#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C6	729	hgsc.bcm.edu	37	5	41181559	41181560	+	Frame_Shift_Ins	INS	-	-	C	rs372345940		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:41181559_41181560insC	ENST00000263413.3	-	7	1092_1093	c.828_829insG	c.(826-831)gggagcfs	p.S277fs	C6_ENST00000337836.5_Frame_Shift_Ins_p.S277fs|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	277	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTGAAAGAGCTCCCCCCCTGAC	0.376																																					p.S277fs		Pindel,Atlas-Indel	.											.	C6	197	.	0			c.829_830insG	GRCh37	CD982526	C6	D		PASS	.																																			SO:0001589	frameshift_variant	729	exon7			.	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.829dupG	5.37:g.41181566_41181566dupC	ENSP00000263413:p.Ser277fs	145.0	0.0	.		156.0	31.0	0.199	NM_001115131		Frame_Shift_Ins	INS	ENST00000263413.3	37	CCDS3936.1																																																																																			.	.	weak		0.376	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
CHST4	10164	hgsc.bcm.edu	37	16	71570645	71570645	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:71570645delT	ENST00000338482.5	+	3	408	c.65delT	c.(64-66)ctafs	p.L22fs	CHST4_ENST00000572450.1_Frame_Shift_Del_p.L22fs|CHST4_ENST00000539698.3_Frame_Shift_Del_p.L22fs|ZNF19_ENST00000568446.1_Intron			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	22					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						ATCTTGGCTCTATTCTTCCAC	0.502																																					p.L22fs		Pindel,Atlas-Indel	.											.	CHST4	47	.	0			c.64delC						PASS	.						111.0	108.0	109.0					16																	71570645		2198	4300	6498	SO:0001589	frameshift_variant	10164	exon2			.	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.65delT	16.37:g.71570645delT	ENSP00000341206:p.Leu22fs	84.0	0.0	.		83.0	17.0	0.205	NM_001166395	Q8IV46|Q9Y5R3	Frame_Shift_Del	DEL	ENST00000338482.5	37	CCDS10902.1																																																																																			.	.	none		0.502	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268992.4	NM_005769	
AR	367	hgsc.bcm.edu	37	X	66765158	66765159	+	In_Frame_Ins	INS	-	-	GCTGCA	rs78686797|rs3032358|rs4045402		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:66765158_66765159insGCTGCA	ENST00000374690.3	+	1	694_695	c.170_171insGCTGCA	c.(169-174)ctgcag>ctGCTGCAgcag	p.57_58LQ>LLQQ	AR_ENST00000504326.1_In_Frame_Ins_p.57_58LQ>LLQQ|AR_ENST00000396044.3_In_Frame_Ins_p.57_58LQ>LLQQ|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	57	Gln-rich.|Modulating.|Poly-Gln.|Poly-Leu.		L -> Q (in prostate cancer).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L57Q(3)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TTGCTGCTGCTgcagcagcagc	0.668									Androgen Insensitivity Syndrome																												p.L57delinsLLQ		Atlas-Indel	.											.	AR	249	.	3	Substitution - Missense(3)	lung(1)|endometrium(1)|central_nervous_system(1)	c.170_171insGCTGCA						PASS	.																																			SO:0001652	inframe_insertion	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	.	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	X.37:g.66765158_66765159insGCTGCA	ENSP00000363822:p.Leu57_Gln58insLeuGln	32.0	0.0	0		20.0	14.0	0.7	NM_000044	A2RUN2|B1AKD7|Q9UD95	In_Frame_Ins	INS	ENST00000374690.3	37	CCDS14387.1																																																																																			.	.	alt		0.668	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
LPIN3	64900	hgsc.bcm.edu	37	20	39977298	39977299	+	Frame_Shift_Ins	INS	-	-	G	rs546459459		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:39977298_39977299insG	ENST00000373257.3	+	4	419_420	c.328_329insG	c.(328-330)tggfs	p.W110fs		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	110					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				ACCCATCCCTTGGGGGGGTCTG	0.663																																					p.W110fs		Pindel,Atlas-Indel	.											.	LPIN3	69	.	0			c.328_329insG						PASS	.																																			SO:0001589	frameshift_variant	64900	exon4			.	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.335dupG	20.37:g.39977305_39977305dupG	ENSP00000362354:p.Trp110fs	40.0	0.0	.		56.0	12.0	0.214	NM_022896	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Frame_Shift_Ins	INS	ENST00000373257.3	37	CCDS33469.1																																																																																			.	.	none		0.663	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080393.1	NM_022896	
ZNF233	353355	hgsc.bcm.edu	37	19	44777859	44777859	+	Missense_Mutation	SNP	G	G	A	rs569951523		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:44777859G>A	ENST00000391958.2	+	5	1173	c.1046G>A	c.(1045-1047)cGg>cAg	p.R349Q	ZNF233_ENST00000334152.1_Missense_Mutation_p.R331Q|ZNF235_ENST00000589799.1_Intron|ZNF233_ENST00000592581.1_3'UTR	NM_181756.2	NP_861421.2	A6NK53	ZN233_HUMAN	zinc finger protein 233	349					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|skin(3)|urinary_tract(1)	20		Prostate(69;0.0435)|all_neural(266;0.226)				GTATATGCCCGGAGCTCCAAC	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		20355	0.0		0.0	False		,,,				2504	0.001				p.R349Q		Atlas-SNP	.											.	ZNF233	73	.	0			c.G1046A						PASS	.						102.0	97.0	99.0					19																	44777859		2203	4300	6503	SO:0001583	missense	353355	exon5			ATGCCCGGAGCTC	AY166792	CCDS33047.1	19q13.31	2013-01-08				ENSG00000159915		"""Zinc fingers, C2H2-type"", ""-"""	30946	protein-coding gene	gene with protein product						12743021	Standard	NM_001207005		Approved	FLJ38032	uc021uvi.1	A6NK53		ENST00000391958.2:c.1046G>A	19.37:g.44777859G>A	ENSP00000375820:p.Arg349Gln	125.0	0.0	0		142.0	44.0	0.309859	NM_001207005	B2RN78|B2RN79|Q86WL8	Missense_Mutation	SNP	ENST00000391958.2	37	CCDS33047.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610015	0.28712	.	.	ENSG00000159915	ENST00000334152;ENST00000391958;ENST00000280305	T;T	0.15718	2.4;2.4	4.29	-0.708	0.11241	.	.	.	.	.	T	0.11024	0.0269	L	0.28400	0.85	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30119	-0.9989	9	0.62326	D	0.03	0.0227	5.1768	0.15139	0.6014:0.1424:0.2562:0.0	.	349	A6NK53	ZN233_HUMAN	Q	331;349;270	ENSP00000334957:R331Q;ENSP00000375820:R349Q	ENSP00000280305:R270Q	R	+	2	0	ZNF233	49469699	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.049000	0.14099	-0.106000	0.12110	-0.355000	0.07637	CGG	.	.	none		0.527	ZNF233-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460737.1	NM_181756	
SRRM2	23524	hgsc.bcm.edu	37	16	2816548	2816548	+	Missense_Mutation	SNP	C	C	T	rs555127784		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr16:2816548C>T	ENST00000301740.8	+	11	6568	c.6019C>T	c.(6019-6021)Cgc>Tgc	p.R2007C		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	2007	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AAGAAGGTCCCGCTCTCGAAC	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17179	0.0		0.0	False		,,,				2504	0.0				p.R2007C		Atlas-SNP	.											SRRM2,colon,carcinoma,-1,1	SRRM2	263	1	0			c.C6019T						PASS	.						73.0	78.0	76.0					16																	2816548		2198	4300	6498	SO:0001583	missense	23524	exon11			AGGTCCCGCTCTC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.6019C>T	16.37:g.2816548C>T	ENSP00000301740:p.Arg2007Cys	114.0	0.0	0		114.0	5.0	0.0438596	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	9.797	1.179393	0.21787	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.27890	1.64	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000020	T	0.33818	0.0876	N	0.08118	0	0.45791	D	0.998673	D	0.89917	1.0	D	0.80764	0.994	T	0.35822	-0.9773	10	0.72032	D	0.01	-6.8635	11.8353	0.52321	0.1749:0.8251:0.0:0.0	.	2007	Q9UQ35	SRRM2_HUMAN	C	2007;2007;1259	ENSP00000301740:R2007C	ENSP00000301740:R2007C	R	+	1	0	SRRM2	2756549	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	2.556000	0.45862	2.572000	0.86782	0.650000	0.86243	CGC	.	.	none		0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
ALG6	29929	hgsc.bcm.edu	37	1	63867944	63867944	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:63867944A>G	ENST00000371108.4	+	4	492	c.187A>G	c.(187-189)Aac>Gac	p.N63D	ALG6_ENST00000263440.4_Missense_Mutation_p.N63D	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	63					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CAGCAGTGATAACAATTTACA	0.318																																					p.N63D		Atlas-SNP	.											.	ALG6	33	.	0			c.A187G						PASS	.						109.0	109.0	109.0					1																	63867944		2203	4299	6502	SO:0001583	missense	29929	exon4			AGTGATAACAATT	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.187A>G	1.37:g.63867944A>G	ENSP00000360149:p.Asn63Asp	89.0	0.0	0		66.0	4.0	0.0606061	NM_013339	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	ENST00000371108.4	37	CCDS30735.1	.	.	.	.	.	.	.	.	.	.	a	26.4	4.734192	0.89482	.	.	ENSG00000088035	ENST00000371108;ENST00000263440	D;D	0.83837	-1.77;-1.77	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.90515	0.7028	M	0.91406	3.205	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	D	0.90800	0.4693	10	0.36615	T	0.2	-20.3602	14.4035	0.67065	1.0:0.0:0.0:0.0	.	63	A2A2G4	.	D	63	ENSP00000360149:N63D;ENSP00000263440:N63D	ENSP00000263440:N63D	N	+	1	0	ALG6	63640532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.928000	0.92853	1.806000	0.52798	0.455000	0.32223	AAC	.	.	none		0.318	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
RFX7	64864	hgsc.bcm.edu	37	15	56387864	56387864	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:56387864G>A	ENST00000559447.2	-	9	2042	c.1771C>T	c.(1771-1773)Cag>Tag	p.Q591*	RFX7_ENST00000423270.1_Nonsense_Mutation_p.Q688*|RFX7_ENST00000422057.1_Nonsense_Mutation_p.Q591*|RFX7_ENST00000317318.6_Nonsense_Mutation_p.Q688*			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	591					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						CCTTGTTTCTGCCCTTCTATG	0.458																																					p.Q688X		Atlas-SNP	.											.	RFX7	170	.	0			c.C2062T						PASS	.						119.0	110.0	113.0					15																	56387864		1903	4122	6025	SO:0001587	stop_gained	64864	exon9			GTTTCTGCCCTTC			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1771C>T	15.37:g.56387864G>A	ENSP00000453281:p.Gln591*	242.0	0.0	0		319.0	127.0	0.398119	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Nonsense_Mutation	SNP	ENST00000559447.2	37		.	.	.	.	.	.	.	.	.	.	G	35	5.487851	0.96323	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	.	.	.	5.57	5.57	0.84162	.	0.272984	0.27134	N	0.020761	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-2.2321	18.5333	0.91000	0.0:0.0:1.0:0.0	.	.	.	.	X	591;688;688	.	ENSP00000313299:Q688X	Q	-	1	0	RFX7	54175156	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	4.113000	0.57851	2.600000	0.87896	0.655000	0.94253	CAG	.	.	none		0.458	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
CNGB3	54714	hgsc.bcm.edu	37	8	87641188	87641188	+	Missense_Mutation	SNP	C	C	T	rs77277189	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:87641188C>T	ENST00000320005.5	-	12	1486	c.1439G>A	c.(1438-1440)cGg>cAg	p.R480Q		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	480					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						ATACCAAGTCCGAACTCGCTT	0.418													C|||	11	0.00219649	0.0083	0.0	5008	,	,		18826	0.0		0.0	False		,,,				2504	0.0				p.R480Q		Atlas-SNP	.											.	CNGB3	176	.	0			c.G1439A						PASS	.	C	GLN/ARG	30,4376	36.0+/-67.5	0,30,2173	221.0	207.0	212.0		1439	4.1	0.8	8	dbSNP_131	212	0,8600		0,0,4300	yes	missense	CNGB3	NM_019098.4	43	0,30,6473	TT,TC,CC		0.0,0.6809,0.2307	probably-damaging	480/810	87641188	30,12976	2203	4300	6503	SO:0001583	missense	54714	exon12			CAAGTCCGAACTC	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1439G>A	8.37:g.87641188C>T	ENSP00000316605:p.Arg480Gln	190.0	0.0	0		165.0	41.0	0.248485	NM_019098	C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	C	22.5	4.298296	0.81025	0.006809	0.0	ENSG00000170289	ENST00000320005	D	0.97186	-4.28	5.92	4.14	0.48551	Cyclic nucleotide-binding-like (1);	0.062472	0.64402	D	0.000013	D	0.94879	0.8345	M	0.68728	2.09	0.52501	D	0.999959	P;P	0.50819	0.939;0.899	P;P	0.47162	0.54;0.49	D	0.92368	0.5903	10	0.33141	T	0.24	.	12.7654	0.57388	0.0:0.8674:0.0:0.1326	.	480;480	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	Q	480	ENSP00000316605:R480Q	ENSP00000316605:R480Q	R	-	2	0	CNGB3	87710304	0.964000	0.33143	0.750000	0.31169	0.945000	0.59286	3.226000	0.51254	0.853000	0.35312	0.555000	0.69702	CGG	C|0.997;T|0.003	0.003	strong		0.418	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
GRB2	2885	hgsc.bcm.edu	37	17	73321980	73321980	+	Splice_Site	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:73321980T>C	ENST00000392562.1	-	4	1080	c.298A>G	c.(298-300)Aag>Gag	p.K100E	GRB2_ENST00000316804.5_Splice_Site_p.K100E|GRB2_ENST00000392564.1_Splice_Site_p.K100E|GRB2_ENST00000462266.1_5'UTR|GRB2_ENST00000392563.1_Intron|GRB2_ENST00000316615.5_Intron|GRB2_ENST00000578961.1_Splice_Site_p.N100D			P62993	GRB2_HUMAN	growth factor receptor-bound protein 2	100	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				aging (GO:0007568)|anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to ionizing radiation (GO:0071479)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of MAPK cascade (GO:0043408)|signal transduction in response to DNA damage (GO:0042770)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Grb2-EGFR complex (GO:0070436)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|identical protein binding (GO:0042802)|insulin receptor substrate binding (GO:0043560)|neurotrophin TRKA receptor binding (GO:0005168)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	17	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	AATACTTACTTGACAGAGAGG	0.522																																					p.K100E		Atlas-SNP	.											.	GRB2	33	.	0			c.A298G						PASS	.						87.0	91.0	90.0					17																	73321980		2203	4300	6503	SO:0001630	splice_region_variant	2885	exon4			CTTACTTGACAGA		CCDS11721.1, CCDS11722.1	17q24-q25	2013-02-14			ENSG00000177885	ENSG00000177885		"""SH2 domain containing"""	4566	protein-coding gene	gene with protein product		108355					Standard	NM_002086		Approved	NCKAP2	uc002jnx.4	P62993	OTTHUMG00000134332	ENST00000392562.1:c.299+1A>G	17.37:g.73321980T>C		57.0	0.0	0		41.0	11.0	0.268293	NM_002086	P29354|Q14450|Q63057|Q63059	Missense_Mutation	SNP	ENST00000392562.1	37	CCDS11721.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.396281	0.83011	.	.	ENSG00000177885	ENST00000316804;ENST00000392562;ENST00000392564	D;D;D	0.89196	-2.48;-2.48;-2.48	5.28	5.28	0.74379	SH2 motif (5);	0.083338	0.85682	D	0.000000	D	0.93239	0.7846	M	0.93420	3.415	0.80722	D	1	B	0.22211	0.066	B	0.35770	0.21	D	0.92705	0.6178	10	0.72032	D	0.01	-25.8083	15.4247	0.75041	0.0:0.0:0.0:1.0	.	100	P62993	GRB2_HUMAN	E	100	ENSP00000339007:K100E;ENSP00000376345:K100E;ENSP00000376347:K100E	ENSP00000339007:K100E	K	-	1	0	GRB2	70833575	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.838000	0.86804	2.240000	0.73641	0.477000	0.44152	AAG	.	.	none		0.522	GRB2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259476.1		Missense_Mutation
DOCK3	1795	hgsc.bcm.edu	37	3	51317590	51317590	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:51317590T>C	ENST00000266037.9	+	27	2900	c.2877T>C	c.(2875-2877)caT>caC	p.H959H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	959					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		GTGACACCCATTTCCAGCACC	0.537																																					p.H959H		Atlas-SNP	.											.	DOCK3	397	.	0			c.T2877C						PASS	.						76.0	77.0	77.0					3																	51317590		2092	4220	6312	SO:0001819	synonymous_variant	1795	exon27			CACCCATTTCCAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2877T>C	3.37:g.51317590T>C		175.0	0.0	0		228.0	64.0	0.280702	NM_004947	O15017	Silent	SNP	ENST00000266037.9	37	CCDS46835.1																																																																																			.	.	none		0.537	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
ZMYND15	84225	hgsc.bcm.edu	37	17	4645298	4645298	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:4645298G>A	ENST00000433935.1	+	4	973	c.916G>A	c.(916-918)Gct>Act	p.A306T	CXCL16_ENST00000574412.1_5'Flank|ZMYND15_ENST00000573751.2_Missense_Mutation_p.A306T|ZMYND15_ENST00000269289.6_Missense_Mutation_p.A306T|CXCL16_ENST00000293778.6_5'Flank|ZMYND15_ENST00000592813.1_Missense_Mutation_p.A306T	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	306					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						CTTCACCTTTGCTTCCCTTCG	0.567																																					p.A306T		Atlas-SNP	.											.	ZMYND15	87	.	0			c.G916A						PASS	.						79.0	83.0	82.0					17																	4645298		2203	4300	6503	SO:0001583	missense	84225	exon4			ACCTTTGCTTCCC	AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.916G>A	17.37:g.4645298G>A	ENSP00000391742:p.Ala306Thr	94.0	0.0	0		118.0	40.0	0.338983	NM_001136046	B4DXY5|I3L296	Missense_Mutation	SNP	ENST00000433935.1	37	CCDS45584.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.806938	0.70797	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.53206	0.67;0.63	5.15	5.15	0.70609	.	0.094778	0.45606	D	0.000355	T	0.53965	0.1829	L	0.29908	0.895	0.33804	D	0.627042	D;D	0.69078	0.997;0.997	D;D	0.73380	0.913;0.98	T	0.64322	-0.6435	10	0.56958	D	0.05	-19.1442	11.1144	0.48252	0.0:0.0:0.8159:0.1841	.	306;306	B4DXY5;Q9H091	.;ZMY15_HUMAN	T	306	ENSP00000391742:A306T;ENSP00000269289:A306T	ENSP00000269289:A306T	A	+	1	0	ZMYND15	4592047	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.585000	0.46111	2.677000	0.91161	0.563000	0.77884	GCT	.	.	none		0.567	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439580.1	NM_032265	
