#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382373	24382374	+	IGR	INS	-	-	TGCTGC	rs371342199|rs35206911|rs201827126		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:24382373_24382374insTGCTGC								AC004552.1 (15350 upstream) : PDK3 (100963 downstream)																							gctgctgctattgctgctgctg	0.574																																					p.I499delinsIAA		Atlas-Indel	.											.	.	.	.	0			c.1496_1497insTGCTGC						PASS	.																																			SO:0001628	intergenic_variant	100130302	exon1			.																													X.37:g.24382374_24382379dupTGCTGC		261.0	0.0	0		206.0	37.0	0.179612	NM_001136234		In_Frame_Ins	INS		37																																																																																				.	.	alt	0	0.574								
SETD1B	23067	hgsc.bcm.edu	37	12	122248312	122248312	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:122248312delG	ENST00000604567.1	+	6	1529	c.1461delG	c.(1459-1461)tcgfs	p.S488fs	SETD1B_ENST00000542440.1_Frame_Shift_Del_p.S488fs|SETD1B_ENST00000267197.5_Frame_Shift_Del_p.S488fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	488	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CGCTGGAGTCGTCCCCTGCAG	0.692																																					p.S487fs		Atlas-Indel	.											.	SETD1B	105	.	0			c.1460delC						PASS	.						22.0	27.0	25.0					12																	122248312		692	1591	2283	SO:0001589	frameshift_variant	23067	exon5			.	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1461delG	12.37:g.122248312delG	ENSP00000474253:p.Ser488fs	56.0	0.0	0		80.0	35.0	0.4375	NM_015048	F6MFW1	Frame_Shift_Del	DEL	ENST00000604567.1	37																																																																																				.	.	none		0.692	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
WDR13	64743	hgsc.bcm.edu	37	X	48462764	48462765	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:48462764_48462765insG	ENST00000218056.5	+	8	1764_1765	c.1259_1260insG	c.(1258-1263)caggggfs	p.QG420fs	WDR13_ENST00000376729.5_Frame_Shift_Ins_p.QG420fs	NM_001166426.1|NM_017883.4	NP_001159898.1|NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13	420						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|large_intestine(4)|lung(4)|ovary(2)	11						TCCTTCCGCCAGGGGGCCTGCG	0.629																																					p.Q420fs		Pindel,Atlas-Indel	.											.	WDR13	96	.	0			c.1259_1260insG						PASS	.																																			SO:0001589	frameshift_variant	64743	exon8			.	AF329819	CCDS14302.1	Xp11.23	2013-01-09			ENSG00000101940	ENSG00000101940		"""WD repeat domain containing"""	14352	protein-coding gene	gene with protein product		300512					Standard	NM_017883		Approved		uc004dkj.2	Q9H1Z4	OTTHUMG00000024119	ENST00000218056.5:c.1264dupG	X.37:g.48462769_48462769dupG	ENSP00000218056:p.Gln420fs	121.0	0.0	.		45.0	25.0	0.556	NM_017883	Q06DW8|Q06DX0|Q06DX1|Q9BUL7|Q9NWW4	Frame_Shift_Ins	INS	ENST00000218056.5	37	CCDS14302.1																																																																																			.	.	none		0.629	WDR13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060743.2		
SPAG17	200162	hgsc.bcm.edu	37	1	118567949	118567949	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:118567949G>A	ENST00000336338.5	-	27	3886	c.3821C>T	c.(3820-3822)aCg>aTg	p.T1274M		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1274						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TGGCATCACCGTTTTATAGAA	0.463																																					p.T1274M		Atlas-SNP	.											.	SPAG17	263	.	0			c.C3821T						PASS	.						96.0	93.0	94.0					1																	118567949		2203	4300	6503	SO:0001583	missense	200162	exon27			ATCACCGTTTTAT		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.3821C>T	1.37:g.118567949G>A	ENSP00000337804:p.Thr1274Met	56.0	0.0	0		90.0	44.0	0.488889	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	37	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889137	0.52014	.	.	ENSG00000155761	ENST00000336338	T	0.19532	2.14	5.58	4.67	0.58626	.	0.573492	0.19744	N	0.107042	T	0.20700	0.0498	L	0.51422	1.61	0.09310	N	1	D	0.71674	0.998	P	0.58130	0.833	T	0.04178	-1.0971	10	0.59425	D	0.04	.	12.3516	0.55151	0.0788:0.0:0.9212:0.0	.	1274	Q6Q759	SPG17_HUMAN	M	1274	ENSP00000337804:T1274M	ENSP00000337804:T1274M	T	-	2	0	SPAG17	118369472	0.008000	0.16893	0.013000	0.15412	0.441000	0.31987	1.697000	0.37784	1.350000	0.45770	0.655000	0.94253	ACG	.	.	none		0.463	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
BCL3	602	hgsc.bcm.edu	37	19	45261657	45261657	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:45261657C>T	ENST00000164227.5	+	7	1290	c.1046C>T	c.(1045-1047)gCg>gTg	p.A349V		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	349					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				CTCATGGTGGCGCGCAGCCGC	0.711			T	IGH@	CLL																																p.A349V		Atlas-SNP	.		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	BCL3	28	.	0			c.C1046T						PASS	.						6.0	5.0	6.0					19																	45261657		1987	3872	5859	SO:0001583	missense	602	exon7			TGGTGGCGCGCAG	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.1046C>T	19.37:g.45261657C>T	ENSP00000164227:p.Ala349Val	85.0	0.0	0		82.0	41.0	0.5	NM_005178		Missense_Mutation	SNP	ENST00000164227.5	37	CCDS12642.2	.	.	.	.	.	.	.	.	.	.	C	33	5.265975	0.95399	.	.	ENSG00000069399	ENST00000403534;ENST00000164227	T	0.62364	0.03	4.88	4.88	0.63580	Ankyrin repeat-containing domain (3);	0.409242	0.20420	N	0.092683	T	0.67711	0.2922	M	0.62209	1.925	0.45648	D	0.998571	D	0.89917	1.0	P	0.49332	0.607	T	0.73065	-0.4100	10	0.72032	D	0.01	-29.5782	15.5034	0.75719	0.0:1.0:0.0:0.0	.	349	P20749	BCL3_HUMAN	V	309;349	ENSP00000164227:A349V	ENSP00000164227:A349V	A	+	2	0	BCL3	49953497	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.532000	0.53553	2.257000	0.74773	0.491000	0.48974	GCG	.	.	none		0.711	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322976.1	NM_005178	
OR2H1	26716	hgsc.bcm.edu	37	6	29429915	29429915	+	Silent	SNP	T	T	C	rs538200065	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:29429915T>C	ENST00000377136.1	+	4	834	c.369T>C	c.(367-369)gcT>gcC	p.A123A	OR2H1_ENST00000377133.1_Silent_p.A123A|OR2H1_ENST00000396792.2_Silent_p.A123A|OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000377132.1_Silent_p.A123A|OR2H1_ENST00000442615.1_Silent_p.A123A			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						GATACGTGGCTGTCTGCCAGC	0.582																																					p.A123A		Atlas-SNP	.											.	OR2H1	38	.	0			c.T369C						PASS	.						163.0	167.0	165.0					6																	29429915		1510	2709	4219	SO:0001819	synonymous_variant	26716	exon3			CGTGGCTGTCTGC	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.369T>C	6.37:g.29429915T>C		88.0	0.0	0		111.0	6.0	0.0540541	NM_030883	B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Silent	SNP	ENST00000377136.1	37	CCDS4660.1																																																																																			.	.	none		0.582	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3		
PLXNB2	23654	hgsc.bcm.edu	37	22	50714348	50714348	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr22:50714348G>A	ENST00000449103.1	-	36	5522	c.5382C>T	c.(5380-5382)ctC>ctT	p.L1794L	PLXNB2_ENST00000359337.4_Silent_p.L1794L|AL022328.1_ENST00000595015.1_Missense_Mutation_p.E56K			O15031	PLXB2_HUMAN	plexin B2	1794					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGTATTGGTAGAGCTGGTGGA	0.672											OREG0026679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1794L		Atlas-SNP	.											.	PLXNB2	172	.	0			c.C5382T						PASS	.						51.0	62.0	58.0					22																	50714348		2082	4203	6285	SO:0001819	synonymous_variant	23654	exon36			TTGGTAGAGCTGG		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.5382C>T	22.37:g.50714348G>A		138.0	0.0	0	971	126.0	38.0	0.301587	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																			.	.	none		0.672	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
TWISTNB	221830	hgsc.bcm.edu	37	7	19738329	19738329	+	Silent	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:19738329T>C	ENST00000222567.5	-	4	697	c.627A>G	c.(625-627)gaA>gaG	p.E209E		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	209					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						CTTCAGAAACTTCAGAGCGCT	0.323																																					p.E209E		Atlas-SNP	.											.	TWISTNB	63	.	0			c.A627G						PASS	.						53.0	61.0	59.0					7																	19738329		2199	4289	6488	SO:0001819	synonymous_variant	221830	exon4			AGAAACTTCAGAG	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.627A>G	7.37:g.19738329T>C		48.0	0.0	0		49.0	24.0	0.489796	NM_001002926	A0PJ45|B7Z724	Silent	SNP	ENST00000222567.5	37	CCDS34606.1																																																																																			.	.	none		0.323	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
LIPM	340654	hgsc.bcm.edu	37	10	90574359	90574359	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr10:90574359G>T	ENST00000404743.4	+	4	704	c.537G>T	c.(535-537)aaG>aaT	p.K179N	LIPM_ENST00000539337.1_Missense_Mutation_p.K139N	NM_001128215.1	NP_001121687.1	Q5VYY2	LIPM_HUMAN	lipase, family member M	179					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)|skin(1)	7						GCCAGGAAAAGATCTATTATG	0.413																																					p.K179N		Atlas-SNP	.											.	LIPM	17	.	0			c.G537T						PASS	.						155.0	126.0	135.0					10																	90574359		692	1591	2283	SO:0001583	missense	340654	exon4			GGAAAAGATCTAT		CCDS44457.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000173239	ENSG00000173239			23455	protein-coding gene	gene with protein product		613923	"""lipase-like, ab-hydrolase domain containing 3"""	LIPL3			Standard	NM_001128215		Approved	bA304I5.1	uc009xtm.1	Q5VYY2	OTTHUMG00000018698	ENST00000404743.4:c.537G>T	10.37:g.90574359G>T	ENSP00000383901:p.Lys179Asn	61.0	0.0	0		62.0	18.0	0.290323	NM_001128215	A6PVS3|B2RXK7|B5MCR3	Missense_Mutation	SNP	ENST00000404743.4	37	CCDS44457.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699396	0.48307	.	.	ENSG00000173239	ENST00000404743;ENST00000539337	T;T	0.73681	-0.77;-0.77	6.03	1.54	0.23209	Alpha/beta hydrolase fold-1 (1);	0.189236	0.38111	N	0.001803	T	0.66066	0.2752	L	0.60904	1.88	0.31588	N	0.654267	B;B	0.33288	0.23;0.406	B;B	0.34590	0.11;0.186	T	0.66842	-0.5821	10	0.59425	D	0.04	-19.6872	5.9596	0.19293	0.1926:0.0:0.5454:0.262	.	139;179	B2RXK7;Q5VYY2	.;LIPM_HUMAN	N	179;139	ENSP00000383901:K179N;ENSP00000440375:K139N	ENSP00000383901:K179N	K	+	3	2	LIPM	90564339	0.058000	0.20735	1.000000	0.80357	0.996000	0.88848	0.209000	0.17435	0.417000	0.25871	0.555000	0.69702	AAG	.	.	none		0.413	LIPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049261.3	XM_291663	
ERBB2IP	55914	hgsc.bcm.edu	37	5	65349497	65349497	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr5:65349497C>A	ENST00000284037.5	+	21	2740	c.2351C>A	c.(2350-2352)tCa>tAa	p.S784*	ERBB2IP_ENST00000511297.1_Nonsense_Mutation_p.S780*|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000380936.1_Nonsense_Mutation_p.S784*|ERBB2IP_ENST00000380938.2_Nonsense_Mutation_p.S784*|ERBB2IP_ENST00000380943.2_Nonsense_Mutation_p.S784*|ERBB2IP_ENST00000508515.1_Nonsense_Mutation_p.S784*|ERBB2IP_ENST00000380935.1_Nonsense_Mutation_p.S784*|ERBB2IP_ENST00000506030.1_Nonsense_Mutation_p.S784*|ERBB2IP_ENST00000380939.2_Nonsense_Mutation_p.S784*	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	784					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)	p.S784*(1)		breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ATGGAAAGATCAAAAACACAG	0.323																																					p.S784X		Atlas-SNP	.											ERBB2IP,medulla,primitive_neuroectodermal_tumour-medulloblastoma,0,1	ERBB2IP	120	1	1	Substitution - Nonsense(1)	central_nervous_system(1)	c.C2351A						PASS	.						48.0	50.0	49.0					5																	65349497		2203	4299	6502	SO:0001587	stop_gained	55914	exon21			AAAGATCAAAAAC		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2351C>A	5.37:g.65349497C>A	ENSP00000284037:p.Ser784*	48.0	0.0	0		59.0	32.0	0.542373	NM_001253699	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Nonsense_Mutation	SNP	ENST00000284037.5	37	CCDS58953.1	.	.	.	.	.	.	.	.	.	.	C	38	6.691405	0.97768	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	.	.	.	5.56	4.69	0.59074	.	0.350015	0.29653	N	0.011556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	9.0238	0.36215	0.0:0.7891:0.0:0.2109	.	.	.	.	X	784;784;784;784;784;784;780;784;784	.	ENSP00000284037:S784X	S	+	2	0	ERBB2IP	65385253	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	2.844000	0.48246	1.347000	0.45714	0.467000	0.42956	TCA	.	.	none		0.323	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695	
EXOC3L1	283849	hgsc.bcm.edu	37	16	67220777	67220777	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr16:67220777G>A	ENST00000314586.6	-	7	1409	c.1169C>T	c.(1168-1170)tCt>tTt	p.S390F	KIAA0895L_ENST00000563902.1_5'Flank|EXOC3L1_ENST00000562887.1_5'Flank|KIAA0895L_ENST00000561621.1_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	390					exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						CAGCCACTGAGACACACTTGC	0.592																																					p.S390F		Atlas-SNP	.											.	EXOC3L1	52	.	0			c.C1169T						PASS	.						55.0	60.0	58.0					16																	67220777		2198	4300	6498	SO:0001583	missense	283849	exon7			CACTGAGACACAC	AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1169C>T	16.37:g.67220777G>A	ENSP00000325674:p.Ser390Phe	35.0	0.0	0		28.0	25.0	0.892857	NM_178516	A8K7I9|Q8NAD2|Q8TEN2	Missense_Mutation	SNP	ENST00000314586.6	37	CCDS10832.1	.	.	.	.	.	.	.	.	.	.	G	7.721	0.697108	0.15106	.	.	ENSG00000179044	ENST00000314586	T	0.07114	3.22	5.19	3.21	0.36854	.	0.413929	0.26723	N	0.022835	T	0.05318	0.0141	N	0.14661	0.345	0.22754	N	0.998779	B	0.02656	0.0	B	0.01281	0.0	T	0.33599	-0.9862	10	0.56958	D	0.05	-0.2662	9.1371	0.36881	0.2452:0.0:0.7548:0.0	.	390	Q86VI1	EX3L1_HUMAN	F	390	ENSP00000325674:S390F	ENSP00000325674:S390F	S	-	2	0	EXOC3L1	65778278	0.101000	0.21875	0.823000	0.32752	0.108000	0.19459	2.780000	0.47742	0.576000	0.29452	0.455000	0.32223	TCT	.	.	none		0.592	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268827.2	NM_178516	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																					p.G23G		Atlas-SNP	.											KRTAP5-4,NS,carcinoma,0,1	KRTAP5-4	78	1	1	Substitution - coding silent(1)	kidney(1)	c.C69T						scavenged	.						4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267	exon1			GCCACAGCCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A		124.0	2.0	0.016129		165.0	8.0	0.0484848	NM_001012709		Silent	SNP	ENST00000399682.1	37																																																																																				.	.	none		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
DSCAML1	57453	hgsc.bcm.edu	37	11	117374656	117374656	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:117374656G>A	ENST00000321322.6	-	11	2444	c.2443C>T	c.(2443-2445)Cgc>Tgc	p.R815C	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R545C	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	755	Ig-like C2-type 9.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGGACGTGGCGGATCAGCAGC	0.607																																					p.R815C		Atlas-SNP	.											DSCAML1,NS,carcinoma,+1,1	DSCAML1	286	1	0			c.C2443T						PASS	.						110.0	91.0	97.0					11																	117374656		2201	4296	6497	SO:0001583	missense	57453	exon11			CGTGGCGGATCAG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2443C>T	11.37:g.117374656G>A	ENSP00000315465:p.Arg815Cys	112.0	0.0	0		134.0	65.0	0.485075	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	37	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192049	0.78902	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.68479	-0.33;-0.33	4.29	4.29	0.51040	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82944	0.5147	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	D	0.86461	0.1779	9	0.66056	D	0.02	.	16.9369	0.86205	0.0:0.0:1.0:0.0	.	755	Q8TD84	DSCL1_HUMAN	C	545;815;522	ENSP00000434335:R545C;ENSP00000315465:R815C	ENSP00000315465:R815C	R	-	1	0	DSCAML1	116879866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.560000	0.53763	2.237000	0.73441	0.462000	0.41574	CGC	.	.	none		0.607	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
OTOP2	92736	hgsc.bcm.edu	37	17	72923357	72923357	+	Missense_Mutation	SNP	G	G	A	rs374632139		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:72923357G>A	ENST00000580223.1	+	3	520	c.490G>A	c.(490-492)Gtc>Atc	p.V164I	OTOP2_ENST00000331427.4_Missense_Mutation_p.V164I			Q7RTS6	OTOP2_HUMAN	otopetrin 2	164						integral component of membrane (GO:0016021)		p.V164I(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					CTGCGTTCACGTCCACCTGGA	0.532																																					p.V164I		Atlas-SNP	.											OTOP2,NS,carcinoma,0,1	OTOP2	81	1	1	Substitution - Missense(1)	prostate(1)	c.G490A						PASS	.	G	ILE/VAL	0,4406		0,0,2203	169.0	136.0	147.0		490	-4.9	0.0	17		147	1,8599	1.2+/-3.3	0,1,4299	no	missense	OTOP2	NM_178160.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	164/563	72923357	1,13005	2203	4300	6503	SO:0001583	missense	92736	exon4			GTTCACGTCCACC	BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.490G>A	17.37:g.72923357G>A	ENSP00000463837:p.Val164Ile	186.0	0.0	0		185.0	89.0	0.481081	NM_178160		Missense_Mutation	SNP	ENST00000580223.1	37	CCDS11708.1	.	.	.	.	.	.	.	.	.	.	G	8.144	0.785922	0.16189	0.0	1.16E-4	ENSG00000183034	ENST00000331427	T	0.21734	1.99	4.96	-4.9	0.03094	.	1.057470	0.07294	N	0.873019	T	0.15003	0.0362	L	0.33753	1.03	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.36456	-0.9747	10	0.21540	T	0.41	-6.2717	13.0707	0.59059	0.6472:0.0:0.3528:0.0	.	164	Q7RTS6	OTOP2_HUMAN	I	164	ENSP00000332528:V164I	ENSP00000332528:V164I	V	+	1	0	OTOP2	70434952	0.000000	0.05858	0.021000	0.16686	0.635000	0.38103	-0.132000	0.10467	-0.832000	0.04251	-1.020000	0.02445	GTC	.	.	weak		0.532	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445306.1	NM_178160	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230371	23230371	+	Missense_Mutation	SNP	A	A	T	rs554492007	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr22:23230371A>T	ENST00000526893.1	+	1	412	c.138A>T	c.(136-138)caA>caT	p.Q46H	IGLL5_ENST00000531372.1_Missense_Mutation_p.Q46H|IGLL5_ENST00000532223.2_Missense_Mutation_p.Q46H|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	46						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						TTGCACCGCAAAGCGGGGACC	0.682																																					p.Q46H		Atlas-SNP	.											.	IGLL5	26	.	0			c.A138T						PASS	.																																			SO:0001583	missense	100423062	exon1			ACCGCAAAGCGGG	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.138A>T	22.37:g.23230371A>T	ENSP00000431254:p.Gln46His	131.0	0.0	0		63.0	49.0	0.777778	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.284481	0.40394	.	.	ENSG00000254709	ENST00000532223;ENST00000526893;ENST00000531372	T;T	0.00597	6.31;6.41	3.55	-2.34	0.06704	.	.	.	.	.	T	0.00496	0.0016	N	0.24115	0.695	0.09310	N	1	P	0.52316	0.952	B	0.42692	0.395	T	0.53556	-0.8422	9	0.59425	D	0.04	.	7.4227	0.27081	0.5576:0.0:0.4424:0.0	.	46	B9A064	IGLL5_HUMAN	H	46	ENSP00000436353:Q46H;ENSP00000431254:Q46H	ENSP00000431254:Q46H	Q	+	3	2	IGLL5	21560371	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.209000	0.09358	-0.338000	0.08413	-1.039000	0.02377	CAA	.	.	none		0.682	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
CSK	1445	hgsc.bcm.edu	37	15	75090639	75090639	+	Start_Codon_SNP	SNP	A	A	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr15:75090639A>T	ENST00000220003.9	+	2	730	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	CSK_ENST00000439220.2_Start_Codon_SNP_p.M1L|CSK_ENST00000309470.9_Start_Codon_SNP_p.M1L|CSK_ENST00000567571.1_Start_Codon_SNP_p.M1L	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	1					adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						TCCTGAGAAGATGTCAGCAAT	0.562																																					p.M1L		Atlas-SNP	.											.	CSK	43	.	0			c.A1T						PASS	.						69.0	60.0	63.0					15																	75090639		2197	4296	6493	SO:0001582	initiator_codon_variant	1445	exon3			GAGAAGATGTCAG		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1A>T	15.37:g.75090639A>T	ENSP00000220003:p.Met1Leu	64.0	0.0	0		78.0	35.0	0.448718	NM_001127190	Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445454	0.63178	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	T;T;T	0.73681	-0.77;-0.77;-0.77	5.29	5.29	0.74685	Src homology-3 domain (1);	0.200615	0.49305	D	0.000152	T	0.78654	0.4317	.	.	.	0.80722	D	1	P	0.39940	0.696	P	0.51170	0.661	T	0.76929	-0.2777	9	0.34782	T	0.22	-17.2848	12.9023	0.58133	1.0:0.0:0.0:0.0	.	1	P41240	CSK_HUMAN	L	1	ENSP00000220003:M1L;ENSP00000414764:M1L;ENSP00000438808:M1L	ENSP00000220003:M1L	M	+	1	0	CSK	72877692	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.640000	0.67875	2.142000	0.66516	0.459000	0.35465	ATG	.	.	none		0.562	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	Missense_Mutation
C16orf58	64755	hgsc.bcm.edu	37	16	31510677	31510677	+	Silent	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr16:31510677A>G	ENST00000327237.2	-	5	585	c.546T>C	c.(544-546)gcT>gcC	p.A182A	C16orf58_ENST00000430477.2_Silent_p.A40A|C16orf58_ENST00000567994.1_Silent_p.A137A|C16orf58_ENST00000570164.1_Silent_p.A182A			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	182						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						GGTATACAGGAGCCATAATCT	0.517																																					p.S182S		Atlas-SNP	.											.	C16orf58	28	.	0			c.T546C						PASS	.						94.0	87.0	89.0					16																	31510677		2197	4300	6497	SO:0001819	synonymous_variant	64755	exon5			TACAGGAGCCATA	AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.546T>C	16.37:g.31510677A>G		156.0	0.0	0		175.0	9.0	0.0514286	NM_022744	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Silent	SNP	ENST00000327237.2	37	CCDS10715.1																																																																																			.	.	none		0.517	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102476412	102476412	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr14:102476412C>T	ENST00000360184.4	+	30	6374	c.6210C>T	c.(6208-6210)gtC>gtT	p.V2070V		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2070	AAA 1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						ACAAAATCGTCCCGTTTTTTA	0.418																																					p.V2070V		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.C6210T						PASS	.						61.0	65.0	64.0					14																	102476412		2203	4299	6502	SO:0001819	synonymous_variant	1778	exon30			AATCGTCCCGTTT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.6210C>T	14.37:g.102476412C>T		38.0	0.0	0		53.0	4.0	0.0754717	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																			.	.	none		0.418	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
