5	37	CCDS6580.1																																																																																			.	.	none		0.587	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052314.1	NM_006285	
SULT1A1	6817	hgsc.bcm.edu	37	16	28618318	28618318	+	Missense_Mutation	SNP	C	C	G	rs1042014	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:28618318C>G	ENST00000395607.1	-	5	726	c.453G>C	c.(451-453)gaG>gaC	p.E151D	SULT1A1_ENST00000569554.1_Missense_Mutation_p.E151D|SULT1A1_ENST00000395609.1_Missense_Mutation_p.E151D|SULT1A1_ENST00000350842.4_Missense_Mutation_p.E73D|SULT1A1_ENST00000314752.7_Missense_Mutation_p.E151D	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	151			E -> D (in dbSNP:rs1042014).|E -> Q (in dbSNP:rs1042011).		3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	AGGTCCCAGGCTCAGGGTGCA	0.562																																					p.E151D		Atlas-SNP	.											.	SULT1A1	53	.	0			c.G453C						PASS	.						226.0	167.0	187.0					16																	28618318		2197	4300	6497	SO:0001583	missense	6817	exon4			CCCAGGCTCAGGG	U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.453G>C	16.37:g.28618318C>G	ENSP00000378971:p.Glu151Asp	239.0	0.0	0		393.0	248.0	0.631043	NM_177534	Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	ENST00000395607.1	37	CCDS32420.1	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.097513	0.00360	.	.	ENSG00000196502	ENST00000314752;ENST00000350842;ENST00000395609;ENST00000395607	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	2.42	-4.84	0.03151	Sulfotransferase domain (1);	0.388985	0.26345	N	0.024915	T	0.44808	0.1311	N	0.02345	-0.59	0.22034	N	0.999403	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.55354	-0.8154	10	0.02654	T	1	.	0.2745	0.00236	0.3382:0.2548:0.1587:0.2483	rs1042014;rs1042014	103;73;151	Q59GG0;P50225-2;P50225	.;.;ST1A1_HUMAN	D	151;73;151;151	ENSP00000321988:E151D;ENSP00000329399:E73D;ENSP00000378972:E151D;ENSP00000378971:E151D	ENSP00000321988:E151D	E	-	3	2	SULT1A1	28525819	0.000000	0.05858	0.817000	0.32601	0.539000	0.34962	-2.571000	0.00913	-2.066000	0.00886	-0.840000	0.03056	GAG	C|0.970;G|0.030	0.030	strong		0.562	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254694.2	NM_001055	
RPUSD4	84881	hgsc.bcm.edu	37	11	126075445	126075445	+	Silent	SNP	C	C	T	rs201545291		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:126075445C>T	ENST00000298317.4	-	5	767	c.714G>A	c.(712-714)cgG>cgA	p.R238R	RPUSD4_ENST00000533628.1_Intron|RPUSD4_ENST00000534393.1_5'Flank	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	238					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		CTTGCGCATTCCGGCTGCGCC	0.537																																					p.R238R		Atlas-SNP	.											.	RPUSD4	36	.	0			c.G714A						PASS	.						137.0	123.0	128.0					11																	126075445		2201	4299	6500	SO:0001819	synonymous_variant	84881	exon5			CGCATTCCGGCTG	BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.714G>A	11.37:g.126075445C>T		111.0	0.0	0		226.0	63.0	0.278761	NM_032795	E9PML2|Q96K56	Silent	SNP	ENST00000298317.4	37	CCDS8469.1																																																																																			C|0.999;A|0.001	.	alt		0.537	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386336.1	NM_032795	
HIAT1	64645	hgsc.bcm.edu	37	1	100547630	100547630	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:100547630G>A	ENST00000370152.3	+	12	1474	c.1338G>A	c.(1336-1338)ttG>ttA	p.L446L	SASS6_ENST00000462159.1_5'Flank|RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	446					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TTGTTGCCTTGTTTATTCCGG	0.463																																					p.L446L		Atlas-SNP	.											.	HIAT1	46	.	0			c.G1338A						PASS	.						109.0	100.0	103.0					1																	100547630		2203	4300	6503	SO:0001819	synonymous_variant	64645	exon12			TGCCTTGTTTATT	AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.1338G>A	1.37:g.100547630G>A		214.0	0.0	0		257.0	112.0	0.435798	NM_033055	Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Silent	SNP	ENST00000370152.3	37	CCDS763.1																																																																																			.	.	none		0.463	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029657.1	NM_033055	
MUC4	4585	hgsc.bcm.edu	37	3	195506555	195506555	+	Missense_Mutation	SNP	C	C	T	rs368695884	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:195506555C>T	ENST00000463781.3	-	2	12355	c.11896G>A	c.(11896-11898)Gcc>Acc	p.A3966T	MUC4_ENST00000475231.1_Missense_Mutation_p.A3966T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.A3966T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGAGGTGGCGTGACCTGTG	0.592													.|||	176	0.0351438	0.0083	0.0677	5008	,	,		7977	0.0119		0.0915	False		,,,				2504	0.0143				p.A3966T		Atlas-SNP	.											MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.G11896A						scavenged	.						15.0	10.0	11.0					3																	195506555		666	1488	2154	SO:0001583	missense	4585	exon2			AGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11896G>A	3.37:g.195506555C>T	ENSP00000417498:p.Ala3966Thr	35.0	2.0	0.0571429		44.0	8.0	0.181818	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.905	-0.721125	0.03182	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.48522	1.23;0.81	.	.	.	.	.	.	.	.	T	0.22551	0.0544	N	0.19112	0.55	0.09310	N	1	B	0.18741	0.03	B	0.06405	0.002	T	0.12915	-1.0529	7	.	.	.	-3.1782	2.1866	0.03888	0.0:0.3341:0.3337:0.3322	.	3838	E7ESK3	.	T	3966	ENSP00000417498:A3966T;ENSP00000420243:A3966T	.	A	-	1	0	MUC4	196991334	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.202000	0.09451	-2.037000	0.00920	-2.088000	0.00374	GCC	.	.	weak		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
P2RY8	286530	hgsc.bcm.edu	37	X	1585400	1585400	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chrX:1585400G>A	ENST00000381297.4	-	2	262	c.52C>T	c.(52-54)Cgg>Tgg	p.R18W	P2RY8_ENST00000460672.1_5'UTR	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCGGGTTCCGCAGCATCTGC	0.697			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.R18W		Atlas-SNP	.		Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	P2RY8	53	.	0			c.C52T						PASS	.						32.0	37.0	36.0					X																	1585400		2203	4294	6497	SO:0001583	missense	286530	exon2			GGTTCCGCAGCAT	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.52C>T	X.37:g.1585400G>A	ENSP00000370697:p.Arg18Trp	32.0	0.0	0		52.0	44.0	0.846154	NM_178129		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	g	7.771	0.707456	0.15239	.	.	ENSG00000182162	ENST00000381297	T	0.37752	1.18	1.87	-1.37	0.09056	.	1.062470	0.07489	U	0.905207	T	0.21103	0.0508	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	P	0.46629	0.522	T	0.25502	-1.0130	10	0.66056	D	0.02	.	5.9234	0.19094	0.0:0.2784:0.4476:0.274	.	18	Q86VZ1	P2RY8_HUMAN	W	18	ENSP00000370697:R18W	ENSP00000370697:R18W	R	-	1	2	P2RY8	1545400	0.008000	0.16893	0.082000	0.20525	0.013000	0.08279	0.872000	0.28037	0.473000	0.27368	0.279000	0.19357	CGG	.	.	none		0.697	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055602.1	NM_178129	
NPLOC4	55666	hgsc.bcm.edu	37	17	79532602	79532602	+	Missense_Mutation	SNP	C	C	T	rs371370139		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:79532602C>T	ENST00000331134.6	-	16	1813	c.1598G>A	c.(1597-1599)cGg>cAg	p.R533Q	NPLOC4_ENST00000374747.5_Missense_Mutation_p.R533Q|NPLOC4_ENST00000539314.1_Missense_Mutation_p.R372Q|NPLOC4_ENST00000572760.1_5'UTR|NPLOC4_ENST00000573876.1_5'UTR	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	533					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ATTTCTGGTCCGCACGGCCTC	0.597																																					p.R533Q		Atlas-SNP	.											.	NPLOC4	27	.	0			c.G1598A						PASS	.	C	GLN/ARG	0,4110		0,0,2055	16.0	20.0	19.0		1598	5.0	0.9	17		19	1,8323		0,1,4161	no	missense	NPLOC4	NM_017921.2	43	0,1,6216	TT,TC,CC		0.012,0.0,0.0080	possibly-damaging	533/609	79532602	1,12433	2055	4162	6217	SO:0001583	missense	55666	exon16			CTGGTCCGCACGG	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1598G>A	17.37:g.79532602C>T	ENSP00000331487:p.Arg533Gln	34.0	0.0	0		32.0	4.0	0.125	NM_017921	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	ENST00000331134.6	37	CCDS45812.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350695	0.41599	0.0	1.2E-4	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.02	5.02	0.67125	Nuclear pore localisation protein NPL4 (1);	0.095949	0.64402	D	0.000002	T	0.62258	0.2413	M	0.70787	2.145	0.53005	D	0.999964	P;D;P	0.52996	0.636;0.957;0.894	B;B;P	0.44897	0.354;0.424;0.463	T	0.64909	-0.6296	9	0.36615	T	0.2	-33.3332	18.5911	0.91212	0.0:1.0:0.0:0.0	.	372;533;533	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	Q	533;532;372	.	ENSP00000331487:R533Q	R	-	2	0	NPLOC4	77143044	1.000000	0.71417	0.944000	0.38274	0.130000	0.20726	3.250000	0.51445	2.628000	0.89032	0.650000	0.86243	CGG	.	.	weak		0.597	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1		
TROAP	10024	hgsc.bcm.edu	37	12	49724403	49724403	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:49724403A>G	ENST00000257909.3	+	13	1851	c.1775A>G	c.(1774-1776)tAc>tGc	p.Y592C	TROAP_ENST00000551245.1_Missense_Mutation_p.Y592C|TROAP_ENST00000547923.1_Intron	NM_005480.3	NP_005471.3	Q12815	TROAP_HUMAN	trophinin associated protein	592	4 X 33 AA approximate tandem repeats.|Cys-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	32						CTAGAGTCCTACTGTAGGATT	0.617																																					p.Y592C		Atlas-SNP	.											TROAP,bladder,carcinoma,0,3	TROAP	80	3	0			c.A1775G						scavenged	.						72.0	70.0	71.0					12																	49724403		2203	4300	6503	SO:0001583	missense	10024	exon13			AGTCCTACTGTAG	U04810	CCDS8784.1, CCDS41779.1, CCDS61117.1	12q13.12	2012-10-17	2012-10-17		ENSG00000135451	ENSG00000135451			12327	protein-coding gene	gene with protein product	"""tastin"""	603872				7758945	Standard	NM_005480		Approved	TASTIN	uc001rtx.4	Q12815	OTTHUMG00000169486	ENST00000257909.3:c.1775A>G	12.37:g.49724403A>G	ENSP00000257909:p.Tyr592Cys	157.0	1.0	0.00636943		321.0	16.0	0.0498442	NM_005480	F8VSF9|Q6PJU7|Q8N5B2	Missense_Mutation	SNP	ENST00000257909.3	37	CCDS8784.1	.	.	.	.	.	.	.	.	.	.	a	5.880	0.346480	0.11126	.	.	ENSG00000135451	ENST00000551245;ENST00000257909	.	.	.	3.34	-3.85	0.04243	.	1.490010	0.03952	N	0.288732	T	0.09069	0.0224	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18272	-1.0342	9	0.28530	T	0.3	7.0657	4.9225	0.13876	0.4025:0.2764:0.321:0.0	.	592;592	F8W130;Q12815	.;TROAP_HUMAN	C	592	.	ENSP00000257909:Y592C	Y	+	2	0	TROAP	48010670	0.904000	0.30761	0.000000	0.03702	0.008000	0.06430	-0.239000	0.08965	-0.648000	0.05437	-1.237000	0.01550	TAC	.	.	none		0.617	TROAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404300.1	NM_005480	