TMCC2	9911	hgsc.bcm.edu	37	1	205238355	205238355	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:205238355A>G	ENST00000358024.3	+	3	1414	c.1025A>G	c.(1024-1026)aAg>aGg	p.K342R	TMCC2_ENST00000329800.7_Missense_Mutation_p.K102R|TMCC2_ENST00000545499.1_Missense_Mutation_p.K264R|TMCC2_ENST00000495538.1_3'UTR|TMCC2_ENST00000330675.7_Missense_Mutation_p.K117R	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	342						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AAGAACCAGAAGTCAGCCCAG	0.592																																					p.K342R		Atlas-SNP	.											.	TMCC2	89	.	0			c.A1025G						PASS	.						57.0	46.0	50.0					1																	205238355		2203	4300	6503	SO:0001583	missense	9911	exon3			ACCAGAAGTCAGC	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.1025A>G	1.37:g.205238355A>G	ENSP00000350718:p.Lys342Arg	87.0	0.0	0		83.0	4.0	0.0481928	NM_014858	A2RRH3|B7Z1P7|Q6ZN09	Missense_Mutation	SNP	ENST00000358024.3	37	CCDS30984.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.746863	0.89663	.	.	ENSG00000133069	ENST00000358024;ENST00000545499;ENST00000367159;ENST00000330675;ENST00000329800	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.64811	0.2632	L	0.59912	1.85	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.972	D;D;D;D	0.87578	0.998;0.997;0.998;0.946	T	0.62609	-0.6818	10	0.35671	T	0.21	.	15.5977	0.76599	1.0:0.0:0.0:0.0	.	138;102;117;342	Q8IW47;G5E963;B2RAX5;O75069	.;.;.;TMCC2_HUMAN	R	342;264;146;117;102	ENSP00000350718:K342R;ENSP00000437943:K264R;ENSP00000356127:K146R;ENSP00000331842:K117R;ENSP00000329436:K102R	ENSP00000329436:K102R	K	+	2	0	TMCC2	203504978	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.339000	0.96797	2.170000	0.68504	0.379000	0.24179	AAG	.	.	none		0.592	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090383.1	NM_014858	
HRCT1	646962	hgsc.bcm.edu	37	9	35906607	35906607	+	Missense_Mutation	SNP	G	G	C	rs201684694		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:35906607G>C	ENST00000354323.2	+	1	419	c.323G>C	c.(322-324)cGc>cCc	p.R108P	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	108	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						cacccccaccgccaccatccc	0.677																																					p.R108P		Atlas-SNP	.											HRCT1,NS,carcinoma,0,1	HRCT1	14	1	0			c.G323C						scavenged	.						5.0	6.0	5.0					9																	35906607		1670	3248	4918	SO:0001583	missense	646962	exon1			CCCACCGCCACCA		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.323G>C	9.37:g.35906607G>C	ENSP00000346283:p.Arg108Pro	32.0	2.0	0.0625		22.0	11.0	0.5	NM_001039792	B7ZBJ1	Missense_Mutation	SNP	ENST00000354323.2	37	CCDS35012.1	.	.	.	.	.	.	.	.	.	.	G	3.247	-0.154060	0.06585	.	.	ENSG00000196196	ENST00000354323	.	.	.	0.698	-1.4	0.08968	.	0.824948	0.09848	N	0.747995	T	0.09335	0.0230	N	0.08118	0	0.09310	N	1	D	0.53312	0.959	B	0.36989	0.238	T	0.17077	-1.0381	8	0.87932	D	0	-29.2099	.	.	.	.	108	Q6UXD1	HRCT1_HUMAN	P	108	.	ENSP00000346283:R108P	R	+	2	0	HRCT1	35896607	0.000000	0.05858	0.002000	0.10522	0.343000	0.28985	-0.250000	0.08830	-0.783000	0.04534	-0.346000	0.07831	CGC	.	.	alt		0.677	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334099.1	NM_001039792	
SVEP1	79987	hgsc.bcm.edu	37	9	113259095	113259095	+	Splice_Site	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:113259095C>G	ENST00000401783.2	-	8	2136	c.1800G>C	c.(1798-1800)aaG>aaC	p.K600N	SVEP1_ENST00000374461.1_Splice_Site_p.K577N|SVEP1_ENST00000302728.8_Splice_Site_p.K600N|SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Splice_Site_p.K577N	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	600	HYR 1. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)	p.K600N(1)		NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CAAACCTTACCTTTTCACCAG	0.383																																					p.K600N		Atlas-SNP	.											SVEP1,colon,carcinoma,0,1	SVEP1	326	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1800C						PASS	.						122.0	110.0	114.0					9																	113259095		1867	4071	5938	SO:0001630	splice_region_variant	79987	exon8			CCTTACCTTTTCA	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1800+1G>C	9.37:g.113259095C>G		204.0	0.0	0		198.0	60.0	0.30303	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181594	0.57800	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.77750	-0.97;-0.98;-1.12;1.21	5.71	4.81	0.61882	Hyalin (2);	0.152075	0.64402	D	0.000013	T	0.70657	0.3249	N	0.16233	0.39	0.39786	D	0.972375	P;P;P	0.43231	0.801;0.801;0.557	P;B;B	0.49192	0.602;0.339;0.167	T	0.69993	-0.4994	9	.	.	.	.	13.6089	0.62063	0.0:0.9241:0.0:0.0759	.	600;600;600	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	N	600;577;600;577	ENSP00000384917:K600N;ENSP00000363593:K577N;ENSP00000304118:K600N;ENSP00000363585:K577N	.	K	-	3	2	SVEP1	112298916	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	6.089000	0.71384	1.430000	0.47334	-0.237000	0.12165	AAG	.	.	none		0.383	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Missense_Mutation
MYC	4609	hgsc.bcm.edu	37	8	128752802	128752802	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128752802G>C	ENST00000377970.2	+	3	1473	c.963G>C	c.(961-963)caG>caC	p.Q321H	MYC_ENST00000524013.1_Missense_Mutation_p.Q320H	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	306					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CCACACATCAGCACAACTACG	0.567		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																p.Q321H		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,carcinoma,+2,2	MYC	168	2	0			c.G963C						scavenged	.						87.0	66.0	73.0					8																	128752802		2203	4300	6503	SO:0001583	missense	4609	exon3			ACATCAGCACAAC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.963G>C	8.37:g.128752802G>C	ENSP00000367207:p.Gln321His	131.0	1.0	0.00763359		127.0	46.0	0.362205	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000377970.2	37	CCDS6359.2	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437078	0.62955	.	.	ENSG00000136997	ENST00000377970;ENST00000524013;ENST00000454617	T;T	0.29142	1.58;1.58	5.54	3.75	0.43078	Transcription regulator Myc, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53136	-0.8481	10	0.87932	D	0	-23.0286	7.9696	0.30119	0.3035:0.0:0.6965:0.0	.	306	P01106	MYC_HUMAN	H	321;320;287	ENSP00000367207:Q321H;ENSP00000430235:Q320H	ENSP00000367207:Q321H	Q	+	3	2	MYC	128821984	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	0.831000	0.27476	1.338000	0.45544	0.650000	0.86243	CAG	.	.	none		0.567	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3		
ID3	3399	hgsc.bcm.edu	37	1	23885690	23885690	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:23885690G>T	ENST00000374561.5	-	1	595	c.228C>A	c.(226-228)taC>taA	p.Y76*	ID3_ENST00000486541.1_5'UTR	NM_002167.4	NP_002158.3	Q02535	ID3_HUMAN	inhibitor of DNA binding 3, dominant negative helix-loop-helix protein	76	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|epithelial cell differentiation (GO:0030855)|heart development (GO:0007507)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|notochord development (GO:0030903)|odontogenesis (GO:0042476)|positive regulation of apoptotic process (GO:0043065)|regulation of cell cycle (GO:0051726)|regulation of DNA replication (GO:0006275)|response to wounding (GO:0009611)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|lung(3)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		GGTCGAGAATGTAGTCGATGA	0.622																																					p.Y76X		Atlas-SNP	.											ID3,NS,lymphoid_neoplasm,-1,1	ID3	29	1	0			c.C228A						PASS	.						58.0	64.0	62.0					1																	23885690		2203	4300	6503	SO:0001587	stop_gained	3399	exon1			GAGAATGTAGTCG	X69111	CCDS237.1	1p36.13-p36.12	2013-05-21			ENSG00000117318	ENSG00000117318		"""Basic helix-loop-helix proteins"""	5362	protein-coding gene	gene with protein product		600277				1628620	Standard	NM_002167		Approved	HEIR-1, bHLHb25	uc001bhh.4	Q02535	OTTHUMG00000003229	ENST00000374561.5:c.228C>A	1.37:g.23885690G>T	ENSP00000363689:p.Tyr76*	96.0	0.0	0		111.0	70.0	0.630631	NM_002167	A8K1T8|O75641	Nonsense_Mutation	SNP	ENST00000374561.5	37	CCDS237.1	.	.	.	.	.	.	.	.	.	.	G	39	7.592021	0.98378	.	.	ENSG00000117318	ENST00000374561	.	.	.	5.6	3.74	0.42951	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6025	10.9515	0.47332	0.1528:0.0:0.8472:0.0	.	.	.	.	X	76	.	ENSP00000363689:Y76X	Y	-	3	2	ID3	23758277	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.456000	0.53000	0.736000	0.32559	0.591000	0.81541	TAC	.	.	none		0.622	ID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008904.1	NM_002167	
GPR101	83550	hgsc.bcm.edu	37	X	136112327	136112327	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:136112327C>T	ENST00000298110.1	-	1	1506	c.1507G>A	c.(1507-1509)Gat>Aat	p.D503N		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	503						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					GTAGCAGAATCGTAGGAAGGG	0.463																																					p.D503N		Atlas-SNP	.											.	GPR101	96	.	0			c.G1507A						PASS	.						82.0	76.0	78.0					X																	136112327		2203	4300	6503	SO:0001583	missense	83550	exon1			CAGAATCGTAGGA	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.1507G>A	X.37:g.136112327C>T	ENSP00000298110:p.Asp503Asn	48.0	0.0	0		48.0	33.0	0.6875	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	37	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	C	2.727	-0.265337	0.05754	.	.	ENSG00000165370	ENST00000298110	T	0.64618	-0.11	5.32	0.906	0.19314	.	.	.	.	.	T	0.38772	0.1053	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.06405	0.002	T	0.21759	-1.0236	9	0.45353	T	0.12	-6.3616	3.4501	0.07495	0.2836:0.4116:0.0:0.3048	.	503	Q96P66	GP101_HUMAN	N	503	ENSP00000298110:D503N	ENSP00000298110:D503N	D	-	1	0	GPR101	135939993	0.319000	0.24607	0.010000	0.14722	0.254000	0.26022	0.603000	0.24149	0.194000	0.20326	-0.511000	0.04467	GAT	.	.	none		0.463	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
SRSF7	6432	hgsc.bcm.edu	37	2	38977316	38977316	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:38977316T>A	ENST00000313117.6	-	2	286	c.49A>T	c.(49-51)Aac>Tac	p.N17Y	SRSF7_ENST00000446327.2_Missense_Mutation_p.N17Y|GEMIN6_ENST00000409011.1_5'Flank|SRSF7_ENST00000409276.1_Missense_Mutation_p.N17Y	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	17	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GTTCCCAGGTTACCAACATAC	0.413																																					p.N17Y		Atlas-SNP	.											.	SRSF7	29	.	0			c.A49T						PASS	.						101.0	100.0	100.0					2																	38977316		2203	4300	6503	SO:0001583	missense	6432	exon2			CCAGGTTACCAAC	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.49A>T	2.37:g.38977316T>A	ENSP00000325905:p.Asn17Tyr	86.0	0.0	0		87.0	33.0	0.37931	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	T	19.10	3.762475	0.69763	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	D;D;D	0.82803	-1.65;-1.65;-1.65	6.07	6.07	0.98685	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	M	0.91090	3.175	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.80764	0.993;0.994	D	0.94275	0.7514	10	0.87932	D	0	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	17;17	G5E9M3;Q16629	.;SRSF7_HUMAN	Y	17	ENSP00000325905:N17Y;ENSP00000402264:N17Y;ENSP00000386806:N17Y	ENSP00000325905:N17Y	N	-	1	0	SRSF7	38830820	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.233000	0.51311	2.326000	0.78906	0.533000	0.62120	AAC	.	.	none		0.413	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
SDK2	54549	hgsc.bcm.edu	37	17	71431699	71431699	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:71431699T>C	ENST00000392650.3	-	9	1085	c.1085A>G	c.(1084-1086)gAc>gGc	p.D362G	SDK2_ENST00000388726.3_Missense_Mutation_p.D362G	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	362	Ig-like C2-type 4.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CAGGCCCCCGTCGTTGCGCTG	0.652																																					p.D362G		Atlas-SNP	.											SDK2,NS,carcinoma,+1,1	SDK2	219	1	0			c.A1085G						scavenged	.						48.0	34.0	39.0					17																	71431699		2201	4297	6498	SO:0001583	missense	54549	exon9			CCCCCGTCGTTGC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1085A>G	17.37:g.71431699T>C	ENSP00000376421:p.Asp362Gly	101.0	1.0	0.00990099		69.0	3.0	0.0434783	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.071712	0.36566	.	.	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.38722	1.12;1.12	4.84	4.84	0.62591	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.127433	0.53938	D	0.000057	T	0.20740	0.0499	N	0.04768	-0.165	0.33996	D	0.649673	B;B	0.11235	0.004;0.001	B;B	0.15052	0.012;0.012	T	0.25012	-1.0144	9	.	.	.	.	10.5573	0.45125	0.0:0.0:0.162:0.838	.	362;362	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	G	362	ENSP00000376421:D362G;ENSP00000373378:D362G	.	D	-	2	0	SDK2	68943294	0.990000	0.36364	0.843000	0.33291	0.816000	0.46133	3.419000	0.52728	1.798000	0.52647	0.459000	0.35465	GAC	.	.	none		0.652	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
LGI3	203190	hgsc.bcm.edu	37	8	22005779	22005779	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:22005779C>T	ENST00000306317.2	-	8	1830	c.1541G>A	c.(1540-1542)cGg>cAg	p.R514Q	LGI3_ENST00000424267.2_Missense_Mutation_p.R490Q	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	514					exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)			endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		GCAGAAGGCCCGAGGAGCCTG	0.582																																					p.R514Q		Atlas-SNP	.											LGI3,mouth,carcinoma,-1,1	LGI3	44	1	0			c.G1541A						scavenged	.						70.0	64.0	66.0					8																	22005779		2203	4300	6503	SO:0001583	missense	203190	exon8			AAGGCCCGAGGAG	AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599	ENST00000306317.2:c.1541G>A	8.37:g.22005779C>T	ENSP00000302297:p.Arg514Gln	62.0	1.0	0.016129		47.0	8.0	0.170213	NM_139278	A5PLP2|Q86TL4|Q8N296	Missense_Mutation	SNP	ENST00000306317.2	37	CCDS6025.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962688	0.92791	.	.	ENSG00000168481	ENST00000306317;ENST00000424267	T;T	0.80994	-1.44;-1.44	4.95	4.95	0.65309	.	0.000000	0.64402	D	0.000001	D	0.89022	0.6597	M	0.73598	2.24	0.52501	D	0.99995	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.988	D	0.90464	0.4448	10	0.87932	D	0	-46.0234	15.6803	0.77364	0.0:1.0:0.0:0.0	.	490;514	A5PLP2;Q8N145	.;LGI3_HUMAN	Q	514;490	ENSP00000302297:R514Q;ENSP00000399121:R490Q	ENSP00000302297:R514Q	R	-	2	0	LGI3	22061724	0.981000	0.34729	0.993000	0.49108	0.994000	0.84299	7.479000	0.81095	2.246000	0.74042	0.561000	0.74099	CGG	.	.	none		0.582	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254482.1		
MYO5B	4645	hgsc.bcm.edu	37	18	47462675	47462675	+	Silent	SNP	C	C	T	rs180849030	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:47462675C>T	ENST00000285039.7	-	16	2249	c.1950G>A	c.(1948-1950)acG>acA	p.T650T		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	650	Actin-binding. {ECO:0000255}.|Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)	p.T650T(1)		NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGTGAGGTGTCGTGGCATTCA	0.517													C|||	2	0.000399361	0.0	0.0	5008	,	,		20181	0.0		0.002	False		,,,				2504	0.0				p.T650T		Atlas-SNP	.											MYO5B,NS,carcinoma,0,1	MYO5B	178	1	1	Substitution - coding silent(1)	lung(1)	c.G1950A						PASS	.						97.0	100.0	99.0					18																	47462675		2083	4237	6320	SO:0001819	synonymous_variant	4645	exon16			AGGTGTCGTGGCA	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1950G>A	18.37:g.47462675C>T		120.0	0.0	0		159.0	56.0	0.352201	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	37	CCDS42436.1																																																																																			C|0.999;T|0.001	0.001	strong		0.517	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
FAM64A	54478	hgsc.bcm.edu	37	17	6352690	6352690	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:6352690T>C	ENST00000250056.8	+	4	732	c.649T>C	c.(649-651)Tcc>Ccc	p.S217P	FAM64A_ENST00000576056.1_Missense_Mutation_p.S217P|FAM64A_ENST00000572447.1_Missense_Mutation_p.S217P|FAM64A_ENST00000570337.2_Missense_Mutation_p.S217P|FAM64A_ENST00000572595.2_Missense_Mutation_p.S248P|FAM64A_ENST00000571373.1_Missense_Mutation_p.S217P	NM_001195228.1	NP_001182157.1	Q9BSJ6	FA64A_HUMAN	family with sequence similarity 64, member A	217					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				COAD - Colon adenocarcinoma(228;0.141)		CCAGAAGCTGTCCCAAGAGCT	0.537																																					p.S217P		Atlas-SNP	.											.	FAM64A	20	.	0			c.T649C						PASS	.						86.0	82.0	84.0					17																	6352690		2203	4300	6503	SO:0001583	missense	54478	exon4			AAGCTGTCCCAAG		CCDS32541.1, CCDS56016.1	17p13.2	2013-10-11			ENSG00000129195	ENSG00000129195			25483	protein-coding gene	gene with protein product	"""CALM interacting protein expressed in thymus and spleen"""					19383357, 16491119	Standard	NM_019013		Approved	FLJ10156, FLJ10491, CATS	uc002gcw.2	Q9BSJ6	OTTHUMG00000177832	ENST00000250056.8:c.649T>C	17.37:g.6352690T>C	ENSP00000250056:p.Ser217Pro	68.0	0.0	0		78.0	5.0	0.0641026	NM_019013	Q96CT4|Q9NVV1|Q9NWB5	Missense_Mutation	SNP	ENST00000250056.8	37	CCDS56016.1	.	.	.	.	.	.	.	.	.	.	.	20.5	4.007184	0.75046	.	.	ENSG00000129195	ENST00000250056;ENST00000308855	T	0.56611	0.45	5.75	5.75	0.90469	.	0.076511	0.51477	D	0.000093	T	0.70343	0.3213	M	0.72118	2.19	0.41665	D	0.989202	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.73852	-0.3852	10	0.66056	D	0.02	-19.9763	12.4405	0.55621	0.0:0.0:0.0:1.0	.	217;217	Q9BSJ6;Q9BSJ6-2	FA64A_HUMAN;.	P	217	ENSP00000250056:S217P	ENSP00000250056:S217P	S	+	1	0	FAM64A	6293414	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	2.868000	0.48436	2.196000	0.70406	0.460000	0.39030	TCC	.	.	none		0.537	FAM64A-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000439156.1	NM_019013	