ADGB	79747	hgsc.bcm.edu	37	6	147103217	147103217	+	Silent	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:147103217T>C	ENST00000397944.3	+	30	4000	c.3924T>C	c.(3922-3924)agT>agC	p.S1308S	ADGB_ENST00000367488.1_Silent_p.S31S|ADGB_ENST00000523560.1_3'UTR|ADGB_ENST00000367493.3_Silent_p.S623S	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1308					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						ACACTATTAGTGAGGGACAAA	0.373																																					p.S1308S		Atlas-SNP	.											.	ADGB	93	.	0			c.T3924C						PASS	.						76.0	68.0	70.0					6																	147103217		692	1591	2283	SO:0001819	synonymous_variant	79747	exon30			TATTAGTGAGGGA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3924T>C	6.37:g.147103217T>C		102.0	0.0	0		93.0	4.0	0.0430108	NM_024694	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	37																																																																																				.	.	none		0.373	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
LURAP1L	286343	hgsc.bcm.edu	37	9	12775861	12775861	+	Silent	SNP	T	T	C	rs3833707|rs139315731		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr9:12775861T>C	ENST00000319264.3	+	1	842	c.147T>C	c.(145-147)ggT>ggC	p.G49G	RP11-3L8.3_ENST00000417638.1_RNA|LURAP1L_ENST00000489107.1_3'UTR	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	52	Gly-rich.		Missing.					p.G49_G50insGGG(2)									gcggtggtggtggcggcggcg	0.687																																					p.G49G		Atlas-SNP	.											C9orf150,NS,carcinoma,0,1	.	.	1	2	Insertion - In frame(2)	prostate(1)|central_nervous_system(1)	c.T147C						scavenged	.						4.0	5.0	5.0					9																	12775861		2038	3961	5999	SO:0001819	synonymous_variant	286343	exon1			TGGTGGTGGCGGC	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.147T>C	9.37:g.12775861T>C		12.0	2.0	0.166667		15.0	5.0	0.333333	NM_203403	Q5VZX7|Q8N923|Q8NCG2	Silent	SNP	ENST00000319264.3	37	CCDS6473.1																																																																																			.	.	none		0.687	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
FAM47A	158724	hgsc.bcm.edu	37	X	34148961	34148961	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:34148961G>A	ENST00000346193.3	-	1	1486	c.1435C>T	c.(1435-1437)Cac>Tac	p.H479Y		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	479										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						TGTTCCGGGTGGGGATGGGAC	0.622																																					p.H479Y		Atlas-SNP	.											.	FAM47A	249	.	0			c.C1435T						PASS	.						48.0	54.0	52.0					X																	34148961		2170	4263	6433	SO:0001583	missense	158724	exon1			CCGGGTGGGGATG	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1435C>T	X.37:g.34148961G>A	ENSP00000345029:p.His479Tyr	92.0	0.0	0		84.0	67.0	0.797619	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	37	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	1.827	-0.470858	0.04445	.	.	ENSG00000185448	ENST00000346193	T	0.13657	2.57	0.48	-0.96	0.10340	.	.	.	.	.	T	0.06234	0.0161	N	0.03608	-0.345	0.20873	N	0.999838	D	0.54772	0.968	P	0.46758	0.526	T	0.22243	-1.0222	8	0.40728	T	0.16	.	.	.	.	.	479	Q5JRC9	FA47A_HUMAN	Y	479	ENSP00000345029:H479Y	ENSP00000345029:H479Y	H	-	1	0	FAM47A	34058882	0.002000	0.14202	0.009000	0.14445	0.040000	0.13550	-0.289000	0.08365	-0.679000	0.05217	0.183000	0.17082	CAC	.	.	none		0.622	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
GALNT16	57452	hgsc.bcm.edu	37	14	69727023	69727023	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr14:69727023G>A	ENST00000337827.4	+	1	343	c.16G>A	c.(16-18)Gcc>Acc	p.A6T	RP11-363J20.2_ENST00000556316.1_lincRNA|GALNT16_ENST00000554858.1_3'UTR|GALNT16_ENST00000448469.3_Missense_Mutation_p.A6T|GALNT16_ENST00000553669.1_Missense_Mutation_p.A6T	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	6					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GAAGATCCGCGCCAATGCCAT	0.697																																					p.A6T		Atlas-SNP	.											.	GALNT16	8	.	0			c.G16A						PASS	.						84.0	65.0	72.0					14																	69727023		2202	4300	6502	SO:0001583	missense	57452	exon1			ATCCGCGCCAATG	AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.16G>A	14.37:g.69727023G>A	ENSP00000336729:p.Ala6Thr	76.0	0.0	0		72.0	4.0	0.0555556	NM_001168368	Q4KMG3|Q58A55|Q9ULT9	Missense_Mutation	SNP	ENST00000337827.4	37	CCDS32107.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722824	0.89298	.	.	ENSG00000100626	ENST00000337827;ENST00000448469;ENST00000553669	T;T;T	0.56941	0.56;0.56;0.43	4.35	2.45	0.29901	.	0.240329	0.32736	N	0.005718	T	0.37919	0.1021	L	0.43152	1.355	0.51012	D	0.999904	B;B	0.18166	0.014;0.026	B;B	0.06405	0.002;0.002	T	0.10870	-1.0611	10	0.13470	T	0.59	.	8.5824	0.33637	0.0828:0.0:0.7656:0.1517	.	6;6	Q8N428;Q58A55	GLTL1_HUMAN;.	T	6	ENSP00000336729:A6T;ENSP00000402970:A6T;ENSP00000451200:A6T	ENSP00000336729:A6T	A	+	1	0	GALNTL1	68796776	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.332000	0.65911	0.360000	0.24265	0.455000	0.32223	GCC	.	.	none		0.697	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412434.1	NM_001168368	
KIAA1377	57562	hgsc.bcm.edu	37	11	101834522	101834522	+	Missense_Mutation	SNP	C	C	T	rs370774279		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:101834522C>T	ENST00000263468.8	+	6	3026	c.2756C>T	c.(2755-2757)cCg>cTg	p.P919L	KIAA1377_ENST00000537689.1_Missense_Mutation_p.P720L	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	919										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GAAAGTTATCCGTCTGTGACT	0.403																																					p.P919L		Atlas-SNP	.											KIAA1377,NS,carcinoma,-1,2	KIAA1377	111	2	0			c.C2756T						PASS	.	C	LEU/PRO	0,4406		0,0,2203	88.0	94.0	92.0		2756	0.1	0.0	11		92	1,8597	1.2+/-3.3	0,1,4298	no	missense	KIAA1377	NM_020802.2	98	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	919/1118	101834522	1,13003	2203	4299	6502	SO:0001583	missense	57562	exon6			GTTATCCGTCTGT	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.2756C>T	11.37:g.101834522C>T	ENSP00000263468:p.Pro919Leu	133.0	0.0	0		134.0	65.0	0.485075	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	37	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	C	4.369	0.067932	0.08436	0.0	1.16E-4	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.06068	3.35;3.35	5.51	0.134	0.14771	.	0.796339	0.11112	N	0.598499	T	0.05868	0.0153	L	0.47716	1.5	0.09310	N	1	B	0.32425	0.371	B	0.19148	0.024	T	0.33879	-0.9851	10	0.08599	T	0.76	3.4773	16.234	0.82361	0.3611:0.6389:0.0:0.0	.	919	Q9P2H0	K1377_HUMAN	L	919;720	ENSP00000263468:P919L;ENSP00000443184:P720L	ENSP00000263468:P919L	P	+	2	0	KIAA1377	101339732	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.508000	0.22692	0.123000	0.18342	-0.266000	0.10368	CCG	.	.	weak		0.403	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
NHSL1	57224	hgsc.bcm.edu	37	6	138745866	138745866	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:138745866G>A	ENST00000427025.2	-	7	4813	c.4185C>T	c.(4183-4185)ggC>ggT	p.G1395G	NHSL1_ENST00000343505.5_Silent_p.G1391G	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	1395										breast(2)|endometrium(4)|kidney(1)	7						TTGGGGCAGCGCCGGTGGGTG	0.547																																					p.G1395G		Atlas-SNP	.											.	NHSL1	99	.	0			c.C4185T						PASS	.						32.0	33.0	33.0					6																	138745866		692	1591	2283	SO:0001819	synonymous_variant	57224	exon7			GGCAGCGCCGGTG	AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.4185C>T	6.37:g.138745866G>A		79.0	0.0	0		85.0	37.0	0.435294	NM_020464	Q3ZCS5|Q5SYE8|Q9P2J0	Silent	SNP	ENST00000427025.2	37	CCDS55063.1																																																																																			.	.	none		0.547	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043700.2	XM_050421	
ABLIM2	84448	hgsc.bcm.edu	37	4	8089920	8089920	+	Missense_Mutation	SNP	C	C	T	rs371815593		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr4:8089920C>T	ENST00000341937.5	-	4	494	c.430G>A	c.(430-432)Gcg>Acg	p.A144T	ABLIM2_ENST00000505872.1_Missense_Mutation_p.A144T|ABLIM2_ENST00000545242.1_Missense_Mutation_p.A144T|ABLIM2_ENST00000428004.2_Missense_Mutation_p.A144T|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000407564.3_Missense_Mutation_p.A144T|ABLIM2_ENST00000361581.5_Missense_Mutation_p.A144T|ABLIM2_ENST00000361737.5_Missense_Mutation_p.A144T|ABLIM2_ENST00000296372.8_Missense_Mutation_p.A144T|ABLIM2_ENST00000546334.1_Missense_Mutation_p.A144T|ABLIM2_ENST00000447017.2_Missense_Mutation_p.A144T	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	144					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						GACAGGTGCGCGCTGCTGCCC	0.627																																					p.A144T		Atlas-SNP	.											.	ABLIM2	59	.	0			c.G430A						PASS	.	C	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4108		0,0,2054	34.0	40.0	38.0		430,430,430,430,430,430,430	-1.5	0.0	4		38	2,8350		0,2,4174	no	missense,missense,missense,missense,missense,missense,missense	ABLIM2	NM_001130083.1,NM_001130084.1,NM_001130085.1,NM_001130086.1,NM_001130087.1,NM_001130088.1,NM_032432.4	58,58,58,58,58,58,58	0,2,6228	TT,TC,CC		0.0239,0.0,0.0161	benign,benign,benign,benign,benign,benign,benign	144/646,144/612,144/573,144/560,144/532,144/471,144/522	8089920	2,12458	2054	4176	6230	SO:0001583	missense	84448	exon4			GGTGCGCGCTGCT	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.430G>A	4.37:g.8089920C>T	ENSP00000342813:p.Ala144Thr	399.0	0.0	0		394.0	190.0	0.482233	NM_001130083	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Missense_Mutation	SNP	ENST00000341937.5	37	CCDS47013.1	.	.	.	.	.	.	.	.	.	.	C	4.648	0.120390	0.08881	0.0	2.39E-4	ENSG00000163995	ENST00000361737;ENST00000400045;ENST00000296372;ENST00000545242;ENST00000546334;ENST00000447017;ENST00000341937;ENST00000361581;ENST00000407564;ENST00000505872;ENST00000428004	T;T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	4.02	-1.51	0.08664	.	0.721192	0.12976	U	0.423720	T	0.23289	0.0563	L	0.37850	1.14	0.09310	N	0.999998	B;B;B;B;B;B;B;B	0.15141	0.012;0.001;0.007;0.0;0.001;0.0;0.001;0.0	B;B;B;B;B;B;B;B	0.09377	0.003;0.002;0.004;0.002;0.002;0.0;0.0;0.0	T	0.16689	-1.0394	10	0.30078	T	0.28	.	0.3069	0.00282	0.2364:0.3013:0.2088:0.2534	.	149;144;144;144;144;144;144;144	B7Z6W4;Q6H8Q1-6;Q08E71;Q6H8Q1-2;Q6H8Q1-3;Q6H8Q1;Q19VH0;E9PF39	.;.;.;.;.;ABLM2_HUMAN;.;.	T	144	ENSP00000354887:A144T;ENSP00000296372:A144T;ENSP00000441255:A144T;ENSP00000444365:A144T;ENSP00000393511:A144T;ENSP00000342813:A144T;ENSP00000355003:A144T;ENSP00000384658:A144T;ENSP00000421283:A144T;ENSP00000389410:A144T	ENSP00000296372:A144T	A	-	1	0	ABLIM2	8140820	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-0.120000	0.10660	-0.226000	0.09899	-0.263000	0.10527	GCG	.	.	weak		0.627	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358862.2	NM_001130083	
PRKG2	5593	hgsc.bcm.edu	37	4	82092909	82092909	+	Silent	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr4:82092909A>G	ENST00000395578.1	-	4	794	c.678T>C	c.(676-678)ccT>ccC	p.P226P	RP11-100N20.1_ENST00000505175.1_RNA|RP11-100N20.1_ENST00000512502.1_RNA|PRKG2_ENST00000418486.2_Silent_p.P226P|PRKG2_ENST00000264399.1_Silent_p.P226P			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	226					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TGGTCCACATAGGGATGGAGG	0.408																																					p.P226P		Atlas-SNP	.											.	PRKG2	195	.	0			c.T678C						PASS	.						97.0	99.0	98.0					4																	82092909		2203	4300	6503	SO:0001819	synonymous_variant	5593	exon3			CCACATAGGGATG	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.678T>C	4.37:g.82092909A>G		78.0	0.0	0		77.0	5.0	0.0649351	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Silent	SNP	ENST00000395578.1	37	CCDS3589.1																																																																																			.	.	none		0.408	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
USP6	9098	hgsc.bcm.edu	37	17	5049419	5049419	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:5049419C>G	ENST00000574788.1	+	28	4499	c.2269C>G	c.(2269-2271)Ctt>Gtt	p.L757V	USP6_ENST00000304328.5_Missense_Mutation_p.L440V|USP6_ENST00000250066.6_Missense_Mutation_p.L757V|USP6_ENST00000332776.4_Missense_Mutation_p.L757V			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	757	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCTCTGTGGACTTAATTCAGA	0.358			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.L757V		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213	.	0			c.C2269G						PASS	.						149.0	147.0	148.0					17																	5049419		2203	4300	6503	SO:0001583	missense	9098	exon20			TGTGGACTTAATT	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2269C>G	17.37:g.5049419C>G	ENSP00000460380:p.Leu757Val	425.0	0.0	0		457.0	172.0	0.376368	NM_004505	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	C	8.818	0.936782	0.18206	.	.	ENSG00000129204	ENST00000332776;ENST00000250066;ENST00000304328	T;T;T	0.14144	2.53;2.94;2.55	2.55	2.55	0.30701	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.14614	0.0353	N	0.16833	0.445	0.50813	D	0.999894	D;D	0.71674	0.998;0.966	D;P	0.77557	0.99;0.908	T	0.23655	-1.0182	10	0.15499	T	0.54	.	5.4016	0.16299	0.0:0.8349:0.0:0.1651	.	440;757	P35125-2;P35125	.;UBP6_HUMAN	V	757;757;440	ENSP00000328010:L757V;ENSP00000250066:L757V;ENSP00000305473:L440V	ENSP00000250066:L757V	L	+	1	0	USP6	4990143	1.000000	0.71417	0.999000	0.59377	0.133000	0.20885	3.846000	0.55888	1.433000	0.47394	0.194000	0.17425	CTT	.	.	none		0.358	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
STXBP5	134957	hgsc.bcm.edu	37	6	147612247	147612247	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:147612247G>T	ENST00000321680.6	+	9	856	c.856G>T	c.(856-858)Ggg>Tgg	p.G286W	STXBP5_ENST00000367480.3_Missense_Mutation_p.G286W|STXBP5_ENST00000179882.6_5'UTR|STXBP5_ENST00000367481.3_Missense_Mutation_p.G286W|STXBP5_ENST00000546097.1_Missense_Mutation_p.G286W	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	286					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		GTTAAAGGATGGGAAGAAGCC	0.308																																					p.G286W		Atlas-SNP	.											.	STXBP5	163	.	0			c.G856T						PASS	.						93.0	89.0	90.0					6																	147612247		2203	4300	6503	SO:0001583	missense	134957	exon9			AAGGATGGGAAGA	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.856G>T	6.37:g.147612247G>T	ENSP00000321826:p.Gly286Trp	114.0	0.0	0		97.0	45.0	0.463918	NM_139244	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	37	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511125	0.85389	.	.	ENSG00000164506	ENST00000367481;ENST00000546097;ENST00000321680;ENST00000367480	T;D;T;T	0.86366	2.45;-2.11;2.44;2.56	5.35	5.35	0.76521	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.000000	0.85682	D	0.000000	D	0.92172	0.7518	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92395	0.5924	10	0.72032	D	0.01	.	19.0338	0.92969	0.0:0.0:1.0:0.0	.	286;286	Q5T5C0-2;Q5T5C0	.;STXB5_HUMAN	W	286	ENSP00000356451:G286W;ENSP00000441479:G286W;ENSP00000321826:G286W;ENSP00000356450:G286W	ENSP00000321826:G286W	G	+	1	0	STXBP5	147653940	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.580000	0.90784	2.656000	0.90262	0.650000	0.86243	GGG	.	.	none		0.308	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
KRTAP4-8	728224	hgsc.bcm.edu	37	17	39253949	39253949	+	Missense_Mutation	SNP	T	T	A	rs200040006	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:39253949T>A	ENST00000333822.4	-	1	444	c.388A>T	c.(388-390)Agc>Tgc	p.S130C		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	130	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgctgcagctgggg	0.677													T|||	312	0.0623003	0.0787	0.0865	5008	,	,		15319	0.0278		0.0616	False		,,,				2504	0.0593				p.S130C		Atlas-SNP	.											KRTAP4-8,NS,carcinoma,0,4	KRTAP4-8	57	4	0			c.A388T						scavenged	.						4.0	6.0	5.0					17																	39253949		641	1513	2154	SO:0001583	missense	728224	exon1			AGATGCTGCAGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.388A>T	17.37:g.39253949T>A	ENSP00000328444:p.Ser130Cys	49.0	2.0	0.0408163		75.0	7.0	0.0933333	NM_031960	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	5.252	0.232015	0.09969	.	.	ENSG00000204880	ENST00000333822	T	0.00593	6.34	3.73	2.64	0.31445	.	.	.	.	.	T	0.00144	0.0004	N	0.00027	-2.645	0.24205	N	0.995495	B	0.02656	0.0	B	0.01281	0.0	T	0.37709	-0.9694	9	0.02654	T	1	.	7.9032	0.29746	0.8151:0.0:0.0:0.1849	.	130	Q9BYQ9	KRA48_HUMAN	C	130	ENSP00000328444:S130C	ENSP00000328444:S130C	S	-	1	0	KRTAP4-8	36507475	0.993000	0.37304	0.954000	0.39281	0.491000	0.33493	4.109000	0.57824	0.430000	0.26230	-0.595000	0.04109	AGC	.	.	weak		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
HCAR3	8843	hgsc.bcm.edu	37	12	123200477	123200477	+	Missense_Mutation	SNP	G	G	A	rs562598836		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:123200477G>A	ENST00000528880.2	-	1	962	c.808C>T	c.(808-810)Cgc>Tgc	p.R270C	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	270					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	TCCACCGAGCGGTACACTTCA	0.547													g|||	1	0.000199681	0.0	0.0014	5008	,	,		17943	0.0		0.0	False		,,,				2504	0.0				p.R270C		Atlas-SNP	.											.	HCAR3	49	.	0			c.C808T						PASS	.						14.0	17.0	16.0					12																	123200477		2072	4240	6312	SO:0001583	missense	8843	exon1			CCGAGCGGTACAC	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.808C>T	12.37:g.123200477G>A	ENSP00000436714:p.Arg270Cys	118.0	0.0	0		148.0	20.0	0.135135	NM_006018	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	ENST00000528880.2	37	CCDS53842.1	.	.	.	.	.	.	.	.	.	.	g	12.25	1.881324	0.33255	.	.	ENSG00000255398	ENST00000528880	T	0.37584	1.19	3.26	2.01	0.26516	.	.	.	.	.	T	0.47097	0.1427	L	0.60067	1.865	0.09310	N	1	D	0.57899	0.981	P	0.59595	0.86	T	0.27938	-1.0059	9	0.66056	D	0.02	.	6.4754	0.22033	0.2217:0.0:0.7783:0.0	.	270	E9PI97	.	C	270	ENSP00000436714:R270C	ENSP00000436714:R270C	R	-	1	0	HCAR3	121766430	0.000000	0.05858	0.023000	0.16930	0.275000	0.26752	-0.123000	0.10611	0.206000	0.20587	0.184000	0.17185	CGC	.	.	weak		0.547	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018	
GPR56	9289	hgsc.bcm.edu	37	16	57691387	57691387	+	Missense_Mutation	SNP	G	G	A	rs147479620	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr16:57691387G>A	ENST00000388812.4	+	10	1710	c.1270G>A	c.(1270-1272)Gcc>Acc	p.A424T	GPR56_ENST00000562558.1_Missense_Mutation_p.A424T|GPR56_ENST00000568909.1_Missense_Mutation_p.A424T|GPR56_ENST00000567835.1_Missense_Mutation_p.A424T|GPR56_ENST00000456916.1_Missense_Mutation_p.A424T|GPR56_ENST00000568908.1_Missense_Mutation_p.A424T|GPR56_ENST00000538815.1_Missense_Mutation_p.A424T|GPR56_ENST00000562631.1_Missense_Mutation_p.A424T|GPR56_ENST00000388813.5_Missense_Mutation_p.A424T|GPR56_ENST00000540164.2_Missense_Mutation_p.A424T|GPR56_ENST00000544297.1_Missense_Mutation_p.A249T|GPR56_ENST00000379694.4_Missense_Mutation_p.A254T|GPR56_ENST00000379696.3_Missense_Mutation_p.A424T			Q9Y653	GPR56_HUMAN	G protein-coupled receptor 56	424					angiogenesis (GO:0001525)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cerebral cortex radial glia guided migration (GO:0021801)|G-protein coupled receptor signaling pathway (GO:0007186)|layer formation in cerebral cortex (GO:0021819)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell adhesion (GO:0045785)|positive regulation of Rho protein signal transduction (GO:0035025)|protein kinase C signaling (GO:0070528)|Rho protein signal transduction (GO:0007266)|vascular endothelial growth factor production (GO:0010573)	extracellular vesicular exosome (GO:0070062)|glial limiting end-foot (GO:0097451)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	15						CACCATTGCCGCCTACCTCTG	0.647													G|||	2	0.000399361	0.0	0.0	5008	,	,		13233	0.0		0.002	False		,,,				2504	0.0				p.A429T		Atlas-SNP	.											.	GPR56	44	.	0			c.G1285A						PASS	.	G	THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	0,4396		0,0,2198	153.0	137.0	142.0		1270,1270,1270,1285,1270,1270,1270,1270	1.7	1.0	16	dbSNP_134	142	9,8591	7.1+/-27.0	0,9,4291	yes	missense,missense,missense,missense,missense,missense,missense,missense	GPR56	NM_001145770.1,NM_001145771.1,NM_001145772.1,NM_001145773.1,NM_001145774.1,NM_005682.5,NM_201524.2,NM_201525.2	58,58,58,58,58,58,58,58	0,9,6489	AA,AG,GG		0.1047,0.0,0.0693	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	424/688,424/694,424/688,429/693,424/688,424/694,424/688,424/688	57691387	9,12987	2198	4300	6498	SO:0001583	missense	9289	exon10			ATTGCCGCCTACC	AJ011001	CCDS32460.1, CCDS32461.1, CCDS73893.1	16q13	2014-08-08				ENSG00000205336		"""-"", ""GPCR / Class B : Orphans"""	4512	protein-coding gene	gene with protein product		604110				10049584, 10100861	Standard	XM_005256237		Approved	TM7LN4, TM7XN1	uc002emb.2	Q9Y653		ENST00000388812.4:c.1270G>A	16.37:g.57691387G>A	ENSP00000373464:p.Ala424Thr	49.0	0.0	0		24.0	20.0	0.833333	NM_001145773	A6NIT7|A6NJV9|B0M0K4|B4DR54|O95966|Q6ZMP1|Q8NGB3|Q96HB4	Missense_Mutation	SNP	ENST00000388812.4	37	CCDS32460.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	14.17	2.455466	0.43634	0.0	0.001047	ENSG00000205336	ENST00000388813;ENST00000388812;ENST00000538815;ENST00000456916;ENST00000540164;ENST00000544297;ENST00000379694;ENST00000379696	T;T;T;T;T;T;T;T	0.47177	1.13;0.85;1.13;0.85;1.13;0.85;0.85;0.85	5.11	1.66	0.24008	GPCR, family 2-like (1);	0.474781	0.19007	N	0.125183	T	0.15522	0.0374	N	0.02391	-0.57	0.29960	N	0.819489	P;P;B;P;P	0.49783	0.911;0.928;0.37;0.91;0.928	B;B;B;B;B	0.40534	0.224;0.332;0.04;0.264;0.332	T	0.07385	-1.0775	10	0.13470	T	0.59	.	3.5997	0.08020	0.2112:0.0:0.4261:0.3628	.	249;429;424;424;254	F5H144;B4DR54;Q9Y653-2;Q9Y653;E7ENB2	.;.;.;GPR56_HUMAN;.	T	424;424;424;424;424;249;254;424	ENSP00000373465:A424T;ENSP00000373464:A424T;ENSP00000444415:A424T;ENSP00000398034:A424T;ENSP00000444911:A424T;ENSP00000438006:A249T;ENSP00000369016:A254T;ENSP00000369018:A424T	ENSP00000369016:A254T	A	+	1	0	GPR56	56248888	0.879000	0.30193	0.974000	0.42286	0.663000	0.39108	1.354000	0.34056	1.142000	0.42291	0.491000	0.48974	GCC	G|0.999;A|0.001	0.001	strong		0.647	GPR56-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000433436.3		
MAGEL2	54551	hgsc.bcm.edu	37	15	23890645	23890645	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr15:23890645G>A	ENST00000532292.1	-	1	530	c.436C>T	c.(436-438)Cgc>Tgc	p.R146C		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	29					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		AAGATCATGCGGTCTTTTGAA	0.602																																					p.R749C		Atlas-SNP	.											MAGEL2_ENST00000532292,colon,carcinoma,0,2	MAGEL2	108	2	0			c.C2245T						PASS	.						33.0	37.0	35.0					15																	23890645		1971	4150	6121	SO:0001583	missense	54551	exon1			TCATGCGGTCTTT	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.436C>T	15.37:g.23890645G>A	ENSP00000433433:p.Arg146Cys	72.0	0.0	0		88.0	34.0	0.386364	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	37																																																																																				.	.	none		0.602	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