RABL3	285282	hgsc.bcm.edu	37	3	120409318	120409318	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:120409318T>C	ENST00000273375.3	-	7	652	c.623A>G	c.(622-624)tAc>tGc	p.Y208C	RABL3_ENST00000491398.1_5'UTR|RABL3_ENST00000483733.1_Missense_Mutation_p.Y184C	NM_173825.3	NP_776186.2	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	208	Small GTPase-like.				small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)	17				GBM - Glioblastoma multiforme(114;0.151)		TCTTAAAAAGTATCTCTTCTC	0.323																																					p.Y208C		Atlas-SNP	.											.	RABL3	23	.	0			c.A623G						PASS	.						40.0	43.0	42.0					3																	120409318		2199	4290	6489	SO:0001583	missense	285282	exon7			AAAAAGTATCTCT	BC020832	CCDS3001.1	3q13.33	2008-02-05			ENSG00000144840	ENSG00000144840			18072	protein-coding gene	gene with protein product						12477932	Standard	NM_173825		Approved	MGC23920	uc003edx.3	Q5HYI8	OTTHUMG00000159668	ENST00000273375.3:c.623A>G	3.37:g.120409318T>C	ENSP00000273375:p.Tyr208Cys	199.0	0.0	0		237.0	102.0	0.43038	NM_173825	Q8WUD3	Missense_Mutation	SNP	ENST00000273375.3	37	CCDS3001.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.338274	0.81911	.	.	ENSG00000144840	ENST00000273375;ENST00000483733	T;T	0.74737	-0.58;-0.87	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.69459	0.3113	N	0.08118	0	0.80722	D	1	D	0.64830	0.994	P	0.57371	0.819	T	0.75184	-0.3407	10	0.52906	T	0.07	-7.5345	14.2018	0.65710	0.0:0.0:0.0:1.0	.	208	Q5HYI8	RABL3_HUMAN	C	208;184	ENSP00000273375:Y208C;ENSP00000419986:Y184C	ENSP00000273375:Y208C	Y	-	2	0	RABL3	121892008	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.258000	0.78371	2.288000	0.76882	0.533000	0.62120	TAC	.	.	none		0.323	RABL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356776.1	NM_173825	
BMP2	650	hgsc.bcm.edu	37	20	6750880	6750880	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:6750880C>T	ENST00000378827.4	+	2	1326	c.107C>T	c.(106-108)gCg>gTg	p.A36V		NM_001200.2	NP_001191.1	P12643	BMP2_HUMAN	bone morphogenetic protein 2	36					activation of MAPK activity (GO:0000187)|atrioventricular valve morphogenesis (GO:0003181)|BMP signaling pathway (GO:0030509)|BMP signaling pathway involved in heart induction (GO:0003130)|bone mineralization (GO:0030282)|bone mineralization involved in bone maturation (GO:0035630)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiocyte differentiation (GO:0035051)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation (GO:0002062)|corticotropin hormone secreting cell differentiation (GO:0060128)|embryo development (GO:0009790)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesenchyme development (GO:0060485)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of calcium-independent cell-cell adhesion (GO:0051042)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of steroid biosynthetic process (GO:0010894)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|pericardium development (GO:0060039)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of odontogenesis (GO:0042482)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of phosphatase activity (GO:0010922)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of Wnt signaling pathway by BMP signaling pathway (GO:0060804)|protein destabilization (GO:0031648)|protein phosphorylation (GO:0006468)|proteoglycan metabolic process (GO:0006029)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|telencephalon development (GO:0021537)|telencephalon regionalization (GO:0021978)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP receptor binding (GO:0070700)|phosphatase activator activity (GO:0019211)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)|retinol dehydrogenase activity (GO:0004745)|SMAD binding (GO:0046332)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	13						TTCGCGGCGGCGTCGTCGGGC	0.697																																					p.A36V		Atlas-SNP	.											.	BMP2	45	.	0			c.C107T						PASS	.						16.0	18.0	17.0					20																	6750880		2198	4294	6492	SO:0001583	missense	650	exon2			CGGCGGCGTCGTC		CCDS13099.1	20p12	2014-01-30			ENSG00000125845	ENSG00000125845		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1069	protein-coding gene	gene with protein product		112261		BMP2A		2376592	Standard	NM_001200		Approved		uc002wmu.1	P12643	OTTHUMG00000031833	ENST00000378827.4:c.107C>T	20.37:g.6750880C>T	ENSP00000368104:p.Ala36Val	27.0	0.0	0		43.0	14.0	0.325581	NM_001200		Missense_Mutation	SNP	ENST00000378827.4	37	CCDS13099.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860846	0.32884	.	.	ENSG00000125845	ENST00000378827	T	0.72394	-0.65	5.02	5.02	0.67125	.	0.340113	0.31199	N	0.008078	T	0.50017	0.1591	N	0.08118	0	0.22446	N	0.999094	B	0.28820	0.224	B	0.18263	0.021	T	0.40905	-0.9538	10	0.31617	T	0.26	.	16.1926	0.82004	0.0:1.0:0.0:0.0	.	36	P12643	BMP2_HUMAN	V	36	ENSP00000368104:A36V	ENSP00000368104:A36V	A	+	2	0	BMP2	6698880	0.348000	0.24861	0.012000	0.15200	0.042000	0.13812	5.100000	0.64560	2.466000	0.83321	0.460000	0.39030	GCG	.	.	none		0.697	BMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077918.3		
AMOTL1	154810	hgsc.bcm.edu	37	11	94583290	94583290	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:94583290T>G	ENST00000433060.2	+	7	1801	c.1660T>G	c.(1660-1662)Ttg>Gtg	p.L554V	AMOTL1_ENST00000317837.9_Intron|AMOTL1_ENST00000317829.8_Missense_Mutation_p.L504V	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	554					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CAAAGAATTCTTGAAGGAAAA	0.468																																					p.L554V		Atlas-SNP	.											.	AMOTL1	95	.	0			c.T1660G						PASS	.						27.0	29.0	28.0					11																	94583290		1959	4155	6114	SO:0001583	missense	154810	exon7			GAATTCTTGAAGG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.1660T>G	11.37:g.94583290T>G	ENSP00000387739:p.Leu554Val	34.0	0.0	0		89.0	22.0	0.247191	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	T	7.496	0.651759	0.14516	.	.	ENSG00000166025	ENST00000317829;ENST00000542840;ENST00000433060	T;T	0.21543	2.0;2.0	5.82	-0.383	0.12477	.	0.000000	0.64402	D	0.000019	T	0.20536	0.0494	L	0.43152	1.355	0.80722	D	1	B;B	0.32302	0.363;0.024	B;B	0.42030	0.373;0.044	T	0.04737	-1.0930	10	0.23302	T	0.38	-15.6535	10.8757	0.46909	0.0:0.3874:0.0:0.6126	.	504;554	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	V	504;560;554	ENSP00000320968:L504V;ENSP00000387739:L554V	ENSP00000320968:L504V	L	+	1	2	AMOTL1	94222938	0.999000	0.42202	0.989000	0.46669	0.903000	0.53119	0.533000	0.23082	-0.318000	0.08665	-0.250000	0.11733	TTG	.	.	none		0.468	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
EBF3	253738	hgsc.bcm.edu	37	10	131761680	131761680	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:131761680G>A	ENST00000355311.5	-	2	314	c.242C>T	c.(241-243)cCg>cTg	p.P81L	EBF3_ENST00000368648.3_Missense_Mutation_p.P81L			Q9H4W6	COE3_HUMAN	early B-cell factor 3	81					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		AATCTCCACCGGCTGCCCCTG	0.557																																					p.P81L		Atlas-SNP	.											EBF3_ENST00000355311,NS,carcinoma,+1,2	EBF3	193	2	0			c.C242T						scavenged	.						70.0	78.0	75.0					10																	131761680		2203	4300	6503	SO:0001583	missense	253738	exon2			TCCACCGGCTGCC		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.242C>T	10.37:g.131761680G>A	ENSP00000347463:p.Pro81Leu	127.0	1.0	0.00787402		142.0	65.0	0.457746	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	ENST00000355311.5	37		.	.	.	.	.	.	.	.	.	.	G	19.06	3.754033	0.69648	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.52754	0.65;0.66	3.45	3.45	0.39498	.	0.000000	0.85682	U	0.000000	T	0.67078	0.2855	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.971	T	0.71111	-0.4687	10	0.51188	T	0.08	-6.4879	14.5175	0.67827	0.0:0.0:1.0:0.0	.	81;81	Q9H4W6;Q9H4W6-2	COE3_HUMAN;.	L	81	ENSP00000347463:P81L;ENSP00000357637:P81L	ENSP00000347463:P81L	P	-	2	0	EBF3	131651670	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.831000	0.92068	1.453000	0.47775	0.205000	0.17691	CCG	.	.	none		0.557	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
WT1	7490	hgsc.bcm.edu	37	11	32456397	32456397	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:32456397G>A	ENST00000332351.3	-	1	779	c.495C>T	c.(493-495)tcC>tcT	p.S165S	WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1_ENST00000448076.3_Silent_p.S165S|WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000459866.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	97					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGAACTGGCCGGAAAAGTGGA	0.682			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.S165S		Atlas-SNP	.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1	744	.	0			c.C495T						PASS	.						17.0	19.0	18.0					11																	32456397		2198	4292	6490	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	CTGGCCGGAAAAG		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.495C>T	11.37:g.32456397G>A		90.0	0.0	0		109.0	41.0	0.376147	NM_024424	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			.	.	none		0.682	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
ARAP3	64411	hgsc.bcm.edu	37	5	141033945	141033945	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:141033945A>G	ENST00000239440.4	-	33	4272	c.4207T>C	c.(4207-4209)Tac>Cac	p.Y1403H	ARAP3_ENST00000508305.1_Missense_Mutation_p.Y1234H|ARAP3_ENST00000512390.1_5'UTR|FCHSD1_ENST00000519800.1_5'Flank|FCHSD1_ENST00000435817.2_5'Flank|ARAP3_ENST00000513878.1_Missense_Mutation_p.Y1052H	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1403					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GGCTCCTCGTACACAGGCTCC	0.552																																					p.Y1403H		Atlas-SNP	.											.	ARAP3	139	.	0			c.T4207C						PASS	.						96.0	97.0	97.0					5																	141033945		2203	4300	6503	SO:0001583	missense	64411	exon33			CCTCGTACACAGG	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.4207T>C	5.37:g.141033945A>G	ENSP00000239440:p.Tyr1403His	69.0	0.0	0		78.0	36.0	0.461538	NM_022481	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	A	13.65	2.300151	0.40694	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	T;T;T	0.14516	2.5;3.2;3.05	3.92	3.92	0.45320	.	0.405610	0.23234	N	0.050433	T	0.18882	0.0453	N	0.24115	0.695	0.34030	D	0.65374	D;D;D	0.69078	0.995;0.997;0.995	D;D;D	0.75484	0.969;0.986;0.969	T	0.13629	-1.0502	10	0.20046	T	0.44	.	9.4487	0.38712	1.0:0.0:0.0:0.0	.	1052;1234;1403	B4DIT1;G5E9Y3;Q8WWN8	.;.;ARAP3_HUMAN	H	1234;1403;1052	ENSP00000421826:Y1234H;ENSP00000239440:Y1403H;ENSP00000421468:Y1052H	ENSP00000239440:Y1403H	Y	-	1	0	ARAP3	141014129	0.997000	0.39634	0.998000	0.56505	0.502000	0.33828	2.505000	0.45424	1.983000	0.57843	0.482000	0.46254	TAC	.	.	none		0.552	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