MACROD2	140733	hgsc.bcm.edu	37	20	14665585	14665585	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:14665585G>T	ENST00000310348.4	+	5	398	c.398G>T	c.(397-399)gGc>gTc	p.G133V	MACROD2_ENST00000464883.1_3'UTR|MACROD2_ENST00000217246.4_Missense_Mutation_p.G133V			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	133	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				ATCACATGTGGCTATGACCTT	0.418																																					p.G133V		Atlas-SNP	.											.	MACROD2	34	.	0			c.G398T						PASS	.						133.0	125.0	127.0					20																	14665585		1924	4158	6082	SO:0001583	missense	140733	exon5			CATGTGGCTATGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.398G>T	20.37:g.14665585G>T	ENSP00000309809:p.Gly133Val	140.0	0.0	0		139.0	51.0	0.366906	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947925	0.92593	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.26957	1.7;1.7	5.62	5.62	0.85841	Appr-1-p processing (3);	0.000000	0.64402	D	0.000006	T	0.70666	0.3250	H	0.98866	4.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.83547	0.0099	10	0.87932	D	0	-13.8763	18.6571	0.91458	0.0:0.0:1.0:0.0	.	133;133	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	V	133	ENSP00000217246:G133V;ENSP00000309809:G133V	ENSP00000217246:G133V	G	+	2	0	MACROD2	14613585	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.642000	0.89623	0.655000	0.94253	GGC	.	.	none		0.418	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
LRIG1	26018	hgsc.bcm.edu	37	3	66432748	66432748	+	Missense_Mutation	SNP	C	C	G	rs147267806		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:66432748C>G	ENST00000273261.3	-	16	3090	c.2566G>C	c.(2566-2568)Gtg>Ctg	p.V856L	SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000383703.3_Missense_Mutation_p.V833L|LRIG1_ENST00000496559.2_5'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	856					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GTCCTGACCACGGTTTCTTGT	0.532																																					p.V856L		Atlas-SNP	.											.	LRIG1	138	.	0			c.G2566C						PASS	.						149.0	153.0	151.0					3																	66432748		2203	4300	6503	SO:0001583	missense	26018	exon16			TGACCACGGTTTC	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2566G>C	3.37:g.66432748C>G	ENSP00000273261:p.Val856Leu	139.0	0.0	0		146.0	39.0	0.267123	NM_015541	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	C	6.761	0.509283	0.12883	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.63913	-0.05;-0.07	5.5	2.73	0.32206	.	0.414681	0.26991	N	0.021468	T	0.49813	0.1579	L	0.40543	1.245	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.35549	-0.9784	10	0.33141	T	0.24	.	10.5755	0.45225	0.0:0.7859:0.0:0.2141	.	833;856;856	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	L	856;833;759	ENSP00000273261:V856L;ENSP00000373208:V833L	ENSP00000273261:V856L	V	-	1	0	LRIG1	66515438	0.000000	0.05858	0.117000	0.21633	0.136000	0.21042	0.099000	0.15210	0.280000	0.22209	-0.751000	0.03497	GTG	C|1.000;T|0.000	.	alt		0.532	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
PLK4	10733	hgsc.bcm.edu	37	4	128804641	128804641	+	Silent	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:128804641A>G	ENST00000270861.5	+	4	544	c.270A>G	c.(268-270)gaA>gaG	p.E90E	PLK4_ENST00000514379.1_Silent_p.E49E|PLK4_ENST00000513090.1_Silent_p.E58E|PLK4_ENST00000515069.1_Silent_p.E90E|PLK4_ENST00000511942.1_3'UTR|PLK4_ENST00000507249.1_Silent_p.E90E	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	90	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						TGGTATTAGAAATGTGCCATA	0.299																																					p.E90E	Colon(135;508 1718 19061 31832 42879)	Atlas-SNP	.											PLK4,NS,carcinoma,+1,1	PLK4	65	1	0			c.A270G						scavenged	.						66.0	71.0	69.0					4																	128804641		2203	4294	6497	SO:0001819	synonymous_variant	10733	exon4			ATTAGAAATGTGC	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.270A>G	4.37:g.128804641A>G		88.0	0.0	0		71.0	3.0	0.0422535	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Silent	SNP	ENST00000270861.5	37	CCDS3735.1																																																																																			.	.	none		0.299	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
PKD1L1	168507	hgsc.bcm.edu	37	7	47873941	47873941	+	Missense_Mutation	SNP	C	C	T	rs17131834	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:47873941C>T	ENST00000289672.2	-	40	6220	c.6170G>A	c.(6169-6171)cGc>cAc	p.R2057H		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2057			R -> H (in dbSNP:rs17131834).		detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ATTTACCTTGCGTGGCTCCTG	0.428													C|||	98	0.0195687	0.0696	0.0072	5008	,	,		21422	0.001		0.0	False		,,,				2504	0.0				p.R2057H		Atlas-SNP	.											.	PKD1L1	328	.	0			c.G6170A						PASS	.	C	HIS/ARG	203,4203	125.3+/-162.5	6,191,2006	144.0	128.0	134.0		6170	-7.9	0.0	7	dbSNP_123	134	0,8600		0,0,4300	yes	missense	PKD1L1	NM_138295.3	29	6,191,6306	TT,TC,CC		0.0,4.6074,1.5608	benign	2057/2850	47873941	203,12803	2203	4300	6503	SO:0001583	missense	168507	exon40			ACCTTGCGTGGCT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6170G>A	7.37:g.47873941C>T	ENSP00000289672:p.Arg2057His	81.0	0.0	0		81.0	4.0	0.0493827	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	37	0.01694139194139194	32	0.06504065040650407	4	0.011049723756906077	1	0.0017482517482517483	0	0.0	C	3.158	-0.172750	0.06421	0.046074	0.0	ENSG00000158683	ENST00000289672	T	0.19669	2.13	3.93	-7.87	0.01183	.	2749.160000	0.00357	U	0.000035	T	0.00724	0.0024	N	0.22421	0.69	0.09310	N	1	B	0.31077	0.307	B	0.20384	0.029	T	0.06534	-1.0821	10	0.15499	T	0.54	.	8.1002	0.30852	0.0:0.1383:0.574:0.2877	rs17131834	2057	Q8TDX9	PK1L1_HUMAN	H	2057	ENSP00000289672:R2057H	ENSP00000289672:R2057H	R	-	2	0	PKD1L1	47840466	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.982000	0.03762	-2.060000	0.00893	-0.369000	0.07265	CGC	C|0.978;T|0.022	0.022	strong		0.428	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
TPTE	7179	hgsc.bcm.edu	37	21	10971306	10971306	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:10971306G>A	ENST00000361285.4	-	5	380	c.51C>T	c.(49-51)ctC>ctT	p.L17L	TPTE_ENST00000342420.5_Silent_p.L17L|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Silent_p.L17L	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	17					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATTGGGGCCGAGCTCAATGA	0.468																																					p.L17L		Atlas-SNP	.											.	TPTE	513	.	0			c.C51T						PASS	.						130.0	100.0	110.0					21																	10971306		2203	4300	6503	SO:0001819	synonymous_variant	7179	exon5			GGGGCCGAGCTCA	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.51C>T	21.37:g.10971306G>A		105.0	0.0	0		124.0	15.0	0.120968	NM_199259	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	37	CCDS13560.2																																																																																			.	.	none		0.468	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
ZBTB7C	201501	hgsc.bcm.edu	37	18	45566798	45566798	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr18:45566798G>A	ENST00000588982.1	-	3	1182	c.681C>T	c.(679-681)atC>atT	p.I227I	ZBTB7C_ENST00000590800.1_Silent_p.I227I|ZBTB7C_ENST00000535628.2_Silent_p.I227I|ZBTB7C_ENST00000332053.2_Silent_p.I227I|ZBTB7C_ENST00000586438.1_Silent_p.I227I			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	227							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						GCAGAGATTCGATGGAGAAGT	0.587																																					p.I227I		Atlas-SNP	.											.	ZBTB7C	73	.	0			c.C681T						PASS	.						49.0	50.0	49.0					18																	45566798		2203	4300	6503	SO:0001819	synonymous_variant	201501	exon2			AGATTCGATGGAG	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.681C>T	18.37:g.45566798G>A		145.0	0.0	0		171.0	63.0	0.368421	NM_001039360	O73453	Silent	SNP	ENST00000588982.1	37	CCDS32830.1																																																																																			.	.	none		0.587	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
ITGA2	3673	hgsc.bcm.edu	37	5	52351856	52351856	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:52351856T>C	ENST00000296585.5	+	9	1116	c.973T>C	c.(973-975)Tta>Cta	p.L325L		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	325	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TACTAAAAATTTAATAAAAGA	0.358																																					p.L325L		Atlas-SNP	.											.	ITGA2	211	.	0			c.T973C						PASS	.						37.0	42.0	41.0					5																	52351856		2198	4297	6495	SO:0001819	synonymous_variant	3673	exon9			AAAAATTTAATAA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.973T>C	5.37:g.52351856T>C		79.0	0.0	0		102.0	5.0	0.0490196	NM_002203	Q14595	Silent	SNP	ENST00000296585.5	37	CCDS3957.1																																																																																			.	.	none		0.358	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
MYC	4609	hgsc.bcm.edu	37	8	128750625	128750625	+	Missense_Mutation	SNP	G	G	C	rs121918684		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750625G>C	ENST00000259523.6	+	2	1322	c.117G>C	c.(115-117)gaG>gaC	p.E39D	MYC_ENST00000377970.2_Missense_Mutation_p.E54D|MYC_ENST00000524013.1_Missense_Mutation_p.E53D			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	39			E -> D (in a Burkitt lymphoma symple). {ECO:0000269|PubMed:6419122, ECO:0000269|PubMed:8220424}.		branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	AGCAGAGCGAGCTGCAGCCCC	0.632		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E54D		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,lymphoid_neoplasm,0,8	MYC	168	8	0			c.G162C						PASS	.						35.0	39.0	38.0					8																	128750625		2203	4300	6503	SO:0001583	missense	4609	exon2			GAGCGAGCTGCAG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.117G>C	8.37:g.128750625G>C	ENSP00000259523:p.Glu39Asp	71.0	0.0	0	1567	74.0	25.0	0.337838	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.32|12.32	1.903276|1.903276	0.33628|0.33628	.|.	.|.	ENSG00000136997|ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013|ENST00000520751	T;T;T;T|.	0.18810|.	2.19;2.19;2.19;2.19|.	4.78|4.78	3.9|3.9	0.45041|0.45041	Transcription regulator Myc, N-terminal (1);|.	0.367998|.	0.32671|.	N|.	0.005795|.	T|T	0.25717|0.25717	0.0626|0.0626	N|N	0.04508|0.04508	-0.205|-0.205	0.35092|0.35092	A|A	0.764443|0.764443	B|.	0.28667|.	0.219|.	B|.	0.30251|.	0.113|.	T|T	0.39461|0.39461	-0.9613|-0.9613	9|5	0.38643|0.87932	T|D	0.18|0	-20.4721|-20.4721	8.9469|8.9469	0.35764|0.35764	0.1688:0.0:0.8312:0.0|0.1688:0.0:0.8312:0.0	.|.	39|.	P01106|.	MYC_HUMAN|.	D|T	39;53;54;53|28	ENSP00000259523:E39D;ENSP00000429441:E53D;ENSP00000367207:E54D;ENSP00000430235:E53D|.	ENSP00000259523:E39D|ENSP00000430226:S28T	E|S	+|+	3|2	2|0	MYC|MYC	128819807|128819807	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.447000|4.447000	0.60020|0.60020	1.389000|1.389000	0.46526|0.46526	0.561000|0.561000	0.74099|0.74099	GAG|AGC	.	.	weak		0.632	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
ASIC5	51802	hgsc.bcm.edu	37	4	156784634	156784634	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:156784634C>T	ENST00000537611.2	-	2	359	c.313G>A	c.(313-315)Gag>Aag	p.E105K	TDO2_ENST00000506181.1_Intron	NM_017419.2	NP_059115.1	Q9NY37	ASIC5_HUMAN	acid-sensing (proton-gated) ion channel family member 5	105					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrogen ion channel activity (GO:0015252)|ligand-gated sodium channel activity (GO:0015280)										GCTGGGAACTCCATCTTTTCC	0.358																																					p.E105K		Atlas-SNP	.											.	.	.	.	0			c.G313A						PASS	.						73.0	64.0	67.0					4																	156784634		2203	4300	6503	SO:0001583	missense	51802	exon2			GGAACTCCATCTT	AJ252011	CCDS3793.1	4q32.1	2012-10-03	2012-03-02	2012-03-02	ENSG00000256394	ENSG00000256394			17537	protein-coding gene	gene with protein product			"""amiloride-sensitive cation channel 5, intestinal"""	ACCN5		10767424	Standard	NM_017419		Approved	INAC, HINAC	uc003ipe.1	Q9NY37	OTTHUMG00000161941	ENST00000537611.2:c.313G>A	4.37:g.156784634C>T	ENSP00000442477:p.Glu105Lys	86.0	0.0	0		96.0	4.0	0.0416667	NM_017419		Missense_Mutation	SNP	ENST00000537611.2	37	CCDS3793.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533035	0.45073	.	.	ENSG00000256394	ENST00000537611	T	0.63417	-0.04	4.34	4.34	0.51931	.	0.501251	0.19042	N	0.124277	T	0.48892	0.1525	L	0.40543	1.245	0.80722	D	1	B	0.12630	0.006	B	0.15870	0.014	T	0.36383	-0.9750	10	0.09590	T	0.72	0.3777	11.8835	0.52589	0.0:0.9036:0.0:0.0964	.	105	Q9NY37	ACCN5_HUMAN	K	105	ENSP00000442477:E105K	ENSP00000264432:E105K	E	-	1	0	ACCN5	157004084	0.985000	0.35326	0.997000	0.53966	0.998000	0.95712	2.520000	0.45554	2.369000	0.80426	0.650000	0.86243	GAG	.	.	none		0.358	ASIC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366464.1		
MTMR7	9108	hgsc.bcm.edu	37	8	17206499	17206499	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:17206499C>T	ENST00000180173.5	-	5	594	c.560G>A	c.(559-561)cGa>cAa	p.R187Q	MTMR7_ENST00000523571.1_5'UTR|MTMR7_ENST00000521857.1_Missense_Mutation_p.R187Q	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	187	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		GACAGGAAATCGCCGTCTACT	0.433																																					p.R187Q		Atlas-SNP	.											MTMR7,NS,carcinoma,0,1	MTMR7	75	1	0			c.G560A						scavenged	.						135.0	129.0	131.0					8																	17206499		2203	4300	6503	SO:0001583	missense	9108	exon5			GGAAATCGCCGTC	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.560G>A	8.37:g.17206499C>T	ENSP00000180173:p.Arg187Gln	58.0	0.0	0		71.0	3.0	0.0422535	NM_004686	A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	ENST00000180173.5	37	CCDS34851.1	.	.	.	.	.	.	.	.	.	.	C	35	5.516652	0.96402	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.98135	-4.74;-4.74	5.24	5.24	0.73138	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.99272	0.9746	H	0.99286	4.5	0.80722	D	1	D	0.76494	0.999	P	0.59288	0.855	D	0.98623	1.0668	10	0.87932	D	0	.	19.719	0.96135	0.0:1.0:0.0:0.0	.	187	Q9Y216	MTMR7_HUMAN	Q	187	ENSP00000180173:R187Q;ENSP00000429733:R187Q	ENSP00000180173:R187Q	R	-	2	0	MTMR7	17250870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.364000	0.79526	2.828000	0.97474	0.655000	0.94253	CGA	.	.	none		0.433	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375311.1	NM_004686	
MFSD3	113655	hgsc.bcm.edu	37	8	145738768	145738768	+	IGR	SNP	G	G	C	rs11342077|rs398010167|rs199605511		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:145738768G>C	ENST00000301327.4	+	0	1548				RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Splice_Site_p.R766G	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			ACCACCACCCGGCAACTGGCC	0.677																																					.		Atlas-SNP	.											.	RECQL4	75	.	0			c.2296+1C>G						PASS	.																																			SO:0001628	intergenic_variant	9401	exon15			CCACCCGGCAACT		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738768G>C		117.0	0.0	0		95.0	11.0	0.115789	NM_004260		Splice_Site	SNP	ENST00000301327.4	37	CCDS6431.1																																																																																			.	.	weak		0.677	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
HIST1H2AC	8334	hgsc.bcm.edu	37	6	26124688	26124688	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:26124688G>A	ENST00000602637.1	+	1	258	c.228G>A	c.(226-228)aaG>aaA	p.K76K	HIST1H2AC_ENST00000377791.2_Silent_p.K76K|HIST1H2BC_ENST00000396984.1_5'Flank|HIST1H2BC_ENST00000314332.5_5'Flank			Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	76						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(5)	12						ACAACAAGAAGACTCGCATCA	0.657																																					p.K76K		Atlas-SNP	.											.	HIST1H2AC	29	.	0			c.G228A						PASS	.						97.0	94.0	95.0					6																	26124688		2203	4300	6503	SO:0001819	synonymous_variant	8334	exon1			CAAGAAGACTCGC	Z80778	CCDS4585.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000180573	ENSG00000180573		"""Histones / Replication-dependent"""	4733	protein-coding gene	gene with protein product		602794	"""H2A histone family, member L"", ""histone 1, H2ac"""	H2AFL		9119399, 12408966	Standard	NM_003512		Approved		uc003ngm.3	Q93077	OTTHUMG00000014428	ENST00000602637.1:c.228G>A	6.37:g.26124688G>A		276.0	0.0	0		265.0	59.0	0.222642	NM_003512	B2R4F7|O00775|O00776|O00777|O00778|Q540R1	Silent	SNP	ENST00000602637.1	37	CCDS4585.1																																																																																			.	.	none		0.657	HIST1H2AC-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000468023.1	NM_003512	