SYNE1	23345	hgsc.bcm.edu	37	6	152651974	152651974	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:152651974C>T	ENST00000367255.5	-	78	14447	c.13846G>A	c.(13846-13848)Gaa>Aaa	p.E4616K	SYNE1_ENST00000448038.1_Missense_Mutation_p.E4545K|SYNE1_ENST00000265368.4_Missense_Mutation_p.E4616K|SYNE1_ENST00000341594.5_Missense_Mutation_p.E4363K|SYNE1_ENST00000423061.1_Missense_Mutation_p.E4545K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4616					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGAAGATTTTCATATTCTGGA	0.383										HNSCC(10;0.0054)																											p.E4616K		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G13846A						PASS	.						164.0	166.0	165.0					6																	152651974		2203	4300	6503	SO:0001583	missense	23345	exon78			GATTTTCATATTC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13846G>A	6.37:g.152651974C>T	ENSP00000356224:p.Glu4616Lys	79.0	0.0	0		74.0	34.0	0.459459	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	19.37	3.815534	0.70912	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.53857	1.33;1.33;1.33;1.33;0.6	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000004	T	0.64832	0.2634	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.997;0.999	T	0.59434	-0.7455	10	0.41790	T	0.15	.	20.3368	0.98748	0.0:1.0:0.0:0.0	.	4616;4616;4616;4545	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	4616;4545;4616;4545;4363	ENSP00000356224:E4616K;ENSP00000396024:E4545K;ENSP00000265368:E4616K;ENSP00000390975:E4545K;ENSP00000341887:E4363K	ENSP00000265368:E4616K	E	-	1	0	SYNE1	152693667	1.000000	0.71417	0.951000	0.38953	0.909000	0.53808	7.818000	0.86416	2.805000	0.96524	0.655000	0.94253	GAA	.	.	none		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SPPL2C	162540	hgsc.bcm.edu	37	17	43923211	43923211	+	Silent	SNP	G	G	A	rs150961436		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:43923211G>A	ENST00000329196.5	+	1	956	c.939G>A	c.(937-939)ccG>ccA	p.P313P	MAPT-AS1_ENST00000581125.1_RNA|MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000579244.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	313						endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										AGAGGCCTCCGCACAGCCTCT	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17815	0.0		0.0	False		,,,				2504	0.0				p.P313P		Atlas-SNP	.											IMP5,colon,carcinoma,+1,1	.	.	1	0			c.G939A						PASS	.	G		1,4405	2.1+/-5.4	0,1,2202	47.0	51.0	50.0		939	1.1	0.0	17	dbSNP_134	50	0,8600		0,0,4300	no	coding-synonymous	IMP5	NM_175882.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		313/685	43923211	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	162540	exon1			GCCTCCGCACAGC		CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.939G>A	17.37:g.43923211G>A		33.0	0.0	0		47.0	19.0	0.404255	NM_175882	Q8TC67|Q8WVZ6	Silent	SNP	ENST00000329196.5	37	CCDS32673.1																																																																																			G|1.000;A|0.000	0.000	weak		0.642	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441156.1	NM_175882	
LIMD2	80774	hgsc.bcm.edu	37	17	61775957	61775957	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:61775957C>T	ENST00000259006.3	-	5	497	c.339G>A	c.(337-339)gaG>gaA	p.E113E	LIMD2_ENST00000578061.1_Silent_p.E113E|LIMD2_ENST00000578402.1_Silent_p.E113E|LIMD2_ENST00000578993.1_Silent_p.E73E|LIMD2_ENST00000582055.1_Silent_p.E64E|LIMD2_ENST00000583211.1_Silent_p.E64E	NM_030576.3	NP_085053.1	Q9BT23	LIMD2_HUMAN	LIM domain containing 2	113							zinc ion binding (GO:0008270)			kidney(1)|lung(2)	3						GGGCCCAGAGCTCCTTGTGCT	0.637																																					p.E113E		Atlas-SNP	.											.	LIMD2	6	.	0			c.G339A						PASS	.						67.0	53.0	58.0					17																	61775957		2203	4300	6503	SO:0001819	synonymous_variant	80774	exon5			CCAGAGCTCCTTG	AK092301	CCDS11641.1	17q23.3	2006-02-03				ENSG00000136490			28142	protein-coding gene	gene with protein product						12477932	Standard	NM_030576		Approved	MGC10986	uc002jbj.4	Q9BT23		ENST00000259006.3:c.339G>A	17.37:g.61775957C>T		76.0	0.0	0		55.0	23.0	0.418182	NM_030576	D3DU16|Q96S91	Silent	SNP	ENST00000259006.3	37	CCDS11641.1																																																																																			.	.	none		0.637	LIMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443877.1	NM_030576	
ARMC9	80210	hgsc.bcm.edu	37	2	232099952	232099952	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:232099952T>C	ENST00000349938.4	+	8	832	c.638T>C	c.(637-639)cTc>cCc	p.L213P	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	213						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		TTGCAGCAGCTCCACCAGCAG	0.398																																					p.L213P		Atlas-SNP	.											.	ARMC9	129	.	0			c.T638C						PASS	.						57.0	57.0	57.0					2																	232099952		2203	4300	6503	SO:0001583	missense	80210	exon8			AGCAGCTCCACCA	BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.638T>C	2.37:g.232099952T>C	ENSP00000258417:p.Leu213Pro	61.0	0.0	0		88.0	4.0	0.0454545	NM_025139	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	ENST00000349938.4	37	CCDS2484.1	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846960	0.71603	.	.	ENSG00000135931	ENST00000349938;ENST00000359743	T	0.19669	2.13	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	T	0.46814	0.1412	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.46665	-0.9175	10	0.66056	D	0.02	-21.8479	15.7937	0.78388	0.0:0.0:0.0:1.0	.	213	Q7Z3E5	ARMC9_HUMAN	P	213	ENSP00000258417:L213P	ENSP00000258417:L213P	L	+	2	0	ARMC9	231808196	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.588000	0.67517	2.126000	0.65437	0.533000	0.62120	CTC	.	.	none		0.398	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256966.3	NM_025139	
TREML2	79865	hgsc.bcm.edu	37	6	41166095	41166095	+	Missense_Mutation	SNP	T	T	C	rs141238140		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:41166095T>C	ENST00000483722.1	-	2	313	c.128A>G	c.(127-129)tAt>tGt	p.Y43C		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	43	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					GTAGCCCTTATAGGAGCACTG	0.522																																					p.Y43C		Atlas-SNP	.											.	TREML2	41	.	0			c.A128G						PASS	.						158.0	166.0	163.0					6																	41166095		2203	4300	6503	SO:0001583	missense	79865	exon2			CCCTTATAGGAGC	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.128A>G	6.37:g.41166095T>C	ENSP00000418767:p.Tyr43Cys	67.0	0.0	0		94.0	6.0	0.0638298	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	14.49	2.551853	0.45487	.	.	ENSG00000112195	ENST00000483722	T	0.68624	-0.34	4.75	4.75	0.60458	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49305	D	0.000157	T	0.81307	0.4795	M	0.93106	3.38	0.38602	D	0.95069	D	0.89917	1.0	D	0.97110	1.0	D	0.85899	0.1433	10	0.87932	D	0	-20.157	10.9548	0.47351	0.0:0.0:0.0:1.0	.	43	Q5T2D2	TRML2_HUMAN	C	43	ENSP00000418767:Y43C	ENSP00000418767:Y43C	Y	-	2	0	TREML2	41274073	1.000000	0.71417	1.000000	0.80357	0.352000	0.29268	1.308000	0.33528	1.901000	0.55032	0.460000	0.39030	TAT	.	.	weak		0.522	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
FBN1	2200	hgsc.bcm.edu	37	15	48779516	48779516	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr15:48779516C>T	ENST00000316623.5	-	28	3911	c.3456G>A	c.(3454-3456)gcG>gcA	p.A1152A		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1152	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TACCGATACACGCGGAGATGT	0.488																																					p.A1152A		Atlas-SNP	.											FBN1,colon,carcinoma,-1,1	FBN1	310	1	0			c.G3456A						scavenged	.						98.0	98.0	98.0					15																	48779516		2198	4296	6494	SO:0001819	synonymous_variant	2200	exon28			GATACACGCGGAG	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.3456G>A	15.37:g.48779516C>T		96.0	1.0	0.0104167		71.0	38.0	0.535211	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	37	CCDS32232.1																																																																																			.	.	none		0.488	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
CACTIN	58509	hgsc.bcm.edu	37	19	3612193	3612193	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:3612193G>A	ENST00000429344.2	-	10	2057	c.2005C>T	c.(2005-2007)Ccg>Tcg	p.P669S	CACTIN_ENST00000221899.3_Missense_Mutation_p.P601S|CACTIN_ENST00000248420.5_Missense_Mutation_p.P669S|CACTIN-AS1_ENST00000592274.1_RNA	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	669					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										ATCTTGGGCGGTGGGTTGTCA	0.587																																					p.P669S		Atlas-SNP	.											.	.	.	.	0			c.C2005T						PASS	.						139.0	156.0	150.0					19																	3612193		2166	4255	6421	SO:0001583	missense	58509	exon10			TGGGCGGTGGGTT	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.2005C>T	19.37:g.3612193G>A	ENSP00000415078:p.Pro669Ser	201.0	0.0	0		222.0	107.0	0.481982	NM_021231	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	ENST00000429344.2	37	CCDS45920.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393353	0.42410	.	.	ENSG00000105298	ENST00000429344;ENST00000248420;ENST00000221899	.	.	.	4.2	2.06	0.26882	Cactin protein, cactus-binding domain, C-terminal (1);	0.120124	0.56097	D	0.000023	T	0.80226	0.4584	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.80841	-0.1202	9	0.87932	D	0	.	9.1523	0.36971	0.1829:0.0:0.8171:0.0	.	669;669	Q8WUQ7-2;Q8WUQ7	.;CS029_HUMAN	S	669;669;601	.	ENSP00000221899:P601S	P	-	1	0	C19orf29	3563193	1.000000	0.71417	0.029000	0.17559	0.001000	0.01503	9.150000	0.94667	0.539000	0.28788	-0.148000	0.13756	CCG	.	.	none		0.587	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457370.2		
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274172	39274172	+	Silent	SNP	G	G	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:39274172G>T	ENST00000391413.2	-	1	434	c.396C>A	c.(394-396)ccC>ccA	p.P132P		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	132	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ggcagcaggtgggctggcagc	0.672																																					p.P132P		Atlas-SNP	.											KRTAP4-11,NS,carcinoma,-2,2	KRTAP4-11	94	2	0			c.C396A						scavenged	.						7.0	12.0	11.0					17																	39274172		675	1578	2253	SO:0001819	synonymous_variant	653240	exon1			GCAGGTGGGCTGG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.396C>A	17.37:g.39274172G>T		78.0	0.0	0		93.0	4.0	0.0430108	NM_033059	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																			.	.	none		0.672	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
PTN	5764	hgsc.bcm.edu	37	7	136936058	136936058	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:136936058G>A	ENST00000348225.2	-	4	797	c.370C>T	c.(370-372)Cga>Tga	p.R124*	PTN_ENST00000393083.2_Nonsense_Mutation_p.R124*	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	124					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						TGCAGGGCTCGCTTCAGACTT	0.527																																					p.R124X		Atlas-SNP	.											.	PTN	38	.	0			c.C370T						PASS	.						292.0	266.0	275.0					7																	136936058		2203	4300	6503	SO:0001587	stop_gained	5764	exon4			GGGCTCGCTTCAG	M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.370C>T	7.37:g.136936058G>A	ENSP00000341170:p.Arg124*	229.0	0.0	0		274.0	131.0	0.478102	NM_002825	Q5U0B0|Q6ICQ5|Q9UCC6	Nonsense_Mutation	SNP	ENST00000348225.2	37	CCDS5844.1	.	.	.	.	.	.	.	.	.	.	G	39	7.527019	0.98339	.	.	ENSG00000105894	ENST00000348225;ENST00000393083	.	.	.	6.02	4.05	0.47172	.	0.115288	0.64402	D	0.000017	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-9.3356	14.1566	0.65422	0.0:0.0:0.5946:0.4054	.	.	.	.	X	124	.	ENSP00000341170:R124X	R	-	1	2	PTN	136586598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.741000	0.47426	1.528000	0.49103	0.650000	0.86243	CGA	.	.	none		0.527	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341339.1	NM_002825	
RBM42	79171	hgsc.bcm.edu	37	19	36124108	36124108	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:36124108C>T	ENST00000262633.4	+	6	743	c.638C>T	c.(637-639)gCt>gTt	p.A213V	RBM42_ENST00000592202.1_Missense_Mutation_p.A159V|RBM42_ENST00000588161.1_Missense_Mutation_p.A183V|RBM42_ENST00000589559.1_Missense_Mutation_p.A184V|RBM42_ENST00000589871.1_Missense_Mutation_p.A191V|RBM42_ENST00000586618.1_Intron|RBM42_ENST00000360475.4_Missense_Mutation_p.A184V	NM_024321.3	NP_077297.2	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	213	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(7)|lung(9)|prostate(1)	21	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			ATGGCTCGGGCTCCAGGGCCC	0.697																																					p.A213V		Atlas-SNP	.											.	RBM42	40	.	0			c.C638T						PASS	.						38.0	49.0	45.0					19																	36124108		2196	4291	6487	SO:0001583	missense	79171	exon6			CTCGGGCTCCAGG	BC004204	CCDS12468.1	19q13.12	2013-02-12				ENSG00000126254		"""RNA binding motif (RRM) containing"""	28117	protein-coding gene	gene with protein product		613232				12477932	Standard	NM_024321		Approved	MGC10433	uc002oan.3	Q9BTD8		ENST00000262633.4:c.638C>T	19.37:g.36124108C>T	ENSP00000262633:p.Ala213Val	32.0	0.0	0		32.0	4.0	0.125	NM_024321	O00320|Q8N5R7|Q9BU66	Missense_Mutation	SNP	ENST00000262633.4	37	CCDS12468.1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576124	0.65878	.	.	ENSG00000126254	ENST00000262633;ENST00000360475	T;T	0.06449	3.3;3.34	5.05	5.05	0.67936	.	0.180852	0.47455	D	0.000236	T	0.11537	0.0281	N	0.14661	0.345	0.29843	N	0.829062	D;D;D;D	0.60575	0.988;0.988;0.988;0.98	D;D;D;D	0.70935	0.971;0.971;0.971;0.935	T	0.03555	-1.1025	10	0.48119	T	0.1	-7.1616	13.7681	0.63008	0.0:1.0:0.0:0.0	.	179;184;183;213	Q9BTD8-4;Q9BTD8-3;Q9BTD8-2;Q9BTD8	.;.;.;RBM42_HUMAN	V	213;184	ENSP00000262633:A213V;ENSP00000353663:A184V	ENSP00000262633:A213V	A	+	2	0	RBM42	40815948	0.988000	0.35896	1.000000	0.80357	0.968000	0.65278	2.033000	0.41136	2.628000	0.89032	0.561000	0.74099	GCT	.	.	none		0.697	RBM42-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459057.2	NM_024321	
SORL1	6653	hgsc.bcm.edu	37	11	121429298	121429298	+	Splice_Site	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:121429298A>G	ENST00000260197.7	+	20	2792		c.e20-1			NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing						cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CATTTTCGCTAGGGTGATGTT	0.473																																					.		Atlas-SNP	.											.	SORL1	218	.	0			c.2664-2A>G						PASS	.						168.0	163.0	164.0					11																	121429298		2203	4299	6502	SO:0001630	splice_region_variant	6653	exon20			TTCGCTAGGGTGA	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2664-1A>G	11.37:g.121429298A>G		90.0	0.0	0		101.0	37.0	0.366337	NM_003105	B2RNX7|Q92856	Splice_Site	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.160296	0.57368	.	.	ENSG00000137642	ENST00000260197	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6637	0.77209	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SORL1	120934508	1.000000	0.71417	0.337000	0.25536	0.644000	0.38419	9.087000	0.94110	2.105000	0.64084	0.533000	0.62120	.	.	.	none		0.473	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	Intron
KRT24	192666	hgsc.bcm.edu	37	17	38859553	38859553	+	Silent	SNP	G	G	T	rs367736597		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:38859553G>T	ENST00000264651.2	-	1	449	c.393C>A	c.(391-393)ggC>ggA	p.G131G		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	131	Gly-rich.|Head.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				GCCCCCCATCGCCAACACCAC	0.537																																					p.G131G	GBM(61;380 1051 14702 23642 31441)	Atlas-SNP	.											.	KRT24	60	.	0			c.C393A						PASS	.						176.0	194.0	188.0					17																	38859553		2203	4300	6503	SO:0001819	synonymous_variant	192666	exon1			CCCATCGCCAACA		CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.393C>A	17.37:g.38859553G>T		77.0	0.0	0		69.0	34.0	0.492754	NM_019016	Q9NXG7	Silent	SNP	ENST00000264651.2	37	CCDS11372.1																																																																																			.	.	alt		0.537	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257217.1	NM_019016	
ABCA3	21	hgsc.bcm.edu	37	16	2326687	2326687	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr16:2326687C>A	ENST00000301732.5	-	33	5803	c.5103G>T	c.(5101-5103)gaG>gaT	p.E1701D	ABCA3_ENST00000382381.3_Missense_Mutation_p.E1643D|MIR4717_ENST00000584656.1_RNA	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	1701					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	ATCGCCCCTCCTCTGCGGTGG	0.612																																					p.E1701D		Atlas-SNP	.											ABCA3,NS,carcinoma,-2,1	ABCA3	176	1	0			c.G5103T						PASS	.						47.0	45.0	46.0					16																	2326687		2198	4300	6498	SO:0001583	missense	21	exon33			CCCCTCCTCTGCG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.5103G>T	16.37:g.2326687C>A	ENSP00000301732:p.Glu1701Asp	55.0	0.0	0		56.0	24.0	0.428571	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.328649	0.24167	.	.	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.83673	-1.75	5.44	-7.48	0.01360	.	0.438733	0.26503	N	0.024012	T	0.52773	0.1755	N	0.12422	0.21	0.26390	N	0.97659	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.50092	-0.8868	10	0.19590	T	0.45	.	0.6966	0.00900	0.3859:0.1226:0.1741:0.3175	.	1705;1701	Q4LE27;Q99758	.;ABCA3_HUMAN	D	1701;1705	ENSP00000301732:E1701D	ENSP00000301732:E1701D	E	-	3	2	ABCA3	2266688	0.000000	0.05858	0.198000	0.23420	0.008000	0.06430	-0.742000	0.04850	-1.113000	0.02981	-0.895000	0.02911	GAG	.	.	none		0.612	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
KCNC1	3746	hgsc.bcm.edu	37	11	17793670	17793670	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:17793670C>T	ENST00000379472.3	+	2	1059	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	KCNC1_ENST00000265969.6_Silent_p.N343N	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	343					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	CCAGCACCAACGAGTTCCTGC	0.617																																					p.N343N		Atlas-SNP	.											.	KCNC1	149	.	0			c.C1029T						PASS	.						37.0	35.0	36.0					11																	17793670		2200	4293	6493	SO:0001819	synonymous_variant	3746	exon2			CACCAACGAGTTC	M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.1029C>T	11.37:g.17793670C>T		51.0	0.0	0		64.0	31.0	0.484375	NM_004976	K4DI87	Silent	SNP	ENST00000379472.3	37	CCDS7827.1																																																																																			.	.	none		0.617	KCNC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389389.1	NM_004976	
STAG2	10735	hgsc.bcm.edu	37	X	123182892	123182892	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:123182892A>T	ENST00000371160.1	+	10	1147	c.857A>T	c.(856-858)aAt>aTt	p.N286I	STAG2_ENST00000354548.5_Missense_Mutation_p.N217I|STAG2_ENST00000371157.3_Missense_Mutation_p.N286I|STAG2_ENST00000371145.3_Missense_Mutation_p.N286I|STAG2_ENST00000371144.3_Missense_Mutation_p.N286I|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.N286I	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	286					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						AATATGATGAATGCAATATTT	0.294																																					p.N286I		Atlas-SNP	.											.	STAG2	309	.	0			c.A857T						PASS	.						100.0	93.0	96.0					X																	123182892		2203	4297	6500	SO:0001583	missense	10735	exon10			TGATGAATGCAAT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.857A>T	X.37:g.123182892A>T	ENSP00000360202:p.Asn286Ile	341.0	0.0	0		256.0	21.0	0.0820312	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.419454	0.83559	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41;1.41;1.41	5.47	5.47	0.80525	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58192	0.2105	M	0.85041	2.73	0.80722	D	1	D;D	0.63046	0.987;0.992	D;D	0.65684	0.937;0.933	T	0.65059	-0.6260	10	0.62326	D	0.03	-0.079	14.1713	0.65512	1.0:0.0:0.0:0.0	.	286;286	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	I	286;286;217;286;286;286;286	ENSP00000218089:N286I;ENSP00000397265:N286I;ENSP00000346555:N217I;ENSP00000360202:N286I;ENSP00000360199:N286I;ENSP00000360187:N286I;ENSP00000360186:N286I	ENSP00000218089:N286I	N	+	2	0	STAG2	123010573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	1.809000	0.52856	0.486000	0.48141	AAT	.	.	none		0.294	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
PSME3	10197	hgsc.bcm.edu	37	17	40985663	40985663	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:40985663G>A	ENST00000590720.1	+	1	248	c.15G>A	c.(13-15)ctG>ctA	p.L5L	PSME3_ENST00000441946.2_5'UTR|PSME3_ENST00000592169.1_Silent_p.L5L|PSME3_ENST00000293362.3_Silent_p.L5L|PSME3_ENST00000592578.1_3'UTR|PSME3_ENST00000545225.1_Intron|PSME3_ENST00000541124.1_Silent_p.L5L			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)	5					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)			NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCTCGTTGCTGAAGGTGGATC	0.652																																					p.L5L		Atlas-SNP	.											.	PSME3	11	.	0			c.G15A						PASS	.						69.0	58.0	62.0					17																	40985663		2203	4300	6503	SO:0001819	synonymous_variant	10197	exon1			GTTGCTGAAGGTG	U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.15G>A	17.37:g.40985663G>A		153.0	0.0	0		160.0	70.0	0.4375	NM_176863	A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Silent	SNP	ENST00000590720.1	37	CCDS45689.1																																																																																			.	.	none		0.652	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452430.1	NM_176863	
ABCA7	10347	hgsc.bcm.edu	37	19	1049321	1049321	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:1049321G>A	ENST00000263094.6	+	18	2668	c.2437G>A	c.(2437-2439)Gag>Aag	p.E813K	ABCA7_ENST00000435683.2_Missense_Mutation_p.E675K|ABCA7_ENST00000433129.1_Missense_Mutation_p.E813K	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	813	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGCAGCCTGGAGAAGCGCTT	0.677																																					p.E813K		Atlas-SNP	.											.	ABCA7	174	.	0			c.G2437A						PASS	.						49.0	57.0	55.0					19																	1049321		2202	4296	6498	SO:0001583	missense	10347	exon18			AGCCTGGAGAAGC	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.2437G>A	19.37:g.1049321G>A	ENSP00000263094:p.Glu813Lys	132.0	0.0	0		133.0	6.0	0.0451128	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	9.960	1.222447	0.22457	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	T;T	0.79554	-1.28;-1.28	4.0	2.94	0.34122	ABC transporter-like (1);	.	.	.	.	T	0.56001	0.1956	N	0.03209	-0.39	0.26432	N	0.975921	B;B	0.13145	0.007;0.004	B;B	0.14578	0.011;0.003	T	0.38351	-0.9665	9	0.07813	T	0.8	.	9.7753	0.40614	0.109:0.0:0.891:0.0	.	675;813	Q8IZY2-2;Q8IZY2	.;ABCA7_HUMAN	K	813	ENSP00000263094:E813K;ENSP00000414062:E813K	ENSP00000263094:E813K	E	+	1	0	ABCA7	1000321	1.000000	0.71417	0.995000	0.50966	0.197000	0.23852	5.512000	0.67030	0.777000	0.33496	0.462000	0.41574	GAG	.	.	none		0.677	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