NCAM2	4685	hgsc.bcm.edu	37	21	22656612	22656612	+	Missense_Mutation	SNP	C	C	T	rs576610818		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr21:22656612C>T	ENST00000400546.1	+	3	478	c.229C>T	c.(229-231)Cgg>Tgg	p.R77W	NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000535285.1_Missense_Mutation_p.R102W	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	77	Ig-like C2-type 1.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R77G(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGTTAGGTCACGGTTAACCAT	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		13851	0.0		0.0	False		,,,				2504	0.001				p.R77W		Atlas-SNP	.											NCAM2,colon,carcinoma,0,2	NCAM2	220	2	1	Substitution - Missense(1)	lung(1)	c.C229T						PASS	.						124.0	117.0	119.0					21																	22656612		1886	4109	5995	SO:0001583	missense	4685	exon3			AGGTCACGGTTAA		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.229C>T	21.37:g.22656612C>T	ENSP00000383392:p.Arg77Trp	83.0	0.0	0		130.0	31.0	0.238462	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	C	15.56	2.868687	0.51588	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	T;T	0.68479	-0.33;-0.33	5.58	2.61	0.31194	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.167812	0.49916	D	0.000140	T	0.46814	0.1412	N	0.26162	0.8	0.49130	D	0.999757	P;P	0.49253	0.921;0.921	B;B	0.38458	0.274;0.274	T	0.32903	-0.9889	10	0.44086	T	0.13	-14.5846	7.7334	0.28799	0.4708:0.4548:0.0:0.0744	.	102;77	B7Z841;O15394	.;NCAM2_HUMAN	W	77;102	ENSP00000383392:R77W;ENSP00000441887:R102W	ENSP00000383392:R77W	R	+	1	2	NCAM2	21578483	0.379000	0.25123	0.999000	0.59377	0.990000	0.78478	0.230000	0.17852	0.230000	0.21059	0.591000	0.81541	CGG	.	.	none		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
IRF4	3662	hgsc.bcm.edu	37	6	393224	393224	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:393224C>T	ENST00000380956.4	+	2	198	c.72C>T	c.(70-72)ctC>ctT	p.L24L	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	24					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ACGGGAAGCTCCGCCAGTGGC	0.701			T	IGH@	MM																																p.L24L		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.C72T						PASS	.						31.0	32.0	32.0					6																	393224		2192	4288	6480	SO:0001819	synonymous_variant	3662	exon2			GAAGCTCCGCCAG	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.72C>T	6.37:g.393224C>T		84.0	0.0	0		124.0	46.0	0.370968	NM_001195286	Q5VUI7|Q99660	Silent	SNP	ENST00000380956.4	37	CCDS4469.1																																																																																			.	.	none		0.701	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
ADAMTS7	11173	hgsc.bcm.edu	37	15	79066981	79066981	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:79066981G>C	ENST00000388820.4	-	12	2071	c.1861C>G	c.(1861-1863)Ccc>Gcc	p.P621A	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	621	Cys-rich.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TTGACCACGGGCACCCATGTG	0.632																																					p.P621A		Atlas-SNP	.											.	ADAMTS7	142	.	0			c.C1861G						PASS	.						56.0	54.0	55.0					15																	79066981		2196	4293	6489	SO:0001583	missense	11173	exon12			CCACGGGCACCCA	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1861C>G	15.37:g.79066981G>C	ENSP00000373472:p.Pro621Ala	75.0	0.0	0		51.0	25.0	0.490196	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505696	0.26949	.	.	ENSG00000136378	ENST00000388820	T	0.00428	7.44	3.61	3.61	0.41365	.	0.145698	0.47852	D	0.000209	T	0.00468	0.0015	M	0.64676	1.99	0.35073	D	0.762647	B;B	0.32071	0.355;0.189	B;B	0.32211	0.142;0.077	T	0.64415	-0.6413	10	0.59425	D	0.04	.	14.4931	0.67665	0.0:0.0:1.0:0.0	.	621;621	A8MQ00;Q9UKP4	.;ATS7_HUMAN	A	621	ENSP00000373472:P621A	ENSP00000373472:P621A	P	-	1	0	ADAMTS7	76854036	1.000000	0.71417	0.960000	0.40013	0.885000	0.51271	4.864000	0.62990	2.044000	0.60594	0.289000	0.19496	CCC	.	.	none		0.632	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
RP1	6101	hgsc.bcm.edu	37	8	55534023	55534023	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:55534023C>T	ENST00000220676.1	+	2	645	c.497C>T	c.(496-498)aCg>aTg	p.T166M		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	166	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)	p.T166M(1)		NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GACCCGAAGACGAGGCGTGCG	0.642																																					p.T166M	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											RP1,NS,carcinoma,0,1	RP1	429	1	1	Substitution - Missense(1)	lung(1)	c.C497T						PASS	.						83.0	85.0	84.0					8																	55534023		2203	4300	6503	SO:0001583	missense	6101	exon2			CGAAGACGAGGCG	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.497C>T	8.37:g.55534023C>T	ENSP00000220676:p.Thr166Met	163.0	0.0	0		212.0	91.0	0.429245	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	37	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709586	0.30322	.	.	ENSG00000104237	ENST00000220676	D	0.86562	-2.14	5.14	1.26	0.21427	Doublecortin domain (4);	0.635417	0.14570	N	0.311486	T	0.72930	0.3522	L	0.38175	1.15	0.09310	N	1	P	0.47604	0.898	B	0.30029	0.11	T	0.65496	-0.6154	10	0.62326	D	0.03	6.4508	4.3984	0.11374	0.1478:0.4103:0.0:0.4419	.	166	P56715	RP1_HUMAN	M	166	ENSP00000220676:T166M	ENSP00000220676:T166M	T	+	2	0	RP1	55696576	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.109000	0.15417	-0.050000	0.13356	0.650000	0.86243	ACG	.	.	none		0.642	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
SMCR8	140775	hgsc.bcm.edu	37	17	18220270	18220270	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:18220270A>G	ENST00000406438.3	+	1	1647	c.1167A>G	c.(1165-1167)atA>atG	p.I389M	TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000582230.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	389						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						AAGAAAGCATACCCTCTAAGC	0.423																																					p.I389M		Atlas-SNP	.											.	SMCR8	62	.	0			c.A1167G						PASS	.						117.0	113.0	114.0					17																	18220270		2203	4300	6503	SO:0001583	missense	140775	exon1			AAGCATACCCTCT	AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.1167A>G	17.37:g.18220270A>G	ENSP00000385025:p.Ile389Met	115.0	0.0	0		137.0	6.0	0.0437956	NM_144775	A5PKZ5|Q3ZCN0|Q6PJL3	Missense_Mutation	SNP	ENST00000406438.3	37	CCDS11195.2	.	.	.	.	.	.	.	.	.	.	A	1.223	-0.626275	0.03610	.	.	ENSG00000176994	ENST00000406438	T	0.22134	1.97	5.9	-10.4	0.00318	.	1.175130	0.06061	N	0.658377	T	0.05640	0.0148	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36456	-0.9747	10	0.30854	T	0.27	-20.6322	6.4044	0.21656	0.1744:0.1901:0.4992:0.1362	.	389	Q8TEV9	SMCR8_HUMAN	M	389	ENSP00000385025:I389M	ENSP00000385025:I389M	I	+	3	3	SMCR8	18160995	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-0.920000	0.04013	-1.650000	0.01506	-0.263000	0.10527	ATA	.	.	none		0.423	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132065.2	NM_144775	
FAM43A	131583	hgsc.bcm.edu	37	3	194408350	194408350	+	Silent	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:194408350G>A	ENST00000329759.4	+	1	1729	c.795G>A	c.(793-795)gaG>gaA	p.E265E		NM_153690.4	NP_710157.2	Q8N2R8	FA43A_HUMAN	family with sequence similarity 43, member A	265										breast(2)|central_nervous_system(1)|lung(6)|skin(1)	10	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		TGGAGCAGGAGCTGCAGGAGG	0.677																																					p.E265E		Atlas-SNP	.											.	FAM43A	24	.	0			c.G795A						PASS	.						15.0	18.0	17.0					3																	194408350		2194	4293	6487	SO:0001819	synonymous_variant	131583	exon1			GCAGGAGCTGCAG	AK074503	CCDS33923.1	3q29	2004-07-28			ENSG00000185112	ENSG00000185112			26888	protein-coding gene	gene with protein product						12477932	Standard	NM_153690		Approved	FLJ90022	uc003fuj.3	Q8N2R8	OTTHUMG00000156016	ENST00000329759.4:c.795G>A	3.37:g.194408350G>A		121.0	0.0	0		183.0	88.0	0.480874	NM_153690	A3KME2|Q8IXP4|Q8WZ07	Silent	SNP	ENST00000329759.4	37	CCDS33923.1																																																																																			.	.	none		0.677	FAM43A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342734.1	NM_153690	
COL11A1	1301	hgsc.bcm.edu	37	1	103484376	103484376	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:103484376C>T	ENST00000370096.3	-	10	1660	c.1348G>A	c.(1348-1350)Gca>Aca	p.A450T	COL11A1_ENST00000358392.2_Missense_Mutation_p.A462T|COL11A1_ENST00000512756.1_Missense_Mutation_p.A334T|COL11A1_ENST00000353414.4_Missense_Mutation_p.A411T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	450	Collagen-like 1.|Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTACATACTGCAGGTCCTGCT	0.328																																					p.A462T		Atlas-SNP	.											.	COL11A1	972	.	0			c.G1384A						PASS	.						54.0	55.0	55.0					1																	103484376		2203	4300	6503	SO:0001583	missense	1301	exon10			ATACTGCAGGTCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1348G>A	1.37:g.103484376C>T	ENSP00000359114:p.Ala450Thr	94.0	0.0	0		130.0	53.0	0.407692	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845119	0.51164	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25;-3.25	5.68	4.72	0.59763	.	0.172573	0.50627	D	0.000108	T	0.81192	0.4771	N	0.17082	0.46	0.45867	D	0.998729	B;B;B;B	0.23650	0.089;0.073;0.073;0.089	B;B;B;B	0.29077	0.098;0.059;0.059;0.098	T	0.76798	-0.2826	10	0.25106	T	0.35	.	11.916	0.52765	0.1356:0.7333:0.131:0.0	.	334;411;462;450	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	T	450;462;411;334;462	ENSP00000359114:A450T;ENSP00000351163:A462T;ENSP00000302551:A411T;ENSP00000426533:A334T;ENSP00000408640:A462T	ENSP00000302551:A411T	A	-	1	0	COL11A1	103256964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.673000	0.37534	2.676000	0.91093	0.637000	0.83480	GCA	.	.	none		0.328	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