ITGA10	8515	hgsc.bcm.edu	37	1	145528314	145528314	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:145528314T>A	ENST00000369304.3	+	4	510	c.335T>A	c.(334-336)cTg>cAg	p.L112Q	ITGA10_ENST00000538811.1_Intron|ITGA10_ENST00000539363.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	112					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GGGATGTCTCTGTTAGAGACA	0.483																																					p.L112Q		Atlas-SNP	.											.	ITGA10	131	.	0			c.T335A						PASS	.						101.0	99.0	99.0					1																	145528314		2203	4300	6503	SO:0001583	missense	8515	exon4			TGTCTCTGTTAGA	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.335T>A	1.37:g.145528314T>A	ENSP00000358310:p.Leu112Gln	199.0	0.0	0		235.0	63.0	0.268085	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.062469	0.76187	.	.	ENSG00000143127	ENST00000369304;ENST00000543043	T	0.72835	-0.69	5.46	5.46	0.80206	.	0.000000	0.56097	D	0.000028	T	0.80396	0.4615	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.998	D	0.83917	0.0299	10	0.87932	D	0	.	11.9274	0.52827	0.0:0.0:0.0:1.0	.	78;112;112	F5H3T9;O75578;O75578-2	.;ITA10_HUMAN;.	Q	112;78	ENSP00000358310:L112Q	ENSP00000358310:L112Q	L	+	2	0	ITGA10	144239671	0.940000	0.31905	0.900000	0.35374	0.992000	0.81027	4.296000	0.59055	2.070000	0.61991	0.459000	0.35465	CTG	.	.	none		0.483	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156941496	156941496	+	Intron	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:156941496C>A	ENST00000361409.2	-	8	1325				ARHGEF11_ENST00000368194.3_Missense_Mutation_p.G232V	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CACCACTGAGCCACCAGTCTC	0.557																																					p.G232V		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.G695T						PASS	.						98.0	91.0	93.0					1																	156941496		2203	4300	6503	SO:0001627	intron_variant	9826	exon8			ACTGAGCCACCAG	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.583-1661G>T	1.37:g.156941496C>A		68.0	0.0	0		61.0	17.0	0.278689	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	37	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829147	0.50845	.	.	ENSG00000132694	ENST00000368194	T	0.65732	-0.17	5.46	4.54	0.55810	.	0.203312	0.34828	N	0.003657	T	0.41351	0.1155	.	.	.	0.80722	D	1	B	0.17268	0.021	B	0.18263	0.021	T	0.42783	-0.9431	9	0.45353	T	0.12	-21.6118	15.2508	0.73545	0.0:0.8587:0.1413:0.0	.	232	O15085-2	.	V	232	ENSP00000357177:G232V	ENSP00000357177:G232V	G	-	2	0	ARHGEF11	155208120	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.332000	0.43903	1.517000	0.48917	0.655000	0.94253	GGC	.	.	none		0.557	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
MYC	4609	hgsc.bcm.edu	37	8	128752907	128752907	+	Silent	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128752907A>G	ENST00000377970.2	+	3	1578	c.1068A>G	c.(1066-1068)aaA>aaG	p.K356K	MYC_ENST00000524013.1_Silent_p.K355K	NM_002467.4	NP_002458	P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	341	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACAACCGAAAATGCACCAGCC	0.557		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""																																p.K356K		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.A1068G						PASS	.						91.0	86.0	87.0					8																	128752907		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon3			CCGAAAATGCACC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000377970.2:c.1068A>G	8.37:g.128752907A>G		124.0	0.0	0		144.0	56.0	0.388889	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000377970.2	37	CCDS6359.2																																																																																			.	.	none		0.557	MYC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250277.3		
MAPK8	5599	hgsc.bcm.edu	37	10	49618087	49618087	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:49618087A>G	ENST00000374189.1	+	5	507	c.326A>G	c.(325-327)gAg>gGg	p.E109G	MAPK8_ENST00000374182.3_Missense_Mutation_p.E109G|MAPK8_ENST00000395611.3_Missense_Mutation_p.E109G|MAPK8_ENST00000374174.1_Missense_Mutation_p.E109G|MAPK8_ENST00000360332.3_Missense_Mutation_p.E109G			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	109	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		ATAGTCATGGAGCTCATGGAT	0.358																																					p.E109G		Atlas-SNP	.											.	MAPK8	118	.	0			c.A326G						PASS	.						161.0	151.0	155.0					10																	49618087		2203	4300	6503	SO:0001583	missense	5599	exon4			TCATGGAGCTCAT	L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.326A>G	10.37:g.49618087A>G	ENSP00000363304:p.Glu109Gly	144.0	0.0	0		154.0	7.0	0.0454545	NM_139047	B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	ENST00000374189.1	37	CCDS7224.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.747324	0.89663	.	.	ENSG00000107643	ENST00000432379;ENST00000429041;ENST00000374189;ENST00000426557;ENST00000374182;ENST00000374179;ENST00000360332;ENST00000374176;ENST00000374174;ENST00000395611	D;D;D;D;D;D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91;-2.91	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97056	0.9038	M	0.93763	3.455	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98041	1.0382	10	0.72032	D	0.01	.	15.7272	0.77770	1.0:0.0:0.0:0.0	.	109;109;109;109;109	Q308M2;P45983-2;P45983;A1L4K2;P45983-3	.;.;MK08_HUMAN;.;.	G	109;26;109;109;109;109;109;109;109;109	ENSP00000387936:E109G;ENSP00000393223:E26G;ENSP00000363304:E109G;ENSP00000397729:E109G;ENSP00000363297:E109G;ENSP00000363294:E109G;ENSP00000353483:E109G;ENSP00000363291:E109G;ENSP00000363289:E109G;ENSP00000378974:E109G	ENSP00000353483:E109G	E	+	2	0	MAPK8	49288093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.176000	0.68965	0.528000	0.53228	GAG	.	.	none		0.358	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047931.1		
LVRN	206338	hgsc.bcm.edu	37	5	115351066	115351066	+	Silent	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:115351066T>A	ENST00000357872.4	+	17	2692	c.2568T>A	c.(2566-2568)atT>atA	p.I856I	AQPEP_ENST00000515454.1_3'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		856						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										AAGAAAAGATTCAACTTGCTT	0.343																																					p.I856I		Atlas-SNP	.											FLJ90650,caecum,carcinoma,0,1	.	.	1	0			c.T2568A						scavenged	.						91.0	87.0	88.0					5																	115351066		2202	4300	6502	SO:0001819	synonymous_variant	0	exon17			AAAGATTCAACTT																												ENST00000357872.4:c.2568T>A	5.37:g.115351066T>A		46.0	2.0	0.0434783		45.0	3.0	0.0666667	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Silent	SNP	ENST00000357872.4	37	CCDS4124.1																																																																																			.	.	none		0.343	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
CWH43	80157	hgsc.bcm.edu	37	4	48990495	48990495	+	Splice_Site	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:48990495A>G	ENST00000226432.4	+	2	228	c.45A>G	c.(43-45)ggA>ggG	p.G15G	CWH43_ENST00000513409.1_5'UTR	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	15					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TTTTTGTAGGATGTGTTTCTT	0.418																																					p.G15G		Atlas-SNP	.											.	CWH43	101	.	0			c.A45G						PASS	.						77.0	79.0	78.0					4																	48990495		2203	4300	6503	SO:0001630	splice_region_variant	80157	exon2			TGTAGGATGTGTT		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.44-1A>G	4.37:g.48990495A>G		40.0	0.0	0		66.0	4.0	0.0606061	NM_025087	B2RPD7	Silent	SNP	ENST00000226432.4	37	CCDS3486.1																																																																																			.	.	none		0.418	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	Silent
CASP8	841	hgsc.bcm.edu	37	2	202141597	202141597	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:202141597T>A	ENST00000432109.2	+	8	897	c.708T>A	c.(706-708)tgT>tgA	p.C236*	CASP8_ENST00000264274.9_Intron|CASP8_ENST00000392259.2_Missense_Mutation_p.S215T|CASP8_ENST00000392266.3_Missense_Mutation_p.S200T|CASP8_ENST00000392258.3_Missense_Mutation_p.S215T|CASP8_ENST00000264275.5_Nonsense_Mutation_p.C253*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.C295*|CASP8_ENST00000323492.7_Nonsense_Mutation_p.C221*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	236					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GGGGATACTGTCTGATCATCA	0.448										HNSCC(4;0.00038)																											p.C295X	Melanoma(82;831 1348 20716 36952 40159)	Atlas-SNP	.											CASP8_ENST00000358485,NS,carcinoma,+1,3	CASP8	272	3	0			c.T885A						PASS	.						91.0	84.0	86.0					2																	202141597		2203	4300	6503	SO:0001587	stop_gained	841	exon7			ATACTGTCTGATC	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.708T>A	2.37:g.202141597T>A	ENSP00000412523:p.Cys236*	173.0	0.0	0		224.0	16.0	0.0714286	NM_001080125	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.28|16.28	3.078350|3.078350	0.55753|0.55753	.|.	.|.	ENSG00000064012|ENSG00000064012	ENST00000392263;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000358485;ENST00000392261;ENST00000323492|ENST00000392259;ENST00000392266;ENST00000392258;ENST00000447616;ENST00000424461	.|.	.|.	.|.	5.6|5.6	3.27|3.27	0.37495|0.37495	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.19446	.|0.0467	.|.	.|.	.|.	0.21256|0.21256	N|N	0.999742|0.999742	.|P;P	.|0.36249	.|0.545;0.545	.|B;B	.|0.32677	.|0.15;0.098	.|T	.|0.09975	.|-1.0650	.|7	0.02654|0.25106	T|T	1|0.35	.|.	4.4221|4.4221	0.11486|0.11486	0.0:0.3337:0.0:0.6663|0.0:0.3337:0.0:0.6663	.|.	.|200;215	.|Q14790-6;Q14790-5	.|.;.	X|T	221;236;253;118;295;221;221|215;200;215;200;63	.|.	ENSP00000264275:C253X|ENSP00000376087:S215T	C|S	+|+	3|1	2|0	CASP8|CASP8	201849842|201849842	0.964000|0.964000	0.33143|0.33143	1.000000|1.000000	0.80357|0.80357	0.254000|0.254000	0.26022|0.26022	1.912000|1.912000	0.39946|0.39946	0.954000|0.954000	0.37851|0.37851	0.459000|0.459000	0.35465|0.35465	TGT|TCT	.	.	none		0.448	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
CEP41	95681	hgsc.bcm.edu	37	7	130067800	130067800	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:130067800G>T	ENST00000223208.5	-	2	363	c.93C>A	c.(91-93)gaC>gaA	p.D31E	CEP41_ENST00000489512.1_Missense_Mutation_p.D31E|CEP41_ENST00000495702.1_5'UTR|CEP41_ENST00000343969.5_Missense_Mutation_p.D31E|CEP41_ENST00000541543.1_Missense_Mutation_p.D31E	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa	31					cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											ACTCACCAGTGTCCAGTCTTG	0.303																																					p.D31E		Atlas-SNP	.											.	.	.	.	0			c.C93A						PASS	.						80.0	79.0	79.0					7																	130067800		2203	4300	6503	SO:0001583	missense	95681	exon2			ACCAGTGTCCAGT	AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.93C>A	7.37:g.130067800G>T	ENSP00000223208:p.Asp31Glu	66.0	0.0	0		64.0	25.0	0.390625	NM_001257159	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Missense_Mutation	SNP	ENST00000223208.5	37	CCDS5821.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.756933	0.69648	.	.	ENSG00000106477	ENST00000223208;ENST00000541543;ENST00000343969;ENST00000477003;ENST00000469826;ENST00000489512	D;D;D;D;D	0.92965	-3.14;-2.34;-3.06;-2.83;-2.61	5.68	2.79	0.32731	.	0.000000	0.85682	D	0.000000	D	0.95085	0.8408	M	0.82630	2.6	0.46901	D	0.999244	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.83275	0.996;0.984;0.948	D	0.93213	0.6602	10	0.87932	D	0	-10.9368	6.9984	0.24795	0.3038:0.0:0.6962:0.0	.	31;31;31	F5H0V6;Q9BYV8-2;Q9BYV8	.;.;CEP41_HUMAN	E	31;31;31;28;18;31	ENSP00000223208:D31E;ENSP00000445888:D31E;ENSP00000342738:D31E;ENSP00000420670:D28E;ENSP00000418712:D18E	ENSP00000223208:D31E	D	-	3	2	TSGA14	129855036	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.757000	0.26433	0.282000	0.22254	0.591000	0.81541	GAC	.	.	none		0.303	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349702.2	NM_018718	
ZNF438	220929	hgsc.bcm.edu	37	10	31137635	31137635	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:31137635T>G	ENST00000361310.3	-	6	2028	c.1699A>C	c.(1699-1701)Atg>Ctg	p.M567L	ZNF438_ENST00000436087.2_Missense_Mutation_p.M567L|ZNF438_ENST00000442986.1_Missense_Mutation_p.M567L|ZNF438_ENST00000452305.1_Missense_Mutation_p.M557L|ZNF438_ENST00000413025.1_Missense_Mutation_p.M567L|ZNF438_ENST00000444692.2_Missense_Mutation_p.M557L|ZNF438_ENST00000331737.6_Missense_Mutation_p.M557L|ZNF438_ENST00000538351.2_Missense_Mutation_p.M518L|ZNF438_ENST00000375311.1_Missense_Mutation_p.M131L			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	567					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TCACAACACATGAGTTTCTTC	0.483																																					p.M567L		Atlas-SNP	.											.	ZNF438	90	.	0			c.A1699C						PASS	.						165.0	157.0	160.0					10																	31137635		2203	4300	6503	SO:0001583	missense	220929	exon7			AACACATGAGTTT	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1699A>C	10.37:g.31137635T>G	ENSP00000354663:p.Met567Leu	202.0	0.0	0		237.0	60.0	0.253165	NM_182755	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	37	CCDS7168.1	.	.	.	.	.	.	.	.	.	.	T	7.360	0.624731	0.14193	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55;2.55;2.55;2.55;3.22	5.4	-3.69	0.04450	Zinc finger, C2H2-like (1);	0.541309	0.20921	N	0.083263	T	0.04679	0.0127	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.40813	-0.9543	10	0.16420	T	0.52	-2.4183	7.8113	0.29232	0.0:0.3656:0.1286:0.5057	.	567;557	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	L	557;567;567;567;567;557;557;518;286;131	ENSP00000333571:M557L;ENSP00000354663:M567L;ENSP00000406934:M567L;ENSP00000412363:M567L;ENSP00000387546:M567L;ENSP00000413060:M557L;ENSP00000410898:M557L;ENSP00000445461:M518L;ENSP00000364460:M131L	ENSP00000333571:M557L	M	-	1	0	ZNF438	31177641	0.000000	0.05858	0.053000	0.19242	0.996000	0.88848	-0.371000	0.07513	-0.355000	0.08199	0.482000	0.46254	ATG	.	.	none		0.483	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755	
CHIT1	1118	hgsc.bcm.edu	37	1	203186088	203186088	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:203186088G>A	ENST00000367229.1	-	11	1364	c.1330C>T	c.(1330-1332)Cgg>Tgg	p.R444W	CHIT1_ENST00000535569.1_Missense_Mutation_p.R435W|CHIT1_ENST00000484834.1_Intron|CHIT1_ENST00000255427.3_Missense_Mutation_p.R425W	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	444	Chitin-binding type-2. {ECO:0000255|PROSITE-ProRule:PRU00144}.				chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						TGGAACAGCCGCCCCGCTGCA	0.597											OREG0014113	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R444W		Atlas-SNP	.											CHIT1,NS,carcinoma,+2,1	CHIT1	61	1	0			c.C1330T						PASS	.						87.0	92.0	90.0					1																	203186088		2203	4300	6503	SO:0001583	missense	1118	exon11			ACAGCCGCCCCGC	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1330C>T	1.37:g.203186088G>A	ENSP00000356198:p.Arg444Trp	55.0	0.0	0	2135	54.0	11.0	0.203704	NM_003465	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Missense_Mutation	SNP	ENST00000367229.1	37	CCDS1436.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.903086	0.52227	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	T;T;T	0.32272	1.46;1.46;1.46	4.81	0.807	0.18714	Chitin binding domain (5);	0.540328	0.15465	N	0.260936	T	0.42040	0.1185	M	0.72624	2.21	0.09310	N	1	B;D;B	0.76494	0.01;0.999;0.031	B;P;B	0.61800	0.003;0.894;0.007	T	0.21861	-1.0233	10	0.37606	T	0.19	-4.997	3.3947	0.07302	0.2568:0.0:0.4399:0.3033	.	415;435;444	Q13231-3;G5EA51;Q13231	.;.;CHIT1_HUMAN	W	444;425;435	ENSP00000356198:R444W;ENSP00000255427:R425W;ENSP00000438078:R435W	ENSP00000255427:R425W	R	-	1	2	CHIT1	201452711	0.000000	0.05858	0.043000	0.18650	0.768000	0.43524	-0.593000	0.05740	-0.110000	0.12022	0.650000	0.86243	CGG	.	.	none		0.597	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100275.2	NM_003465	
MITF	4286	hgsc.bcm.edu	37	3	69928321	69928321	+	Silent	SNP	G	G	A	rs199697494		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:69928321G>A	ENST00000448226.2	+	2	268	c.141G>A	c.(139-141)ccG>ccA	p.P47P	MITF_ENST00000394355.2_Silent_p.P22P|MITF_ENST00000328528.6_Silent_p.P46P|MITF_ENST00000472437.1_5'UTR|MITF_ENST00000314589.5_Silent_p.P31P|MITF_ENST00000352241.4_Silent_p.P47P			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	47					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CCAAGCCTCCGATAAGCTCCT	0.537			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""						G|||	1	0.000199681	0.0	0.0	5008	,	,		18415	0.001		0.0	False		,,,				2504	0.0				p.P47P	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	156	.	0			c.G141A						PASS	.						43.0	48.0	46.0					3																	69928321		2035	4202	6237	SO:0001819	synonymous_variant	4286	exon2			GCCTCCGATAAGC		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.141G>A	3.37:g.69928321G>A		107.0	0.0	0		93.0	30.0	0.322581	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																				G|1.000;A|0.000	0.000	strong		0.537	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
SEPT5	5413	hgsc.bcm.edu	37	22	19709201	19709201	+	Silent	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:19709201G>T	ENST00000455784.2	+	9	881	c.756G>T	c.(754-756)gtG>gtT	p.V252V	SEPT5_ENST00000383045.3_Silent_p.V261V|GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000438754.2_Silent_p.V261V|SEPT5_ENST00000406395.1_Silent_p.V252V	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	252	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GCAACACGGTGGTGGAGGCCA	0.642																																					p.V261V		Atlas-SNP	.											.	SEPT5	32	.	0			c.G783T						PASS	.						38.0	48.0	44.0					22																	19709201		2203	4299	6502	SO:0001819	synonymous_variant	5413	exon8			CACGGTGGTGGAG	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.756G>T	22.37:g.19709201G>T		104.0	0.0	0		108.0	5.0	0.0462963	NM_001009939	O15251|Q96MY5	Silent	SNP	ENST00000455784.2	37	CCDS13764.1																																																																																			.	.	none		0.642	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