TNFRSF11B	4982	hgsc.bcm.edu	37	8	119938922	119938922	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr8:119938922C>A	ENST00000297350.4	-	4	1006	c.628G>T	c.(628-630)Gct>Tct	p.A210S		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	210	Death 1.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			GTAGGAACAGCAAACCTGAAG	0.413																																					p.A210S		Atlas-SNP	.											.	TNFRSF11B	87	.	0			c.G628T						PASS	.						102.0	91.0	95.0					8																	119938922		2203	4300	6503	SO:0001583	missense	4982	exon4			GAACAGCAAACCT	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.628G>T	8.37:g.119938922C>A	ENSP00000297350:p.Ala210Ser	96.0	0.0	0		106.0	5.0	0.0471698	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	37	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599564	0.87055	.	.	ENSG00000164761	ENST00000297350	T	0.62639	0.01	5.6	5.6	0.85130	DEATH-like (1);	0.151580	0.44097	D	0.000494	T	0.71517	0.3349	L	0.44542	1.39	0.40998	D	0.984908	D	0.76494	0.999	D	0.63793	0.918	T	0.69499	-0.5129	9	.	.	.	-6.7848	17.8092	0.88610	0.0:1.0:0.0:0.0	.	210	O00300	TR11B_HUMAN	S	210	ENSP00000297350:A210S	.	A	-	1	0	TNFRSF11B	120008103	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.309000	0.43699	2.652000	0.90054	0.563000	0.77884	GCT	.	.	none		0.413	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
MUC2	4583	hgsc.bcm.edu	37	11	1092885	1092885	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:1092885G>A	ENST00000441003.2	+	30	4731	c.4704G>A	c.(4702-4704)acG>acA	p.T1568T	MUC2_ENST00000359061.5_Silent_p.T1569T|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCACCACCACGGTGaccccaa	0.637																																					p.T1568T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,+1,8	MUC2	614	8	0			c.G4704A						scavenged	.						124.0	160.0	148.0					11																	1092885		1964	3666	5630	SO:0001819	synonymous_variant	4583	exon30			CACCACGGTGACC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4704G>A	11.37:g.1092885G>A		70.0	2.0	0.0285714		91.0	9.0	0.0989011	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.	.	none		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
STAB1	23166	hgsc.bcm.edu	37	3	52549477	52549477	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr3:52549477C>T	ENST00000321725.6	+	37	3979	c.3903C>T	c.(3901-3903)ttC>ttT	p.F1301F		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1301					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GATCTGGCTTCTCCTTCTCCC	0.612																																					p.F1301F		Atlas-SNP	.											.	STAB1	178	.	0			c.C3903T						PASS	.						82.0	76.0	78.0					3																	52549477		2202	4300	6502	SO:0001819	synonymous_variant	23166	exon37			TGGCTTCTCCTTC	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3903C>T	3.37:g.52549477C>T		108.0	0.0	0		95.0	4.0	0.0421053	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1																																																																																			.	.	none		0.612	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
RGAG1	57529	hgsc.bcm.edu	37	X	109697658	109697658	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:109697658G>A	ENST00000465301.2	+	3	4059	c.3813G>A	c.(3811-3813)cgG>cgA	p.R1271R	RGAG1_ENST00000540313.1_Silent_p.R1271R	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1271										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CCATTCTACGGACCAGGTTTC	0.522																																					p.R1271R		Atlas-SNP	.											.	RGAG1	168	.	0			c.G3813A						PASS	.						126.0	122.0	123.0					X																	109697658		2203	4300	6503	SO:0001819	synonymous_variant	57529	exon3			TCTACGGACCAGG	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3813G>A	X.37:g.109697658G>A		161.0	0.0	0		107.0	8.0	0.0747664	NM_020769	Q9P2M8	Silent	SNP	ENST00000465301.2	37	CCDS14552.1																																																																																			.	.	none		0.522	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
VIT	5212	hgsc.bcm.edu	37	2	36970315	36970315	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:36970315C>A	ENST00000389975.3	+	4	493	c.191C>A	c.(190-192)gCa>gAa	p.A64E	VIT_ENST00000379241.3_Missense_Mutation_p.A64E|VIT_ENST00000379242.3_Missense_Mutation_p.A64E|VIT_ENST00000401530.1_Missense_Mutation_p.A64E|VIT_ENST00000457137.2_Missense_Mutation_p.A64E|VIT_ENST00000497382.1_5'UTR|VIT_ENST00000404084.1_Missense_Mutation_p.A42E	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	64	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				AAATGTCCAGCAGGATGCCAA	0.483																																					p.A64E		Atlas-SNP	.											.	VIT	138	.	0			c.C191A						PASS	.						173.0	142.0	152.0					2																	36970315		2203	4300	6503	SO:0001583	missense	5212	exon4			GTCCAGCAGGATG	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.191C>A	2.37:g.36970315C>A	ENSP00000374625:p.Ala64Glu	109.0	0.0	0		101.0	48.0	0.475248	NM_001177969	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	37	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721566	0.89298	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000402257;ENST00000457137;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55;-2.55;-2.55	4.77	4.77	0.60923	LCCL (5);	0.124941	0.52532	D	0.000062	D	0.93598	0.7956	M	0.75777	2.31	0.47584	D	0.999461	D;D;D;D;D;D	0.71674	0.998;0.998;0.994;0.996;0.995;0.997	D;P;P;D;P;P	0.65773	0.932;0.903;0.897;0.938;0.888;0.888	D	0.94337	0.7567	10	0.72032	D	0.01	-8.2082	16.3687	0.83346	0.0:1.0:0.0:0.0	.	64;64;64;64;64;64	B4DRU4;E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4;Q6UXI7-3	.;.;.;VITRN_HUMAN;.;.	E	64;64;64;64;42;64;64	ENSP00000368544:A64E;ENSP00000374625:A64E;ENSP00000393561:A64E;ENSP00000384154:A42E;ENSP00000368543:A64E;ENSP00000385658:A64E	ENSP00000368543:A64E	A	+	2	0	VIT	36823819	1.000000	0.71417	0.995000	0.50966	0.912000	0.54170	5.496000	0.66918	2.358000	0.79984	0.650000	0.86243	GCA	.	.	none		0.483	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
PHEX	5251	hgsc.bcm.edu	37	X	22117216	22117216	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:22117216C>T	ENST00000379374.4	+	9	1591	c.1026C>T	c.(1024-1026)cgC>cgT	p.R342R	PHEX_ENST00000418858.3_Silent_p.R45R|PHEX_ENST00000535894.1_Silent_p.R245R|PHEX_ENST00000475778.1_3'UTR|PHEX_ENST00000537599.1_Silent_p.R342R	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	342					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						TGGTGGTCCGCGTCCCGCAGT	0.448																																					p.R342R		Atlas-SNP	.											.	PHEX	95	.	0			c.C1026T						PASS	.						117.0	106.0	110.0					X																	22117216		2203	4300	6503	SO:0001819	synonymous_variant	5251	exon9			GGTCCGCGTCCCG	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1026C>T	X.37:g.22117216C>T		83.0	0.0	0		64.0	6.0	0.09375	NM_000444	O00678|Q13646|Q2M325|Q93032|Q99827	Silent	SNP	ENST00000379374.4	37	CCDS14204.1																																																																																			.	.	none		0.448	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056035.1	NM_000444	
SNED1	25992	hgsc.bcm.edu	37	2	241992639	241992639	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:241992639C>T	ENST00000310397.8	+	16	2153	c.2153C>T	c.(2152-2154)gCg>gTg	p.A718V	SNED1_ENST00000342631.6_Missense_Mutation_p.A718V|SNED1_ENST00000401884.1_Missense_Mutation_p.A718V|SNED1_ENST00000405547.3_Missense_Mutation_p.A718V|AC005237.4_ENST00000458377.1_RNA|SNED1_ENST00000469006.1_3'UTR	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	718	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CGGCTGGGCGCGGTGGCCCTG	0.697																																					p.A718V		Atlas-SNP	.											.	SNED1	76	.	0			c.C2153T						PASS	.						19.0	25.0	23.0					2																	241992639		2042	4152	6194	SO:0001583	missense	25992	exon16			TGGGCGCGGTGGC	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.2153C>T	2.37:g.241992639C>T	ENSP00000308893:p.Ala718Val	63.0	0.0	0		46.0	29.0	0.630435	NM_001080437	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	.	.	.	.	.	.	.	.	.	.	C	9.411	1.080605	0.20309	.	.	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	4.28	4.28	0.50868	Complement control module (1);Sushi/SCR/CCP (2);	0.437637	0.19414	N	0.114867	T	0.16514	0.0397	L	0.39326	1.205	0.24368	N	0.994843	P	0.42993	0.797	B	0.27500	0.08	T	0.14643	-1.0465	10	0.33141	T	0.24	.	12.5961	0.56470	0.0:0.8327:0.1673:0.0	.	718	Q8TER0	SNED1_HUMAN	V	718	ENSP00000384871:A718V;ENSP00000386007:A718V;ENSP00000308893:A718V;ENSP00000342992:A718V	ENSP00000308893:A718V	A	+	2	0	SNED1	241641312	0.996000	0.38824	0.010000	0.14722	0.007000	0.05969	4.403000	0.59729	1.927000	0.55829	0.561000	0.74099	GCG	.	.	none		0.697	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
MTMR10	54893	hgsc.bcm.edu	37	15	31266590	31266590	+	Nonsense_Mutation	SNP	A	A	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr15:31266590A>C	ENST00000435680.1	-	5	498	c.401T>G	c.(400-402)tTa>tGa	p.L134*	MTMR10_ENST00000425768.1_Nonsense_Mutation_p.L134*|MTMR10_ENST00000314404.8_5'UTR|MTMR10_ENST00000563714.1_Nonsense_Mutation_p.L52*	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	134							phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		ATAAATAATTAACTCTGTTGG	0.323																																					p.L134X		Atlas-SNP	.											.	MTMR10	74	.	0			c.T401G						PASS	.						52.0	52.0	52.0					15																	31266590		1797	4057	5854	SO:0001587	stop_gained	54893	exon5			ATAATTAACTCTG	AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.401T>G	15.37:g.31266590A>C	ENSP00000402537:p.Leu134*	104.0	0.0	0		127.0	70.0	0.551181	NM_017762	Q6P4Q6	Nonsense_Mutation	SNP	ENST00000435680.1	37	CCDS45204.1	.	.	.	.	.	.	.	.	.	.	A	37	6.370397	0.97511	.	.	ENSG00000166912	ENST00000435680;ENST00000425768;ENST00000340566	.	.	.	5.49	3.15	0.36227	.	0.065888	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7074	0.28659	0.8072:0.0:0.068:0.1248	.	.	.	.	X	134;134;52	.	ENSP00000340637:L52X	L	-	2	0	MTMR10	29053882	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.910000	0.92685	0.446000	0.26666	0.533000	0.62120	TTA	.	.	none		0.323	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1	NM_017762	
OR4C6	219432	hgsc.bcm.edu	37	11	55433434	55433434	+	Silent	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:55433434C>A	ENST00000314259.3	+	1	821	c.792C>A	c.(790-792)ccC>ccA	p.P264P		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P264P(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						TCACTCACCCCATAGACAAGG	0.483																																					p.P264P		Atlas-SNP	.											OR4C6,NS,carcinoma,0,1	OR4C6	114	1	1	Substitution - coding silent(1)	lung(1)	c.C792A						PASS	.						105.0	103.0	104.0					11																	55433434		2200	4296	6496	SO:0001819	synonymous_variant	219432	exon1			TCACCCCATAGAC	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.792C>A	11.37:g.55433434C>A		106.0	0.0	0		146.0	64.0	0.438356	NM_001004704	B2RP11|Q6IFD2	Silent	SNP	ENST00000314259.3	37	CCDS31506.1																																																																																			.	.	none		0.483	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704	
MANEA	79694	hgsc.bcm.edu	37	6	96053987	96053987	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:96053987C>T	ENST00000358812.4	+	5	1229	c.1095C>T	c.(1093-1095)atC>atT	p.I365I		NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	365	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		ATACCAGCATCCGTCCATGGA	0.423																																					p.I365I		Atlas-SNP	.											.	MANEA	58	.	0			c.C1095T						PASS	.						99.0	107.0	104.0					6																	96053987		2203	4300	6503	SO:0001819	synonymous_variant	79694	exon5			CAGCATCCGTCCA	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.1095C>T	6.37:g.96053987C>T		52.0	0.0	0		50.0	28.0	0.56	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Silent	SNP	ENST00000358812.4	37	CCDS5032.1																																																																																			.	.	none		0.423	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
KLHL29	114818	hgsc.bcm.edu	37	2	23785138	23785138	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:23785138C>T	ENST00000486442.1	+	3	789	c.72C>T	c.(70-72)aaC>aaT	p.N24N		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	24										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						GGAGCGTCAACGGGACGCATG	0.701																																					p.N24N		Atlas-SNP	.											.	KLHL29	47	.	0			c.C72T						PASS	.						14.0	22.0	20.0					2																	23785138		692	1591	2283	SO:0001819	synonymous_variant	114818	exon3			CGTCAACGGGACG		CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.72C>T	2.37:g.23785138C>T		66.0	0.0	0		66.0	26.0	0.393939	NM_052920	Q8N388|Q96BF0|Q96PW7	Silent	SNP	ENST00000486442.1	37	CCDS54335.1																																																																																			.	.	none		0.701	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324315.3	NM_052920	
MAGI3	260425	hgsc.bcm.edu	37	1	114191926	114191926	+	Silent	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:114191926A>G	ENST00000307546.9	+	13	2298	c.2223A>G	c.(2221-2223)ctA>ctG	p.L741L	MAGI3_ENST00000369611.4_Silent_p.L741L|MAGI3_ENST00000369617.4_Silent_p.L766L|MAGI3_ENST00000369615.1_Silent_p.L741L	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	766					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCAGGGTGCTAGGAGGAGATG	0.413																																					p.L741L		Atlas-SNP	.											.	MAGI3	181	.	0			c.A2223G						PASS	.						127.0	126.0	126.0					1																	114191926		2203	4300	6503	SO:0001819	synonymous_variant	260425	exon13			GGTGCTAGGAGGA	AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.2223A>G	1.37:g.114191926A>G		42.0	0.0	0		85.0	4.0	0.0470588	NM_152900	Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Silent	SNP	ENST00000307546.9	37	CCDS44196.1																																																																																			.	.	none		0.413	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000032429.1	NM_152900	
PLAC1	10761	hgsc.bcm.edu	37	X	133700486	133700486	+	Missense_Mutation	SNP	C	C	T	rs200146589		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:133700486C>T	ENST00000359237.4	-	3	512	c.227G>A	c.(226-228)cGt>cAt	p.R76H	PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1											large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					TTCAGTAACACGGTAGGTGAA	0.488													C|||	1	0.000264901	0.0	0.0	3775	,	,		17035	0.001		0.0	False		,,,				2504	0.0				p.R76H		Atlas-SNP	.											.	PLAC1	17	.	0			c.G227A						PASS	.						234.0	193.0	207.0					X																	133700486		2203	4300	6503	SO:0001583	missense	10761	exon3			GTAACACGGTAGG	AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.227G>A	X.37:g.133700486C>T	ENSP00000352173:p.Arg76His	207.0	0.0	0		116.0	5.0	0.0431034	NM_021796		Missense_Mutation	SNP	ENST00000359237.4	37	CCDS14642.1	1	6.027727546714888E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	15.39	2.818858	0.50633	.	.	ENSG00000170965	ENST00000359237	D	0.82526	-1.62	4.5	3.63	0.41609	.	0.165937	0.29159	N	0.012976	D	0.88085	0.6342	M	0.72479	2.2	0.32859	D	0.507722	D	0.89917	1.0	D	0.76575	0.988	D	0.88235	0.2906	10	0.35671	T	0.21	-20.1143	8.8436	0.35157	0.2223:0.7777:0.0:0.0	.	76	Q9HBJ0	PLAC1_HUMAN	H	76	ENSP00000352173:R76H	ENSP00000352173:R76H	R	-	2	0	PLAC1	133528152	0.907000	0.30839	0.869000	0.34112	0.580000	0.36256	1.622000	0.36997	1.226000	0.43582	0.600000	0.82982	CGT	C|0.999;T|0.001	0.001	strong		0.488	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058375.1	NM_021796	
CUL7	9820	hgsc.bcm.edu	37	6	43007981	43007981	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:43007981A>G	ENST00000265348.3	-	22	4292	c.4207T>C	c.(4207-4209)Tca>Cca	p.S1403P	CUL7_ENST00000535468.1_Missense_Mutation_p.S1487P			Q14999	CUL7_HUMAN	cullin 7	1403					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGGCAGATTGAGGCAACAGGC	0.552																																					p.S1487P		Atlas-SNP	.											.	CUL7	133	.	0			c.T4459C						PASS	.						163.0	123.0	136.0					6																	43007981		2203	4300	6503	SO:0001583	missense	9820	exon22			AGATTGAGGCAAC	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.4207T>C	6.37:g.43007981A>G	ENSP00000265348:p.Ser1403Pro	116.0	0.0	0		123.0	5.0	0.0406504	NM_001168370	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	A	10.75	1.438588	0.25900	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.79653	-1.29;-1.29	5.71	4.58	0.56647	Cullin, N-terminal (1);Cullin homology (2);	0.242102	0.45126	D	0.000398	T	0.45895	0.1365	N	0.25286	0.73	0.44117	D	0.996898	B;B;B;B	0.33171	0.05;0.061;0.031;0.4	B;B;B;B	0.37833	0.019;0.032;0.017;0.259	T	0.55134	-0.8188	10	0.02654	T	1	-1.3666	5.3129	0.15841	0.8032:0.0:0.1968:0.0	.	1487;1403;1487;1403	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	P	1403;1487	ENSP00000265348:S1403P;ENSP00000438788:S1487P	ENSP00000265348:S1403P	S	-	1	0	CUL7	43115959	0.997000	0.39634	0.953000	0.39169	0.828000	0.46876	1.426000	0.34870	2.179000	0.69175	0.459000	0.35465	TCA	.	.	none		0.552	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
SNX13	23161	hgsc.bcm.edu	37	7	17874490	17874490	+	Splice_Site	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:17874490T>C	ENST00000409389.1	-	14	1532		c.e14-2		SNX13_ENST00000428135.3_Splice_Site			Q9Y5W8	SNX13_HUMAN	sorting nexin 13						intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TGGAGATGCCTAACAGAGAAA	0.299																																					.		Atlas-SNP	.											.	SNX13	113	.	0			c.1360-2A>G						PASS	.						41.0	40.0	40.0					7																	17874490		1805	4059	5864	SO:0001630	splice_region_variant	23161	exon15			GATGCCTAACAGA	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1360-2A>G	7.37:g.17874490T>C		95.0	0.0	0		89.0	4.0	0.0449438	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Splice_Site	SNP	ENST00000409389.1	37		.	.	.	.	.	.	.	.	.	.	T	19.85	3.904370	0.72868	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.863	0.70394	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNX13	17841015	1.000000	0.71417	0.951000	0.38953	0.887000	0.51463	5.681000	0.68175	1.979000	0.57680	0.402000	0.26972	.	.	.	none		0.299	SNX13-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000327608.1	NM_015132	Intron
LDOC1	23641	hgsc.bcm.edu	37	X	140271025	140271025	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:140271025C>A	ENST00000370526.2	-	1	285	c.182G>T	c.(181-183)aGc>aTc	p.S61I	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	61					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					GAGCCGGGAGCTCTCGCCATT	0.617																																					p.S61I		Atlas-SNP	.											.	LDOC1	26	.	0			c.G182T						PASS	.						49.0	44.0	45.0					X																	140271025		2203	4300	6503	SO:0001583	missense	23641	exon1			CGGGAGCTCTCGC	AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.182G>T	X.37:g.140271025C>A	ENSP00000359557:p.Ser61Ile	54.0	0.0	0		35.0	24.0	0.685714	NM_012317	Q6IAR6	Missense_Mutation	SNP	ENST00000370526.2	37	CCDS14672.1	.	.	.	.	.	.	.	.	.	.	.	12.62	1.991895	0.35131	.	.	ENSG00000182195	ENST00000370526	T	0.32023	1.47	3.61	1.75	0.24633	.	0.179052	0.36591	N	0.002511	T	0.22244	0.0536	L	0.46157	1.445	0.09310	N	0.999999	P	0.39665	0.682	B	0.33690	0.168	T	0.09885	-1.0654	10	0.51188	T	0.08	-8.3488	8.8927	0.35444	0.0:0.5574:0.4426:0.0	.	61	O95751	LDOC1_HUMAN	I	61	ENSP00000359557:S61I	ENSP00000359557:S61I	S	-	2	0	LDOC1	140098691	0.893000	0.30496	0.335000	0.25508	0.944000	0.59088	0.619000	0.24388	0.331000	0.23511	0.287000	0.19450	AGC	.	.	none		0.617	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058592.1	NM_012317	
COL3A1	1281	hgsc.bcm.edu	37	2	189864021	189864021	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:189864021G>A	ENST00000304636.3	+	30	2203	c.2033G>A	c.(2032-2034)gGt>gAt	p.G678D	COL3A1_ENST00000317840.5_Missense_Mutation_p.G678D	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	678	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	GGTGATGCTGGTGCCCCTGGT	0.498																																					p.G678D		Atlas-SNP	.											.	COL3A1	292	.	0			c.G2033A						PASS	.						40.0	40.0	40.0					2																	189864021		2202	4299	6501	SO:0001583	missense	1281	exon30			ATGCTGGTGCCCC	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2033G>A	2.37:g.189864021G>A	ENSP00000304408:p.Gly678Asp	54.0	0.0	0		62.0	35.0	0.564516	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	37	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.056475	0.76074	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.99619	-6.28;-6.28	4.96	4.96	0.65561	.	0.000000	0.44688	D	0.000428	D	0.99792	0.9912	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96883	0.9647	10	0.87932	D	0	.	18.6093	0.91277	0.0:0.0:1.0:0.0	.	678	P02461	CO3A1_HUMAN	D	678	ENSP00000304408:G678D;ENSP00000315243:G678D	ENSP00000304408:G678D	G	+	2	0	COL3A1	189572266	1.000000	0.71417	0.996000	0.52242	0.969000	0.65631	9.813000	0.99286	2.472000	0.83506	0.650000	0.86243	GGT	.	.	none		0.498	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
ZNF555	148254	hgsc.bcm.edu	37	19	2852470	2852470	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:2852470T>A	ENST00000334241.4	+	4	545	c.407T>A	c.(406-408)aTt>aAt	p.I136N	ZNF555_ENST00000591539.1_Missense_Mutation_p.I135N|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	136					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACAAGAAAATTCCACCTGGA	0.428																																					p.I136N		Atlas-SNP	.											.	ZNF555	61	.	0			c.T407A						PASS	.						85.0	82.0	83.0					19																	2852470		2203	4300	6503	SO:0001583	missense	148254	exon4			AGAAAATTCCACC	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.407T>A	19.37:g.2852470T>A	ENSP00000334853:p.Ile136Asn	70.0	0.0	0		74.0	30.0	0.405405	NM_152791	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	ENST00000334241.4	37	CCDS12096.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.302445	0.23736	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.06933	3.24	3.62	-0.788	0.10939	.	.	.	.	.	T	0.08447	0.0210	M	0.64260	1.97	0.09310	N	1	B;B	0.23650	0.001;0.089	B;B	0.16289	0.001;0.015	T	0.32640	-0.9899	9	0.66056	D	0.02	.	3.7148	0.08434	0.0:0.4382:0.1968:0.3651	.	136;135	Q8NEP9;A8KA89	ZN555_HUMAN;.	N	136;135	ENSP00000334853:I136N	ENSP00000334853:I136N	I	+	2	0	ZNF555	2803470	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.427000	0.06999	-0.198000	0.10333	0.459000	0.35465	ATT	.	.	none		0.428	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451637.3	NM_152791	