JSRP1	126306	hgsc.bcm.edu	37	19	2254194	2254194	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:2254194G>T	ENST00000300961.6	-	4	318	c.254C>A	c.(253-255)gCc>gAc	p.A85D	JSRP1_ENST00000586471.2_Missense_Mutation_p.A85D	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	85					protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCGCTCCGGCTTTCAGCCT	0.642											OREG0025137	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A85D		Atlas-SNP	.											.	JSRP1	18	.	0			c.C254A						PASS	.						133.0	131.0	132.0					19																	2254194		2203	4300	6503	SO:0001583	missense	126306	exon4			GCTCCGGCTTTCA	AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.254C>A	19.37:g.2254194G>T	ENSP00000300961:p.Ala85Asp	60.0	0.0	0	602	62.0	24.0	0.387097	NM_144616		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150195	0.37923	.	.	ENSG00000167476	ENST00000300961	T	0.22336	1.96	3.24	-0.348	0.12613	.	0.669075	0.12336	N	0.477943	T	0.14657	0.0354	L	0.29908	0.895	0.09310	N	1	P	0.47677	0.899	P	0.45099	0.469	T	0.14783	-1.0460	10	0.87932	D	0	-0.0226	2.9112	0.05738	0.2903:0.245:0.4647:0.0	.	85	Q96MG2	JSPR1_HUMAN	D	85	ENSP00000300961:A85D	ENSP00000300961:A85D	A	-	2	0	JSRP1	2205194	0.000000	0.05858	0.259000	0.24435	0.174000	0.22865	-0.004000	0.12878	0.137000	0.18759	0.555000	0.69702	GCC	.	.	none		0.642	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
UBXN11	91544	hgsc.bcm.edu	37	1	26608866	26608866	+	Missense_Mutation	SNP	C	C	G	rs188535926		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:26608866C>G	ENST00000374222.1	-	16	1951	c.1487G>C	c.(1486-1488)gGt>gCt	p.G496A	UBXN11_ENST00000374221.3_Missense_Mutation_p.G496A|UBXN11_ENST00000357089.4_Missense_Mutation_p.G463A|UBXN11_ENST00000374223.1_Missense_Mutation_p.G253A|UBXN11_ENST00000314675.7_Missense_Mutation_p.G376A|UBXN11_ENST00000374217.2_Missense_Mutation_p.G463A			Q5T124	UBX11_HUMAN	UBX domain protein 11	496	3 X 8 AA tandem repeats of P-G-P-G-P-G-P- S.|Pro-rich.		Missing.			cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.G490_P515delGPGPSPGPGPGPSPGPGPGPSPCPGP(1)		endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						gggaccgggaccgggactggg	0.721																																					p.G496A		Atlas-SNP	.											UBXN11,colon,carcinoma,-1,2	UBXN11	54	2	1	Deletion - In frame(1)	ovary(1)	c.G1487C						scavenged	.						25.0	29.0	28.0					1																	26608866		1767	4017	5784	SO:0001583	missense	91544	exon16			CCGGGACCGGGAC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.1487G>C	1.37:g.26608866C>G	ENSP00000363339:p.Gly496Ala	25.0	2.0	0.08		25.0	7.0	0.28	NM_183008	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	ENST00000374222.1	37	CCDS41288.1	20	0.009157509157509158	6	0.012195121951219513	1	0.0027624309392265192	5	0.008741258741258742	8	0.010554089709762533	C	2.556	-0.303022	0.05495	.	.	ENSG00000158062	ENST00000314675;ENST00000374223;ENST00000357089;ENST00000374221;ENST00000374222;ENST00000374217	T;T;T;T;T;T	0.21932	1.98;2.16;2.48;2.34;2.34;2.48	.	.	.	.	.	.	.	.	T	0.06325	0.0163	N	0.08118	0	0.58432	P	2.9999999999752447E-6	P;P;P;P	0.49961	0.93;0.93;0.93;0.886	B;B;B;B	0.40444	0.329;0.329;0.329;0.176	T	0.15292	-1.0442	7	0.45353	T	0.12	.	5.6498	0.17610	0.0:0.6576:0.3424:0.0	.	463;458;376;496	Q5T124-2;Q5T124-4;Q5T124-3;Q5T124	.;.;.;UBX11_HUMAN	A	376;253;463;496;496;463	ENSP00000324721:G376A;ENSP00000363340:G253A;ENSP00000349601:G463A;ENSP00000363338:G496A;ENSP00000363339:G496A;ENSP00000363334:G463A	ENSP00000324721:G376A	G	-	2	0	UBXN11	26481453	0.000000	0.05858	0.127000	0.21898	0.134000	0.20937	-0.138000	0.10374	0.392000	0.25172	0.391000	0.25812	GGT	C|0.991;G|0.009	0.009	strong		0.721	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000009500.1	NM_145345	
ZNF20	7568	hgsc.bcm.edu	37	19	12243529	12243529	+	Missense_Mutation	SNP	T	T	C	rs557758485		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:12243529T>C	ENST00000334213.5	-	4	1696	c.1472A>G	c.(1471-1473)aAt>aGt	p.N491S	ZNF20_ENST00000485451.1_5'Flank|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000600335.1_Intron	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	491					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						TCGAATGTAATTGGAAATAAA	0.418													T|||	1	0.000199681	0.0008	0.0	5008	,	,		22095	0.0		0.0	False		,,,				2504	0.0				p.N491S		Atlas-SNP	.											.	ZNF20	86	.	0			c.A1472G						PASS	.						172.0	183.0	179.0					19																	12243529		2203	4298	6501	SO:0001583	missense	7568	exon4			ATGTAATTGGAAA	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1472A>G	19.37:g.12243529T>C	ENSP00000335437:p.Asn491Ser	85.0	0.0	0		78.0	38.0	0.487179	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	37	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	T	0.165	-1.077307	0.01903	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	T	0.05319	3.46	0.94	-1.88	0.07713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00875	0.0029	N	0.00064	-2.31	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40572	-0.9556	9	0.02654	T	1	.	2.726	0.05214	0.0:0.268:0.2608:0.4712	.	491	P17024	ZNF20_HUMAN	S	491	ENSP00000335437:N491S	ENSP00000292241:N491S	N	-	2	0	ZNF20	12104529	0.000000	0.05858	0.001000	0.08648	0.910000	0.53928	-3.261000	0.00536	-0.843000	0.04189	0.260000	0.18958	AAT	.	.	none		0.418	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
OR10H5	284433	hgsc.bcm.edu	37	19	15905664	15905664	+	Missense_Mutation	SNP	C	C	T	rs144567857	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:15905664C>T	ENST00000308940.8	+	1	904	c.806C>T	c.(805-807)cCg>cTg	p.P269L		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						CCCCAGTCTCCGGAAGGAGAC	0.567													.|||	5	0.000998403	0.003	0.0014	5008	,	,		17105	0.0		0.0	False		,,,				2504	0.0				p.P269L		Atlas-SNP	.											OR10H5,NS,carcinoma,-1,1	OR10H5	49	1	0			c.C806T						scavenged	.						111.0	90.0	98.0					19																	15905664		2203	4300	6503	SO:0001583	missense	284433	exon1			AGTCTCCGGAAGG	AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.806C>T	19.37:g.15905664C>T	ENSP00000310704:p.Pro269Leu	222.0	1.0	0.0045045		173.0	63.0	0.364162	NM_001004466	Q6IFJ0|Q96R60	Missense_Mutation	SNP	ENST00000308940.8	37	CCDS32940.1	5	0.0022893772893772895	1	0.0020325203252032522	0	0.0	0	0.0	4	0.005277044854881266	.	0	-2.679788	0.00102	.	.	ENSG00000172519	ENST00000308940	T	0.00207	8.55	3.88	-4.19	0.03835	GPCR, rhodopsin-like superfamily (1);	0.571038	0.14488	N	0.316535	T	0.00039	0.0001	N	0.03000	-0.44	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14200	-1.0481	10	0.26408	T	0.33	.	2.5734	0.04800	0.2427:0.418:0.1238:0.2154	.	269	Q8NGA6	O10H5_HUMAN	L	269	ENSP00000310704:P269L	ENSP00000310704:P269L	P	+	2	0	OR10H5	15766664	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.821000	0.00749	-1.726000	0.01370	-4.535000	0.00005	CCG	C|0.998;T|0.002	0.002	strong		0.567	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460363.1		
AHNAK2	113146	hgsc.bcm.edu	37	14	105418008	105418008	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:105418008G>T	ENST00000333244.5	-	7	3899	c.3780C>A	c.(3778-3780)gaC>gaA	p.D1260E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1260						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCCTTGAGGTCCACTTTGG	0.617																																					p.D1260E		Atlas-SNP	.											.	AHNAK2	719	.	0			c.C3780A						PASS	.						85.0	70.0	75.0					14																	105418008		1788	3218	5006	SO:0001583	missense	113146	exon7			CTTGAGGTCCACT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.3780C>A	14.37:g.105418008G>T	ENSP00000353114:p.Asp1260Glu	197.0	0.0	0		209.0	86.0	0.411483	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	N	9.476	1.096873	0.20552	.	.	ENSG00000185567	ENST00000333244	T	0.01838	4.61	3.99	-2.74	0.05932	.	.	.	.	.	T	0.02342	0.0072	M	0.76328	2.33	0.09310	N	1	B	0.30146	0.27	B	0.28139	0.086	T	0.49606	-0.8922	9	0.05959	T	0.93	.	3.689	0.08339	0.0883:0.1204:0.4663:0.325	.	1260	Q8IVF2	AHNK2_HUMAN	E	1260	ENSP00000353114:D1260E	ENSP00000353114:D1260E	D	-	3	2	AHNAK2	104489053	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.304000	0.08199	-0.748000	0.04753	-1.280000	0.01385	GAC	.	.	none		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
NR2C1	7181	hgsc.bcm.edu	37	12	95442844	95442844	+	Splice_Site	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:95442844C>T	ENST00000333003.5	-	9	1461	c.1131G>A	c.(1129-1131)agG>agA	p.R377R	NR2C1_ENST00000330677.7_Splice_Site_p.R377R|NR2C1_ENST00000393101.3_Splice_Site_p.R377R|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	377					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						ATAGAAATACCCTGAAAGCTA	0.363																																					p.R377R		Atlas-SNP	.											.	NR2C1	56	.	0			c.G1131A						PASS	.						100.0	92.0	95.0					12																	95442844		2203	4300	6503	SO:0001630	splice_region_variant	7181	exon9			AAATACCCTGAAA	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1131+1G>A	12.37:g.95442844C>T		93.0	0.0	0		67.0	24.0	0.358209	NM_001032287	A8K5K4|Q15625|Q15626	Silent	SNP	ENST00000333003.5	37	CCDS9051.1																																																																																			.	.	none		0.363	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297	Silent