ALDOB	229	hgsc.bcm.edu	37	9	104189813	104189813	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:104189813A>G	ENST00000374855.4	-	5	615	c.491T>C	c.(490-492)aTc>aCc	p.I164T	ALDOB_ENST00000468981.3_Intron	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	164					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				GTTTTCCTGGATAGCGAGGCT	0.552																																					p.I164T		Atlas-SNP	.											.	ALDOB	69	.	0			c.T491C						PASS	.						110.0	86.0	94.0					9																	104189813		2203	4300	6503	SO:0001583	missense	229	exon5			TCCTGGATAGCGA	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.491T>C	9.37:g.104189813A>G	ENSP00000363988:p.Ile164Thr	105.0	0.0	0		125.0	27.0	0.216	NM_000035	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	37	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.784232	0.90282	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.89196	-2.48	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.96377	0.8818	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97485	1.0050	10	0.87932	D	0	-22.1026	16.0034	0.80327	1.0:0.0:0.0:0.0	.	164	P05062	ALDOB_HUMAN	T	164;91;164	ENSP00000363988:I164T	ENSP00000363986:I91T	I	-	2	0	ALDOB	103229634	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	ATC	.	.	none		0.552	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
MYC	4609	hgsc.bcm.edu	37	8	128751021	128751021	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128751021C>T	ENST00000259523.6	+	2	1718	c.513C>T	c.(511-513)tgC>tgT	p.C171C	MYC_ENST00000377970.2_Silent_p.C186C|MYC_ENST00000524013.1_Silent_p.C185C			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	171				C -> S (in Ref. 5; no nucleotide entry). {ECO:0000305}.	branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACAGCGTCTGCTCCACCTCCA	0.677		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C186C		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.C558T						PASS	.						21.0	23.0	22.0					8																	128751021		2203	4298	6501	SO:0001819	synonymous_variant	4609	exon2			CGTCTGCTCCACC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.513C>T	8.37:g.128751021C>T		65.0	0.0	0	1567	59.0	16.0	0.271186	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37																																																																																				.	.	none		0.677	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
RHPN2	85415	hgsc.bcm.edu	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M		Atlas-SNP	.											RHPN2,face,carcinoma,0,2	RHPN2	107	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A						scavenged	.						84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met	23.0	0.0	0		38.0	4.0	0.105263	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG	.	.	none		0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
MACROD2	140733	hgsc.bcm.edu	37	20	16021849	16021849	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr20:16021849C>T	ENST00000310348.4	+	16	1157	c.1157C>T	c.(1156-1158)cCa>cTa	p.P386L	MACROD2_ENST00000402914.1_Missense_Mutation_p.P151L|MACROD2_ENST00000407045.3_Missense_Mutation_p.P37L|MACROD2_ENST00000378058.3_Missense_Mutation_p.P151L|MACROD2_ENST00000217246.4_Missense_Mutation_p.P386L			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	386	Glu-rich.				brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CTTCCAGCTCCAGGCGAGGAC	0.478																																					p.P386L		Atlas-SNP	.											.	MACROD2	34	.	0			c.C1157T						PASS	.						69.0	68.0	69.0					20																	16021849		2203	4299	6502	SO:0001583	missense	140733	exon16			CAGCTCCAGGCGA	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.1157C>T	20.37:g.16021849C>T	ENSP00000309809:p.Pro386Leu	77.0	0.0	0		93.0	4.0	0.0430108	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.409786	0.00193	.	.	ENSG00000172264	ENST00000217246;ENST00000310348;ENST00000402914;ENST00000378058;ENST00000407045	T;T;T;T	0.43688	2.54;2.55;0.94;0.94	5.37	-1.96	0.07525	.	0.458260	0.18726	N	0.132894	T	0.13670	0.0331	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.20338	-1.0278	10	0.30854	T	0.27	-3.5581	6.857	0.24046	0.3256:0.4397:0.0:0.2348	.	37;386;386	A1Z1Q3-6;A1Z1Q3;A1Z1Q3-2	.;MACD2_HUMAN;.	L	386;386;151;151;37	ENSP00000217246:P386L;ENSP00000309809:P386L;ENSP00000385290:P151L;ENSP00000367297:P151L	ENSP00000217246:P386L	P	+	2	0	MACROD2	15969849	0.197000	0.23362	0.044000	0.18714	0.188000	0.23474	-0.121000	0.10643	-0.211000	0.10124	-1.268000	0.01426	CCA	.	.	none		0.478	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	
NEB	4703	hgsc.bcm.edu	37	2	152432215	152432215	+	Silent	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:152432215C>A	ENST00000172853.10	-	79	12051	c.11904G>T	c.(11902-11904)gtG>gtT	p.V3968V	NEB_ENST00000397345.3_Silent_p.V5669V|NEB_ENST00000603639.1_Silent_p.V5669V|NEB_ENST00000409198.1_Silent_p.V3968V|NEB_ENST00000604864.1_Silent_p.V5669V|NEB_ENST00000427231.2_Silent_p.V5669V			P20929	NEBU_HUMAN	nebulin	3968					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTACATTGCTCACATTAAGAG	0.423																																					p.V5669V		Atlas-SNP	.											.	NEB	1697	.	0			c.G17007T						PASS	.						234.0	233.0	233.0					2																	152432215		1861	4099	5960	SO:0001819	synonymous_variant	4703	exon107			ATTGCTCACATTA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11904G>T	2.37:g.152432215C>A		135.0	0.0	0		159.0	52.0	0.327044	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	ENST00000172853.10	37																																																																																				.	.	none		0.423	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
MN1	4330	hgsc.bcm.edu	37	22	28194930	28194930	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:28194930C>T	ENST00000302326.4	-	1	2556	c.1602G>A	c.(1600-1602)caG>caA	p.Q534Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	534	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q550_R551insQ(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgctgttgctgct	0.647			T	ETV6	"""AML, meningioma"""																																p.Q534Q		Atlas-SNP	.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	MN1,colon,carcinoma,0,4	MN1	122	4	1	Insertion - In frame(1)	prostate(1)	c.G1602A						scavenged	.						4.0	5.0	5.0					22																	28194930		1760	3656	5416	SO:0001819	synonymous_variant	4330	exon1			CTGCTGCTGTTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1602G>A	22.37:g.28194930C>T		41.0	1.0	0.0243902		36.0	3.0	0.0833333	NM_002430	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			C|0.958;T|0.042	0.042	strong		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
SRSF7	6432	hgsc.bcm.edu	37	2	38976739	38976739	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:38976739G>C	ENST00000313117.6	-	3	555	c.318C>G	c.(316-318)tgC>tgG	p.C106W	SRSF7_ENST00000446327.2_Missense_Mutation_p.C106W|GEMIN6_ENST00000409011.1_5'Flank|SRSF7_ENST00000409276.1_Missense_Mutation_p.C106W	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	106					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CACACTCATAGCATCTATCAT	0.458																																					p.C106W		Atlas-SNP	.											.	SRSF7	29	.	0			c.C318G						PASS	.						147.0	139.0	141.0					2																	38976739		2203	4300	6503	SO:0001583	missense	6432	exon3			CTCATAGCATCTA	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.318C>G	2.37:g.38976739G>C	ENSP00000325905:p.Cys106Trp	295.0	0.0	0		280.0	91.0	0.325	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.741058	0.49151	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	D;D;D	0.98028	-4.67;-4.67;-4.67	5.93	1.43	0.22495	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (2);	0.000000	0.85682	D	0.000000	D	0.98582	0.9526	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98776	1.0730	10	0.87932	D	0	.	11.8039	0.52143	0.3644:0.0:0.6356:0.0	.	106;106	G5E9M3;Q16629	.;SRSF7_HUMAN	W	106	ENSP00000325905:C106W;ENSP00000402264:C106W;ENSP00000386806:C106W	ENSP00000325905:C106W	C	-	3	2	SRSF7	38830243	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.830000	0.27462	0.355000	0.24131	0.655000	0.94253	TGC	.	.	none		0.458	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
KRTAP26-1	388818	hgsc.bcm.edu	37	21	31692282	31692282	+	Silent	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr21:31692282G>T	ENST00000360542.3	-	1	325	c.72C>A	c.(70-72)ctC>ctA	p.L24L		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	24						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						CGATGGAGGTGAGAGGAATAT	0.537																																					p.L24L		Atlas-SNP	.											KRTAP26-1,NS,carcinoma,0,1	KRTAP26-1	58	1	0			c.C72A						PASS	.						61.0	64.0	63.0					21																	31692282		2203	4300	6503	SO:0001819	synonymous_variant	388818	exon1			GGAGGTGAGAGGA	AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.72C>A	21.37:g.31692282G>T		165.0	0.0	0		157.0	57.0	0.363057	NM_203405	B0RZD3	Silent	SNP	ENST00000360542.3	37	CCDS13588.1																																																																																			.	.	none		0.537	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
ITPR1	3708	hgsc.bcm.edu	37	3	4681129	4681129	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:4681129T>C	ENST00000443694.2	+	4	341	c.341T>C	c.(340-342)gTa>gCa	p.V114A	ITPR1_ENST00000357086.4_Missense_Mutation_p.V114A|ITPR1_ENST00000456211.2_Missense_Mutation_p.V114A|ITPR1_ENST00000423119.2_Missense_Mutation_p.V114A|ITPR1_ENST00000544951.1_Missense_Mutation_p.V114A|ITPR1_ENST00000354582.6_Missense_Mutation_p.V114A|ITPR1_ENST00000302640.8_Missense_Mutation_p.V114A			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	114	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CTGGGGACCGTAATCCAGTAT	0.453																																					p.V114A		Atlas-SNP	.											.	ITPR1	659	.	0			c.T341C						PASS	.						82.0	85.0	84.0					3																	4681129		1986	4151	6137	SO:0001583	missense	3708	exon6			GGACCGTAATCCA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.341T>C	3.37:g.4681129T>C	ENSP00000401671:p.Val114Ala	92.0	0.0	0		93.0	25.0	0.268817	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610731	0.87258	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	D;D;D;D;D;D;D	0.98947	-5.26;-5.26;-5.26;-5.26;-5.26;-5.26;-5.26	5.32	5.32	0.75619	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);MIR (1);	0.116894	0.64402	D	0.000020	D	0.98469	0.9490	M	0.81341	2.54	0.40494	D	0.980576	B;P;P;P;P	0.43633	0.353;0.722;0.576;0.512;0.813	B;P;P;P;B	0.50162	0.17;0.633;0.45;0.45;0.432	D	0.99915	1.1220	10	0.22109	T	0.4	.	15.608	0.76689	0.0:0.0:0.0:1.0	.	114;114;114;114;114	B7ZMI3;E7EPX7;Q14643;E7EVP7;G5E9P1	.;.;ITPR1_HUMAN;.;.	A	114	ENSP00000306253:V114A;ENSP00000346595:V114A;ENSP00000405934:V114A;ENSP00000349597:V114A;ENSP00000397885:V114A;ENSP00000440564:V114A;ENSP00000401671:V114A	ENSP00000306253:V114A	V	+	2	0	ITPR1	4656129	1.000000	0.71417	0.050000	0.19076	0.964000	0.63967	7.908000	0.87438	2.141000	0.66446	0.528000	0.53228	GTA	.	.	none		0.453	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
FRMD3	257019	hgsc.bcm.edu	37	9	85863362	85863362	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr9:85863362C>T	ENST00000304195.3	-	14	1471	c.1265G>A	c.(1264-1266)cGg>cAg	p.R422Q	FRMD3_ENST00000376434.1_Missense_Mutation_p.R228Q|FRMD3_ENST00000328788.1_Missense_Mutation_p.R79Q|FRMD3_ENST00000376438.1_Missense_Mutation_p.R422Q|FRMD3_ENST00000465485.1_5'UTR	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	422						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						TTCATACTCCCGGGCTGCCTT	0.443																																					p.R422Q		Atlas-SNP	.											FRMD3,NS,carcinoma,+1,1	FRMD3	96	1	0			c.G1265A						PASS	.						72.0	72.0	72.0					9																	85863362		1847	4100	5947	SO:0001583	missense	257019	exon14			TACTCCCGGGCTG	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1265G>A	9.37:g.85863362C>T	ENSP00000303508:p.Arg422Gln	65.0	0.0	0		68.0	25.0	0.367647	NM_174938	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	ENST00000304195.3	37	CCDS43840.1	.	.	.	.	.	.	.	.	.	.	C	5.988	0.366206	0.11352	.	.	ENSG00000172159	ENST00000376438;ENST00000376434;ENST00000328788;ENST00000304195	D;D;T;D	0.85411	-1.57;-1.98;0.97;-1.59	5.38	-0.87	0.10646	.	1.075110	0.07080	N	0.836929	T	0.73171	0.3553	N	0.21448	0.665	0.09310	N	1	B;B;B	0.20261	0.0;0.0;0.043	B;B;B	0.09377	0.0;0.001;0.004	T	0.52609	-0.8553	10	0.13470	T	0.59	.	10.6066	0.45398	0.0:0.5266:0.0:0.4734	.	422;422;79	A2A2Y4;A2A2Y4-2;A2A2Y4-4	FRMD3_HUMAN;.;.	Q	422;228;79;422	ENSP00000365621:R422Q;ENSP00000365617:R228Q;ENSP00000328615:R79Q;ENSP00000303508:R422Q	ENSP00000303508:R422Q	R	-	2	0	FRMD3	85053182	0.000000	0.05858	0.897000	0.35233	0.991000	0.79684	-0.925000	0.03992	-0.358000	0.08162	-0.131000	0.14894	CGG	.	.	none		0.443	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938	
TMEM30A	55754	hgsc.bcm.edu	37	6	75969072	75969072	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:75969072G>A	ENST00000230461.6	-	5	1005	c.676C>T	c.(676-678)Cga>Tga	p.R226*	TMEM30A_ENST00000475111.2_Nonsense_Mutation_p.R190*|TMEM30A_ENST00000370050.5_Nonsense_Mutation_p.R107*	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	226					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.R226*(1)		NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCTTTAAATCGTTCTTCCAGG	0.308																																					p.R226X		Atlas-SNP	.											TMEM30A,caecum,carcinoma,0,2	TMEM30A	40	2	1	Substitution - Nonsense(1)	lung(1)	c.C676T						PASS	.						74.0	79.0	77.0					6																	75969072		2203	4298	6501	SO:0001587	stop_gained	55754	exon5			TAAATCGTTCTTC	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.676C>T	6.37:g.75969072G>A	ENSP00000230461:p.Arg226*	199.0	0.0	0		140.0	51.0	0.364286	NM_018247	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Nonsense_Mutation	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	G	39	7.311733	0.98203	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111	.	.	.	5.51	2.43	0.29744	.	0.572479	0.17857	N	0.159668	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	10.4926	0.44760	0.0:0.1178:0.5054:0.3768	.	.	.	.	X	226;210;107;190	.	ENSP00000230461:R226X	R	-	1	2	TMEM30A	76025792	0.004000	0.15560	1.000000	0.80357	0.933000	0.57130	0.839000	0.27586	0.724000	0.32296	0.655000	0.94253	CGA	.	.	none		0.308	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
CASP8	841	hgsc.bcm.edu	37	2	202141586	202141586	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:202141586C>T	ENST00000432109.2	+	8	886	c.697C>T	c.(697-699)Cgg>Tgg	p.R233W	CASP8_ENST00000264274.9_Intron|CASP8_ENST00000392259.2_Missense_Mutation_p.S211L|CASP8_ENST00000392266.3_Missense_Mutation_p.S196L|CASP8_ENST00000392258.3_Missense_Mutation_p.S211L|CASP8_ENST00000264275.5_Missense_Mutation_p.R250W|CASP8_ENST00000358485.4_Missense_Mutation_p.R292W|CASP8_ENST00000323492.7_Missense_Mutation_p.R218W	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	233					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						AAGCAAACCTCGGGGATACTG	0.428										HNSCC(4;0.00038)																											p.R292W	Melanoma(82;831 1348 20716 36952 40159)	Atlas-SNP	.											CASP8_ENST00000358485,NS,carcinoma,0,6	CASP8	272	6	0			c.C874T						PASS	.						79.0	76.0	77.0					2																	202141586		2203	4300	6503	SO:0001583	missense	841	exon7			AAACCTCGGGGAT	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.697C>T	2.37:g.202141586C>T	ENSP00000412523:p.Arg233Trp	176.0	0.0	0		230.0	19.0	0.0826087	NM_001080125	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	ENST00000432109.2	37	CCDS2342.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.43|16.43	3.120327|3.120327	0.56613|0.56613	.|.	.|.	ENSG00000064012|ENSG00000064012	ENST00000392263;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000358485;ENST00000392261;ENST00000323492|ENST00000392259;ENST00000392266;ENST00000392258;ENST00000447616;ENST00000424461	D;D;D;D;D;D|.	0.84223|.	-1.53;-1.53;-1.82;-1.82;-1.53;-1.53|.	5.6|5.6	5.6|5.6	0.85130|0.85130	Peptidase C14, caspase precursor p45, core (2);DEATH-like (1);Peptidase C14, ICE, catalytic subunit p20 (1);|.	0.194920|.	0.44097|.	D|.	0.000497|.	T|T	0.29458|0.29458	0.0734|0.0734	N|N	0.24115|0.24115	0.695|0.695	0.24514|0.24514	N|N	0.994191|0.994191	D;D;D;D;D;D|D;P	0.89917|0.62365	1.0;1.0;1.0;1.0;1.0;1.0|0.991;0.931	D;D;D;D;D;D|P;B	0.91635|0.45753	0.994;0.987;0.997;0.998;0.999;0.997|0.492;0.356	T|T	0.10428|0.10428	-1.0630|-1.0630	10|8	0.66056|0.33141	D|T	0.02|0.24	.|.	12.1349|12.1349	0.53966|0.53966	0.0:0.9188:0.0:0.0812|0.0:0.9188:0.0:0.0812	.|.	233;218;292;233;218;250|196;211	Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4|Q14790-6;Q14790-5	.;.;.;CASP8_HUMAN;.;.|.;.	W|L	218;233;250;115;292;218;218|211;196;211;196;59	ENSP00000376091:R218W;ENSP00000412523:R233W;ENSP00000264275:R250W;ENSP00000391709:R115W;ENSP00000351273:R292W;ENSP00000325722:R218W|.	ENSP00000264275:R250W|ENSP00000376087:S211L	R|S	+|+	1|2	2|0	CASP8|CASP8	201849831|201849831	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.328000|0.328000	0.28507|0.28507	1.051000|1.051000	0.30417|0.30417	2.624000|2.624000	0.88883|0.88883	0.561000|0.561000	0.74099|0.74099	CGG|TCG	.	.	none		0.428	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
DLG2	1740	hgsc.bcm.edu	37	11	84027956	84027956	+	Missense_Mutation	SNP	C	C	T	rs569088235		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:84027956C>T	ENST00000398301.2	-	1	426	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	DLG2_ENST00000376104.2_Intron|DLG2_ENST00000280241.8_Missense_Mutation_p.R78Q|DLG2_ENST00000532653.1_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000543673.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGGGCTTTTCCGCACACTGTC	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		17533	0.0		0.001	False		,,,				2504	0.0				p.R78Q		Atlas-SNP	.											.	DLG2	448	.	0			c.G233A						PASS	.						88.0	86.0	87.0					11																	84027956		876	1990	2866	SO:0001583	missense	1740	exon1			CTTTTCCGCACAC	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000398301.2:c.233G>A	11.37:g.84027956C>T	ENSP00000381346:p.Arg78Gln	50.0	0.0	0		73.0	23.0	0.315068	NM_001206769	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000398301.2	37		.	.	.	.	.	.	.	.	.	.	C	17.43	3.388124	0.61956	.	.	ENSG00000150672	ENST00000280241;ENST00000398301	T;T	0.42131	0.98;0.98	5.86	4.89	0.63831	.	.	.	.	.	T	0.23410	0.0566	L	0.27053	0.805	0.80722	D	1	P	0.52463	0.953	B	0.36845	0.234	T	0.01397	-1.1365	8	.	.	.	.	6.9773	0.24683	0.0:0.7033:0.1505:0.1462	.	78	Q6ZSU2	.	Q	78	ENSP00000280241:R78Q;ENSP00000381346:R78Q	.	R	-	2	0	DLG2	83705604	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.176000	0.42500	2.774000	0.95407	0.585000	0.79938	CGG	.	.	none		0.597	DLG2-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000259244.2	NM_001364	