LRRN3	54674	hgsc.bcm.edu	37	7	110764121	110764121	+	Silent	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:110764121T>C	ENST00000422987.3	+	2	2124	c.1293T>C	c.(1291-1293)aaT>aaC	p.N431N	IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000405709.2_Intron|LRRN3_ENST00000451085.1_Silent_p.N431N|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000415362.1_Intron|LRRN3_ENST00000308478.5_Silent_p.N431N|IMMP2L_ENST00000450877.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	431	Ig-like C2-type.				positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		TTCCTTCTAATCTAAATGTAG	0.438																																					p.N431N		Atlas-SNP	.											.	LRRN3	132	.	0			c.T1293C						PASS	.						111.0	117.0	115.0					7																	110764121		2203	4300	6503	SO:0001819	synonymous_variant	54674	exon2			TTCTAATCTAAAT	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.1293T>C	7.37:g.110764121T>C		58.0	0.0	0		64.0	34.0	0.53125	NM_018334	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	CCDS5754.1																																																																																			.	.	none		0.438	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
KMT2D	8085	hgsc.bcm.edu	37	12	49421689	49421689	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:49421689C>A	ENST00000301067.7	-	47	14539	c.14540G>T	c.(14539-14541)gGc>gTc	p.G4847V		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4847					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGGGCTCTTGCCTTCCAGACC	0.547																																					p.G4847V		Atlas-SNP	.											.	MLL2	1173	.	0			c.G14540T						PASS	.						60.0	62.0	61.0					12																	49421689		1987	4141	6128	SO:0001583	missense	8085	exon47			CTCTTGCCTTCCA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.14540G>T	12.37:g.49421689C>A	ENSP00000301067:p.Gly4847Val	145.0	0.0	0		182.0	65.0	0.357143	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292727	0.23564	.	.	ENSG00000167548	ENST00000301067	T	0.79033	-1.23	5.01	2.11	0.27256	.	0.851336	0.09837	N	0.749407	T	0.66336	0.2779	L	0.38175	1.15	0.47621	D	0.999471	B	0.06786	0.001	B	0.06405	0.002	T	0.59300	-0.7480	10	0.87932	D	0	.	4.6868	0.12762	0.2706:0.5222:0.1314:0.0759	.	4847	O14686	MLL2_HUMAN	V	4847	ENSP00000301067:G4847V	ENSP00000301067:G4847V	G	-	2	0	MLL2	47707956	0.996000	0.38824	0.978000	0.43139	0.990000	0.78478	0.607000	0.24209	0.226000	0.20979	0.655000	0.94253	GGC	.	.	none		0.547	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
C11orf88	399949	hgsc.bcm.edu	37	11	111385703	111385703	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:111385703C>T	ENST00000375618.4	+	1	194	c.194C>T	c.(193-195)cCg>cTg	p.P65L	C11orf88_ENST00000332814.6_Missense_Mutation_p.P65L|MIR34B_ENST00000385076.1_RNA|BTG4_ENST00000356018.2_5'Flank|C11orf88_ENST00000529167.1_Missense_Mutation_p.P65L|MIR34C_ENST00000384831.1_RNA|RP11-794P6.6_ENST00000530283.1_RNA|BTG4_ENST00000525791.1_5'Flank	NM_001100388.1	NP_001093858.1	Q6PI97	CK088_HUMAN	chromosome 11 open reading frame 88	65										endometrium(1)|large_intestine(3)|lung(2)	6						CAGCGTCTGCCGGTGGCGCGG	0.597											OREG0021329	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P65L		Atlas-SNP	.											.	C11orf88	37	.	0			c.C194T						PASS	.						40.0	47.0	44.0					11																	111385703		2153	4278	6431	SO:0001583	missense	399949	exon1			GTCTGCCGGTGGC	BC039505, AK128145	CCDS41712.1, CCDS41713.1	11q23.1	2012-08-10			ENSG00000183644	ENSG00000183644			25061	protein-coding gene	gene with protein product	"""hypothetical gene supported by BC039505"""					12477932	Standard	NM_001100388		Approved	FLJ46266	uc009yyd.3	Q6PI97	OTTHUMG00000166720	ENST00000375618.4:c.194C>T	11.37:g.111385703C>T	ENSP00000364768:p.Pro65Leu	50.0	0.0	0	1434	59.0	28.0	0.474576	NM_001100388	E9PAN0|Q6ZRL3	Missense_Mutation	SNP	ENST00000375618.4	37	CCDS41713.1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342184	0.41498	.	.	ENSG00000183644	ENST00000375618;ENST00000529167;ENST00000332814	.	.	.	5.09	0.987	0.19790	.	0.159222	0.40144	N	0.001171	T	0.72598	0.3480	M	0.66939	2.045	0.44677	D	0.997668	D;D	0.76494	0.999;0.996	P;P	0.60886	0.88;0.866	T	0.74850	-0.3524	9	0.62326	D	0.03	-1.5825	14.7899	0.69833	0.0:0.4087:0.5913:0.0	.	65;65	E9PAN0;Q6PI97	.;CK088_HUMAN	L	65	.	ENSP00000333845:P65L	P	+	2	0	C11orf88	110890913	0.097000	0.21791	0.804000	0.32291	0.030000	0.12068	0.229000	0.17833	0.033000	0.15463	-0.282000	0.10007	CCG	.	.	none		0.597	C11orf88-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391181.1	NM_001100388	
OR4D1	26689	hgsc.bcm.edu	37	17	56232687	56232687	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:56232687C>A	ENST00000268912.5	+	1	194	c.173C>A	c.(172-174)cCc>cAc	p.P58H		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	58					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						CTCCACACACCCATGTATTTT	0.473																																					p.P58H		Atlas-SNP	.											.	OR4D1	48	.	0			c.C173A						PASS	.						175.0	172.0	173.0					17																	56232687		2114	4269	6383	SO:0001583	missense	26689	exon1			ACACACCCATGTA	X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.173C>A	17.37:g.56232687C>A	ENSP00000365451:p.Pro58His	103.0	0.0	0		131.0	64.0	0.48855	NM_012374	B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	ENST00000268912.5	37	CCDS42365.1	.	.	.	.	.	.	.	.	.	.	c	23.1	4.369670	0.82573	.	.	ENSG00000141194	ENST00000268912	T	0.02050	4.48	5.63	5.63	0.86233	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40908	U	0.000991	T	0.22742	0.0549	H	0.97131	3.945	0.58432	D	0.99999	D	0.76494	0.999	D	0.72338	0.977	T	0.25433	-1.0132	10	0.87932	D	0	-29.8376	17.1781	0.86846	0.0:1.0:0.0:0.0	.	58	Q15615	OR4D1_HUMAN	H	58	ENSP00000365451:P58H	ENSP00000365451:P58H	P	+	2	0	OR4D1	53587686	1.000000	0.71417	0.986000	0.45419	0.980000	0.70556	5.971000	0.70440	2.652000	0.90054	0.543000	0.68304	CCC	.	.	none		0.473	OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443364.1		
PRR30	339779	hgsc.bcm.edu	37	2	27360666	27360666	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:27360666A>G	ENST00000335524.3	-	3	1057	c.532T>C	c.(532-534)Tgg>Cgg	p.W178R		NM_178553.3	NP_848648.2	Q53SZ7	PRR30_HUMAN		178										cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TACTGATGCCAGCGCCATGTC	0.627																																					p.W178R		Atlas-SNP	.											.	C2orf53	45	.	0			c.T532C						PASS	.						53.0	55.0	54.0					2																	27360666		2203	4300	6503	SO:0001583	missense	339779	exon3			GATGCCAGCGCCA																												ENST00000335524.3:c.532T>C	2.37:g.27360666A>G	ENSP00000335017:p.Trp178Arg	72.0	0.0	0		96.0	7.0	0.0729167	NM_178553	Q86UE2	Missense_Mutation	SNP	ENST00000335524.3	37	CCDS1739.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.32|12.32	1.901753|1.901753	0.33535|0.33535	.|.	.|.	ENSG00000186143|ENSG00000186143	ENST00000432962|ENST00000335524	.|T	.|0.34072	.|1.38	4.56|4.56	0.778|0.778	0.18543|0.18543	.|.	.|0.231694	.|0.22575	.|N	.|0.058287	T|T	0.20700|0.20700	0.0498|0.0498	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	.|B	.|0.24368	.|0.102	.|B	.|0.23852	.|0.049	T|T	0.13548|0.13548	-1.0505|-1.0505	6|10	0.87932|0.59425	D|D	0|0.04	-2.4502|-2.4502	2.6344|2.6344	0.04954|0.04954	0.5896:0.0:0.2152:0.1952|0.5896:0.0:0.2152:0.1952	.|.	.|178	.|Q53SZ7	.|CB053_HUMAN	P|R	13|178	.|ENSP00000335017:W178R	ENSP00000393468:L13P|ENSP00000335017:W178R	L|W	-|-	2|1	0|0	C2orf53|C2orf53	27214170|27214170	0.075000|0.075000	0.21258|0.21258	0.008000|0.008000	0.14137|0.14137	0.183000|0.183000	0.23260|0.23260	1.140000|1.140000	0.31516|0.31516	0.773000|0.773000	0.33404|0.33404	0.459000|0.459000	0.35465|0.35465	CTG|TGG	.	.	none		0.627	C2orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250188.1		
MT-CYB	4519	hgsc.bcm.edu	37	M	15622	15622	+	Silent	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrM:15622T>C	ENST00000361789.2	+	1	876	c.876T>C	c.(874-876)ctT>ctC	p.L292L	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-ND6_ENST00000361681.2_5'Flank			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	292					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GGAGGCGTCCTTGCCCTATTA	0.453											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L292L		Atlas-SNP	.											.	.	.	.	0			c.T876C						PASS	.																																			SO:0001819	synonymous_variant	0	exon1			CGTCCTTGCCCTA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.876T>C	M.37:g.15622T>C		8.0	0.0	0	585	8.0	8.0	1	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	37																																																																																				.	.	none		0.453	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
RGL3	57139	hgsc.bcm.edu	37	19	11529920	11529920	+	Splice_Site	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:11529920A>G	ENST00000380456.3	-	1	97		c.e1+1		RGL3_ENST00000393423.3_Splice_Site	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3						small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						TTGTCCCCTTACCAGGGCCAG	0.697																																					.	GBM(174;751 2067 17998 27979 33959)	Atlas-SNP	.											.	RGL3	100	.	0			c.33+2T>C						PASS	.						60.0	74.0	69.0					19																	11529920		2203	4300	6503	SO:0001630	splice_region_variant	57139	exon2			CCCCTTACCAGGG	BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.33+1T>C	19.37:g.11529920A>G		76.0	0.0	0		98.0	5.0	0.0510204	NM_001161616	B5ME84|B7ZL22|Q0P6G0	Splice_Site	SNP	ENST00000380456.3	37	CCDS32910.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.961190	0.53400	.	.	ENSG00000205517	ENST00000393423;ENST00000380456;ENST00000453604	.	.	.	4.22	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2496	0.26142	0.7737:0.2263:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RGL3	11390920	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	1.747000	0.38298	1.694000	0.51137	0.254000	0.18369	.	.	.	none		0.697	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421208.3	XM_290867	Intron
EPHB2	2048	hgsc.bcm.edu	37	1	23236932	23236932	+	Missense_Mutation	SNP	G	G	A	rs549199396		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:23236932G>A	ENST00000400191.3	+	14	2578	c.2560G>A	c.(2560-2562)Gcc>Acc	p.A854T	EPHB2_ENST00000374632.3_Missense_Mutation_p.A855T|EPHB2_ENST00000374630.3_Missense_Mutation_p.A854T|EPHB2_ENST00000374627.1_Missense_Mutation_p.A849T	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	854	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)	p.A854T(1)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		CTGCCCGAGCGCCCTGCACCA	0.587																																					p.A855T		Atlas-SNP	.											EPHB2,colon,carcinoma,0,1	EPHB2	257	1	1	Substitution - Missense(1)	large_intestine(1)	c.G2563A						PASS	.						122.0	89.0	100.0					1																	23236932		2203	4300	6503	SO:0001583	missense	2048	exon14			CCGAGCGCCCTGC	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.2560G>A	1.37:g.23236932G>A	ENSP00000383053:p.Ala854Thr	138.0	0.0	0		78.0	59.0	0.75641	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Missense_Mutation	SNP	ENST00000400191.3	37		.	.	.	.	.	.	.	.	.	.	G	20.9	4.070225	0.76301	.	.	ENSG00000133216	ENST00000374625;ENST00000374630;ENST00000400191;ENST00000374632;ENST00000374627	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	4.64	4.64	0.57946	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	L	0.28556	0.865	0.80722	D	1	B;B;B;B	0.32203	0.043;0.36;0.066;0.017	B;B;B;B	0.23150	0.006;0.044;0.018;0.019	T	0.76506	-0.2934	10	0.66056	D	0.02	.	16.6405	0.85070	0.0:0.0:1.0:0.0	.	796;854;872;855	A6NJM0;P29323;Q4LE53;P29323-3	.;EPHB2_HUMAN;.;.	T	796;854;854;855;849	ENSP00000363761:A854T;ENSP00000383053:A854T;ENSP00000363763:A855T;ENSP00000363758:A849T	ENSP00000363755:A796T	A	+	1	0	EPHB2	23109519	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	7.803000	0.85983	2.586000	0.87340	0.555000	0.69702	GCC	.	.	none		0.587	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
MPDZ	8777	hgsc.bcm.edu	37	9	13150599	13150599	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr9:13150599C>T	ENST00000319217.7	-	25	3788	c.3541G>A	c.(3541-3543)Gtg>Atg	p.V1181M	MPDZ_ENST00000447879.1_Missense_Mutation_p.V1181M|MPDZ_ENST00000546205.1_Missense_Mutation_p.V1195M|MPDZ_ENST00000381022.2_Missense_Mutation_p.V1181M|MPDZ_ENST00000541718.1_Missense_Mutation_p.V1181M|MPDZ_ENST00000538841.1_Missense_Mutation_p.V73M|MPDZ_ENST00000536827.1_Missense_Mutation_p.V1181M|MPDZ_ENST00000381015.4_Missense_Mutation_p.V1181M	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1181	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CCCCTCATCACTTCTCCATTG	0.458																																					p.V1181M		Atlas-SNP	.											.	MPDZ	324	.	0			c.G3541A						PASS	.						140.0	138.0	138.0					9																	13150599		1911	4137	6048	SO:0001583	missense	8777	exon25			TCATCACTTCTCC	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3541G>A	9.37:g.13150599C>T	ENSP00000320006:p.Val1181Met	91.0	0.0	0		109.0	42.0	0.385321	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	37		.	.	.	.	.	.	.	.	.	.	C	15.87	2.960646	0.53400	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359;ENST00000542239	T;T;T;T;T;T;T;T;T;T;T	0.47177	2.78;2.73;2.73;2.61;2.76;2.74;2.79;2.78;2.79;0.85;0.9	5.95	5.95	0.96441	.	0.000000	0.38272	N	0.001757	T	0.64450	0.2599	L	0.45352	1.415	0.80722	D	1	D;B;D;D;D	0.89917	0.992;0.057;0.99;1.0;0.99	D;B;P;D;P	0.91635	0.94;0.069;0.901;0.999;0.901	T	0.60596	-0.7232	10	0.48119	T	0.1	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	1181;73;1181;1131;1181	B7ZMI4;B7ZB24;O75970-3;E7EPZ1;O75970-2	.;.;.;.;.	M	1181;1181;1181;187;73;1181;1181;1181;1131;1195;73;73	ENSP00000320006:V1181M;ENSP00000439807:V1181M;ENSP00000370410:V1181M;ENSP00000444230:V187M;ENSP00000444717:V73M;ENSP00000444151:V1181M;ENSP00000415208:V1181M;ENSP00000370403:V1181M;ENSP00000446358:V1195M;ENSP00000389705:V73M;ENSP00000443672:V73M	ENSP00000320006:V1181M	V	-	1	0	MPDZ	13140599	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	2.324000	0.43831	2.825000	0.97269	0.655000	0.94253	GTG	.	.	none		0.458	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
SETD1B	23067	hgsc.bcm.edu	37	12	122248314	122248314	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:122248314C>T	ENST00000604567.1	+	6	1531	c.1463C>T	c.(1462-1464)tCc>tTc	p.S488F	SETD1B_ENST00000542440.1_Missense_Mutation_p.S488F|SETD1B_ENST00000267197.5_Missense_Mutation_p.S488F			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	488	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						CTGGAGTCGTCCCCTGCAGGG	0.687																																					p.S488F		Atlas-SNP	.											.	SETD1B	105	.	0			c.C1463T						PASS	.						22.0	27.0	25.0					12																	122248314		692	1591	2283	SO:0001583	missense	23067	exon5			AGTCGTCCCCTGC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1463C>T	12.37:g.122248314C>T	ENSP00000474253:p.Ser488Phe	57.0	0.0	0		81.0	35.0	0.432099	NM_015048	F6MFW1	Missense_Mutation	SNP	ENST00000604567.1	37		.	.	.	.	.	.	.	.	.	.	C	12.24	1.880098	0.33162	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.94758	-3.51;-3.51	4.97	4.97	0.65823	.	.	.	.	.	D	0.94781	0.8315	L	0.50333	1.59	0.09310	N	1	D	0.61697	0.99	P	0.54664	0.758	D	0.89400	0.3695	9	0.49607	T	0.09	.	13.7217	0.62732	0.0:1.0:0.0:0.0	.	488	Q9UPS6	SET1B_HUMAN	F	488	ENSP00000442924:S488F;ENSP00000267197:S488F	ENSP00000267197:S488F	S	+	2	0	SETD1B	120732697	0.439000	0.25610	0.039000	0.18376	0.790000	0.44656	3.940000	0.56599	2.304000	0.77564	0.462000	0.41574	TCC	.	.	none		0.687	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
EPHA7	2045	hgsc.bcm.edu	37	6	94120454	94120454	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:94120454T>G	ENST00000369303.4	-	3	781	c.597A>C	c.(595-597)aaA>aaC	p.K199N	EPHA7_ENST00000369297.1_Missense_Mutation_p.K199N	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	199	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGTAGTACACTTTGACAGAAA	0.428																																					p.K199N		Atlas-SNP	.											.	EPHA7	251	.	0			c.A597C						PASS	.						81.0	85.0	84.0					6																	94120454		2203	4300	6503	SO:0001583	missense	2045	exon3			GTACACTTTGACA	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.597A>C	6.37:g.94120454T>G	ENSP00000358309:p.Lys199Asn	143.0	0.0	0		178.0	78.0	0.438202	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	37	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.458621	0.63401	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.04317	3.65;3.65	5.66	3.26	0.37387	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.06005	0.0156	L	0.61036	1.89	0.52099	D	0.999943	P;D;D;D	0.63880	0.728;0.993;0.96;0.967	B;P;P;P	0.53224	0.277;0.596;0.6;0.721	T	0.10474	-1.0628	10	0.87932	D	0	.	10.4747	0.44657	0.0:0.1379:0.0:0.8621	.	199;199;199;199	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	N	199	ENSP00000358309:K199N;ENSP00000358303:K199N	ENSP00000358303:K199N	K	-	3	2	EPHA7	94177175	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.685000	0.37659	1.090000	0.41315	0.533000	0.62120	AAA	.	.	none		0.428	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
CSMD3	114788	hgsc.bcm.edu	37	8	114111175	114111175	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr8:114111175C>A	ENST00000297405.5	-	5	971	c.727G>T	c.(727-729)Gga>Tga	p.G243*	CSMD3_ENST00000343508.3_Nonsense_Mutation_p.G203*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.G243*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.G243*|CSMD3_ENST00000519485.1_5'UTR	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	243	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CTCATTGTTCCTCCACAAGCA	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G243X		Atlas-SNP	.											CSMD3_ENST00000343508,NS,carcinoma,+1,2	CSMD3	2325	2	0			c.G727T						PASS	.						110.0	96.0	101.0					8																	114111175		2203	4299	6502	SO:0001587	stop_gained	114788	exon5			TTGTTCCTCCACA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.727G>T	8.37:g.114111175C>A	ENSP00000297405:p.Gly243*	57.0	0.0	0		80.0	40.0	0.5	NM_052900	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	37	6.448676	0.97577	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	.	.	.	5.1	5.1	0.69264	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	18.8655	0.92290	0.0:1.0:0.0:0.0	.	.	.	.	X	203;243;243;243	.	ENSP00000297405:G243X	G	-	1	0	CSMD3	114180351	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.771000	0.85420	2.542000	0.85734	0.591000	0.81541	GGA	.	.	none		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
ESYT3	83850	hgsc.bcm.edu	37	3	138181019	138181019	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr3:138181019C>G	ENST00000389567.4	+	8	1072	c.886C>G	c.(886-888)Ctg>Gtg	p.L296V	ESYT3_ENST00000289135.4_Missense_Mutation_p.L296V	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	296	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						GGGGCTGGATCTGACCAACCT	0.577																																					p.L296V		Atlas-SNP	.											.	ESYT3	64	.	0			c.C886G						PASS	.						186.0	137.0	154.0					3																	138181019		2203	4300	6503	SO:0001583	missense	83850	exon8			CTGGATCTGACCA	AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.886C>G	3.37:g.138181019C>G	ENSP00000374218:p.Leu296Val	130.0	0.0	0		254.0	148.0	0.582677	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	ENST00000389567.4	37	CCDS3101.2	.	.	.	.	.	.	.	.	.	.	C	0.363	-0.938291	0.02340	.	.	ENSG00000158220	ENST00000389567;ENST00000289135	T;T	0.35236	1.32;1.61	4.65	1.56	0.23342	.	0.297369	0.32459	N	0.006061	T	0.08846	0.0219	N	0.01624	-0.795	0.20821	N	0.999845	B	0.02656	0.0	B	0.01281	0.0	T	0.33929	-0.9849	10	0.02654	T	1	-8.7761	3.55	0.07843	0.3091:0.2142:0.4766:0.0	.	296	A0FGR9	ESYT3_HUMAN	V	296	ENSP00000374218:L296V;ENSP00000289135:L296V	ENSP00000289135:L296V	L	+	1	2	ESYT3	139663709	0.000000	0.05858	0.970000	0.41538	0.979000	0.70002	-0.565000	0.05929	0.556000	0.29098	-0.321000	0.08615	CTG	.	.	none		0.577	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
ITGB3	3690	hgsc.bcm.edu	37	17	45331302	45331302	+	Silent	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:45331302A>G	ENST00000559488.1	+	1	91	c.75A>G	c.(73-75)gtA>gtG	p.V25V	ITGB3_ENST00000435993.2_5'UTR|ITGB3_ENST00000571680.1_Silent_p.V25V|ITGB3_ENST00000560629.1_Missense_Mutation_p.R14G	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	25					activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	GCGTTGGCGTAGGAGGTGAGT	0.756																																					p.V25V		Atlas-SNP	.											.	ITGB3	157	.	0			c.A75G						PASS	.						3.0	4.0	4.0					17																	45331302		1794	3699	5493	SO:0001819	synonymous_variant	3690	exon1			TGGCGTAGGAGGT		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.75A>G	17.37:g.45331302A>G		4.0	0.0	0		7.0	5.0	0.714286	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Silent	SNP	ENST00000559488.1	37	CCDS11511.1																																																																																			.	.	none		0.756	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
ZCCHC8	55596	hgsc.bcm.edu	37	12	122975093	122975093	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:122975093C>T	ENST00000336229.4	-	4	469	c.339G>A	c.(337-339)gaG>gaA	p.E113E	SNORA9_ENST00000516383.1_RNA|ZCCHC8_ENST00000543897.1_5'UTR|ZCCHC8_ENST00000536306.1_5'UTR	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	113					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		ATACAAATTCCTCTATTTCTT	0.333																																					p.E113E		Atlas-SNP	.											.	ZCCHC8	56	.	0			c.G339A						PASS	.						52.0	50.0	50.0					12																	122975093		1810	4068	5878	SO:0001819	synonymous_variant	55596	exon4			AAATTCCTCTATT	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.339G>A	12.37:g.122975093C>T		37.0	0.0	0		78.0	4.0	0.0512821	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Silent	SNP	ENST00000336229.4	37																																																																																				.	.	none		0.333	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