TP53	7157	hgsc.bcm.edu	37	17	7578419	7578419	+	Nonsense_Mutation	SNP	C	C	A	rs587781845		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:7578419C>A	ENST00000269305.4	-	5	700	c.511G>T	c.(511-513)Gag>Tag	p.E171*	TP53_ENST00000413465.2_Nonsense_Mutation_p.E171*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E171*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.E171*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E171*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E171*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	171	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in a sporadic cancer; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E171K(11)|p.E171*(10)|p.0?(8)|p.E171Q(4)|p.E171fs*2(3)|p.E171fs*3(2)|p.E171fs*10(2)|p.V157_C176del20(1)|p.T170fs*8(1)|p.P151_V173del23(1)|p.E171fs*61(1)|p.E171fs*9(1)|p.T170fs*2(1)|p.E171fs*1(1)|p.E78fs*2(1)|p.H168fs*3(1)|p.H168fs*69(1)|p.T170_E171insXX(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.E39fs*2(1)|p.E171_V172delEV(1)|p.E39K(1)|p.E78K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCACAACCTCCGTCATGTGC	0.662		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E171X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,bladder,carcinoma,0,47	TP53	33396	47	57	Substitution - Missense(17)|Deletion - Frameshift(15)|Substitution - Nonsense(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Insertion - In frame(1)	urinary_tract(8)|lung(8)|breast(8)|oesophagus(6)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|large_intestine(3)|stomach(3)|central_nervous_system(3)|skin(3)|upper_aerodigestive_tract(2)|thyroid(1)|kidney(1)|endometrium(1)|liver(1)|ovary(1)	c.G511T						PASS	.						52.0	52.0	52.0					17																	7578419		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAACCTCCGTCAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.511G>T	17.37:g.7578419C>A	ENSP00000269305:p.Glu171*	137.0	0.0	0		83.0	72.0	0.86747	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186918	0.78789	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.47	5.47	0.80525	.	0.106949	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-29.8225	17.1938	0.86887	0.0:1.0:0.0:0.0	.	.	.	.	X	171;171;171;171;171;171;160;78;39;78;39	.	ENSP00000269305:E171X	E	-	1	0	TP53	7519144	1.000000	0.71417	0.689000	0.30133	0.389000	0.30415	7.775000	0.85489	2.735000	0.93741	0.563000	0.77884	GAG	.	.	none		0.662	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
CTSH	1512	hgsc.bcm.edu	37	15	79220112	79220112	+	Missense_Mutation	SNP	G	G	C	rs142506062		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr15:79220112G>C	ENST00000220166.5	-	9	751	c.642C>G	c.(640-642)tgC>tgG	p.C214W	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	214					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						GTTGGAACTTGCAATAACCAT	0.483																																					p.C214W		Atlas-SNP	.											.	CTSH	23	.	0			c.C642G						PASS	.						158.0	119.0	132.0					15																	79220112		2196	4293	6489	SO:0001583	missense	1512	exon9			GAACTTGCAATAA	X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.642C>G	15.37:g.79220112G>C	ENSP00000220166:p.Cys214Trp	58.0	0.0	0		44.0	28.0	0.636364	NM_004390	B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	ENST00000220166.5	37	CCDS10308.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.264475	0.23136	.	.	ENSG00000103811	ENST00000220166;ENST00000394758	D	0.93712	-3.27	4.94	4.02	0.46733	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97936	0.9321	H	0.99225	4.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97240	0.9890	10	0.87932	D	0	.	9.4585	0.38769	0.0996:0.0:0.9004:0.0	.	214;202	P09668;E9PBP2	CATH_HUMAN;.	W	214;202	ENSP00000220166:C214W	ENSP00000220166:C214W	C	-	3	2	CTSH	77007167	1.000000	0.71417	0.996000	0.52242	0.027000	0.11550	2.681000	0.46926	1.094000	0.41399	-0.216000	0.12614	TGC	G|1.000;A|0.000	.	alt		0.483	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291370.1	NM_004390	
PAK7	57144	hgsc.bcm.edu	37	20	9560944	9560944	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr20:9560944G>A	ENST00000378429.3	-	5	1384	c.838C>T	c.(838-840)Ccc>Tcc	p.P280S	PAK7_ENST00000378423.1_Missense_Mutation_p.P280S|PAK7_ENST00000353224.5_Missense_Mutation_p.P280S|RP5-986I17.2_ENST00000428769.1_RNA	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	280	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CGCATGGTGGGCTGAGGGCTT	0.552																																					p.P280S		Atlas-SNP	.											.	PAK7	194	.	0			c.C838T						PASS	.						169.0	147.0	155.0					20																	9560944		2203	4300	6503	SO:0001583	missense	57144	exon4			TGGTGGGCTGAGG	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.838C>T	20.37:g.9560944G>A	ENSP00000367686:p.Pro280Ser	266.0	0.0	0		400.0	125.0	0.3125	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.625175	0.46840	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.29917	1.55;1.55;1.55	5.6	5.6	0.85130	.	0.047698	0.85682	D	0.000000	T	0.26122	0.0637	L	0.29908	0.895	0.80722	D	1	P;P	0.48503	0.911;0.911	B;B	0.39840	0.311;0.311	T	0.01492	-1.1341	9	.	.	.	.	19.9969	0.97387	0.0:0.0:1.0:0.0	.	280;280	B0AZM9;Q9P286	.;PAK7_HUMAN	S	280;280;280;228	ENSP00000367686:P280S;ENSP00000322957:P280S;ENSP00000367679:P280S	.	P	-	1	0	PAK7	9508944	1.000000	0.71417	0.999000	0.59377	0.016000	0.09150	9.424000	0.97464	2.813000	0.96785	0.637000	0.83480	CCC	.	.	none		0.552	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
PTPRZ1	5803	hgsc.bcm.edu	37	7	121650463	121650463	+	Silent	SNP	A	A	C	rs199595173	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr7:121650463A>C	ENST00000393386.2	+	12	1774	c.1363A>C	c.(1363-1365)Agg>Cgg	p.R455R	PTPRZ1_ENST00000449182.1_Silent_p.R455R	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	455					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AAACCAAATCAGGAAAAAGGA	0.423													A|||	6	0.00119808	0.0	0.0	5008	,	,		18694	0.0		0.0	False		,,,				2504	0.0061				p.R455R		Atlas-SNP	.											.	PTPRZ1	605	.	0			c.A1363C						PASS	.						153.0	143.0	146.0					7																	121650463		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon12			CAAATCAGGAAAA	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.1363A>C	7.37:g.121650463A>C		78.0	0.0	0		80.0	38.0	0.475	NM_001206838	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																			A|0.999;C|0.001	0.001	weak		0.423	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
AMN	81693	hgsc.bcm.edu	37	14	103394811	103394811	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:103394811G>A	ENST00000299155.5	+	4	289	c.256G>A	c.(256-258)Ggc>Agc	p.G86S		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	86					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGCCGGATTCGGCGTCTCAGA	0.716																																					p.G86S		Atlas-SNP	.											.	AMN	13	.	0			c.G256A						PASS	.						17.0	17.0	17.0					14																	103394811		2193	4292	6485	SO:0001583	missense	81693	exon4			GGATTCGGCGTCT	AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.256G>A	14.37:g.103394811G>A	ENSP00000299155:p.Gly86Ser	84.0	0.0	0		103.0	43.0	0.417476	NM_030943	Q6UX83	Missense_Mutation	SNP	ENST00000299155.5	37	CCDS9977.1	.	.	.	.	.	.	.	.	.	.	G	6.859	0.527850	0.13127	.	.	ENSG00000166126	ENST00000299155;ENST00000541086	D	0.87887	-2.31	3.33	-3.8	0.04307	.	1.167550	0.06155	N	0.674896	T	0.67887	0.2941	N	0.11560	0.145	0.09310	N	1	B	0.22983	0.078	B	0.20384	0.029	T	0.59752	-0.7395	10	0.06099	T	0.92	-10.4145	5.7356	0.18065	0.2807:0.1937:0.5256:0.0	.	86	Q9BXJ7	AMNLS_HUMAN	S	86;32	ENSP00000299155:G86S	ENSP00000299155:G86S	G	+	1	0	AMN	102464564	0.000000	0.05858	0.063000	0.19743	0.325000	0.28411	-0.484000	0.06528	-0.663000	0.05331	-0.390000	0.06520	GGC	.	.	none		0.716	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415704.1		
ENPP7	339221	hgsc.bcm.edu	37	17	77709108	77709108	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr17:77709108C>T	ENST00000328313.5	+	3	887	c.666C>T	c.(664-666)acC>acT	p.T222T		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGGACCGGACCGTGGGCTACC	0.657																																					p.T222T		Atlas-SNP	.											.	ENPP7	63	.	0			c.C666T						PASS	.						53.0	51.0	51.0					17																	77709108		2203	4300	6503	SO:0001819	synonymous_variant	339221	exon3			CCGGACCGTGGGC	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.666C>T	17.37:g.77709108C>T		35.0	0.0	0		41.0	17.0	0.414634	NM_178543		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																			.	.	none		0.657	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
PTGER3	5733	hgsc.bcm.edu	37	1	71318536	71318536	+	3'UTR	SNP	A	A	C			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:71318536A>C	ENST00000370931.3	-	0	1413				PTGER3_ENST00000370932.2_Missense_Mutation_p.F362V|PTGER3_ENST00000460330.1_Missense_Mutation_p.F371V|PTGER3_ENST00000351052.5_3'UTR	NM_198714.1	NP_942007.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)						cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	TTTCCCCAAAATTCCTCCTGG	0.328																																					p.F371V		Atlas-SNP	.											PTGER3_ENST00000460330,NS,carcinoma,0,1	PTGER3	246	1	0			c.T1111G						PASS	.						131.0	146.0	141.0					1																	71318536		2203	4300	6503	SO:0001624	3_prime_UTR_variant	5733	exon4			CCCAAAATTCCTC	X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000370931.3:c.*30T>G	1.37:g.71318536A>C		118.0	0.0	0		122.0	45.0	0.368852	NM_198716	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	ENST00000370931.3	37	CCDS656.1	.	.	.	.	.	.	.	.	.	.	A	3.509	-0.100135	0.07010	.	.	ENSG00000050628	ENST00000370932;ENST00000460330	T;T	0.17370	2.28;2.5	2.92	1.79	0.24919	.	.	.	.	.	T	0.02494	0.0076	.	.	.	0.30139	N	0.804125	B;B	0.15141	0.012;0.012	B;B	0.19946	0.017;0.027	T	0.47156	-0.9139	8	0.17369	T	0.5	.	4.5446	0.12074	0.8453:0.0:0.1547:0.0	.	362;371	P43115-3;P43115-4	.;.	V	362;371	ENSP00000359970:F362V;ENSP00000418073:F371V	ENSP00000359970:F362V	F	-	1	0	PTGER3	71091124	0.128000	0.22383	0.482000	0.27366	0.272000	0.26649	0.026000	0.13599	0.528000	0.28580	0.377000	0.23210	TTT	.	.	none		0.328	PTGER3-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026077.1	NM_000957	
TUFM	7284	hgsc.bcm.edu	37	16	28854369	28854369	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:28854369C>T	ENST00000313511.3	-	10	1433	c.1295G>A	c.(1294-1296)cGg>cAg	p.R432Q	MIR4721_ENST00000577590.1_RNA	NM_003321.4	NP_003312.3	P49411	EFTU_HUMAN	Tu translation elongation factor, mitochondrial	429					translational elongation (GO:0006414)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation elongation factor activity (GO:0003746)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13						GCCAATAGTCCGGTTGCCATC	0.542																																					p.R432Q		Atlas-SNP	.											TUFM,colon,carcinoma,-1,1	TUFM	33	1	0			c.G1295A						PASS	.						171.0	142.0	152.0					16																	28854369		2197	4300	6497	SO:0001583	missense	7284	exon10			ATAGTCCGGTTGC	L38995	CCDS10642.1	16p11.2	2010-10-26			ENSG00000178952	ENSG00000178952			12420	protein-coding gene	gene with protein product		602389				9332382, 9545647	Standard	NM_003321		Approved	EFTu, EF-TuMT, EFTU	uc002drh.2	P49411	OTTHUMG00000097039	ENST00000313511.3:c.1295G>A	16.37:g.28854369C>T	ENSP00000322439:p.Arg432Gln	170.0	0.0	0		98.0	4.0	0.0408163	NM_003321	O15276	Missense_Mutation	SNP	ENST00000313511.3	37	CCDS10642.1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734727	0.48939	.	.	ENSG00000178952	ENST00000313511	T	0.73258	-0.73	4.92	2.46	0.29980	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.448187	0.22595	N	0.058034	T	0.57740	0.2074	L	0.38838	1.175	0.25971	N	0.982508	B	0.12013	0.005	B	0.10450	0.005	T	0.55438	-0.8141	10	0.87932	D	0	-5.2056	8.3795	0.32463	0.0:0.6754:0.0:0.3246	.	429	P49411	EFTU_HUMAN	Q	432	ENSP00000322439:R432Q	ENSP00000322439:R432Q	R	-	2	0	TUFM	28761870	0.522000	0.26266	1.000000	0.80357	0.871000	0.50021	0.842000	0.27627	0.870000	0.35726	0.655000	0.94253	CGG	.	.	none		0.542	TUFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214140.1	NM_003321	