TMEM184A	202915	hgsc.bcm.edu	37	7	1590488	1590488	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:1590488T>C	ENST00000297477.5	-	3	666	c.350A>G	c.(349-351)tAc>tGc	p.Y117C		NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	117					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GAAGTAGACGTAGTACTGGTG	0.647																																					p.Y117C		Atlas-SNP	.											.	TMEM184A	35	.	0			c.A350G						PASS	.						82.0	89.0	87.0					7																	1590488		2203	4300	6503	SO:0001583	missense	202915	exon3			TAGACGTAGTACT		CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.350A>G	7.37:g.1590488T>C	ENSP00000297477:p.Tyr117Cys	62.0	0.0	0		62.0	4.0	0.0645161	NM_001097620	Q8TBQ6	Missense_Mutation	SNP	ENST00000297477.5	37	CCDS43537.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.114546	0.77210	.	.	ENSG00000164855	ENST00000297477;ENST00000319010;ENST00000414730;ENST00000441933;ENST00000431208	T;T;T;T;T	0.49139	1.42;0.84;0.79;0.81;0.81	5.03	5.03	0.67393	.	0.000000	0.85682	U	0.000000	T	0.73466	0.3590	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.79240	-0.1885	10	0.54805	T	0.06	0.0726	14.7478	0.69501	0.0:0.0:0.0:1.0	.	117	Q6ZMB5	T184A_HUMAN	C	117	ENSP00000297477:Y117C;ENSP00000325945:Y117C;ENSP00000398382:Y117C;ENSP00000389092:Y117C;ENSP00000403499:Y117C	ENSP00000297477:Y117C	Y	-	2	0	TMEM184A	1557014	1.000000	0.71417	0.939000	0.37840	0.784000	0.44337	7.869000	0.87170	1.891000	0.54761	0.334000	0.21626	TAC	.	.	none		0.647	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239229.4	NM_152689	
MICAL2	9645	hgsc.bcm.edu	37	11	12281376	12281376	+	Missense_Mutation	SNP	G	G	A	rs2270515	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:12281376G>A	ENST00000256194.4	+	26	3554	c.3266G>A	c.(3265-3267)cGg>cAg	p.R1089Q	MICAL2_ENST00000379612.3_Missense_Mutation_p.R863Q|MICAL2_ENST00000342902.5_Missense_Mutation_p.R1068Q|MICAL2_ENST00000537344.1_Missense_Mutation_p.R899Q|MICAL2_ENST00000527546.1_Missense_Mutation_p.R899Q|RP11-265D17.2_ENST00000527288.1_RNA	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1089			R -> Q (in dbSNP:rs2270515).		actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GAAGCCCCTCGGAGAGACACT	0.552													G|||	8	0.00159744	0.0	0.0	5008	,	,		17690	0.0079		0.0	False		,,,				2504	0.0				p.R1089Q		Atlas-SNP	.											MICAL2,NS,carcinoma,+1,1	MICAL2	114	1	0			c.G3266A						PASS	.						54.0	54.0	54.0					11																	12281376		2201	4294	6495	SO:0001583	missense	9645	exon26			CCCCTCGGAGAGA	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3266G>A	11.37:g.12281376G>A	ENSP00000256194:p.Arg1089Gln	131.0	0.0	0		161.0	56.0	0.347826	NM_014632	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	ENST00000256194.4	37	CCDS7809.1	7	0.003205128205128205	0	0.0	0	0.0	7	0.012237762237762238	0	0.0	G	1.895	-0.454548	0.04540	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.26	5.26	-3.4	0.04853	.	1.374950	0.04696	N	0.414963	T	0.23611	0.0571	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;B	0.32128	0.002;0.03;0.0;0.0;0.001;0.357	B;B;B;B;B;B	0.18871	0.001;0.005;0.0;0.0;0.001;0.023	T	0.06058	-1.0848	10	0.13470	T	0.59	.	3.761	0.08604	0.2276:0.3179:0.3678:0.0867	rs2270515;rs52826400;rs2270515	432;1068;899;842;863;1089	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	Q	899;432;1089;899;1068;863	ENSP00000441689:R899Q;ENSP00000256194:R1089Q;ENSP00000433965:R899Q;ENSP00000344894:R1068Q;ENSP00000368932:R863Q	ENSP00000256194:R1089Q	R	+	2	0	MICAL2	12237952	0.000000	0.05858	0.016000	0.15963	0.370000	0.29829	-0.913000	0.04042	-0.723000	0.04915	-1.378000	0.01179	CGG	G|0.994;A|0.006	0.006	strong		0.552	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385993.1	NM_014632	
CSPG4	1464	hgsc.bcm.edu	37	15	75980270	75980270	+	Missense_Mutation	SNP	C	C	T	rs552897521		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:75980270C>T	ENST00000308508.5	-	3	3228	c.3136G>A	c.(3136-3138)Gat>Aat	p.D1046N		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1046	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GAGTCAGCATCGCTGAAGGCC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		19833	0.001		0.0	False		,,,				2504	0.0				p.D1046N		Atlas-SNP	.											.	CSPG4	175	.	0			c.G3136A						PASS	.																																			SO:0001583	missense	1464	exon3			CAGCATCGCTGAA	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3136G>A	15.37:g.75980270C>T	ENSP00000312506:p.Asp1046Asn	124.0	0.0	0		203.0	101.0	0.497537	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	.	26.0	4.692443	0.88735	.	.	ENSG00000173546	ENST00000308508	T	0.51071	0.72	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000002	T	0.69975	0.3171	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73839	-0.3856	10	0.56958	D	0.05	.	17.0533	0.86525	0.0:1.0:0.0:0.0	.	1046	Q6UVK1	CSPG4_HUMAN	N	1046	ENSP00000312506:D1046N	ENSP00000312506:D1046N	D	-	1	0	CSPG4	73767325	1.000000	0.71417	0.708000	0.30435	0.809000	0.45718	7.817000	0.86213	2.253000	0.74438	0.555000	0.69702	GAT	.	.	none		0.642	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
IFITM3	10410	hgsc.bcm.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.11_ENST00000602756.1_RNA|RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.11_ENST00000508004.2_RNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000602429.1_RNA	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																					p.V31M		Atlas-SNP	.											IFITM3,brain,glioma,0,1	IFITM3	132	1	0			c.G91A						scavenged	.						87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	10410	exon1			CCAGCACAGCCAC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met	78.0	2.0	0.025641		116.0	12.0	0.103448	NM_021034	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	ENST00000399808.4	37	CCDS41585.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	.	.	weak		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
FZR1	51343	hgsc.bcm.edu	37	19	3532490	3532490	+	Missense_Mutation	SNP	G	G	A	rs371550562		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:3532490G>A	ENST00000395095.3	+	10	1084	c.1084G>A	c.(1084-1086)Gcc>Acc	p.A362T	FZR1_ENST00000441788.2_Missense_Mutation_p.A362T|FZR1_ENST00000313639.8_Missense_Mutation_p.A273T	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	362					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GAAGGCCATCGCCTGGTCCCC	0.672																																					p.A362T		Atlas-SNP	.											.	FZR1	42	.	0			c.G1084A						PASS	.		THR/ALA,THR/ALA,THR/ALA	0,4398		0,0,2199	29.0	31.0	30.0		817,1084,1084	5.4	1.0	19		30	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense	FZR1	NM_001136197.1,NM_001136198.1,NM_016263.3	58,58,58	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	273/405,362/497,362/494	3532490	1,12993	2199	4298	6497	SO:0001583	missense	51343	exon10			GCCATCGCCTGGT	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1084G>A	19.37:g.3532490G>A	ENSP00000378529:p.Ala362Thr	143.0	0.0	0		83.0	4.0	0.0481928	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	37	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	g	36	5.780530	0.96929	0.0	1.16E-4	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.63744	-0.06;-0.06;-0.06	5.39	5.39	0.77823	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047137	0.85682	D	0.000000	T	0.81749	0.4888	M	0.84773	2.715	0.80722	D	1	P;D;D	0.89917	0.889;0.999;1.0	P;D;D	0.91635	0.723;0.968;0.999	D	0.84022	0.0354	10	0.59425	D	0.04	-45.9139	17.7131	0.88327	0.0:0.0:1.0:0.0	.	362;273;362	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	T	362;362;273	ENSP00000410369:A362T;ENSP00000378529:A362T;ENSP00000321800:A273T	ENSP00000321800:A273T	A	+	1	0	FZR1	3483490	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.420000	0.97426	2.531000	0.85337	0.543000	0.68304	GCC	.	.	weak		0.672	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
RBM27	54439	hgsc.bcm.edu	37	5	145631422	145631422	+	Silent	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:145631422T>C	ENST00000265271.5	+	9	1594	c.1428T>C	c.(1426-1428)ccT>ccC	p.P476P	RBM27_ENST00000506502.1_Intron	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	476					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCTCCAGCCCTACCCCTCTGG	0.547																																					p.P476P		Atlas-SNP	.											.	RBM27	119	.	0			c.T1428C						PASS	.						246.0	226.0	232.0					5																	145631422		1568	3582	5150	SO:0001819	synonymous_variant	54439	exon9			CAGCCCTACCCCT	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1428T>C	5.37:g.145631422T>C		70.0	0.0	0		82.0	4.0	0.0487805	NM_018989	Q8IYW9	Silent	SNP	ENST00000265271.5	37	CCDS43378.1																																																																																			.	.	none		0.547	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
NAP1L3	4675	hgsc.bcm.edu	37	X	92928071	92928071	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:92928071T>G	ENST00000373079.3	-	1	496	c.233A>C	c.(232-234)aAg>aCg	p.K78T	FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.K71T|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	78					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						AGGTACCCTCTTCTTTCTATA	0.612																																					p.K78T		Atlas-SNP	.											.	NAP1L3	81	.	0			c.A233C						PASS	.						16.0	17.0	16.0					X																	92928071		2201	4286	6487	SO:0001583	missense	4675	exon1			ACCCTCTTCTTTC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.233A>C	X.37:g.92928071T>G	ENSP00000362171:p.Lys78Thr	33.0	0.0	0		40.0	10.0	0.25	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	T	5.105	0.204991	0.09704	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.32988	1.43	3.53	-3.32	0.04973	.	0.287732	0.37348	N	0.002124	T	0.12902	0.0313	N	0.24115	0.695	0.28377	N	0.919728	P	0.34522	0.455	B	0.33568	0.166	T	0.33904	-0.9850	10	0.15066	T	0.55	.	4.8148	0.13362	0.153:0.4055:0.0:0.4415	.	78	Q99457	NP1L3_HUMAN	T	78;71	ENSP00000362171:K78T	ENSP00000362171:K78T	K	-	2	0	NAP1L3	92814727	0.157000	0.22836	0.689000	0.30133	0.173000	0.22820	-0.320000	0.08028	-0.886000	0.03966	-0.509000	0.04479	AAG	.	.	none		0.612	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
SEC14L3	266629	hgsc.bcm.edu	37	22	30867895	30867895	+	Silent	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:30867895G>C	ENST00000215812.4	-	1	141	c.51C>G	c.(49-51)gcC>gcG	p.A17A	SEC14L3_ENST00000540910.1_5'Flank|SEC14L3_ENST00000402286.1_5'UTR|SEC14L3_ENST00000401751.1_5'UTR|SEC14L3_ENST00000415957.2_5'Flank|SEC14L3_ENST00000539629.1_5'UTR|SEC14L3_ENST00000403066.1_5'UTR	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	17						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	CTCTCACCTTGGCCAGGGTCT	0.622																																					p.A17A	Esophageal Squamous(108;290 1516 3584 23771 37333)	Atlas-SNP	.											.	SEC14L3	46	.	0			c.C51G						PASS	.						63.0	65.0	64.0					22																	30867895		2203	4300	6503	SO:0001819	synonymous_variant	266629	exon1			CACCTTGGCCAGG	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.51C>G	22.37:g.30867895G>C		43.0	0.0	0		44.0	12.0	0.272727	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	ENST00000215812.4	37	CCDS13877.1																																																																																			.	.	none		0.622	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
SMC1B	27127	hgsc.bcm.edu	37	22	45802439	45802439	+	Silent	SNP	T	T	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr22:45802439T>G	ENST00000357450.4	-	4	516	c.517A>C	c.(517-519)Aga>Cga	p.R173R	SMC1B_ENST00000404354.3_Silent_p.R173R	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	173					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TGTAACTTTCTTTTCTTTTCT	0.368																																					p.R173R		Atlas-SNP	.											.	SMC1B	215	.	0			c.A517C						PASS	.						85.0	77.0	80.0					22																	45802439		1809	4072	5881	SO:0001819	synonymous_variant	27127	exon4			ACTTTCTTTTCTT	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.517A>C	22.37:g.45802439T>G		66.0	0.0	0		70.0	28.0	0.4	NM_148674	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Silent	SNP	ENST00000357450.4	37	CCDS43027.1																																																																																			.	.	none		0.368	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
TMTC4	84899	hgsc.bcm.edu	37	13	101287335	101287335	+	Silent	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr13:101287335C>A	ENST00000376234.3	-	10	1449	c.1260G>T	c.(1258-1260)ggG>ggT	p.G420G	TMTC4_ENST00000342624.5_Silent_p.G439G|TMTC4_ENST00000462211.1_5'UTR|TMTC4_ENST00000328767.5_Silent_p.G309G	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	420						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCACACAGTACCCAACGCTGG	0.537																																					p.G439G		Atlas-SNP	.											.	TMTC4	103	.	0			c.G1317T						PASS	.						84.0	77.0	79.0					13																	101287335		2203	4300	6503	SO:0001819	synonymous_variant	84899	exon11			ACAGTACCCAACG		CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1260G>T	13.37:g.101287335C>A		160.0	0.0	0		216.0	12.0	0.0555556	NM_032813	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	ENST00000376234.3	37	CCDS41904.1																																																																																			.	.	none		0.537	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045649.2	NM_032813	
LRP1B	53353	hgsc.bcm.edu	37	2	141294279	141294279	+	Splice_Site	SNP	C	C	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:141294279C>A	ENST00000389484.3	-	46	8485		c.e46-1			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAATTTTTAGCTGCAAGAAAA	0.328										TSP Lung(27;0.18)																											.	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.7514-1G>T						PASS	.						49.0	48.0	48.0					2																	141294279		2203	4300	6503	SO:0001630	splice_region_variant	53353	exon47			TTTTAGCTGCAAG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7514-1G>T	2.37:g.141294279C>A		84.0	0.0	0		94.0	27.0	0.287234	NM_018557	Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.970286	0.74246	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9639	0.92687	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	141010749	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.726000	0.84824	2.490000	0.84030	0.650000	0.86243	.	.	.	none		0.328	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Intron
TTN	7273	hgsc.bcm.edu	37	2	179600638	179600638	+	Silent	SNP	G	G	A	rs184307461	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr2:179600638G>A	ENST00000591111.1	-	48	13808	c.13584C>T	c.(13582-13584)gaC>gaT	p.D4528D	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.D3601D|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Silent_p.D4845D|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12284	Ig-like 25.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTTTCTGCGTCGGAAATCC	0.443													G|||	3	0.000599042	0.0	0.0043	5008	,	,		20196	0.0		0.0	False		,,,				2504	0.0				p.D4845D		Atlas-SNP	.											TTN_ENST00000356127,NS,carcinoma,-2,2	TTN	18412	2	0			c.C14535T						PASS	.	G	,,,	0,3874		0,0,1937	135.0	131.0	132.0		,10803,,	-0.5	0.5	2		132	2,8284		0,2,4141	no	intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,2,6078	AA,AG,GG		0.0241,0.0,0.0164	,,,	,3601/33424,,	179600638	2,12158	1937	4143	6080	SO:0001819	synonymous_variant	7273	exon50			TTCTGCGTCGGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13584C>T	2.37:g.179600638G>A		155.0	0.0	0		205.0	43.0	0.209756	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				G|1.000;A|0.000	0.000	strong		0.443	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ADAM29	11086	hgsc.bcm.edu	37	4	175899130	175899130	+	Silent	SNP	G	G	A	rs376108430	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr4:175899130G>A	ENST00000359240.3	+	5	3124	c.2454G>A	c.(2452-2454)acG>acA	p.T818T	RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Silent_p.T818T|ADAM29_ENST00000404450.4_Silent_p.T818T|ADAM29_ENST00000445694.1_Silent_p.T818T	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	818	9 X 9 AA approximate repeats.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.T818T(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTCCTGTGACGCCCTCCTAGA	0.587													G|||	9	0.00179712	0.0	0.0	5008	,	,		17825	0.0069		0.0	False		,,,				2504	0.002				p.T818T	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											ADAM29,NS,carcinoma,0,1	ADAM29	262	1	1	Substitution - coding silent(1)	lung(1)	c.G2454A						scavenged	.	G	,,,	2,4404	4.2+/-10.8	0,2,2201	107.0	105.0	106.0		2454,2454,2454,2454	-1.3	0.0	4		106	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ADAM29	NM_001130703.1,NM_001130704.1,NM_001130705.1,NM_014269.4	,,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,,	818/821,818/821,818/821,818/821	175899130	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	11086	exon4			TGTGACGCCCTCC	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2454G>A	4.37:g.175899130G>A		63.0	2.0	0.031746		75.0	9.0	0.12	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	37	CCDS3823.1																																																																																			.	.	weak		0.587	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