HIST1H4F	8361	hgsc.bcm.edu	37	6	26240696	26240696	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:26240696G>A	ENST00000377745.2	+	1	136	c.43G>A	c.(43-45)Ggc>Agc	p.G15S		NM_003540.3	NP_003531.1	P62805	H4_HUMAN	histone cluster 1, H4f	15					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AGGAAAGGGAGGCGCCAAGCG	0.537																																					p.G15S		Atlas-SNP	.											.	HIST1H4F	9	.	0			c.G43A						PASS	.						46.0	47.0	46.0					6																	26240696		2203	4300	6503	SO:0001583	missense	8361	exon1			AAGGGAGGCGCCA	M60749	CCDS4598.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198327			"""Histones / Replication-dependent"""	4783	protein-coding gene	gene with protein product		602824	"""H4 histone family, member C"", ""histone 1, H4f"""	H4FC		1916825, 9119399, 12408966	Standard	NM_003540		Approved	H4/c, H4	uc003nhe.1	P62805	OTTHUMG00000014443	ENST00000377745.2:c.43G>A	6.37:g.26240696G>A	ENSP00000366974:p.Gly15Ser	66.0	0.0	0		80.0	37.0	0.4625	NM_003540	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377745.2	37	CCDS4598.1	.	.	.	.	.	.	.	.	.	.	.	15.20	2.761893	0.49468	.	.	ENSG00000198327	ENST00000377745	.	.	.	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.69637	0.3133	.	.	.	0.45899	D	0.998749	.	.	.	.	.	.	T	0.72861	-0.4164	6	0.59425	D	0.04	.	16.6943	0.85330	0.0:0.0:1.0:0.0	.	.	.	.	S	15	.	ENSP00000366974:G15S	G	+	1	0	HIST1H4F	26348675	1.000000	0.71417	0.813000	0.32504	0.016000	0.09150	9.222000	0.95196	2.503000	0.84419	0.655000	0.94253	GGC	.	.	none		0.537	HIST1H4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040106.1	NM_003540	
SPINK5	11005	hgsc.bcm.edu	37	5	147470759	147470759	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr5:147470759G>A	ENST00000256084.7	+	8	676	c.634G>A	c.(634-636)Ggt>Agt	p.G212S	SPINK5_ENST00000476608.1_3'UTR|SPINK5_ENST00000359874.3_Missense_Mutation_p.G212S|SPINK5_ENST00000398454.1_Missense_Mutation_p.G212S	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	212	Kazal-like 3. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGCGAGAGGGTGAAACTAG	0.363																																					p.G212S		Atlas-SNP	.											.	SPINK5	245	.	0			c.G634A						PASS	.						90.0	86.0	87.0					5																	147470759		1866	4104	5970	SO:0001583	missense	11005	exon8			CGAGAGGGTGAAA	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.634G>A	5.37:g.147470759G>A	ENSP00000256084:p.Gly212Ser	27.0	0.0	0		26.0	10.0	0.384615	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	G	9.653	1.142058	0.21205	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.39406	1.08;1.11;1.17;1.12	4.3	-0.561	0.11785	Proteinase inhibitor I1, Kazal (1);	1.472930	0.04149	N	0.321015	T	0.18841	0.0452	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.22146	0.044;0.014;0.02;0.065	B;B;B;B	0.21360	0.034;0.013;0.034;0.02	T	0.16778	-1.0391	10	0.23302	T	0.38	-0.4099	7.2188	0.25975	0.5383:0.0:0.4617:0.0	.	193;212;212;212	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	S	212;212;193;212	ENSP00000381472:G212S;ENSP00000352936:G212S;ENSP00000421519:G193S;ENSP00000256084:G212S	ENSP00000256084:G212S	G	+	1	0	SPINK5	147450952	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.154000	0.16343	-0.127000	0.11661	0.650000	0.86243	GGT	.	.	none		0.363	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
MMP15	4324	hgsc.bcm.edu	37	16	58073912	58073912	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr16:58073912C>T	ENST00000219271.3	+	4	1359	c.574C>T	c.(574-576)Cag>Tag	p.Q192*		NM_002428.2	NP_002419.1	P51511	MMP15_HUMAN	matrix metallopeptidase 15 (membrane-inserted)	192					cellular protein modification process (GO:0006464)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)|response to estradiol (GO:0032355)	extracellular matrix (GO:0031012)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	18					Marimastat(DB00786)	GCTGCGGCGACAGAAGGAGGC	0.652																																					p.Q192X		Atlas-SNP	.											MMP15,NS,malignant_melanoma,0,1	MMP15	58	1	0			c.C574T						PASS	.						69.0	62.0	64.0					16																	58073912		2198	4300	6498	SO:0001587	stop_gained	4324	exon4			CGGCGACAGAAGG	Z48482	CCDS10792.1	16q13	2008-05-14	2005-08-08		ENSG00000102996	ENSG00000102996			7161	protein-coding gene	gene with protein product		602261	"""matrix metalloproteinase 15 (membrane-inserted)"""			9070935, 9119382	Standard	NM_002428		Approved	MT2-MMP, MTMMP2, SMCP-2	uc002ena.3	P51511	OTTHUMG00000133466	ENST00000219271.3:c.574C>T	16.37:g.58073912C>T	ENSP00000219271:p.Gln192*	84.0	0.0	0		48.0	6.0	0.125	NM_002428	A0A2U6|Q14111	Nonsense_Mutation	SNP	ENST00000219271.3	37	CCDS10792.1	.	.	.	.	.	.	.	.	.	.	C	44	11.154668	0.99523	.	.	ENSG00000102996	ENST00000219271	.	.	.	4.68	4.68	0.58851	.	0.189298	0.47455	D	0.000222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	6.2159	0.20656	0.1999:0.7043:0.0:0.0958	.	.	.	.	X	192	.	ENSP00000219271:Q192X	Q	+	1	0	MMP15	56631413	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.584000	0.36589	2.157000	0.67596	0.455000	0.32223	CAG	.	.	none		0.652	MMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257342.1	NM_002428	
S100A6	6277	hgsc.bcm.edu	37	1	153507187	153507187	+	Silent	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:153507187T>C	ENST00000368720.2	-	4	560	c.258A>G	c.(256-258)gaA>gaG	p.E86E	S100A6_ENST00000496817.1_Silent_p.E86E|S100A6_ENST00000368719.4_Silent_p.E86E|BX470102.3_ENST00000420695.1_RNA			P06703	S10A6_HUMAN	S100 calcium binding protein A6	86					axonogenesis (GO:0007409)|positive regulation of fibroblast proliferation (GO:0048146)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|ion transmembrane transporter activity (GO:0015075)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)|tropomyosin binding (GO:0005523)|zinc ion binding (GO:0008270)			ovary(1)	1	all_lung(78;1.66e-32)|Lung NSC(65;5.71e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCTTGAGGGCTTCATTGTAGA	0.478																																					p.E86E		Atlas-SNP	.											.	S100A6	8	.	0			c.A258G						PASS	.						69.0	69.0	69.0					1																	153507187		2203	4300	6503	SO:0001819	synonymous_variant	6277	exon3			GAGGGCTTCATTG	BC001431	CCDS1040.1	1q21	2013-01-10	2006-09-11		ENSG00000197956	ENSG00000197956		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10496	protein-coding gene	gene with protein product		114110	"""S100 calcium-binding protein A6 (calcyclin)"", ""S100 calcium binding protein A6 (calcyclin)"""	CACY			Standard	NM_014624		Approved	2A9, PRA, CABP	uc001fbw.1	P06703	OTTHUMG00000013549	ENST00000368720.2:c.258A>G	1.37:g.153507187T>C		89.0	0.0	0		93.0	4.0	0.0430108	NM_014624	D3DV39|Q5RHS4	Silent	SNP	ENST00000368720.2	37	CCDS1040.1																																																																																			.	.	none		0.478	S100A6-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037723.2	NM_014624	
ARFGAP1	55738	hgsc.bcm.edu	37	20	61907883	61907883	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr20:61907883G>A	ENST00000370283.4	+	4	362	c.222G>A	c.(220-222)aaG>aaA	p.K74K	ARFGAP1_ENST00000353546.3_Silent_p.K74K|ARFGAP1_ENST00000370275.4_Silent_p.K74K|ARFGAP1_ENST00000519273.2_De_novo_Start_OutOfFrame|ARFGAP1_ENST00000547204.1_De_novo_Start_InFrame|ARFGAP1_ENST00000519604.1_Silent_p.K21K	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	74	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGCTTGAGAAGATGAAAGCTG	0.527																																					p.K74K		Atlas-SNP	.											.	ARFGAP1	38	.	0			c.G222A						PASS	.						135.0	111.0	119.0					20																	61907883		2203	4300	6503	SO:0001819	synonymous_variant	55738	exon4			TGAGAAGATGAAA	AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.222G>A	20.37:g.61907883G>A		207.0	0.0	0		256.0	105.0	0.410156	NM_018209	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Silent	SNP	ENST00000370283.4	37	CCDS13515.1																																																																																			.	.	none		0.527	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209	
IL37	27178	hgsc.bcm.edu	37	2	113674819	113674819	+	Missense_Mutation	SNP	C	C	T	rs370690543		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:113674819C>T	ENST00000263326.3	+	3	301	c.259C>T	c.(259-261)Cgc>Tgc	p.R87C	IL37_ENST00000311328.2_Missense_Mutation_p.R61C|IL37_ENST00000353225.3_Intron|IL37_ENST00000352179.3_Missense_Mutation_p.R66C|IL37_ENST00000349806.3_Intron	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	87					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)			NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						AAACTACATACGCCCAGGTGA	0.493																																					p.R87C		Atlas-SNP	.											.	IL37	56	.	0			c.C259T						PASS	.		CYS/ARG,CYS/ARG,,,CYS/ARG	0,4406		0,0,2203	139.0	134.0	136.0		259,196,,,181	-0.0	0.0	2		136	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron,intron,missense	IL37	NM_014439.3,NM_173202.1,NM_173203.1,NM_173204.1,NM_173205.1	180,180,,,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,,,possibly-damaging	87/219,66/198,,,61/193	113674819	1,13005	2203	4300	6503	SO:0001583	missense	27178	exon3			TACATACGCCCAG	AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.259C>T	2.37:g.113674819C>T	ENSP00000263326:p.Arg87Cys	121.0	0.0	0		127.0	42.0	0.330709	NM_014439	B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Missense_Mutation	SNP	ENST00000263326.3	37	CCDS2103.1	.	.	.	.	.	.	.	.	.	.	c	5.381	0.255487	0.10185	0.0	1.16E-4	ENSG00000125571	ENST00000263326;ENST00000352179;ENST00000311328	T;T;T	0.58358	0.34;0.34;0.34	2.85	-0.033	0.13902	.	3.274280	0.01053	N	0.004506	T	0.32675	0.0837	N	0.11064	0.09	0.09310	N	1	B;B;B	0.13145	0.007;0.003;0.007	B;B;B	0.06405	0.002;0.001;0.001	T	0.24048	-1.0171	10	0.56958	D	0.05	0.8511	2.8893	0.05671	0.2145:0.5315:0.0:0.254	.	61;66;87	Q9NZH6-2;Q9NZH6-4;Q9NZH6	.;.;IL37_HUMAN	C	87;66;61	ENSP00000263326:R87C;ENSP00000263327:R66C;ENSP00000309883:R61C	ENSP00000263326:R87C	R	+	1	0	IL37	113391290	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.073000	0.00300	-0.016000	0.14127	-0.763000	0.03452	CGC	.	.	weak		0.493	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254126.1	NM_014439	
TAOK1	57551	hgsc.bcm.edu	37	17	27829683	27829683	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:27829683G>A	ENST00000261716.3	+	13	1799	c.1280G>A	c.(1279-1281)cGt>cAt	p.R427H	TAOK1_ENST00000536202.1_Missense_Mutation_p.R427H	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	427					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			CAAGTATCTCGTCACAAATCA	0.373																																					p.R427H		Atlas-SNP	.											.	TAOK1	151	.	0			c.G1280A						PASS	.						173.0	141.0	152.0					17																	27829683		2203	4300	6503	SO:0001583	missense	57551	exon13			TATCTCGTCACAA	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1280G>A	17.37:g.27829683G>A	ENSP00000261716:p.Arg427His	111.0	0.0	0		146.0	65.0	0.445205	NM_025142	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	37	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	G	35	5.539205	0.96474	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.43294	0.95;0.95	6.03	6.03	0.97812	Protein kinase-like domain (1);	0.050877	0.85682	D	0.000000	T	0.46889	0.1416	L	0.34521	1.04	0.80722	D	1	D;P;B	0.67145	0.996;0.853;0.004	P;P;B	0.50708	0.648;0.616;0.006	T	0.30851	-0.9964	10	0.48119	T	0.1	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	427;253;427	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	H	427	ENSP00000261716:R427H;ENSP00000438819:R427H	ENSP00000261716:R427H	R	+	2	0	TAOK1	24853809	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.701000	0.74624	2.854000	0.98071	0.655000	0.94253	CGT	.	.	none		0.373	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
MPP7	143098	hgsc.bcm.edu	37	10	28527517	28527517	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr10:28527517G>A	ENST00000375732.1	-	2	276	c.17C>T	c.(16-18)aCg>aTg	p.T6M	MPP7_ENST00000375719.3_Missense_Mutation_p.T6M|MPP7_ENST00000445954.2_De_novo_Start_OutOfFrame|MPP7_ENST00000481244.1_5'UTR|MPP7_ENST00000540098.1_Missense_Mutation_p.T6M|MPP7_ENST00000337532.5_Missense_Mutation_p.T6M			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	6					establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						CCCAGATCCCGTTGACAAAGC	0.512																																					p.T6M		Atlas-SNP	.											MPP7,rectum,carcinoma,+1,2	MPP7	60	2	0			c.C17T						PASS	.						147.0	117.0	128.0					10																	28527517		2203	4300	6503	SO:0001583	missense	143098	exon4			GATCCCGTTGACA	BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.17C>T	10.37:g.28527517G>A	ENSP00000364884:p.Thr6Met	49.0	0.0	0		53.0	24.0	0.45283	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	ENST00000375732.1	37	CCDS7158.1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.632038	0.46944	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000441595	T;T;T;T;T	0.33216	2.7;2.7;2.7;2.7;1.42	6.07	5.16	0.70880	.	0.115089	0.64402	N	0.000016	T	0.32496	0.0831	L	0.36672	1.1	0.80722	D	1	P	0.39535	0.677	P	0.44732	0.459	T	0.08889	-1.0700	10	0.56958	D	0.05	.	13.615	0.62103	0.0713:0.0:0.9287:0.0	.	6	Q5T2T1	MPP7_HUMAN	M	6	ENSP00000364884:T6M;ENSP00000337907:T6M;ENSP00000438693:T6M;ENSP00000364871:T6M;ENSP00000398319:T6M	ENSP00000337907:T6M	T	-	2	0	MPP7	28567523	0.998000	0.40836	0.049000	0.19019	0.259000	0.26198	6.263000	0.72521	1.571000	0.49722	0.655000	0.94253	ACG	.	.	none		0.512	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
TREML2	79865	hgsc.bcm.edu	37	6	41166123	41166123	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:41166123C>T	ENST00000483722.1	-	2	285	c.100G>A	c.(100-102)Ggg>Agg	p.G34R		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	34	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGAGTCTCCCCTTCAAGGAGC	0.493																																					p.G34R		Atlas-SNP	.											.	TREML2	41	.	0			c.G100A						PASS	.						127.0	130.0	129.0					6																	41166123		2203	4300	6503	SO:0001583	missense	79865	exon2			TCTCCCCTTCAAG	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.100G>A	6.37:g.41166123C>T	ENSP00000418767:p.Gly34Arg	70.0	0.0	0		100.0	6.0	0.06	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	14.59	2.581804	0.46006	.	.	ENSG00000112195	ENST00000483722	D	0.81499	-1.5	4.75	4.75	0.60458	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000044	D	0.86623	0.5977	M	0.75085	2.285	0.40423	D	0.979861	D	0.89917	1.0	D	0.97110	1.0	D	0.88269	0.2928	10	0.72032	D	0.01	-23.1011	13.6225	0.62144	0.0:1.0:0.0:0.0	.	34	Q5T2D2	TRML2_HUMAN	R	34	ENSP00000418767:G34R	ENSP00000418767:G34R	G	-	1	0	TREML2	41274101	1.000000	0.71417	0.998000	0.56505	0.028000	0.11728	3.388000	0.52509	2.344000	0.79699	0.563000	0.77884	GGG	.	.	none		0.493	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
T	6862	hgsc.bcm.edu	37	6	166578142	166578142	+	Silent	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:166578142T>C	ENST00000296946.2	-	6	1149	c.681A>G	c.(679-681)aaA>aaG	p.K227K	T_ENST00000366871.3_Silent_p.K227K	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	227					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		CCATCATCTCTTTGTGATCAC	0.388									Chordoma, Familial Clustering of																												p.K227K		Atlas-SNP	.											.	T	77	.	0			c.A681G						PASS	.						95.0	97.0	96.0					6																	166578142		2203	4300	6503	SO:0001819	synonymous_variant	6862	exon6	Familial Cancer Database		CATCTCTTTGTGA	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.681A>G	6.37:g.166578142T>C		58.0	0.0	0		87.0	4.0	0.045977	NM_003181	E7ERD6|Q4KMP4	Silent	SNP	ENST00000296946.2	37	CCDS5290.1																																																																																			.	.	none		0.388	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043037.2	NM_003181	
ONECUT2	9480	hgsc.bcm.edu	37	18	55103350	55103350	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr18:55103350C>T	ENST00000491143.2	+	1	434	c.402C>T	c.(400-402)tcC>tcT	p.S134S	AC090340.1_ENST00000581316.1_RNA	NM_004852.2	NP_004843.2	O95948	ONEC2_HUMAN	one cut homeobox 2	134					cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|epithelial cell development (GO:0002064)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ morphogenesis (GO:0009887)|peripheral nervous system neuron development (GO:0048935)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(4)|ovary(2)|skin(1)	15		Colorectal(73;0.234)		READ - Rectum adenocarcinoma(59;0.227)|Colorectal(16;0.245)		TGAGCATGTCCTGCGACTCGT	0.662																																					p.S134S		Atlas-SNP	.											.	ONECUT2	42	.	0			c.C402T						PASS	.						41.0	46.0	44.0					18																	55103350		2203	4300	6503	SO:0001819	synonymous_variant	9480	exon1			CATGTCCTGCGAC	Y18198	CCDS42440.1	18q21.31	2012-03-09	2007-07-16		ENSG00000119547	ENSG00000119547		"""Homeoboxes / CUT class"""	8139	protein-coding gene	gene with protein product		604894	"""one cut domain, family member 2"""			9915796	Standard	NM_004852		Approved	OC-2	uc002lgo.3	O95948	OTTHUMG00000159776	ENST00000491143.2:c.402C>T	18.37:g.55103350C>T		27.0	0.0	0		25.0	9.0	0.36	NM_004852		Silent	SNP	ENST00000491143.2	37	CCDS42440.1																																																																																			.	.	none		0.662	ONECUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357264.3		
DNAH1	25981	hgsc.bcm.edu	37	3	52400534	52400534	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr3:52400534C>T	ENST00000420323.2	+	35	5841	c.5580C>T	c.(5578-5580)ctC>ctT	p.L1860L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1860	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCCTCATGCTCGTCGGGCCCA	0.622																																					p.L1860L		Atlas-SNP	.											.	DNAH1	534	.	0			c.C5580T						PASS	.						31.0	32.0	32.0					3																	52400534		2091	4214	6305	SO:0001819	synonymous_variant	25981	exon35			CATGCTCGTCGGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5580C>T	3.37:g.52400534C>T		117.0	0.0	0		114.0	48.0	0.421053	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	37	CCDS46842.1																																																																																			.	.	none		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
HCAR2	338442	hgsc.bcm.edu	37	12	123187023	123187023	+	Missense_Mutation	SNP	G	G	A	rs201423596		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:123187023G>A	ENST00000328880.5	-	1	867	c.808C>T	c.(808-810)Cgc>Tgc	p.R270C	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_177551.3	NP_808219.1	Q8TDS4	HCAR2_HUMAN	hydroxycarboxylic acid receptor 2	270					negative regulation of lipid catabolic process (GO:0050995)|neutrophil apoptotic process (GO:0001781)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of neutrophil apoptotic process (GO:0033031)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nicotinic acid receptor activity (GO:0070553)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	15					Niacin(DB00627)	TCCACCGAGCGGTACACTTCA	0.552																																					p.R270C		Atlas-SNP	.											.	HCAR2	36	.	0			c.C808T						PASS	.						50.0	46.0	47.0					12																	123187023		2203	4294	6497	SO:0001583	missense	338442	exon1			CCGAGCGGTACAC	AY148884	CCDS9235.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000182782	ENSG00000182782		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	24827	protein-coding gene	gene with protein product	"""niacin receptor 1"""	609163	"""G protein-coupled receptor 109A"""	GPR109A		21167710, 12522134, 12646212, 19141678, 18983141, 21454438	Standard	NM_177551		Approved	HCA2, HM74A, PUMAG, Puma-g, NIACR1	uc001ucx.1	Q8TDS4	OTTHUMG00000162722	ENST00000328880.5:c.808C>T	12.37:g.123187023G>A	ENSP00000375066:p.Arg270Cys	238.0	0.0	0		285.0	67.0	0.235088	NM_177551	A0PJL5|A7LGG3	Missense_Mutation	SNP	ENST00000328880.5	37	CCDS9235.1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292018	0.23564	.	.	ENSG00000182782	ENST00000328880;ENST00000536970	T	0.37584	1.19	4.83	-1.66	0.08265	GPCR, rhodopsin-like superfamily (1);	0.524402	0.18457	N	0.140657	T	0.41465	0.1160	M	0.62088	1.915	0.09310	N	1	D	0.54207	0.965	P	0.56788	0.806	T	0.26538	-1.0100	10	0.62326	D	0.03	-6.7453	3.923	0.09251	0.3275:0.0:0.4073:0.2652	.	270	Q8TDS4	HCAR2_HUMAN	C	270	ENSP00000375066:R270C	ENSP00000375066:R270C	R	-	1	0	HCAR2	121752976	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.110000	0.10824	-0.192000	0.10432	0.563000	0.77884	CGC	.	.	weak		0.552	HCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370202.1	NM_177551	
DCHS2	54798	hgsc.bcm.edu	37	4	155411418	155411418	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr4:155411418C>T	ENST00000339452.1	-	1	1450	c.1090G>A	c.(1090-1092)Gtg>Atg	p.V364M	DCHS2_ENST00000443500.1_Missense_Mutation_p.V364M|DCHS2_ENST00000456341.2_Missense_Mutation_p.V357M	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1533	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ACTCGCACCACGCCGCTCAGC	0.731																																					p.V364M		Atlas-SNP	.											.	DCHS2	594	.	0			c.G1090A						PASS	.						8.0	11.0	10.0					4																	155411418		688	1580	2268	SO:0001583	missense	54798	exon1			GCACCACGCCGCT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1090G>A	4.37:g.155411418C>T	ENSP00000345062:p.Val364Met	31.0	0.0	0		10.0	7.0	0.7	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000339452.1	37	CCDS47150.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.800606	0.31869	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.53423	0.62;0.62;0.62	4.7	2.9	0.33743	.	.	.	.	.	T	0.62429	0.2427	M	0.64260	1.97	0.19300	N	0.999978	P;D	0.89917	0.955;1.0	P;D	0.73380	0.523;0.98	T	0.51164	-0.8740	9	0.48119	T	0.1	.	10.3423	0.43887	0.1419:0.5835:0.2746:0.0	.	364;364	E9PG03;E9PC11	.;.	M	364;364;357;364	ENSP00000345062:V364M;ENSP00000408543:V357M;ENSP00000395539:V364M	ENSP00000345062:V364M	V	-	1	0	DCHS2	155630868	0.091000	0.21658	0.990000	0.47175	0.214000	0.24535	0.793000	0.26944	0.468000	0.27243	0.561000	0.74099	GTG	.	.	none		0.731	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
CLASP1	23332	hgsc.bcm.edu	37	2	122135079	122135079	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:122135079T>C	ENST00000263710.4	-	34	4027	c.3638A>G	c.(3637-3639)gAt>gGt	p.D1213G	CLASP1_ENST00000541859.1_Missense_Mutation_p.D930G|CLASP1_ENST00000545861.1_Missense_Mutation_p.D920G|CLASP1_ENST00000409078.3_Missense_Mutation_p.D1146G|CLASP1_ENST00000397587.3_Missense_Mutation_p.D1153G|CLASP1_ENST00000541377.1_Missense_Mutation_p.D1152G|CLASP1_ENST00000455322.2_Missense_Mutation_p.D1169G	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1213					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					ACTTACAATATCACACTCCTT	0.378																																					p.D1213G		Atlas-SNP	.											.	CLASP1	135	.	0			c.A3638G						PASS	.						165.0	140.0	148.0					2																	122135079		1863	4104	5967	SO:0001583	missense	23332	exon33			ACAATATCACACT	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.3638A>G	2.37:g.122135079T>C	ENSP00000263710:p.Asp1213Gly	165.0	0.0	0		157.0	70.0	0.44586	NM_015282	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	ENST00000263710.4	37		.	.	.	.	.	.	.	.	.	.	T	17.18	3.323437	0.60634	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T	0.47869	2.17;2.15;2.15;2.14;0.83;2.15	5.74	5.74	0.90152	Armadillo-type fold (1);	0.226336	0.44285	N	0.000463	T	0.41994	0.1183	L	0.39020	1.185	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.28073	-1.0055	10	0.87932	D	0	-13.4635	16.0335	0.80603	0.0:0.0:0.0:1.0	.	1146;1153;1154;1213	E7EUA5;F5GWS0;A2RU21;Q7Z460	.;.;.;CLAP1_HUMAN	G	1213;1169;1153;1152;930;1146;920	ENSP00000263710:D1213G;ENSP00000389372:D1169G;ENSP00000380717:D1153G;ENSP00000441625:D1152G;ENSP00000441770:D930G;ENSP00000386442:D1146G	ENSP00000263710:D1213G	D	-	2	0	CLASP1	121851549	1.000000	0.71417	0.986000	0.45419	0.816000	0.46133	7.578000	0.82498	2.195000	0.70347	0.533000	0.62120	GAT	.	.	none		0.378	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