OBSCN	84033	hgsc.bcm.edu	37	1	228522538	228522538	+	Silent	SNP	G	G	A	rs373968488		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:228522538G>A	ENST00000422127.1	+	61	16154	c.16110G>A	c.(16108-16110)ccG>ccA	p.P5370P	OBSCN_ENST00000570156.2_Silent_p.P6327P|OBSCN_ENST00000284548.11_Silent_p.P5370P|OBSCN_ENST00000366707.4_Silent_p.P3004P|OBSCN_ENST00000366709.4_Silent_p.P2489P	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5370					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCTGGTGCCGCCCCGAATGC	0.617																																					p.P6327P		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G18981A						PASS	.	G	,	0,4092		0,0,2046	25.0	31.0	29.0		16110,16110	-6.5	1.0	1		29	1,8309		0,1,4154	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	0,1,6200	AA,AG,GG		0.012,0.0,0.0081	,	5370/7969,5370/6621	228522538	1,12401	2046	4155	6201	SO:0001819	synonymous_variant	84033	exon72			GGTGCCGCCCCGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16110G>A	1.37:g.228522538G>A		62.0	0.0	0		42.0	32.0	0.761905	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			.	.	none		0.617	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
MSRB3	253827	hgsc.bcm.edu	37	12	65857048	65857048	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:65857048C>T	ENST00000355192.3	+	6	651	c.525C>T	c.(523-525)gcC>gcT	p.A175A	MSRB3_ENST00000308259.5_Silent_p.A168A|MSRB3_ENST00000535664.1_Silent_p.A168A	NM_198080.3	NP_932346.1	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3	175					protein repair (GO:0030091)|response to oxidative stress (GO:0006979)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)	13			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		GTGGCACCGCCGAGGGAGGCA	0.527																																					p.A175A		Atlas-SNP	.											MSRB3_ENST00000355192,colon,carcinoma,+2,4	MSRB3	80	4	0			c.C525T						PASS	.						68.0	63.0	65.0					12																	65857048		2203	4300	6503	SO:0001819	synonymous_variant	253827	exon6			CACCGCCGAGGGA	BX640871	CCDS8973.1, CCDS31853.1	12q14.3	2011-11-29			ENSG00000174099	ENSG00000174099			27375	protein-coding gene	gene with protein product		613719	"""deafness, autosomal recessive 74"""	DFNB74		21185009	Standard	NM_198080		Approved	FLJ36866, DKFZp686C1178	uc021qzy.1	Q8IXL7	OTTHUMG00000168866	ENST00000355192.3:c.525C>T	12.37:g.65857048C>T		126.0	0.0	0		190.0	55.0	0.289474	NM_198080	B4DR19|B7ZAQ0|Q6UXS2	Silent	SNP	ENST00000355192.3	37	CCDS8973.1																																																																																			.	.	none		0.527	MSRB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000401421.1	NM_198080	
NRG2	9542	hgsc.bcm.edu	37	5	139260442	139260442	+	Splice_Site	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr5:139260442G>A	ENST00000361474.1	-	3	1214	c.990C>T	c.(988-990)agC>agT	p.S330S	NRG2_ENST00000541337.1_Splice_Site_p.S330S|NRG2_ENST00000394770.1_Splice_Site_p.S330S|NRG2_ENST00000340391.3_Splice_Site_p.S127S|NRG2_ENST00000518130.1_5'UTR|NRG2_ENST00000358522.3_Splice_Site_p.S330S|NRG2_ENST00000289422.7_Splice_Site_p.S330S|NRG2_ENST00000289409.4_Splice_Site_p.S330S|NRG2_ENST00000545385.1_Splice_Site_p.S330S	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	330	Ig-like C2-type.|Ser/Thr-rich.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.S330S(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCACCTACCGCTGTTGACGT	0.642																																					p.S330S		Atlas-SNP	.											NRG2,NS,carcinoma,0,1	NRG2	69	1	1	Substitution - coding silent(1)	stomach(1)	c.C990T						PASS	.						75.0	78.0	77.0					5																	139260442		2203	4300	6503	SO:0001630	splice_region_variant	9542	exon3			CCTACCGCTGTTG		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.991+1C>T	5.37:g.139260442G>A		67.0	0.0	0		86.0	26.0	0.302326	NM_013982		Silent	SNP	ENST00000361474.1	37	CCDS4217.1																																																																																			.	.	none		0.642	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	Silent
DMBT1	1755	hgsc.bcm.edu	37	10	124358568	124358568	+	Missense_Mutation	SNP	T	T	A	rs201802690		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr10:124358568T>A	ENST00000338354.3	+	26	3341	c.3235T>A	c.(3235-3237)Tcc>Acc	p.S1079T	DMBT1_ENST00000330163.4_Missense_Mutation_p.S580T|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368956.2_Missense_Mutation_p.S580T|DMBT1_ENST00000368909.3_Missense_Mutation_p.S1079T|DMBT1_ENST00000344338.3_Missense_Mutation_p.S1069T|DMBT1_ENST00000368955.3_Missense_Mutation_p.S1069T			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1079	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGGCTGGCTCTCCCACAACTG	0.572																																					p.S1079T	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											DMBT1_ENST00000368915,NS,carcinoma,0,3	DMBT1	677	3	0			c.T3235A						scavenged	.						101.0	96.0	98.0					10																	124358568		1929	4141	6070	SO:0001583	missense	1755	exon26			TGGCTCTCCCACA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.3235T>A	10.37:g.124358568T>A	ENSP00000342210:p.Ser1079Thr	184.0	2.0	0.0108696		224.0	14.0	0.0625	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	T	8.702	0.909917	0.17833	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94	3.57	-6.98	0.01611	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.838313	0.10030	N	0.724884	T	0.30541	0.0768	L	0.27944	0.81	0.09310	N	1	B;D;B;B;B	0.57257	0.167;0.979;0.107;0.0;0.0	B;P;B;B;B	0.56563	0.087;0.801;0.023;0.001;0.001	T	0.20605	-1.0270	10	0.13853	T	0.58	.	4.1715	0.10332	0.6029:0.0791:0.1583:0.1597	.	586;1079;580;1069;1079	Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	T	1079;1079;1079;1079;1079;1079;580;1069;580;580;1079;1069;580	ENSP00000342210:S1079T;ENSP00000343175:S1069T;ENSP00000327747:S580T;ENSP00000357905:S1079T;ENSP00000357951:S1069T;ENSP00000357952:S580T	ENSP00000331522:S580T	S	+	1	0	DMBT1	124348558	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-5.877000	0.00093	-0.959000	0.03618	-0.386000	0.06593	TCC	.	.	weak		0.572	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
LEFTY2	7044	hgsc.bcm.edu	37	1	226127479	226127479	+	Silent	SNP	G	G	A	rs188858500	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:226127479G>A	ENST00000366820.5	-	2	822	c.474C>T	c.(472-474)aaC>aaT	p.N158N	LEFTY2_ENST00000420304.2_Silent_p.N124N|RP4-559A3.6_ENST00000513672.1_RNA|LEFTY2_ENST00000474493.1_5'UTR	NM_003240.3	NP_003231.2	O00292	LFTY2_HUMAN	left-right determination factor 2	158					blood coagulation (GO:0007596)|cell growth (GO:0016049)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16	Breast(184;0.197)					GGGAGGTGCGGTTGGAGCCGT	0.776													G|||	32	0.00638978	0.0	0.0014	5008	,	,		12140	0.0298		0.0	False		,,,				2504	0.001				p.N158N	Colon(172;116 2643 9098 43333)	Atlas-SNP	.											.	LEFTY2	25	.	0			c.C474T						PASS	.						3.0	5.0	4.0					1																	226127479		1604	3499	5103	SO:0001819	synonymous_variant	7044	exon2			GGTGCGGTTGGAG	U81523	CCDS1549.1, CCDS53479.1	1q42.1	2008-07-18	2004-11-17	2004-11-17	ENSG00000143768	ENSG00000143768			3122	protein-coding gene	gene with protein product	"""transforming growth factor, beta-4 (endometrial bleeding-associated factor; LEFTY A)"""	601877	"""endometrial bleeding associated factor (left-right determination, factor A; transforming growth factor beta superfamily)"""	TGFB4, EBAF		9153275	Standard	NM_001172425		Approved	LEFTA, LEFTYA	uc001hpt.2	O00292	OTTHUMG00000037441	ENST00000366820.5:c.474C>T	1.37:g.226127479G>A		1.0	0.0	0		14.0	12.0	0.857143	NM_003240	B3KNH4|B4E332|E9PDM4|O75611|Q5TE89|Q8NBQ9	Silent	SNP	ENST00000366820.5	37	CCDS1549.1																																																																																			G|0.990;A|0.010	0.010	strong		0.776	LEFTY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091152.1	NM_003240	
ATF7	11016	hgsc.bcm.edu	37	12	53911012	53911012	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:53911012A>G	ENST00000548446.2	-	12	1506	c.1394T>C	c.(1393-1395)cTc>cCc	p.L465P	ATF7_ENST00000415113.1_Missense_Mutation_p.L433P|ATF7_ENST00000546661.1_5'UTR|ATF7_ENST00000328463.7_Missense_Mutation_p.L465P|ATF7_ENST00000456903.4_Missense_Mutation_p.L454P|RP11-793H13.3_ENST00000548347.1_RNA|ATF7_ENST00000420353.2_Missense_Mutation_p.L454P|RP11-793H13.10_ENST00000591834.1_Intron			P17544	ATF7_HUMAN	activating transcription factor 7	465	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	CATCTGAGTGAGGACCGAGGT	0.577																																					p.L454P		Atlas-SNP	.											.	ATF7	51	.	0			c.T1361C						PASS	.						103.0	104.0	104.0					12																	53911012		2075	4205	6280	SO:0001583	missense	11016	exon12			TGAGTGAGGACCG	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1394T>C	12.37:g.53911012A>G	ENSP00000449938:p.Leu465Pro	74.0	0.0	0		147.0	7.0	0.047619	NM_006856	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		.	.	.	.	.	.	.	.	.	.	A	20.8	4.045077	0.75846	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.57107	0.42;0.42;0.58;0.43;0.43	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.63522	0.2518	L	0.41710	1.295	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.993;0.999	T	0.66999	-0.5781	10	0.87932	D	0	-16.28	13.4618	0.61231	1.0:0.0:0.0:0.0	.	433;454;465	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	P	465;465;278;433;454;454	ENSP00000449938:L465P;ENSP00000329212:L465P;ENSP00000404880:L433P;ENSP00000399465:L454P;ENSP00000387406:L454P	ENSP00000304187:L278P	L	-	2	0	ATF7	52197279	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.366000	0.90111	2.087000	0.62958	0.454000	0.30748	CTC	.	.	none		0.577	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