MYC	4609	hgsc.bcm.edu	37	8	128750536	128750536	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750536A>G	ENST00000259523.6	+	2	1233	c.28A>G	c.(28-30)Agg>Ggg	p.R10G	MYC_ENST00000377970.2_Missense_Mutation_p.R25G|MYC_ENST00000524013.1_Missense_Mutation_p.R24G			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	10				R -> K (in Ref. 5; no nucleotide entry). {ECO:0000305}.	branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	CTTCACCAACAGGAACTATGA	0.597		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R25G		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.A73G						PASS	.						74.0	74.0	74.0					8																	128750536		2203	4300	6503	SO:0001583	missense	4609	exon2			ACCAACAGGAACT		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.28A>G	8.37:g.128750536A>G	ENSP00000259523:p.Arg10Gly	75.0	0.0	0	1567	88.0	31.0	0.352273	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	A	18.41	3.617613	0.66787	.	.	ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013;ENST00000454617	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	5.08	5.08	0.68730	Transcription regulator Myc, N-terminal (1);	0.194195	0.53938	D	0.000047	T	0.19565	0.0470	L	0.40543	1.245	0.30828	N	0.737012	B	0.31459	0.324	B	0.30716	0.119	T	0.11036	-1.0604	10	0.46703	T	0.11	-13.7167	14.1763	0.65544	1.0:0.0:0.0:0.0	.	10	P01106	MYC_HUMAN	G	10;24;25;24;10	ENSP00000259523:R10G;ENSP00000429441:R24G;ENSP00000367207:R25G;ENSP00000430235:R24G	ENSP00000259523:R10G	R	+	1	2	MYC	128819718	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	6.799000	0.75160	2.144000	0.66660	0.459000	0.35465	AGG	.	.	none		0.597	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
GRM4	2914	hgsc.bcm.edu	37	6	34004150	34004150	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:34004150G>C	ENST00000538487.2	-	9	2180	c.1737C>G	c.(1735-1737)atC>atG	p.I579M	GRM4_ENST00000374181.4_Missense_Mutation_p.I579M|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Missense_Mutation_p.I446M|GRM4_ENST00000609222.1_Missense_Mutation_p.I446M|GRM4_ENST00000544773.2_Missense_Mutation_p.I410M|GRM4_ENST00000455714.2_Missense_Mutation_p.I439M|GRM4_ENST00000374177.3_Missense_Mutation_p.I463M	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	579					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						ACTCAAGCTTGATGATGGGGA	0.632																																					p.I579M		Atlas-SNP	.											.	GRM4	317	.	0			c.C1737G						PASS	.						47.0	45.0	46.0					6																	34004150		2203	4300	6503	SO:0001583	missense	2914	exon9			AAGCTTGATGATG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1737C>G	6.37:g.34004150G>C	ENSP00000440556:p.Ile579Met	87.0	0.0	0		79.0	15.0	0.189873	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	37	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.376436	0.24857	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.88201	-2.35;-2.34;-2.1;-2.14;-2.17;-2.35;-2.18	4.81	2.11	0.27256	.	0.230082	0.44483	D	0.000446	D	0.84880	0.5570	M	0.76328	2.33	0.29060	N	0.883982	B;P;P;P;P	0.44344	0.447;0.58;0.773;0.664;0.833	B;B;P;B;B	0.48840	0.326;0.39;0.592;0.216;0.438	T	0.78899	-0.2022	10	0.49607	T	0.09	.	9.8402	0.40993	0.2272:0.0:0.7728:0.0	.	532;410;439;579;446	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	M	579;463;271;446;410;579;439	ENSP00000363296:I579M;ENSP00000363292:I463M;ENSP00000445533:I271M;ENSP00000437925:I446M;ENSP00000437730:I410M;ENSP00000440556:I579M;ENSP00000398456:I439M	ENSP00000363292:I463M	I	-	3	3	GRM4	34112128	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	1.355000	0.34068	0.259000	0.21709	-0.480000	0.04831	ATC	.	.	none		0.632	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
PTPRO	5800	hgsc.bcm.edu	37	12	15637161	15637161	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:15637161G>A	ENST00000281171.4	+	2	659	c.329G>A	c.(328-330)aGa>aAa	p.R110K	PTPRO_ENST00000543886.1_Missense_Mutation_p.R110K|PTPRO_ENST00000348962.2_Missense_Mutation_p.R110K	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	110	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AAGCCATCCAGATCAATCACT	0.413																																					p.R110K		Atlas-SNP	.											.	PTPRO	148	.	0			c.G329A						PASS	.						95.0	95.0	95.0					12																	15637161		2203	4300	6503	SO:0001583	missense	5800	exon2			CATCCAGATCAAT	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.329G>A	12.37:g.15637161G>A	ENSP00000281171:p.Arg110Lys	114.0	0.0	0		145.0	6.0	0.0413793	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	37	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606381	0.46527	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.03889	3.78;3.77	5.58	4.69	0.59074	Fibronectin, type III (1);	0.000000	0.56097	D	0.000029	T	0.03564	0.0102	N	0.14661	0.345	0.80722	D	1	B;B;B	0.24963	0.049;0.029;0.115	B;B;B	0.24848	0.008;0.004;0.056	T	0.48843	-0.8999	10	0.48119	T	0.1	.	10.1372	0.42715	0.1479:0.0:0.8521:0.0	.	110;110;110	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	K	110	ENSP00000281171:R110K;ENSP00000343434:R110K	ENSP00000281171:R110K	R	+	2	0	PTPRO	15528428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.889000	0.56212	2.630000	0.89119	0.655000	0.94253	AGA	.	.	none		0.413	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
PDE3A	5139	hgsc.bcm.edu	37	12	20787945	20787945	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr12:20787945A>T	ENST00000359062.3	+	8	1996	c.1956A>T	c.(1954-1956)aaA>aaT	p.K652N	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	652					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CTCTGAGGAAAGCATCGGCTT	0.433																																					p.K652N		Atlas-SNP	.											.	PDE3A	184	.	0			c.A1956T						PASS	.						135.0	114.0	121.0					12																	20787945		2203	4300	6503	SO:0001583	missense	5139	exon8			GAGGAAAGCATCG		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1956A>T	12.37:g.20787945A>T	ENSP00000351957:p.Lys652Asn	95.0	0.0	0		111.0	7.0	0.0630631	NM_000921	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	7.711	0.695201	0.15039	.	.	ENSG00000172572	ENST00000359062	T	0.62105	0.05	5.64	-0.807	0.10872	.	7739.210000	0.00166	N	0.000000	T	0.50565	0.1623	L	0.36672	1.1	0.09310	N	1	B	0.16396	0.017	B	0.06405	0.002	T	0.17501	-1.0367	10	0.27785	T	0.31	.	6.338	0.21306	0.4635:0.1377:0.3988:0.0	.	652	Q14432	PDE3A_HUMAN	N	652	ENSP00000351957:K652N	ENSP00000351957:K652N	K	+	3	2	PDE3A	20679212	0.993000	0.37304	0.091000	0.20842	0.139000	0.21198	1.258000	0.32944	-0.134000	0.11516	0.528000	0.53228	AAA	.	.	none		0.433	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
SPAG5	10615	hgsc.bcm.edu	37	17	26919654	26919654	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:26919654T>C	ENST00000321765.5	-	3	940	c.608A>G	c.(607-609)gAg>gGg	p.E203G		NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	203					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					TGGAGACTCCTCTAAGAGATG	0.493																																					p.E203G		Atlas-SNP	.											.	SPAG5	92	.	0			c.A608G						PASS	.						103.0	102.0	103.0					17																	26919654		2203	4300	6503	SO:0001583	missense	10615	exon3			GACTCCTCTAAGA	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.608A>G	17.37:g.26919654T>C	ENSP00000323300:p.Glu203Gly	126.0	0.0	0		134.0	48.0	0.358209	NM_006461	O95213|Q9BWE8|Q9NT17|Q9UFE6	Missense_Mutation	SNP	ENST00000321765.5	37	CCDS32594.1	.	.	.	.	.	.	.	.	.	.	T	1.807	-0.475729	0.04414	.	.	ENSG00000076382	ENST00000321765	T	0.43688	0.94	5.33	2.99	0.34606	.	0.841403	0.10417	N	0.677155	T	0.22437	0.0541	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.18335	-1.0340	10	0.87932	D	0	-0.7221	4.8055	0.13317	0.0:0.0969:0.1906:0.7125	.	203	Q96R06	SPAG5_HUMAN	G	203	ENSP00000323300:E203G	ENSP00000323300:E203G	E	-	2	0	SPAG5	23943781	0.008000	0.16893	0.003000	0.11579	0.058000	0.15608	1.333000	0.33816	0.857000	0.35407	0.533000	0.62120	GAG	.	.	none		0.493	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390564.2	NM_006461	
IKBKB	3551	hgsc.bcm.edu	37	8	42166458	42166458	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:42166458G>A	ENST00000520810.1	+	8	793	c.607G>A	c.(607-609)Gtc>Atc	p.V203I	IKBKB_ENST00000519735.1_Missense_Mutation_p.V203I|IKBKB_ENST00000379708.3_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.V201I|IKBKB_ENST00000416505.2_Missense_Mutation_p.V144I|IKBKB_ENST00000522147.1_Intron	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	203	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CACAGTGACCGTCGACTACTG	0.657																																					p.V203I		Atlas-SNP	.											.	IKBKB	88	.	0			c.G607A						PASS	.						149.0	129.0	136.0					8																	42166458		2203	4300	6503	SO:0001583	missense	3551	exon8			GTGACCGTCGACT	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.607G>A	8.37:g.42166458G>A	ENSP00000430684:p.Val203Ile	104.0	0.0	0		91.0	36.0	0.395604	NM_001556	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	37	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	G	34	5.373729	0.95923	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000519735;ENST00000520835	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	M	0.62209	1.925	0.80722	D	1	P;D;D;D;D	0.76494	0.947;0.994;0.998;0.999;0.986	B;P;D;D;P	0.68621	0.4;0.864;0.959;0.915;0.834	T	0.64630	-0.6362	10	0.56958	D	0.05	.	18.4904	0.90844	0.0:0.0:1.0:0.0	.	144;201;154;203;203	B4E0U4;O14920-2;Q59GL9;O14920;Q32ND9	.;.;.;IKKB_HUMAN;.	I	203;144;203;201	ENSP00000430684:V203I;ENSP00000404920:V144I;ENSP00000430483:V203I;ENSP00000430868:V201I	ENSP00000404920:V144I	V	+	1	0	IKBKB	42285615	1.000000	0.71417	0.833000	0.33012	0.967000	0.64934	9.743000	0.98849	2.437000	0.82529	0.563000	0.77884	GTC	.	.	none		0.657	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
MYC	4609	hgsc.bcm.edu	37	8	128750613	128750613	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750613G>A	ENST00000259523.6	+	2	1310	c.105G>A	c.(103-105)caG>caA	p.Q35Q	MYC_ENST00000377970.2_Silent_p.Q50Q|MYC_ENST00000524013.1_Silent_p.Q49Q			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	35	Poly-Gln.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACCAGCAGCAGCAGCAGAGCG	0.622		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q50Q		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC_ENST00000377970,NS,lymphoid_neoplasm,0,4	MYC	168	4	0			c.G150A						PASS	.						42.0	44.0	44.0					8																	128750613		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon2			GCAGCAGCAGCAG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.105G>A	8.37:g.128750613G>A		75.0	0.0	0	1567	88.0	29.0	0.329545	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37		.	.	.	.	.	.	.	.	.	.	G	9.434	1.086417	0.20390	.	.	ENSG00000136997	ENST00000520751	.	.	.	5.08	2.26	0.28386	.	.	.	.	.	T	0.65964	0.2742	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64812	-0.6319	5	0.87932	D	0	-22.7786	9.9515	0.41642	0.3084:0.0:0.6916:0.0	.	.	.	.	N	24	.	ENSP00000430226:S24N	S	+	2	0	MYC	128819795	1.000000	0.71417	0.998000	0.56505	0.774000	0.43823	1.221000	0.32503	0.054000	0.16065	-1.134000	0.01955	AGC	.	.	none		0.622	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
MSH3	4437	hgsc.bcm.edu	37	5	79950717	79950717	+	Silent	SNP	C	C	T	rs201874762|rs201906899	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:79950717C>T	ENST00000265081.6	+	1	251	c.171C>T	c.(169-171)gcC>gcT	p.A57A	DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000439211.2_5'UTR	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	57	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ctgcagcggccgcagcggccg	0.701								Mismatch excision repair (MMR)					-|||	1025	0.204673	0.2602	0.1715	5008	,	,		6102	0.0466		0.2048	False		,,,				2504	0.316				p.A57A	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											MSH3_ENST00000265081,NS,carcinoma,+2,1	MSH3	129	1	0			c.C171T						scavenged	.						6.0	7.0	7.0					5																	79950717		2068	4046	6114	SO:0001819	synonymous_variant	4437	exon1			AGCGGCCGCAGCG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.171C>T	5.37:g.79950717C>T		7.0	0.0	0		12.0	3.0	0.25	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	ENST00000265081.6	37	CCDS34195.1																																																																																			C|0.979;T|0.021	0.021	strong		0.701	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
HAVCR1	26762	hgsc.bcm.edu	37	5	156479571	156479571	+	Missense_Mutation	SNP	C	C	T	rs6149307|rs386693994|rs183130208|rs141023871	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr5:156479571C>T	ENST00000339252.3	-	3	1006	c.474G>A	c.(472-474)atG>atA	p.M158I	HAVCR1_ENST00000523175.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000522693.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000425854.1_Missense_Mutation_p.M158I|HAVCR1_ENST00000544197.1_Missense_Mutation_p.M158I	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAACAGTCGTCATTGGAACAG	0.488																																					p.M158I		Atlas-SNP	.											.	HAVCR1	84	.	0			c.G474A						PASS	.						413.0	302.0	340.0					5																	156479571		2079	3991	6070	SO:0001583	missense	26762	exon4			AGTCGTCATTGGA	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.474G>A	5.37:g.156479571C>T	ENSP00000344844:p.Met158Ile	342.0	0.0	0		437.0	23.0	0.0526316	NM_001099414	O43656	Missense_Mutation	SNP	ENST00000339252.3	37	CCDS43392.1	.	.	.	.	.	.	.	.	.	.	C	2.575	-0.298775	0.05532	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.13901	2.55;2.6;2.6;2.55;2.6;2.57	1.56	-3.12	0.05282	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.31392	-0.9945	7	0.62326	D	0.03	.	0.1239	0.00067	0.2901:0.1916:0.1631:0.3551	.	.	.	.	I	158	ENSP00000428524:M158I;ENSP00000427898:M158I;ENSP00000344844:M158I;ENSP00000403333:M158I;ENSP00000440258:M158I;ENSP00000428422:M158I	ENSP00000344844:M158I	M	-	3	0	HAVCR1	156412149	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	0.878000	0.28126	-1.479000	0.01867	-0.507000	0.04495	ATG	.	.	weak		0.488	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
SYDE1	85360	hgsc.bcm.edu	37	19	15224520	15224520	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr19:15224520G>A	ENST00000342784.2	+	8	1985	c.1954G>A	c.(1954-1956)Gcc>Acc	p.A652T	SYDE1_ENST00000600252.1_Missense_Mutation_p.A309T|SYDE1_ENST00000600440.1_Missense_Mutation_p.A585T	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	652					activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						CAACCGCTACGCCGGCGACTG	0.692																																					p.A652T		Atlas-SNP	.											.	SYDE1	44	.	0			c.G1954A						PASS	.						43.0	53.0	50.0					19																	15224520		2203	4298	6501	SO:0001583	missense	85360	exon8			CGCTACGCCGGCG	BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1954G>A	19.37:g.15224520G>A	ENSP00000341489:p.Ala652Thr	80.0	0.0	0		34.0	8.0	0.235294	NM_033025	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	ENST00000342784.2	37	CCDS12324.1	.	.	.	.	.	.	.	.	.	.	G	35	5.533392	0.96460	.	.	ENSG00000105137	ENST00000342784	T	0.55930	0.49	5.52	5.52	0.82312	.	0.134668	0.48767	D	0.000170	T	0.73916	0.3648	M	0.79123	2.44	0.54753	D	0.99998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.76995	-0.2752	10	0.87932	D	0	.	16.928	0.86182	0.0:0.0:1.0:0.0	.	585;585;652	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	T	652	ENSP00000341489:A652T	ENSP00000341489:A652T	A	+	1	0	SYDE1	15085520	1.000000	0.71417	0.979000	0.43373	0.968000	0.65278	9.146000	0.94640	2.604000	0.88044	0.491000	0.48974	GCC	.	.	none		0.692	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1	NM_033025	
TATDN2	9797	hgsc.bcm.edu	37	3	10318158	10318158	+	Silent	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr3:10318158C>T	ENST00000287652.4	+	5	2998	c.1947C>T	c.(1945-1947)gaC>gaT	p.D649D	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Silent_p.D649D|TATDN2_ENST00000496355.1_3'UTR	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	649					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TGCCCCCTGACTACAAGATCC	0.458																																					p.D649D		Atlas-SNP	.											.	TATDN2	59	.	0			c.C1947T						PASS	.						72.0	65.0	68.0					3																	10318158		2203	4300	6503	SO:0001819	synonymous_variant	9797	exon5			CCCTGACTACAAG	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.1947C>T	3.37:g.10318158C>T		58.0	0.0	0		52.0	4.0	0.0769231	NM_014760	Q3MIL9|Q5BKU0	Silent	SNP	ENST00000287652.4	37	CCDS33698.1																																																																																			.	.	none		0.458	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
ZNF33A	7581	hgsc.bcm.edu	37	10	38343345	38343345	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:38343345A>C	ENST00000458705.2	+	5	448	c.290A>C	c.(289-291)aAc>aCc	p.N97T	ZNF33A_ENST00000469037.2_Missense_Mutation_p.N98T|ZNF33A_ENST00000374618.3_Missense_Mutation_p.N98T|ZNF33A_ENST00000307441.9_Missense_Mutation_p.N97T|ZNF33A_ENST00000432900.2_Missense_Mutation_p.N104T			Q06730	ZN33A_HUMAN	zinc finger protein 33A	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						AGCCAAGAAAACCAATCTAAA	0.348																																					p.N98T		Atlas-SNP	.											.	ZNF33A	103	.	0			c.A293C						PASS	.						90.0	91.0	90.0					10																	38343345		2203	4300	6503	SO:0001583	missense	7581	exon5			AAGAAAACCAATC	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.290A>C	10.37:g.38343345A>C	ENSP00000387713:p.Asn97Thr	116.0	0.0	0		122.0	24.0	0.196721	NM_006954	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	ENST00000458705.2	37	CCDS31182.1	.	.	.	.	.	.	.	.	.	.	A	10.12	1.263115	0.23051	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000277672;ENST00000307441	T;T;T;T	0.06218	3.34;3.34;3.33;3.33	1.46	1.46	0.22682	.	0.192021	0.25487	N	0.030322	T	0.09247	0.0228	L	0.45228	1.405	0.25885	N	0.983546	D;B;P;D	0.55385	0.971;0.031;0.952;0.971	P;B;P;P	0.52554	0.691;0.012;0.494;0.702	T	0.09552	-1.0669	10	0.51188	T	0.08	.	6.9664	0.24625	1.0:0.0:0.0:0.0	.	104;98;97;98	F6TH33;Q9H5I4;Q06730;F8WAJ5	.;.;ZN33A_HUMAN;.	T	98;104;97;98;97	ENSP00000363747:N98T;ENSP00000402467:N104T;ENSP00000387713:N97T;ENSP00000304268:N97T	ENSP00000277672:N98T	N	+	2	0	ZNF33A	38383351	0.912000	0.30974	0.296000	0.24974	0.924000	0.55760	1.642000	0.37207	0.918000	0.36919	0.377000	0.23210	AAC	.	.	none		0.348	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974	