NEB	4703	hgsc.bcm.edu	37	2	152536281	152536281	+	Missense_Mutation	SNP	G	G	A	rs371710158		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:152536281G>A	ENST00000172853.10	-	32	3356	c.3209C>T	c.(3208-3210)gCg>gTg	p.A1070V	NEB_ENST00000427231.2_Missense_Mutation_p.A1070V|NEB_ENST00000603639.1_Missense_Mutation_p.A1070V|NEB_ENST00000409198.1_Missense_Mutation_p.A1070V|NEB_ENST00000397345.3_Missense_Mutation_p.A1070V|NEB_ENST00000604864.1_Missense_Mutation_p.A1070V			P20929	NEBU_HUMAN	nebulin	1070					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.A1070V(2)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GATGGGAATCGCATCAGTTCT	0.468																																					p.A1070V		Atlas-SNP	.											NEB,NS,carcinoma,0,1	NEB	1697	1	2	Substitution - Missense(2)	endometrium(2)	c.C3209T						scavenged	.						102.0	100.0	100.0					2																	152536281		1954	4153	6107	SO:0001583	missense	4703	exon32			GGAATCGCATCAG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3209C>T	2.37:g.152536281G>A	ENSP00000172853:p.Ala1070Val	132.0	1.0	0.00757576		149.0	60.0	0.402685	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	G	35	5.526780	0.96431	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.65554	0.2702	M	0.91406	3.205	0.80722	D	1	P	0.51147	0.942	P	0.46362	0.514	T	0.75566	-0.3273	10	0.87932	D	0	.	18.7041	0.91631	0.0:0.0:1.0:0.0	.	1070	P20929	NEBU_HUMAN	V	1070	ENSP00000386259:A1070V;ENSP00000380505:A1070V;ENSP00000416578:A1070V;ENSP00000172853:A1070V	ENSP00000172853:A1070V	A	-	2	0	NEB	152244527	1.000000	0.71417	0.687000	0.30102	0.982000	0.71751	9.705000	0.98719	2.720000	0.93068	0.650000	0.86243	GCG	.	.	alt		0.468	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
KLHL6	89857	hgsc.bcm.edu	37	3	183273170	183273170	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr3:183273170G>A	ENST00000341319.3	-	1	307	c.272C>T	c.(271-273)gCc>gTc	p.A91V		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	91	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			GCTGGCTGCGGCAAGCACCAC	0.512																																					p.A91V		Atlas-SNP	.											.	KLHL6	100	.	0			c.C272T						PASS	.						94.0	85.0	88.0					3																	183273170		2203	4300	6503	SO:0001583	missense	89857	exon1			GCTGCGGCAAGCA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.272C>T	3.37:g.183273170G>A	ENSP00000341342:p.Ala91Val	172.0	0.0	0		282.0	99.0	0.351064	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851144	0.91277	.	.	ENSG00000172578	ENST00000341319	T	0.72725	-0.68	5.56	5.56	0.83823	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.83059	0.5172	M	0.88570	2.965	0.80722	D	1	P	0.37370	0.592	P	0.46885	0.53	D	0.84866	0.0822	10	0.62326	D	0.03	.	19.5245	0.95199	0.0:0.0:1.0:0.0	.	91	Q8WZ60	KLHL6_HUMAN	V	91	ENSP00000341342:A91V	ENSP00000341342:A91V	A	-	2	0	KLHL6	184755864	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.900000	0.87376	2.608000	0.88229	0.655000	0.94253	GCC	.	.	none		0.512	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		Atlas-SNP	.											.	KIF1A	152	.	0			c.G2751T						PASS	.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		42.0	0.0	0		49.0	4.0	0.0816327	NM_001244008	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.	.	none		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
CCDC130	81576	hgsc.bcm.edu	37	19	13873535	13873535	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:13873535G>A	ENST00000586600.1	+	11	1347	c.844G>A	c.(844-846)Gcg>Acg	p.A282T	CCDC130_ENST00000221554.8_Missense_Mutation_p.A282T|CCDC130_ENST00000587019.1_3'UTR|MRI1_ENST00000040663.6_5'Flank|MRI1_ENST00000319545.8_5'Flank			P13994	CC130_HUMAN	coiled-coil domain containing 130	282					response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			CCGCAGAACCGCGCTTGCCAC	0.697																																					p.A282T		Atlas-SNP	.											CCDC130,NS,carcinoma,-1,1	CCDC130	25	1	0			c.G844A						PASS	.						21.0	21.0	21.0					19																	13873535		2202	4300	6502	SO:0001583	missense	81576	exon10			AGAACCGCGCTTG	AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994		ENST00000586600.1:c.844G>A	19.37:g.13873535G>A	ENSP00000465776:p.Ala282Thr	36.0	0.0	0		38.0	14.0	0.368421	NM_030818	Q9BQ72	Missense_Mutation	SNP	ENST00000586600.1	37	CCDS12296.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023846	0.35701	.	.	ENSG00000104957	ENST00000221554	T	0.31510	1.49	5.23	-3.93	0.04143	.	0.706623	0.13770	N	0.363927	T	0.14743	0.0356	L	0.31926	0.97	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.09377	0.004;0.004	T	0.18967	-1.0320	10	0.24483	T	0.36	-24.402	2.0876	0.03650	0.4101:0.1249:0.3384:0.1265	.	282;282	B3KUZ1;P13994	.;CC130_HUMAN	T	282	ENSP00000221554:A282T	ENSP00000221554:A282T	A	+	1	0	CCDC130	13734535	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.701000	0.05075	-0.174000	0.10743	0.561000	0.74099	GCG	.	.	none		0.697	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453216.2	NM_030818	
UBR5	51366	hgsc.bcm.edu	37	8	103269903	103269903	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr8:103269903C>T	ENST00000520539.1	-	58	8750	c.8144G>A	c.(8143-8145)tGg>tAg	p.W2715*	UBR5_ENST00000518205.1_Nonsense_Mutation_p.W443*|UBR5_ENST00000521922.1_Nonsense_Mutation_p.W2708*|UBR5_ENST00000220959.4_Nonsense_Mutation_p.W2714*|KB-431C1.5_ENST00000606361.1_RNA	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2715	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TACTATTGACCAGAACCAACG	0.323																																					p.W2715X	Ovarian(131;96 1741 5634 7352 27489)	Atlas-SNP	.											.	UBR5	285	.	0			c.G8144A						PASS	.						89.0	84.0	85.0					8																	103269903		2202	4300	6502	SO:0001587	stop_gained	51366	exon58			ATTGACCAGAACC	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.8144G>A	8.37:g.103269903C>T	ENSP00000429084:p.Trp2715*	72.0	0.0	0		76.0	40.0	0.526316	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Nonsense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	53	20.275754	0.99929	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3216	0.94243	0.0:1.0:0.0:0.0	.	.	.	.	X	2715;2714;443;2708	.	ENSP00000220959:W2714X	W	-	2	0	UBR5	103339079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.578000	0.87016	0.585000	0.79938	TGG	.	.	none		0.323	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
FOXP4	116113	hgsc.bcm.edu	37	6	41557528	41557528	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:41557528G>A	ENST00000307972.4	+	9	1097	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	FOXP4_ENST00000373057.3_Missense_Mutation_p.R360Q|FOXP4_ENST00000373060.1_Missense_Mutation_p.R362Q|FOXP4_ENST00000409208.1_Missense_Mutation_p.R362Q|FOXP4_ENST00000373063.3_Missense_Mutation_p.R361Q			Q8IVH2	FOXP4_HUMAN	forkhead box P4	362	Leucine-zipper.				embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GAGAGCGAGCGGCTGCAGGCC	0.692											OREG0004066	type=REGULATORY REGION|Gene=FOXP4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R362Q		Atlas-SNP	.											.	FOXP4	83	.	0			c.G1085A						PASS	.						34.0	37.0	36.0					6																	41557528		2202	4298	6500	SO:0001583	missense	116113	exon10			GCGAGCGGCTGCA	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.1085G>A	6.37:g.41557528G>A	ENSP00000309823:p.Arg362Gln	70.0	0.0	0	902	107.0	35.0	0.327103	NM_001012426	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	37	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615982	0.87359	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12	4.5	4.5	0.54988	.	0.000000	0.64402	D	0.000001	T	0.32734	0.0839	M	0.74258	2.255	0.80722	D	1	D;D;D	0.67145	0.996;0.993;0.987	P;P;P	0.56563	0.801;0.801;0.701	T	0.32052	-0.9921	10	0.87932	D	0	.	17.2142	0.86938	0.0:0.0:1.0:0.0	.	361;360;362	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	Q	362;361;362;360;362	ENSP00000362151:R362Q;ENSP00000362154:R361Q;ENSP00000386958:R362Q;ENSP00000362148:R360Q;ENSP00000309823:R362Q	ENSP00000309823:R362Q	R	+	2	0	FOXP4	41665506	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.688000	0.61715	2.072000	0.62099	0.305000	0.20034	CGG	.	.	none		0.692	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
C3orf79	152118	hgsc.bcm.edu	37	3	153203809	153203809	+	Silent	SNP	C	C	T	rs57748412	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr3:153203809C>T	ENST00000446603.2	+	2	200	c.138C>T	c.(136-138)tcC>tcT	p.S46S	RP11-23D24.2_ENST00000493214.2_RNA	NM_001101337.1	NP_001094807.1	P0CE67	CC079_HUMAN	chromosome 3 open reading frame 79	46										endometrium(1)|large_intestine(3)	4						GACAGACTTCCGGTTGTCTAA	0.358													C|||	77	0.0153754	0.0567	0.0029	5008	,	,		16257	0.0		0.0	False		,,,				2504	0.0				p.S46S		Atlas-SNP	.											.	C3orf79	13	.	0			c.C138T						PASS	.	C		144,3480		4,136,1672	37.0	34.0	35.0		138	0.8	0.0	3	dbSNP_129	35	1,8135		0,1,4067	no	coding-synonymous	C3orf79	NM_001101337.1		4,137,5739	TT,TC,CC		0.0123,3.9735,1.233		46/101	153203809	145,11615	1812	4068	5880	SO:0001819	synonymous_variant	152118	exon2			GACTTCCGGTTGT	AF086445	CCDS46937.1	3q25.2	2009-09-30			ENSG00000237787	ENSG00000237787			37259	protein-coding gene	gene with protein product							Standard	NM_001101337		Approved		uc003ezt.3	P0CE67	OTTHUMG00000159629	ENST00000446603.2:c.138C>T	3.37:g.153203809C>T		53.0	0.0	0		95.0	4.0	0.0421053	NM_001101337		Silent	SNP	ENST00000446603.2	37	CCDS46937.1																																																																																			C|0.985;T|0.015	0.015	strong		0.358	C3orf79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356570.1	NM_001101337	
CHAD	1101	hgsc.bcm.edu	37	17	48543124	48543124	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:48543124G>A	ENST00000508540.1	-	2	1034	c.882C>T	c.(880-882)acC>acT	p.T294T	CHAD_ENST00000258969.4_Silent_p.T294T|ACSF2_ENST00000541920.1_Intron|ACSF2_ENST00000504392.1_Intron|ACSF2_ENST00000300441.4_Intron|ACSF2_ENST00000427954.2_Intron|ACSF2_ENST00000502667.1_Intron	NM_001267.2	NP_001258.2	O15335	CHAD_HUMAN	chondroadherin	294					bone development (GO:0060348)|cartilage condensation (GO:0001502)|negative regulation of bone trabecula formation (GO:1900155)	proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(2)|ovary(2)	15	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TAAGGGCGAGGGTCTCCAGGC	0.572																																					p.T294T		Atlas-SNP	.											.	CHAD	36	.	0			c.C882T						PASS	.						178.0	158.0	164.0					17																	48543124		2203	4300	6503	SO:0001819	synonymous_variant	1101	exon2			GGCGAGGGTCTCC	U96767	CCDS11568.1	17q21.33	2008-02-05			ENSG00000136457	ENSG00000136457		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	1909	protein-coding gene	gene with protein product	"""chondroadherin proteoglycan"""	602178				9344663	Standard	NM_001267		Approved	SLRR4A	uc010dbr.3	O15335	OTTHUMG00000162129	ENST00000508540.1:c.882C>T	17.37:g.48543124G>A		119.0	0.0	0		92.0	40.0	0.434783	NM_001267	A8K812|Q6GTU0|Q96RJ5	Silent	SNP	ENST00000508540.1	37	CCDS11568.1																																																																																			.	.	none		0.572	CHAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367447.3	NM_001267	
TNFRSF14	8764	hgsc.bcm.edu	37	1	2488105	2488105	+	Start_Codon_SNP	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:2488105T>C	ENST00000355716.4	+	1	301	c.2T>C	c.(1-3)aTg>aCg	p.M1T	TNFRSF14_ENST00000409119.1_Start_Codon_SNP_p.M1T|RP3-395M20.8_ENST00000452793.1_RNA|RP3-395M20.8_ENST00000416860.2_RNA|TNFRSF14_ENST00000442392.2_3'UTR	NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14	1					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		GCCTGAGGCATGGAGCCTCCT	0.642			"""Mis, N, F"""		follicular lymphoma																																p.M1T		Atlas-SNP	.		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	.	TNFRSF14	89	.	0			c.T2C						PASS	.						36.0	39.0	38.0					1																	2488105		2199	4298	6497	SO:0001582	initiator_codon_variant	8764	exon1			GAGGCATGGAGCC	U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.2T>C	1.37:g.2488105T>C	ENSP00000347948:p.Met1Thr	73.0	0.0	0		73.0	69.0	0.945205	NM_003820	B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	Missense_Mutation	SNP	ENST00000355716.4	37	CCDS44046.1	.	.	.	.	.	.	.	.	.	.	t	12.71	2.019131	0.35606	.	.	ENSG00000157873	ENST00000426449;ENST00000434817;ENST00000435221;ENST00000451778;ENST00000409119;ENST00000423768;ENST00000355716	D;D;D;D;D;D	0.88896	-2.38;-2.29;-2.29;-2.29;-2.44;-2.38	2.33	1.16	0.20824	.	.	.	.	.	D	0.90954	0.7156	.	.	.	0.80722	D	1	D;B	0.54601	0.967;0.106	P;B	0.60789	0.879;0.026	D	0.87877	0.2675	8	0.87932	D	0	-26.9813	4.2458	0.10670	0.0:0.1749:0.0:0.8251	.	1;1	B4DU65;Q92956	.;TNR14_HUMAN	T	1	ENSP00000411854:M1T;ENSP00000415254:M1T;ENSP00000399292:M1T;ENSP00000399533:M1T;ENSP00000386859:M1T;ENSP00000347948:M1T	ENSP00000347948:M1T	M	+	2	0	TNFRSF14	2486313	0.000000	0.05858	0.031000	0.17742	0.095000	0.18619	-0.986000	0.03747	0.325000	0.23359	0.155000	0.16302	ATG	.	.	none		0.642	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002088.1		Missense_Mutation
MTMR1	8776	hgsc.bcm.edu	37	X	149896262	149896262	+	Splice_Site	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:149896262A>G	ENST00000370390.3	+	5	687	c.530A>G	c.(529-531)aAg>aGg	p.K177R	MTMR1_ENST00000538506.1_Splice_Site_p.K64R|MTMR1_ENST00000445323.2_Splice_Site_p.K185R|MTMR1_ENST00000544228.1_Splice_Site_p.K177R|MTMR1_ENST00000542156.1_Splice_Site_p.K177R|MTMR1_ENST00000451863.2_Splice_Site_p.K177R|MTMR1_ENST00000541925.1_Splice_Site_p.K83R	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	177					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					ATAGTGTGCAAGGTATAATAG	0.423																																					p.K177R		Atlas-SNP	.											.	MTMR1	82	.	0			c.A530G						PASS	.						89.0	81.0	84.0					X																	149896262		2203	4300	6503	SO:0001630	splice_region_variant	8776	exon5			TGTGCAAGGTATA	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.531+1A>G	X.37:g.149896262A>G		110.0	0.0	0		67.0	50.0	0.746269	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	a	24.9	4.582513	0.86748	.	.	ENSG00000063601	ENST00000541925;ENST00000493995;ENST00000439546;ENST00000429965;ENST00000434699;ENST00000542156;ENST00000370390;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000538506	D;D;D;D;D;D;D;D;D;D;D	0.88277	-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36;-2.36	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.94029	0.8087	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.993;0.999	D	0.94719	0.7899	10	0.87932	D	0	.	14.1476	0.65360	1.0:0.0:0.0:0.0	.	177;185;177	Q13613;F8WA39;Q8NEC6	MTMR1_HUMAN;.;.	R	83;83;83;83;83;177;177;185;177;177;64	ENSP00000441879:K83R;ENSP00000431992:K83R;ENSP00000404599:K83R;ENSP00000390736:K83R;ENSP00000405946:K83R;ENSP00000445281:K177R;ENSP00000359417:K177R;ENSP00000414178:K185R;ENSP00000440534:K177R;ENSP00000387446:K177R;ENSP00000443444:K64R	ENSP00000359417:K177R	K	+	2	0	MTMR1	149646920	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	9.026000	0.93700	1.787000	0.52448	0.441000	0.28932	AAG	.	.	none		0.423	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	Missense_Mutation
JMY	133746	hgsc.bcm.edu	37	5	78587039	78587039	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr5:78587039T>C	ENST00000396137.4	+	4	1906	c.1444T>C	c.(1444-1446)Tat>Cat	p.Y482H		NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	482	Interaction with p300/EP300. {ECO:0000250}.				'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		AAAACTCCAGTATGCAGTTTC	0.403																																					p.Y482H		Atlas-SNP	.											.	JMY	82	.	0			c.T1444C						PASS	.						76.0	74.0	75.0					5																	78587039		1879	4094	5973	SO:0001583	missense	133746	exon4			CTCCAGTATGCAG	AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.1444T>C	5.37:g.78587039T>C	ENSP00000379441:p.Tyr482His	49.0	0.0	0		65.0	4.0	0.0615385	NM_152405	A1L4P5|B5MDS2|B5MDT0	Missense_Mutation	SNP	ENST00000396137.4	37	CCDS4047.3	.	.	.	.	.	.	.	.	.	.	T	25.6	4.659897	0.88154	.	.	ENSG00000152409	ENST00000282259;ENST00000396137	T	0.11169	2.8	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.33000	0.0848	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04855	-1.0922	10	0.66056	D	0.02	.	15.2486	0.73526	0.0:0.0:0.0:1.0	.	482	Q8N9B5	JMY_HUMAN	H	482	ENSP00000379441:Y482H	ENSP00000282259:Y482H	Y	+	1	0	JMY	78622795	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.223000	0.78033	1.999000	0.58509	0.454000	0.30748	TAT	.	.	none		0.403	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254070.4	NM_152405	
GLB1L3	112937	hgsc.bcm.edu	37	11	134188798	134188798	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:134188798G>A	ENST00000431683.2	+	20	1924	c.1924G>A	c.(1924-1926)Ggc>Agc	p.G642S		NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	642					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		GATGATGAGTGGCTCAGATAT	0.413																																					p.G642S		Atlas-SNP	.											.	GLB1L3	102	.	0			c.G1924A						PASS	.						116.0	106.0	109.0					11																	134188798		1871	4118	5989	SO:0001583	missense	112937	exon20			ATGAGTGGCTCAG		CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.1924G>A	11.37:g.134188798G>A	ENSP00000396615:p.Gly642Ser	100.0	0.0	0		80.0	30.0	0.375	NM_001080407	A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	ENST00000431683.2	37	CCDS44780.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579506	0.65878	.	.	ENSG00000166105	ENST00000431683	D	0.95588	-3.75	5.14	5.14	0.70334	Galactose-binding domain-like (1);	0.237649	0.44097	D	0.000491	D	0.88952	0.6577	N	0.11845	0.185	0.19575	N	0.999964	P	0.37824	0.609	B	0.34590	0.186	T	0.81874	-0.0732	10	0.30854	T	0.27	.	14.3466	0.66668	0.0:0.0:1.0:0.0	.	642	Q8NCI6	GLBL3_HUMAN	S	642	ENSP00000396615:G642S	ENSP00000396615:G642S	G	+	1	0	GLB1L3	133694008	0.566000	0.26618	0.093000	0.20910	0.010000	0.07245	2.785000	0.47782	2.844000	0.97970	0.650000	0.86243	GGC	.	.	none		0.413	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393625.1	NM_138416	
ZP3	7784	hgsc.bcm.edu	37	7	76058885	76058885	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:76058885C>T	ENST00000394857.3	+	2	424	c.366C>T	c.(364-366)ccC>ccT	p.P122P	ZP3_ENST00000416245.1_5'UTR|ZP3_ENST00000336517.4_Silent_p.P71P	NM_001110354.1	NP_001103824.1	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 (sperm receptor)	122	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				binding of sperm to zona pellucida (GO:0007339)|blastocyst formation (GO:0001825)|calcium ion transmembrane transport (GO:0070588)|egg coat formation (GO:0035803)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|negative regulation of transcription, DNA-templated (GO:0045892)|oocyte development (GO:0048599)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of acrosomal vesicle exocytosis (GO:2000368)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of antral ovarian follicle growth (GO:2000388)|positive regulation of calcium ion import (GO:0090280)|positive regulation of humoral immune response (GO:0002922)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of ovarian follicle development (GO:2000386)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type IV hypersensitivity (GO:0001809)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|outer acrosomal membrane (GO:0002081)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)	acrosin binding (GO:0032190)|carbohydrate binding (GO:0030246)|manganese ion transmembrane transporter activity (GO:0005384)|signal transducer activity (GO:0004871)|store-operated calcium channel activity (GO:0015279)			endometrium(1)|large_intestine(3)|lung(2)|skin(1)	7						ACCCCCGCCCCGTGGGAAACC	0.612																																					p.P122P		Atlas-SNP	.											.	ZP3	32	.	0			c.C366T						PASS	.						112.0	83.0	93.0					7																	76058885		2203	4300	6503	SO:0001819	synonymous_variant	7784	exon2			CCGCCCCGTGGGA	M60504	CCDS5586.1, CCDS47618.1	7q11.23	2014-07-04	2002-09-17	2002-09-20	ENSG00000188372	ENSG00000188372		"""Zona pellucida glycoproteins"""	13189	protein-coding gene	gene with protein product		182889	"""zona pellucida glycoprotein 3A (sperm receptor)"""	ZP3A, ZP3B		1478648	Standard	NM_007155		Approved	ZP3-424, ZP3-372, ZPC	uc003ufd.4	P21754	OTTHUMG00000130575	ENST00000394857.3:c.366C>T	7.37:g.76058885C>T		136.0	0.0	0		127.0	54.0	0.425197	NM_001110354	Q06633|Q29RW0	Silent	SNP	ENST00000394857.3	37	CCDS47618.1																																																																																			.	.	none		0.612	ZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253004.1		
SND1	27044	hgsc.bcm.edu	37	7	127447592	127447592	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:127447592C>T	ENST00000354725.3	+	11	1401	c.1207C>T	c.(1207-1209)Cgg>Tgg	p.R403W		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	403	TNase-like 3. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						GTTTGAGGCCCGGGAATTTCT	0.368																																					p.R403W		Atlas-SNP	.											.	SND1	104	.	0			c.C1207T						PASS	.						138.0	136.0	137.0					7																	127447592		2203	4300	6503	SO:0001583	missense	27044	exon11			GAGGCCCGGGAAT		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.1207C>T	7.37:g.127447592C>T	ENSP00000346762:p.Arg403Trp	101.0	0.0	0		88.0	4.0	0.0454545	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	37	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.740470	0.89573	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.34072	1.38	5.86	5.86	0.93980	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.052414	0.85682	D	0.000000	T	0.69396	0.3106	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76664	-0.2876	10	0.87932	D	0	-19.8134	12.9338	0.58303	0.1619:0.8381:0.0:0.0	.	403	Q7KZF4	SND1_HUMAN	W	403;393	ENSP00000346762:R403W	ENSP00000346762:R403W	R	+	1	2	SND1	127234828	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.304000	0.43655	2.937000	0.99478	0.650000	0.86243	CGG	.	.	none		0.368	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