IFITM3	10410	hgsc.bcm.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.11_ENST00000602429.1_RNA|RP11-326C3.10_ENST00000534271.1_RNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																					p.V31M		Atlas-SNP	.											IFITM3,brain,glioma,0,1	IFITM3	132	1	0			c.G91A						scavenged	.						87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	10410	exon1			CCAGCACAGCCAC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met	53.0	1.0	0.0188679		86.0	4.0	0.0465116	NM_021034	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	37	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	.	.	weak		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
EYS	346007	hgsc.bcm.edu	37	6	65612316	65612316	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:65612316C>A	ENST00000370621.3	-	17	3245	c.2719G>T	c.(2719-2721)Gat>Tat	p.D907Y	EYS_ENST00000370616.2_Missense_Mutation_p.D907Y|EYS_ENST00000503581.1_Missense_Mutation_p.D907Y			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	907	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTGACCATATCTTCACAGTCA	0.333																																					p.D907Y		Atlas-SNP	.											EYS_ENST00000370621,NS,carcinoma,+2,1	EYS	527	1	0			c.G2719T						PASS	.						151.0	125.0	133.0					6																	65612316		692	1591	2283	SO:0001583	missense	346007	exon17			CCATATCTTCACA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2719G>T	6.37:g.65612316C>A	ENSP00000359655:p.Asp907Tyr	119.0	0.0	0		98.0	43.0	0.438776	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	C	5.293	0.239526	0.10023	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.95656	-3.77;-3.77;-3.77	4.36	1.38	0.22167	.	.	.	.	.	D	0.93099	0.7803	M	0.94142	3.5	0.80722	D	1	B	0.18741	0.03	B	0.23419	0.046	D	0.88285	0.2939	9	0.87932	D	0	.	4.268	0.10773	0.1613:0.5952:0.156:0.0876	.	907	Q5T1H1-1	.	Y	907	ENSP00000424243:D907Y;ENSP00000359655:D907Y;ENSP00000359650:D907Y	ENSP00000359650:D907Y	D	-	1	0	EYS	65669037	1.000000	0.71417	0.010000	0.14722	0.116000	0.19942	2.134000	0.42102	0.034000	0.15491	-0.218000	0.12543	GAT	.	.	none		0.333	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
RAPH1	65059	hgsc.bcm.edu	37	2	204304225	204304225	+	Silent	SNP	G	G	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:204304225G>T	ENST00000319170.5	-	14	3987	c.3688C>A	c.(3688-3690)Cgg>Agg	p.R1230R	ABI2_ENST00000295851.5_3'UTR|RAPH1_ENST00000457812.1_Intron|RAPH1_ENST00000374493.3_Silent_p.R1282R	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	1230					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGTCCTCTCCGCAACGTTGCA	0.507																																					p.R1230R		Atlas-SNP	.											.	RAPH1	118	.	0			c.C3688A						PASS	.						85.0	81.0	83.0					2																	204304225		2203	4300	6503	SO:0001819	synonymous_variant	65059	exon14			CTCTCCGCAACGT	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.3688C>A	2.37:g.204304225G>T		62.0	0.0	0		87.0	4.0	0.045977	NM_213589	Q96Q37|Q9C0I2	Silent	SNP	ENST00000319170.5	37	CCDS2359.1																																																																																			.	.	none		0.507	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
BTG1	694	hgsc.bcm.edu	37	12	92538187	92538187	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr12:92538187C>T	ENST00000256015.3	-	2	546	c.185G>A	c.(184-186)tGc>tAc	p.C62Y	C12orf79_ENST00000551843.1_5'Flank|C12orf79_ENST00000549802.1_5'Flank|RP11-796E2.4_ENST00000501008.2_RNA|RP11-796E2.4_ENST00000499685.2_RNA|C12orf79_ENST00000546975.1_5'Flank|C12orf79_ENST00000551563.2_5'Flank	NM_001731.2	NP_001722.1	P62324	BTG1_HUMAN	B-cell translocation gene 1, anti-proliferative	62					cell migration (GO:0016477)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of myoblast differentiation (GO:0045663)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|transcription cofactor activity (GO:0003712)			haematopoietic_and_lymphoid_tissue(12)|kidney(1)|large_intestine(1)|lung(2)	16		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				CGATCCCTTGCATGGCTTTTC	0.463			T	MYC	BCLL						OREG0022024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C62Y		Atlas-SNP	.		Dom	yes		12	12q22	694	"""B-cell translocation gene 1, anti-proliferative"""		L	.	BTG1	30	.	0			c.G185A						PASS	.						119.0	120.0	120.0					12																	92538187		2203	4300	6503	SO:0001583	missense	694	exon2			CCCTTGCATGGCT		CCDS9043.1	12q21.33	2012-10-02			ENSG00000133639	ENSG00000133639			1130	protein-coding gene	gene with protein product		109580				15033446	Standard	NM_001731		Approved		uc001tby.3	P62324	OTTHUMG00000170092	ENST00000256015.3:c.185G>A	12.37:g.92538187C>T	ENSP00000256015:p.Cys62Tyr	118.0	0.0	0	1291	131.0	39.0	0.29771	NM_001731	P31607	Missense_Mutation	SNP	ENST00000256015.3	37	CCDS9043.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081433	0.36758	.	.	ENSG00000133639	ENST00000256015	T	0.22336	1.96	5.81	5.81	0.92471	Anti-proliferative protein (4);	0.139437	0.64402	D	0.000002	T	0.16128	0.0388	L	0.39085	1.19	0.51482	D	0.999929	B	0.06786	0.001	B	0.13407	0.009	T	0.04565	-1.0942	10	0.02654	T	1	-4.1118	15.5494	0.76137	0.0:0.8627:0.1373:0.0	.	62	P62324	BTG1_HUMAN	Y	62	ENSP00000256015:C62Y	ENSP00000256015:C62Y	C	-	2	0	BTG1	91062318	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.537000	0.60643	2.738000	0.93877	0.655000	0.94253	TGC	.	.	none		0.463	BTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407227.1		
VARS2	57176	hgsc.bcm.edu	37	6	30893890	30893890	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:30893890C>T	ENST00000321897.5	+	29	3727	c.3095C>T	c.(3094-3096)tCt>tTt	p.S1032F	VARS2_ENST00000476162.1_3'UTR|VARS2_ENST00000541562.1_Missense_Mutation_p.S1062F|VARS2_ENST00000416670.2_Missense_Mutation_p.S1032F|VARS2_ENST00000542001.1_Missense_Mutation_p.S892F			Q5ST30	SYVM_HUMAN	valyl-tRNA synthetase 2, mitochondrial	1032					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(3)|prostate(3)|skin(4)|urinary_tract(1)	46						GTCCAGCTTTCTTCCCTCCAG	0.617																																					p.S1062F		Atlas-SNP	.											.	VARS2	60	.	0			c.C3185T						PASS	.						63.0	65.0	64.0					6																	30893890		1510	2709	4219	SO:0001583	missense	57176	exon30			AGCTTTCTTCCCT	AB067472	CCDS34387.1, CCDS54980.1	6p21.33	2012-10-26	2012-10-26	2007-02-23	ENSG00000137411	ENSG00000137411	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	21642	protein-coding gene	gene with protein product	"""valine tRNA ligase 2, mitochondrial"""	612802	"""valyl-tRNA synthetase 2-like"", ""valyl-tRNA synthetase like"", ""valyl-tRNA synthetase 2, mitochondrial (putative)"""	VARS2L, VARSL		1898367, 11572484, 18400783	Standard	NM_001167734		Approved	DKFZP434L1435, KIAA1885, G7a	uc011dmz.2	Q5ST30	OTTHUMG00000031263	ENST00000321897.5:c.3095C>T	6.37:g.30893890C>T	ENSP00000316092:p.Ser1032Phe	263.0	0.0	0		307.0	128.0	0.416938	NM_001167734	A2ABL7|B4DET4|B4E3P5|F5GXJ0|F5H323|Q2M2A0|Q59FI1|Q5SQ96|Q5SS98|Q6DKJ5|Q6ZV24|Q96GN2|Q96H77|Q96Q02|Q9H6R2|Q9UFH7	Missense_Mutation	SNP	ENST00000321897.5	37	CCDS34387.1	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461584	0.63513	.	.	ENSG00000137411	ENST00000321897;ENST00000416670;ENST00000542001;ENST00000541562	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.48241	0.1489	M	0.70595	2.14	0.37604	D	0.920671	D;D;D;D	0.76494	0.983;0.998;0.999;0.998	P;D;D;D	0.85130	0.837;0.994;0.997;0.994	T	0.50448	-0.8827	10	0.72032	D	0.01	-21.6103	15.561	0.76244	0.0:1.0:0.0:0.0	.	470;1030;1062;1032	Q5ST30-2;B7ZL25;F5GXJ0;Q5ST30	.;.;.;SYVM_HUMAN	F	1032;1032;892;1062	ENSP00000316092:S1032F;ENSP00000394802:S1032F;ENSP00000438200:S892F;ENSP00000441000:S1062F	ENSP00000316092:S1032F	S	+	2	0	VARS2	31001869	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	3.549000	0.53681	2.755000	0.94549	0.655000	0.94253	TCT	.	.	none		0.617	VARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076566.2	NM_020442	
ZBTB22	9278	hgsc.bcm.edu	37	6	33283277	33283277	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr6:33283277C>G	ENST00000431845.2	-	2	1568	c.1417G>C	c.(1417-1419)Gtc>Ctc	p.V473L	TAPBP_ENST00000456592.2_5'Flank|TAPBP_ENST00000426633.2_5'Flank|TAPBP_ENST00000489157.1_5'Flank|ZBTB22_ENST00000418724.1_Missense_Mutation_p.V473L|TAPBP_ENST00000475304.1_5'Flank|TAPBP_ENST00000434618.2_5'Flank	NM_005453.4	NP_005444.4	O15209	ZBT22_HUMAN	zinc finger and BTB domain containing 22	473					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(3)	21						CCTCCAGGGACCCCACCAACG	0.642																																					p.V473L		Atlas-SNP	.											.	ZBTB22	48	.	0			c.G1417C						PASS	.						131.0	145.0	141.0					6																	33283277		2203	4300	6503	SO:0001583	missense	9278	exon2			CAGGGACCCCACC	Z97183	CCDS4775.1	6p21.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000236104	ENSG00000236104		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13085	protein-coding gene	gene with protein product		611439	"""zinc finger protein 297"""	ZNF297			Standard	NM_005453		Approved	BING1, ZNF297A, fruitless, fru, ZBTB22A	uc010juu.3	O15209	OTTHUMG00000031110	ENST00000431845.2:c.1417G>C	6.37:g.33283277C>G	ENSP00000407545:p.Val473Leu	69.0	0.0	0		78.0	35.0	0.448718	NM_001145338	B0V007|Q5HYV4|Q5STL0|Q5STR7|Q8WV82	Missense_Mutation	SNP	ENST00000431845.2	37	CCDS4775.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.332545	0.00227	.	.	ENSG00000236104	ENST00000418724;ENST00000431845	T;T	0.04970	3.52;3.52	4.11	-1.01	0.10169	.	1.112010	0.07113	N	0.842560	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48246	-0.9052	10	0.27082	T	0.32	.	8.6065	0.33775	0.0:0.3929:0.0:0.6071	.	473	O15209	ZBT22_HUMAN	L	473	ENSP00000404403:V473L;ENSP00000407545:V473L	ENSP00000404403:V473L	V	-	1	0	ZBTB22	33391255	0.000000	0.05858	0.011000	0.14972	0.025000	0.11179	-0.980000	0.03770	-0.115000	0.11915	0.448000	0.29417	GTC	.	.	none		0.642	ZBTB22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076183.2		