ARRDC4	91947	hgsc.bcm.edu	37	15	98512603	98512603	+	Silent	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr15:98512603C>G	ENST00000268042.6	+	5	1040	c.876C>G	c.(874-876)tcC>tcG	p.S292S	ARRDC4_ENST00000538249.1_Silent_p.S205S	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	292					positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TGGACTATTCCTTAGCTGTAA	0.398																																					p.S292S		Atlas-SNP	.											.	ARRDC4	30	.	0			c.C876G						PASS	.						86.0	78.0	81.0					15																	98512603		2197	4298	6495	SO:0001819	synonymous_variant	91947	exon5			CTATTCCTTAGCT	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.876C>G	15.37:g.98512603C>G		75.0	0.0	0		95.0	36.0	0.378947	NM_183376	Q6NSI9	Silent	SNP	ENST00000268042.6	37	CCDS10377.1																																																																																			.	.	none		0.398	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
ERCC5	2073	hgsc.bcm.edu	37	13	103504506	103504506	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr13:103504506C>G	ENST00000355739.4	+	2	1550	c.127C>G	c.(127-129)Cgg>Ggg	p.R43G	BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.P468R|ERCC5_ENST00000535557.1_Missense_Mutation_p.R43G	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	43	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TAAAGGAGTCCGGGATCGCCA	0.378			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.R497G		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	.	0			c.C1489G						PASS	.						128.0	131.0	130.0					13																	103504506		2203	4300	6503	SO:0001583	missense	0	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GGAGTCCGGGATC	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.127C>G	13.37:g.103504506C>G	ENSP00000347978:p.Arg43Gly	113.0	0.0	0		180.0	47.0	0.261111	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136257	0.37728	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000535557	T;T	0.69435	-0.4;-0.4	5.39	3.47	0.39725	XPG N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.79258	2.445	0.53005	D	0.999964	P;P;D	0.64830	0.933;0.954;0.994	D;P;P	0.63033	0.91;0.765;0.903	T	0.77948	-0.2396	10	0.62326	D	0.03	-16.4647	8.4298	0.32750	0.2594:0.6527:0.0:0.0879	.	43;43;468	B4DSI5;P28715;Q59FZ7	.;ERCC5_HUMAN;.	G	468;43;43	ENSP00000347978:R43G;ENSP00000442117:R43G	ENSP00000347978:R43G	R	+	1	2	ERCC5	102302507	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	2.390000	0.44416	1.269000	0.44280	-0.233000	0.12211	CGG	.	.	none		0.378	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
COL22A1	169044	hgsc.bcm.edu	37	8	139626110	139626110	+	Splice_Site	SNP	C	C	T	rs139816222		TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:139626110C>T	ENST00000303045.6	-	56	4424	c.3978G>A	c.(3976-3978)ccG>ccA	p.P1326P	COL22A1_ENST00000435777.1_Splice_Site_p.P1306P|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1326	Collagen-like 13.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CAAAACTCACCGGTGGGCCCC	0.478										HNSCC(7;0.00092)																											p.P1326P		Atlas-SNP	.											COL22A1,rectum,carcinoma,-1,1	COL22A1	390	1	0			c.G3978A						PASS	.	C		1,4405	2.1+/-5.4	0,1,2202	131.0	139.0	137.0		3978	3.8	1.0	8	dbSNP_134	137	0,8600		0,0,4300	no	coding-synonymous-near-splice	COL22A1	NM_152888.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		1326/1627	139626110	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	169044	exon56			ACTCACCGGTGGG	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3978+1G>A	8.37:g.139626110C>T		126.0	0.0	0		142.0	35.0	0.246479	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			C|1.000;T|0.000	0.000	weak		0.478	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	Silent
NUP153	9972	hgsc.bcm.edu	37	6	17706506	17706506	+	Splice_Site	SNP	A	A	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr6:17706506A>T	ENST00000262077.2	-	1	111		c.e1+1		RP11-500C11.3_ENST00000606771.1_RNA|NUP153_ENST00000537253.1_Splice_Site	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GGGGTCCCATACCTGATGCTG	0.716																																					.		Atlas-SNP	.											.	NUP153	116	.	0			c.111+2T>A						PASS	.						59.0	49.0	52.0					6																	17706506		2200	4299	6499	SO:0001630	splice_region_variant	9972	exon2			TCCCATACCTGAT	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.111+1T>A	6.37:g.17706506A>T		72.0	0.0	0		37.0	11.0	0.297297	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Splice_Site	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	A	12.30	1.898108	0.33535	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	.	.	.	3.91	3.91	0.45181	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4521	0.38731	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP153	17814485	1.000000	0.71417	0.977000	0.42913	0.328000	0.28507	2.201000	0.42734	2.006000	0.58801	0.482000	0.46254	.	.	.	none		0.716	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		Intron
SLC29A3	55315	hgsc.bcm.edu	37	10	73111474	73111474	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr10:73111474C>T	ENST00000373189.5	+	4	591	c.539C>T	c.(538-540)aCt>aTt	p.T180I	SLC29A3_ENST00000469204.1_3'UTR	NM_001174098.1|NM_018344.5	NP_001167569.1|NP_060814.4	Q9BZD2	S29A3_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 3	180					transmembrane transport (GO:0055085)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	15						GGTGCCTCCACTGTCTTCAGC	0.567																																					p.T180I	Esophageal Squamous(200;1319 2142 18949 31248 39672)	Atlas-SNP	.											.	SLC29A3	51	.	0			c.C539T						PASS	.						129.0	97.0	108.0					10																	73111474		2203	4300	6503	SO:0001583	missense	55315	exon4			CCTCCACTGTCTT	AF326987	CCDS7310.1	10q22.2	2013-07-17	2013-07-17		ENSG00000198246	ENSG00000198246		"""Solute carriers"""	23096	protein-coding gene	gene with protein product		612373	"""solute carrier family 29 (nucleoside transporters), member 3"""			11396612	Standard	NM_018344		Approved	ENT3, FLJ11160	uc001jrr.4	Q9BZD2	OTTHUMG00000018424	ENST00000373189.5:c.539C>T	10.37:g.73111474C>T	ENSP00000362285:p.Thr180Ile	108.0	0.0	0		91.0	4.0	0.043956	NM_018344	B2RB50|B4E2Z9|B7ZA37|Q0VAM9|Q5T465|Q7RTT8|Q8IVZ0|Q9BWI2|Q9NUS9	Missense_Mutation	SNP	ENST00000373189.5	37	CCDS7310.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964306	0.34659	.	.	ENSG00000198246	ENST00000373189	T	0.63580	-0.05	5.83	2.91	0.33838	.	0.231809	0.45606	N	0.000358	T	0.62221	0.2410	M	0.78916	2.43	0.35689	D	0.814676	B	0.18013	0.025	B	0.27076	0.076	T	0.66404	-0.5932	9	0.72032	D	0.01	-22.0043	8.8699	0.35309	0.0:0.7627:0.0:0.2373	.	180	Q9BZD2	S29A3_HUMAN	I	180	ENSP00000362285:T180I	ENSP00000362285:T180I	T	+	2	0	SLC29A3	72781480	0.977000	0.34250	0.048000	0.18961	0.667000	0.39255	2.530000	0.45641	0.345000	0.23873	0.555000	0.69702	ACT	.	.	none		0.567	SLC29A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048544.1	NM_018344	
MYC	4609	hgsc.bcm.edu	37	8	128750559	128750559	+	Missense_Mutation	SNP	C	C	G	rs146504683	byFrequency	TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:128750559C>G	ENST00000259523.6	+	2	1256	c.51C>G	c.(49-51)gaC>gaG	p.D17E	MYC_ENST00000377970.2_Missense_Mutation_p.D32E|MYC_ENST00000524013.1_Missense_Mutation_p.D31E			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	17					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	TCGACTACGACTCGGTGCAGC	0.612		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D32E		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.C96G						PASS	.						59.0	61.0	60.0					8																	128750559		2203	4300	6503	SO:0001583	missense	4609	exon2			CTACGACTCGGTG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.51C>G	8.37:g.128750559C>G	ENSP00000259523:p.Asp17Glu	82.0	0.0	0	1567	94.0	31.0	0.329787	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.62|12.62	1.991184|1.991184	0.35131|0.35131	.|.	.|.	ENSG00000136997|ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013;ENST00000454617|ENST00000520751	T;T;T;T|.	0.34072|.	1.38;1.38;1.38;1.38|.	5.08|5.08	2.27|2.27	0.28462|0.28462	Transcription regulator Myc, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71771|0.71771	0.3379|0.3379	M|M	0.79011|0.79011	2.435|2.435	0.53688|0.53688	D|D	0.999977|0.999977	D|.	0.69078|.	0.997|.	D|.	0.79108|.	0.992|.	T|T	0.73569|0.73569	-0.3941|-0.3941	10|6	0.56958|0.87932	D|D	0.05|0	-39.7262|-39.7262	9.824|9.824	0.40901|0.40901	0.0:0.7719:0.0:0.2281|0.0:0.7719:0.0:0.2281	.|.	17|.	P01106|.	MYC_HUMAN|.	E|S	17;31;32;31;17|6	ENSP00000259523:D17E;ENSP00000429441:D31E;ENSP00000367207:D32E;ENSP00000430235:D31E|.	ENSP00000259523:D17E|ENSP00000430226:T6S	D|T	+|+	3|2	2|0	MYC|MYC	128819741|128819741	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	1.519000|1.519000	0.35888|0.35888	0.742000|0.742000	0.32697|0.32697	0.561000|0.561000	0.74099|0.74099	GAC|ACT	C|0.999;T|0.001	.	alt		0.612	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
DDX3X	1654	hgsc.bcm.edu	37	X	41204802	41204802	+	Splice_Site	SNP	G	G	T			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chrX:41204802G>T	ENST00000399959.2	+	12	2170		c.e12+1		DDX3X_ENST00000457138.2_Splice_Site|DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000542215.1_Splice_Site|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000478993.1_Splice_Site	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked						ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						AATGCAACAGGTAACATTATG	0.418										HNSCC(61;0.18)																											.		Atlas-SNP	.											.	DDX3X	138	.	0			c.1267+1G>T						PASS	.						77.0	70.0	72.0					X																	41204802		1990	4159	6149	SO:0001630	splice_region_variant	1654	exon11			CAACAGGTAACAT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1315+1G>T	X.37:g.41204802G>T		80.0	0.0	0		129.0	68.0	0.527132	NM_001193417	A8K538|B4E3E8|O15536	Splice_Site	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	g	19.49	3.837914	0.71373	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0725	0.89415	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DDX3X	41089746	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.737000	0.98831	2.203000	0.70933	0.522000	0.50473	.	.	.	none		0.418	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	Intron
ABCA8	10351	hgsc.bcm.edu	37	17	66918384	66918384	+	Splice_Site	SNP	T	T	C			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr17:66918384T>C	ENST00000269080.2	-	11	1637	c.1500A>G	c.(1498-1500)aaA>aaG	p.K500K	ABCA8_ENST00000586539.1_Splice_Site_p.K500K|ABCA8_ENST00000430352.2_Splice_Site_p.K500K	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	500	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					tttttttACCTTTCAAGGCTT	0.209																																					p.K500K		Atlas-SNP	.											.	ABCA8	213	.	0			c.A1500G						PASS	.						18.0	18.0	18.0					17																	66918384		2152	4259	6411	SO:0001630	splice_region_variant	10351	exon11			TTTACCTTTCAAG	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1501+1A>G	17.37:g.66918384T>C		64.0	0.0	0		60.0	20.0	0.333333	NM_007168	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	37	CCDS11680.1																																																																																			.	.	none		0.209	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	Silent
FKBP9	11328	hgsc.bcm.edu	37	7	33014897	33014897	+	Silent	SNP	G	G	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr7:33014897G>A	ENST00000242209.4	+	3	640	c.471G>A	c.(469-471)ccG>ccA	p.P157P	FKBP9_ENST00000538443.1_Silent_p.P19P|AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538336.1_Silent_p.P210P	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	157					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			TCAAGCCCCCGAGTTGCCCTC	0.483																																					p.P157P		Atlas-SNP	.											FKBP9,brain,glioma,+1,9	FKBP9	335	9	0			c.G471A						scavenged	.						100.0	90.0	93.0					7																	33014897		2203	4300	6503	SO:0001819	synonymous_variant	11328	exon3			GCCCCCGAGTTGC	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.471G>A	7.37:g.33014897G>A		138.0	1.0	0.00724638		135.0	43.0	0.318519	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	ENST00000242209.4	37	CCDS5439.1																																																																																			.	.	none		0.483	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
TACC1	6867	hgsc.bcm.edu	37	8	38677553	38677553	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr8:38677553A>G	ENST00000317827.4	+	3	1170	c.791A>G	c.(790-792)tAt>tGt	p.Y264C	TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000520973.1_Missense_Mutation_p.Y69C|TACC1_ENST00000520615.1_Missense_Mutation_p.Y69C|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000379931.3_Missense_Mutation_p.Y264C|TACC1_ENST00000518415.1_Missense_Mutation_p.Y219C|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000520340.1_Missense_Mutation_p.Y228C|TACC1_ENST00000519416.1_Missense_Mutation_p.Y69C|TACC1_ENST00000443286.2_Missense_Mutation_p.Y280C	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	264	Interaction with YEATS4.|SPAZ 1.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			AAGGCATCCTATCACTTCAGT	0.532																																					p.Y264C		Atlas-SNP	.											.	TACC1	98	.	0			c.A791G						PASS	.						40.0	41.0	40.0					8																	38677553		2203	4300	6503	SO:0001583	missense	6867	exon3			CATCCTATCACTT	AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.791A>G	8.37:g.38677553A>G	ENSP00000321703:p.Tyr264Cys	16.0	0.0	0		22.0	7.0	0.318182	NM_006283	B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	ENST00000317827.4	37	CCDS6109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.514|0.514	-0.865152|-0.865152	0.02590|0.02590	.|.	.|.	ENSG00000147526|ENSG00000147526	ENST00000521866|ENST00000519416;ENST00000520615;ENST00000443388;ENST00000443286;ENST00000518415;ENST00000522904;ENST00000317827;ENST00000379931;ENST00000520973;ENST00000521935	.|T;T;T;T;T;T;T;T;T	.|0.45668	.|2.63;2.63;2.74;2.71;2.56;2.78;2.77;2.58;0.89	4.93|4.93	-1.26|-1.26	0.09376|0.09376	.|.	.|0.676508	.|0.14325	.|N	.|0.326751	T|T	0.26159|0.26159	0.0638|0.0638	L|L	0.33485|0.33485	1.01|1.01	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B;B;B	.|0.17667	.|0.023;0.009;0.009;0.004;0.004;0.004;0.002;0.02	.|B;B;B;B;B;B;B;B	.|0.18871	.|0.015;0.007;0.005;0.005;0.006;0.003;0.001;0.023	T|T	0.13818|0.13818	-1.0495|-1.0495	5|10	.|0.42905	.|T	.|0.14	1.732|1.732	4.9397|4.9397	0.13960|0.13960	0.4702:0.2082:0.3216:0.0|0.4702:0.2082:0.3216:0.0	.|.	.|69;69;69;280;264;264;69;219	.|B7Z3G3;E7EVI4;B4DH49;B4E302;O75410-2;O75410;E7ET87;O75410-7	.|.;.;.;.;.;TACC1_HUMAN;.;.	V|C	39|69;69;69;280;219;236;264;264;69;69	.|ENSP00000428687:Y69C;ENSP00000428450:Y69C;ENSP00000393647:Y280C;ENSP00000428706:Y219C;ENSP00000430355:Y236C;ENSP00000321703:Y264C;ENSP00000369263:Y264C;ENSP00000430959:Y69C;ENSP00000428175:Y69C	.|ENSP00000321703:Y264C	I|Y	+|+	1|2	0|0	TACC1|TACC1	38796710|38796710	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.044000|0.044000	0.14063|0.14063	0.935000|0.935000	0.28924|0.28924	-0.540000|-0.540000	0.06265|0.06265	-0.376000|-0.376000	0.06991|0.06991	ATC|TAT	.	.	none		0.532	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376768.1	NM_006283	
C1orf27	54953	hgsc.bcm.edu	37	1	186357578	186357578	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8046-01A-11D-2210-10	TCGA-FF-8046-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	aa847c3d-d3a7-46aa-a81b-db5099a458fb	35736b32-0a2a-45c0-aef9-5e7f3d2733aa	g.chr1:186357578T>A	ENST00000287859.6	+	5	460	c.335T>A	c.(334-336)aTg>aAg	p.M112K	C1orf27_ENST00000432021.3_Missense_Mutation_p.M112K|C1orf27_ENST00000367470.3_Missense_Mutation_p.M112K|C1orf27_ENST00000419367.3_Missense_Mutation_p.M80K	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	112						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TTTCAGCTAATGTTTGCTGTG	0.333																																					p.M112K		Atlas-SNP	.											C1orf27_ENST00000287859,NS,carcinoma,-1,2	C1orf27	41	2	0			c.T335A						PASS	.						32.0	31.0	31.0					1																	186357578		1807	4068	5875	SO:0001583	missense	54953	exon5			AGCTAATGTTTGC	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.335T>A	1.37:g.186357578T>A	ENSP00000287859:p.Met112Lys	115.0	0.0	0		120.0	38.0	0.316667	NM_001164245	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	ENST00000287859.6	37	CCDS53448.1	.	.	.	.	.	.	.	.	.	.	T	11.70	1.717373	0.30413	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	T;T;T;T	0.42900	1.03;0.96;1.03;1.03	5.3	4.15	0.48705	.	0.545614	0.20190	N	0.097330	T	0.26122	0.0637	N	0.08118	0	0.28249	N	0.925366	B;B;B	0.20459	0.045;0.014;0.014	B;B;B	0.24848	0.056;0.006;0.006	T	0.22906	-1.0203	10	0.66056	D	0.02	-17.5983	12.025	0.53365	0.0:0.0:0.1449:0.8551	.	80;112;112	E9PFR7;Q5SWX8-2;Q5SWX8	.;.;ODR4_HUMAN	K	112;80;112;112	ENSP00000356440:M112K;ENSP00000395084:M80K;ENSP00000402029:M112K;ENSP00000287859:M112K	ENSP00000287859:M112K	M	+	2	0	C1orf27	184624201	0.988000	0.35896	0.998000	0.56505	0.369000	0.29798	6.000000	0.70678	0.817000	0.34445	0.460000	0.39030	ATG	.	.	none		0.333	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