ACIN1	22985	hgsc.bcm.edu	37	14	23548787	23548787	+	Missense_Mutation	SNP	C	C	T	rs55838227|rs34870944|rs61741619	byFrequency	TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr14:23548787C>T	ENST00000262710.1	-	6	2258	c.1931G>A	c.(1930-1932)cGt>cAt	p.R644H	ACIN1_ENST00000605057.1_Missense_Mutation_p.R586H|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000457657.1_Missense_Mutation_p.R604H|ACIN1_ENST00000555053.1_Missense_Mutation_p.R644H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	644	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S643_R644insHS(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TGAACGAGAACGTGAACGTGA	0.488																																					p.R644H		Atlas-SNP	.											.	ACIN1	147	.	1	Insertion - In frame(1)	upper_aerodigestive_tract(1)	c.G1931A						PASS	.						255.0	224.0	235.0					14																	23548787		2203	4300	6503	SO:0001583	missense	22985	exon6			CGAGAACGTGAAC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1931G>A	14.37:g.23548787C>T	ENSP00000262710:p.Arg644His	150.0	0.0	0		198.0	34.0	0.171717	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061864	0.76187	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.30448	2.29;1.53;2.29	5.46	5.46	0.80206	.	0.000000	0.41001	D	0.000979	T	0.42720	0.1215	L	0.27053	0.805	0.36352	D	0.86012	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.984;0.984	T	0.50808	-0.8784	10	0.59425	D	0.04	-1.7144	14.8141	0.70017	0.0:1.0:0.0:0.0	.	644;644;604	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	644;604;644	ENSP00000262710:R644H;ENSP00000405677:R604H;ENSP00000451328:R644H	ENSP00000262710:R644H	R	-	2	0	ACIN1	22618627	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	1.398000	0.34554	2.556000	0.86216	0.655000	0.94253	CGT	C|0.985;T|0.015	0.015	strong		0.488	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
TEX15	56154	hgsc.bcm.edu	37	8	30701914	30701914	+	Silent	SNP	C	C	T			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr8:30701914C>T	ENST00000256246.2	-	1	4694	c.4620G>A	c.(4618-4620)gaG>gaA	p.E1540E		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1540					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CCCCCTTCTTCTCTCTTTTGT	0.368																																					p.E1540E		Atlas-SNP	.											.	TEX15	350	.	0			c.G4620A						PASS	.						185.0	188.0	187.0					8																	30701914		2203	4300	6503	SO:0001819	synonymous_variant	56154	exon1			CTTCTTCTCTCTT	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4620G>A	8.37:g.30701914C>T		172.0	0.0	0		196.0	75.0	0.382653	NM_031271		Silent	SNP	ENST00000256246.2	37	CCDS6080.1																																																																																			.	.	none		0.368	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376193.1		
TUBB4A	10382	hgsc.bcm.edu	37	19	6495416	6495416	+	Missense_Mutation	SNP	G	G	A	rs1053267		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr19:6495416G>A	ENST00000264071.2	-	4	1465	c.1094C>T	c.(1093-1095)gCg>gTg	p.A365V	TUBB4A_ENST00000540257.1_Missense_Mutation_p.A365V|CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	365			A -> V (in dbSNP:rs1053267). {ECO:0000269|PubMed:6462917}.		'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										GATGAAGGTCGCGGCCATCTT	0.617																																					p.A365V		Atlas-SNP	.											TUBB4,colon,carcinoma,+1,1	.	.	1	0			c.C1094T						scavenged	.						176.0	154.0	162.0					19																	6495416		2203	4300	6503	SO:0001583	missense	10382	exon4			AAGGTCGCGGCCA	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1094C>T	19.37:g.6495416G>A	ENSP00000264071:p.Ala365Val	98.0	1.0	0.0102041		108.0	57.0	0.527778	NM_006087	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	37	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519188	0.27211	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	D;D	0.83837	-1.77;-1.77	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000003	T	0.71525	0.3350	N	0.16478	0.41	0.48452	D	0.999651	B	0.14012	0.009	B	0.12837	0.008	T	0.70594	-0.4829	10	0.87932	D	0	.	13.6752	0.62449	0.0:0.0:1.0:0.0	rs1053267	365	P04350	TBB4A_HUMAN	V	365;365;283	ENSP00000264071:A365V;ENSP00000443590:A365V	ENSP00000264071:A365V	A	-	2	0	TUBB4	6446416	1.000000	0.71417	0.965000	0.40720	0.833000	0.47200	5.606000	0.67641	1.473000	0.48159	0.306000	0.20318	GCG	G|1.000;|0.000	.	weak		0.617	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
IGSF3	3321	hgsc.bcm.edu	37	1	117158983	117158983	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr1:117158983T>G	ENST00000369486.3	-	3	905	c.140A>C	c.(139-141)tAc>tCc	p.Y47S	IGSF3_ENST00000369483.1_Missense_Mutation_p.Y47S|IGSF3_ENST00000318837.6_Missense_Mutation_p.Y47S	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	47	Ig-like C2-type 1.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		AGGTCCCTGGTAGCCACTCAC	0.577																																					p.Y47S		Atlas-SNP	.											IGSF3_ENST00000369483,NS,carcinoma,+1,2	IGSF3	294	2	0			c.A140C						scavenged	.						28.0	28.0	28.0					1																	117158983		2203	4292	6495	SO:0001583	missense	3321	exon3			CCCTGGTAGCCAC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.140A>C	1.37:g.117158983T>G	ENSP00000358498:p.Tyr47Ser	88.0	2.0	0.0227273		139.0	6.0	0.0431655	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	T	18.18	3.567123	0.65651	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02323	4.34;4.34;4.34	4.65	-3.71	0.04424	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.463445	0.23369	N	0.048939	T	0.03915	0.0110	M	0.69823	2.125	0.52099	D	0.999948	P;P	0.49783	0.928;0.919	P;P	0.56823	0.784;0.807	T	0.16394	-1.0404	10	0.72032	D	0.01	-17.8621	10.721	0.46040	0.6328:0.0:0.0:0.3672	.	47;47	O75054;A6NJZ6	IGSF3_HUMAN;.	S	47	ENSP00000358498:Y47S;ENSP00000358495:Y47S;ENSP00000321184:Y47S	ENSP00000321184:Y47S	Y	-	2	0	IGSF3	116960506	1.000000	0.71417	0.995000	0.50966	0.983000	0.72400	1.704000	0.37857	-0.387000	0.07809	0.454000	0.30748	TAC	T|0.500;G|0.500	0.500	weak		0.577	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
CLCN2	1181	hgsc.bcm.edu	37	3	184071474	184071474	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr3:184071474T>G	ENST00000265593.4	-	16	2002	c.1831A>C	c.(1831-1833)Atg>Ctg	p.M611L	CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000344937.7_Missense_Mutation_p.M594L|CLCN2_ENST00000434054.2_Missense_Mutation_p.M567L|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000457512.1_Missense_Mutation_p.M611L|CLCN2_ENST00000423355.2_3'UTR	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	611	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	AGGGCCAGCATTCGGCCCTTG	0.657																																					p.M611L		Atlas-SNP	.											.	CLCN2	74	.	0			c.A1831C						PASS	.						38.0	37.0	37.0					3																	184071474		2202	4300	6502	SO:0001583	missense	1181	exon16			CCAGCATTCGGCC	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1831A>C	3.37:g.184071474T>G	ENSP00000265593:p.Met611Leu	76.0	0.0	0		74.0	30.0	0.405405	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	t	16.00	2.998041	0.54147	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.0	3.81	0.43845	Cystathionine beta-synthase, core (1);	0.387182	0.31709	N	0.007192	T	0.76364	0.3977	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B	0.16166	0.016;0.009;0.015;0.004;0.009	B;B;B;B;B	0.15052	0.005;0.005;0.012;0.005;0.005	T	0.69172	-0.5215	10	0.62326	D	0.03	-12.1521	5.9788	0.19395	0.1445:0.0793:0.0:0.7762	.	567;611;594;611;567	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	L	611;594;567;611	ENSP00000265593:M611L;ENSP00000345056:M594L;ENSP00000400425:M567L;ENSP00000391928:M611L	ENSP00000265593:M611L	M	-	1	0	CLCN2	185554168	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.305000	0.51873	0.734000	0.32515	0.460000	0.39030	ATG	.	.	none		0.657	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
PSME4	23198	hgsc.bcm.edu	37	2	54135501	54135501	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr2:54135501G>A	ENST00000404125.1	-	24	2795	c.2740C>T	c.(2740-2742)Cga>Tga	p.R914*	PSME4_ENST00000421748.2_Nonsense_Mutation_p.R58*	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	914					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CTTTTCCATCGGGAGTCAAAT	0.338																																					p.R914X		Atlas-SNP	.											PSME4,rectum,carcinoma,+1,1	PSME4	247	1	0			c.C2740T						PASS	.						55.0	55.0	55.0					2																	54135501		2203	4298	6501	SO:0001587	stop_gained	23198	exon24			TCCATCGGGAGTC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.2740C>T	2.37:g.54135501G>A	ENSP00000384211:p.Arg914*	64.0	0.0	0		57.0	43.0	0.754386	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Nonsense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600660	0.87055	.	.	ENSG00000068878	ENST00000421748;ENST00000404125	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	13.9841	0.64324	0.0:0.0:0.8484:0.1515	.	.	.	.	X	58;914	.	ENSP00000384211:R914X	R	-	1	2	PSME4	53989005	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	3.927000	0.56499	2.486000	0.83907	0.655000	0.94253	CGA	.	.	none		0.338	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
TMC5	79838	hgsc.bcm.edu	37	16	19481009	19481009	+	Silent	SNP	C	C	T	rs145726955		TCGA-FF-8043-01A-11D-2210-10	TCGA-FF-8043-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	e89e9c69-ffcd-4a4c-818d-1dee43ddc76a	dfa74511-2a52-4bd5-88f2-dad8c7450be4	g.chr16:19481009C>T	ENST00000396229.2	+	10	2393	c.1644C>T	c.(1642-1644)gcC>gcT	p.A548A	TMC5_ENST00000564959.1_Silent_p.A231A|TMC5_ENST00000381414.4_Silent_p.A548A|TMC5_ENST00000542583.2_Silent_p.A548A|TMC5_ENST00000219821.5_Silent_p.A302A|TMC5_ENST00000561503.1_Silent_p.A189A|TMC5_ENST00000541464.1_Silent_p.A548A	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	548					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTAGCATGGCCAAGTATTTCC	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17834	0.0		0.0	False		,,,				2504	0.0				p.A548A		Atlas-SNP	.											.	TMC5	169	.	0			c.C1644T						PASS	.	C	,,	8,4386	14.3+/-33.2	0,8,2189	112.0	103.0	106.0		1644,1644,906	2.5	1.0	16	dbSNP_134	106	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	TMC5	NM_001105248.1,NM_001105249.1,NM_024780.4	,,	0,8,6489	TT,TC,CC		0.0,0.1821,0.0616	,,	548/1007,548/949,302/761	19481009	8,12986	2197	4300	6497	SO:0001819	synonymous_variant	79838	exon10			CATGGCCAAGTAT	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1644C>T	16.37:g.19481009C>T		113.0	0.0	0		304.0	94.0	0.309211	NM_001105249	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	ENST00000396229.2	37	CCDS45431.1																																																																																			C|0.999;T|0.001	0.001	strong		0.473	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