COPB1	1315	hgsc.bcm.edu	37	11	14504615	14504615	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:14504615T>C	ENST00000249923.3	-	8	1220	c.920A>G	c.(919-921)gAa>gGa	p.E307G	COPB1_ENST00000439561.2_Missense_Mutation_p.E307G	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	307					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						CTCTTTTAATTCTATCAAGCG	0.318																																					p.E307G		Atlas-SNP	.											.	COPB1	81	.	0			c.A920G						PASS	.						82.0	77.0	79.0					11																	14504615		2199	4293	6492	SO:0001583	missense	1315	exon8			TTTAATTCTATCA	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.920A>G	11.37:g.14504615T>C	ENSP00000249923:p.Glu307Gly	53.0	0.0	0		40.0	4.0	0.1	NM_001144062	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	37	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.011321	0.75046	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	T;T;T	0.26957	1.7;1.7;1.7	5.56	5.56	0.83823	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.30008	0.0751	L	0.56769	1.78	0.80722	D	1	B	0.20459	0.045	B	0.26614	0.071	T	0.04053	-1.0981	10	0.33940	T	0.23	.	15.7137	0.77652	0.0:0.0:0.0:1.0	.	307	P53618	COPB_HUMAN	G	307	ENSP00000249923:E307G;ENSP00000397873:E307G;ENSP00000436383:E307G	ENSP00000249923:E307G	E	-	2	0	COPB1	14461191	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.018000	0.88722	2.118000	0.64928	0.482000	0.46254	GAA	.	.	none		0.318	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
FKBP9	11328	hgsc.bcm.edu	37	7	33014908	33014908	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:33014908G>A	ENST00000242209.4	+	3	651	c.482G>A	c.(481-483)cGg>cAg	p.R161Q	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000538443.1_Missense_Mutation_p.R23Q|FKBP9_ENST00000538336.1_Missense_Mutation_p.R214Q	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	161					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AGTTGCCCTCGGACCATCCAG	0.473																																					p.R161Q		Atlas-SNP	.											FKBP9,brain,glioma,0,9	FKBP9	335	9	0			c.G482A						scavenged	.						99.0	87.0	91.0					7																	33014908		2203	4300	6503	SO:0001583	missense	11328	exon3			GCCCTCGGACCAT	AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.482G>A	7.37:g.33014908G>A	ENSP00000242209:p.Arg161Gln	98.0	1.0	0.0102041		121.0	7.0	0.0578512	NM_007270	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	ENST00000242209.4	37	CCDS5439.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720086	0.89205	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443	D;D;D	0.86164	-2.08;-2.08;-2.08	5.36	5.36	0.76844	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.000000	0.85682	D	0.000000	D	0.92714	0.7684	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.92752	0.6217	10	0.56958	D	0.05	-4.2611	19.0957	0.93249	0.0:0.0:1.0:0.0	.	214;161;161	B7Z6H3;O95302;B3KQQ0	.;FKBP9_HUMAN;.	Q	161;214;23	ENSP00000242209:R161Q;ENSP00000439250:R214Q;ENSP00000437504:R23Q	ENSP00000242209:R161Q	R	+	2	0	FKBP9	32981433	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	9.809000	0.99208	2.524000	0.85096	0.650000	0.86243	CGG	.	.	none		0.473	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215137.1	NM_007270	
ARMC8	25852	hgsc.bcm.edu	37	3	138009387	138009387	+	Splice_Site	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr3:138009387G>A	ENST00000469044.1	+	21	2165		c.e21-1		ARMC8_ENST00000538260.1_Splice_Site|NME9_ENST00000341790.5_Intron|NME9_ENST00000484930.1_Intron|NME9_ENST00000317876.4_Intron|NME9_ENST00000383180.2_Intron|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000461822.1_Splice_Site|ARMC8_ENST00000485396.1_Splice_Site|ARMC8_ENST00000491704.1_Splice_Site|ARMC8_ENST00000481646.1_Splice_Site|ARMC8_ENST00000393058.3_Splice_Site	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8											endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						TAATCGTTTAGGTTCACAAGA	0.428																																					.		Atlas-SNP	.											.	ARMC8	79	.	0			c.1853-1G>A						PASS	.						68.0	64.0	65.0					3																	138009387		1918	4126	6044	SO:0001630	splice_region_variant	25852	exon22			CGTTTAGGTTCAC		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1895-1G>A	3.37:g.138009387G>A		83.0	0.0	0		147.0	44.0	0.29932	NM_015396	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Splice_Site	SNP	ENST00000469044.1	37		.	.	.	.	.	.	.	.	.	.	G	17.36	3.370690	0.61624	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461822;ENST00000485396;ENST00000538260;ENST00000393058;ENST00000539459	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.834	0.78782	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARMC8	139492077	1.000000	0.71417	0.966000	0.40874	0.711000	0.40976	9.281000	0.95811	2.305000	0.77605	0.442000	0.29010	.	.	.	none		0.428	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	Intron
UBE2A	7319	hgsc.bcm.edu	37	X	118708868	118708868	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:118708868C>T	ENST00000371558.2	+	2	223	c.49C>T	c.(49-51)Cag>Tag	p.Q17*	UBE2A_ENST00000346330.3_Nonsense_Mutation_p.Q17*|UBE2A_ENST00000469205.1_3'UTR	NM_001282161.1|NM_003336.2|NM_181762.1	NP_001269090.1|NP_003327.2|NP_861427.1	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A	17					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|DNA repair (GO:0006281)|histone H2A ubiquitination (GO:0033522)|in utero embryonic development (GO:0001701)|maternal process involved in female pregnancy (GO:0060135)|positive regulation of cell proliferation (GO:0008284)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|response to UV (GO:0009411)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|cytosol (GO:0005829)|HULC complex (GO:0033503)|nuclear chromatin (GO:0000790)|XY body (GO:0001741)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)			haematopoietic_and_lymphoid_tissue(1)|lung(7)	8						CCGAAGGTTGCAGGAGGATCC	0.701								Rad6 pathway																													p.Q17X		Atlas-SNP	.											.	UBE2A	43	.	0			c.C49T						PASS	.						137.0	111.0	120.0					X																	118708868		2203	4300	6503	SO:0001587	stop_gained	7319	exon2			AGGTTGCAGGAGG	AK223045	CCDS14580.1, CCDS14581.1	Xq24	2011-05-19	2011-05-19		ENSG00000077721	ENSG00000077721		"""Ubiquitin-conjugating enzymes E2"""	12472	protein-coding gene	gene with protein product		312180	"""ubiquitin-conjugating enzyme E2A (RAD6 homolog)"""			1559696	Standard	NM_003336		Approved	UBC2, HHR6A, RAD6A	uc004erl.3	P49459	OTTHUMG00000022275	ENST00000371558.2:c.49C>T	X.37:g.118708868C>T	ENSP00000360613:p.Gln17*	183.0	0.0	0		106.0	81.0	0.764151	NM_003336	A6NFE9|A6NGR2|A6NMF5|B2R7R9|D3DWI1|Q4TTG1|Q96FX4	Nonsense_Mutation	SNP	ENST00000371558.2	37	CCDS14580.1	.	.	.	.	.	.	.	.	.	.	C	33	5.277119	0.95459	.	.	ENSG00000077721	ENST00000371558;ENST00000346330	.	.	.	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-3.7589	15.601	0.76626	0.0:1.0:0.0:0.0	.	.	.	.	X	17	.	ENSP00000335027:Q17X	Q	+	1	0	UBE2A	118592896	1.000000	0.71417	0.999000	0.59377	0.572000	0.35998	7.145000	0.77365	2.131000	0.65755	0.529000	0.55759	CAG	.	.	none		0.701	UBE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058036.1	NM_003336	
DDX52	11056	hgsc.bcm.edu	37	17	36003419	36003419	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:36003419C>T	ENST00000349699.2	-	1	74	c.31G>A	c.(31-33)Ggc>Agc	p.G11S	RP11-697E22.2_ENST00000586950.1_RNA|DDX52_ENST00000394367.3_5'UTR|RP11-697E22.2_ENST00000586163.1_RNA	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	11						membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				GCCCCCGCGCCGAGCCGGCGA	0.632																																					p.G11S		Atlas-SNP	.											.	DDX52	40	.	0			c.G31A						PASS	.						44.0	45.0	45.0					17																	36003419		2203	4300	6503	SO:0001583	missense	11056	exon1			CCGCGCCGAGCCG	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.31G>A	17.37:g.36003419C>T	ENSP00000268854:p.Gly11Ser	40.0	0.0	0		53.0	4.0	0.0754717	NM_007010	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	CCDS11323.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871577	0.33069	.	.	ENSG00000141141	ENST00000349699	T	0.13778	2.56	5.5	4.53	0.55603	.	2.488010	0.00945	N	0.002898	T	0.13970	0.0338	L	0.41710	1.295	0.80722	D	1	B	0.26672	0.156	B	0.18263	0.021	T	0.43637	-0.9379	10	0.07990	T	0.79	.	11.6948	0.51538	0.1761:0.8239:0.0:0.0	.	11	Q9Y2R4	DDX52_HUMAN	S	11	ENSP00000268854:G11S	ENSP00000268854:G11S	G	-	1	0	DDX52	33077532	0.436000	0.25586	0.246000	0.24233	0.197000	0.23852	2.315000	0.43752	1.555000	0.49500	-0.152000	0.13540	GGC	.	.	none		0.632	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300	
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR|NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V		Atlas-SNP	.											NBPF10,NS,carcinoma,0,2	NBPF10	221	2	2	Substitution - Missense(2)	kidney(2)	c.C130G						scavenged	.																																			SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val	98.0	1.0	0.0102041		142.0	7.0	0.0492958	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT	.	.	weak		0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding	OTTHUMT00000038550.3	NM_001039703	
PLEKHO2	80301	hgsc.bcm.edu	37	15	65157677	65157677	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr15:65157677C>G	ENST00000323544.4	+	6	1191	c.1063C>G	c.(1063-1065)Ccc>Gcc	p.P355A	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	355	Pro-rich.									NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						GCCTGCCAAGCCCTCTCAGGC	0.612																																					p.P355A		Atlas-SNP	.											.	PLEKHO2	50	.	0			c.C1063G						PASS	.						70.0	70.0	70.0					15																	65157677		2202	4299	6501	SO:0001583	missense	80301	exon6			GCCAAGCCCTCTC	AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1063C>G	15.37:g.65157677C>G	ENSP00000326706:p.Pro355Ala	22.0	0.0	0		29.0	14.0	0.482759	NM_025201	Q7L4H4|Q8WYS8	Missense_Mutation	SNP	ENST00000323544.4	37	CCDS10196.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.120411	0.00346	.	.	ENSG00000241839	ENST00000323544	T	0.34275	1.37	5.05	2.03	0.26663	.	0.935404	0.09141	N	0.842938	T	0.16727	0.0402	N	0.11560	0.145	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.32561	-0.9902	10	0.12430	T	0.62	.	4.9907	0.14213	0.0:0.5785:0.1598:0.2617	.	305;355	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	A	355	ENSP00000326706:P355A	ENSP00000326706:P355A	P	+	1	0	PLEKHO2	62944730	0.000000	0.05858	0.007000	0.13788	0.112000	0.19704	0.094000	0.15107	0.497000	0.27926	0.655000	0.94253	CCC	.	.	none		0.612	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256659.1	NM_025201	
DOCK9	23348	hgsc.bcm.edu	37	13	99537314	99537314	+	Missense_Mutation	SNP	C	C	T	rs370847473		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr13:99537314C>T	ENST00000376460.1	-	21	2373	c.2293G>A	c.(2293-2295)Gga>Aga	p.G765R	DOCK9_ENST00000448493.2_Missense_Mutation_p.G777R|DOCK9_ENST00000339416.2_Missense_Mutation_p.G766R|DOCK9_ENST00000442173.1_Missense_Mutation_p.G765R	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	766	DHR-1.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					ACCACCCTTCCGTCTTTCAGG	0.512																																					p.G766R		Atlas-SNP	.											DOCK9_ENST00000448493,left_upper_lobe,carcinoma,+1,3	DOCK9	311	3	0			c.G2296A						scavenged	.	C	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	0,3882		0,0,1941	50.0	50.0	50.0		2293,2296,2293,2296	6.0	1.0	13		50	1,8283		0,1,4141	no	missense,missense,missense,missense	DOCK9	NM_001130048.1,NM_001130049.1,NM_001130050.1,NM_015296.2	125,125,125,125	0,1,6082	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging,probably-damaging,probably-damaging,probably-damaging	765/2069,766/1255,765/1254,766/2070	99537314	1,12165	1941	4142	6083	SO:0001583	missense	23348	exon21			CCCTTCCGTCTTT	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2293G>A	13.37:g.99537314C>T	ENSP00000365643:p.Gly765Arg	57.0	0.0	0		60.0	3.0	0.05	NM_001130049	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	ENST00000376460.1	37	CCDS45062.1	.	.	.	.	.	.	.	.	.	.	C	34	5.398347	0.96030	0.0	1.21E-4	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.57301	0.2044	M	0.81239	2.535	0.80722	D	1	D;D;D;P;D	0.89917	0.995;1.0;0.995;0.921;1.0	P;D;P;P;D	0.97110	0.88;1.0;0.819;0.479;1.0	T	0.57528	-0.7796	10	0.62326	D	0.03	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	766;765;765;765;766	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	R	765;766;766;766;765;766;777;765	ENSP00000365643:G765R;ENSP00000341086:G766R;ENSP00000401958:G777R;ENSP00000406883:G765R	ENSP00000341086:G766R	G	-	1	0	DOCK9	98335315	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	7.281000	0.78621	2.832000	0.97577	0.655000	0.94253	GGA	.	.	weak		0.512	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
MYC	4609	hgsc.bcm.edu	37	8	128750820	128750820	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr8:128750820G>A	ENST00000259523.6	+	2	1517	c.312G>A	c.(310-312)gaG>gaA	p.E104E	MYC_ENST00000524013.1_Silent_p.E118E|MYC_ENST00000377970.2_Silent_p.E119E			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	104					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	TGGTGACCGAGCTGCTGGGAG	0.602		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E119E		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	.	MYC	168	.	0			c.G357A						PASS	.						52.0	52.0	52.0					8																	128750820		2203	4300	6503	SO:0001819	synonymous_variant	4609	exon2			GACCGAGCTGCTG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.312G>A	8.37:g.128750820G>A		94.0	0.0	0	1567	122.0	60.0	0.491803	NM_002467	A8WFE7|P01107|Q14026	Silent	SNP	ENST00000259523.6	37																																																																																				.	.	none		0.602	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
CDC27	996	hgsc.bcm.edu	37	17	45234463	45234463	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:45234463A>C	ENST00000066544.3	-	7	751	c.658T>G	c.(658-660)Tcc>Gcc	p.S220A	CDC27_ENST00000531206.1_Missense_Mutation_p.S220A|CDC27_ENST00000527547.1_Missense_Mutation_p.S220A|CDC27_ENST00000446365.2_Missense_Mutation_p.S159A|CDC27_ENST00000528748.1_5'UTR	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	220					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTTGAATTGGAAGATTCTAAA	0.323																																					p.S220A		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27	337	2	0			c.T658G						scavenged	.						25.0	27.0	26.0					17																	45234463		2153	4281	6434	SO:0001583	missense	996	exon7			AATTGGAAGATTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.658T>G	17.37:g.45234463A>C	ENSP00000066544:p.Ser220Ala	31.0	0.0	0		45.0	3.0	0.0666667	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.291146	0.40494	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.68331	-0.32;-0.27;-0.05;-0.32;0.81	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.48150	0.1484	N	0.19112	0.55	0.58432	D	0.999998	B;B;B;B	0.21225	0.013;0.023;0.053;0.031	B;B;B;B	0.15484	0.004;0.004;0.013;0.009	T	0.45086	-0.9285	10	0.07175	T	0.84	-13.9867	13.9377	0.64034	1.0:0.0:0.0:0.0	.	159;220;220;220	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	A	220;220;159;220;220	ENSP00000066544:S220A;ENSP00000434614:S220A;ENSP00000392802:S159A;ENSP00000437339:S220A;ENSP00000432105:S220A	ENSP00000066544:S220A	S	-	1	0	CDC27	42589462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.754000	0.91642	2.180000	0.69256	0.455000	0.32223	TCC	.	.	none		0.323	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
OR52R1	119695	hgsc.bcm.edu	37	11	4825192	4825192	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:4825192G>A	ENST00000356069.2	-	1	418	c.419C>T	c.(418-420)aCc>aTc	p.T140I	MMP26_ENST00000380390.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.T219I|MMP26_ENST00000477339.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	140						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GACCGATGGGGTCAGGATGCT	0.567																																					p.T140I		Atlas-SNP	.											.	OR52R1	81	.	0			c.C419T						PASS	.						105.0	93.0	97.0					11																	4825192		2201	4298	6499	SO:0001583	missense	119695	exon1			GATGGGGTCAGGA	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.419C>T	11.37:g.4825192G>A	ENSP00000348368:p.Thr140Ile	52.0	0.0	0		56.0	27.0	0.482143	NM_001005177	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	CCDS31360.2	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582644	0.46006	.	.	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.00381	7.63;7.63	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.133368	0.33670	N	0.004668	T	0.01661	0.0053	H	0.97611	4.04	0.32673	N	0.51654	D	0.60160	0.987	P	0.57776	0.827	T	0.01961	-1.1239	10	0.87932	D	0	.	17.9523	0.89057	0.0:0.0:1.0:0.0	.	140	Q8NGF1	O52R1_HUMAN	I	140;219	ENSP00000348368:T140I;ENSP00000369742:T219I	ENSP00000348368:T140I	T	-	2	0	OR52R1	4781768	0.021000	0.18746	0.396000	0.26296	0.137000	0.21094	1.265000	0.33027	2.826000	0.97356	0.650000	0.86243	ACC	.	.	none		0.567	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
ARHGAP28	79822	hgsc.bcm.edu	37	18	6882194	6882194	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr18:6882194T>A	ENST00000383472.4	+	11	1453	c.1349T>A	c.(1348-1350)aTg>aAg	p.M450K	ARHGAP28_ENST00000262227.3_Missense_Mutation_p.M398K|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.M291K|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.M450K|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.M291K|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.M291K|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.M273K|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.M286K			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	450	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				TGGGACAAAATGTGCCATAGA	0.383																																					p.M291K		Atlas-SNP	.											.	ARHGAP28	181	.	0			c.T872A						PASS	.						174.0	167.0	169.0					18																	6882194		2203	4300	6503	SO:0001583	missense	79822	exon10			ACAAAATGTGCCA	BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1349T>A	18.37:g.6882194T>A	ENSP00000372964:p.Met450Lys	172.0	0.0	0		101.0	83.0	0.821782	NM_001010000	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	ENST00000383472.4	37		.	.	.	.	.	.	.	.	.	.	T	25.4	4.633106	0.87660	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01	5.68	5.68	0.88126	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.048511	0.85682	D	0.000000	T	0.42063	0.1186	N	0.22421	0.69	0.44409	D	0.997329	P;P;P;B	0.49961	0.93;0.8;0.762;0.239	P;P;P;B	0.50270	0.631;0.636;0.503;0.249	T	0.42032	-0.9475	10	0.72032	D	0.01	.	15.9369	0.79717	0.0:0.0:0.0:1.0	.	450;282;291;398	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	K	450;398;291;286;291;291;282;273	ENSP00000382963:M450K;ENSP00000262227:M398K;ENSP00000392660:M291K;ENSP00000437262:M286K;ENSP00000313506:M291K;ENSP00000406907:M291K	ENSP00000262227:M398K	M	+	2	0	ARHGAP28	6872194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.655000	0.74392	2.172000	0.68678	0.533000	0.62120	ATG	.	.	none		0.383	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000442123.3	XM_371108	
PIWIL1	9271	hgsc.bcm.edu	37	12	130847589	130847589	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:130847589G>A	ENST00000245255.3	+	18	2367	c.2095G>A	c.(2095-2097)Gtg>Atg	p.V699M		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	699	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CCGGATCATCGTGTACCGCGA	0.488																																					p.V699M		Atlas-SNP	.											.	PIWIL1	157	.	0			c.G2095A						PASS	.						114.0	112.0	113.0					12																	130847589		2203	4300	6503	SO:0001583	missense	9271	exon18			ATCATCGTGTACC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.2095G>A	12.37:g.130847589G>A	ENSP00000245255:p.Val699Met	139.0	0.0	0		130.0	43.0	0.330769	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	ENST00000245255.3	37	CCDS9268.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700418	0.68501	.	.	ENSG00000125207	ENST00000245255	T	0.16597	2.33	5.66	5.66	0.87406	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.056584	0.64402	D	0.000001	T	0.37785	0.1016	M	0.79258	2.445	0.58432	D	0.999999	D;D	0.71674	0.998;0.994	P;P	0.59546	0.859;0.815	T	0.14699	-1.0463	10	0.66056	D	0.02	-15.817	12.0926	0.53736	0.0782:0.0:0.9218:0.0	.	699;699	Q96J94;Q96J94-2	PIWL1_HUMAN;.	M	699	ENSP00000245255:V699M	ENSP00000245255:V699M	V	+	1	0	PIWIL1	129413542	1.000000	0.71417	0.960000	0.40013	0.456000	0.32438	5.444000	0.66587	2.663000	0.90544	0.591000	0.81541	GTG	.	.	none		0.488	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
MED27	9442	hgsc.bcm.edu	37	9	134736013	134736013	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr9:134736013C>T	ENST00000292035.5	-	8	911	c.848G>A	c.(847-849)cGc>cAc	p.R283H	MED27_ENST00000357028.2_Missense_Mutation_p.R247H	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	283					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		CTTCCCGCAGCGCTGGCACGG	0.562																																					p.R283H	Colon(41;784 923 6932 42329 52483)	Atlas-SNP	.											.	MED27	37	.	0			c.G848A						PASS	.						33.0	32.0	32.0					9																	134736013		2203	4300	6503	SO:0001583	missense	9442	exon8			CCGCAGCGCTGGC	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.848G>A	9.37:g.134736013C>T	ENSP00000292035:p.Arg283His	141.0	0.0	0		121.0	9.0	0.0743802	NM_004269	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Missense_Mutation	SNP	ENST00000292035.5	37	CCDS6945.1	.	.	.	.	.	.	.	.	.	.	C	33	5.219164	0.95104	.	.	ENSG00000160563	ENST00000292035;ENST00000357028;ENST00000372184	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.78572	0.4304	M	0.73598	2.24	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.96	T	0.80600	-0.1310	9	0.62326	D	0.03	0.0762	16.105	0.81213	0.0:1.0:0.0:0.0	.	247;283	Q6P2C8-2;Q6P2C8	.;MED27_HUMAN	H	283;209;247	.	ENSP00000292035:R283H	R	-	2	0	MED27	133725834	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.611000	0.82962	2.472000	0.83506	0.655000	0.94253	CGC	.	.	none		0.562	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
ABLIM1	3983	hgsc.bcm.edu	37	10	116331143	116331143	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr10:116331143G>A	ENST00000277895.5	-	4	683	c.586C>T	c.(586-588)Cga>Tga	p.R196*	ABLIM1_ENST00000533213.2_Nonsense_Mutation_p.R136*|ABLIM1_ENST00000369252.4_Nonsense_Mutation_p.R136*	NM_002313.5	NP_002304.3	O14639	ABLM1_HUMAN	actin binding LIM protein 1	196	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				axon guidance (GO:0007411)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	30		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		AATGTGACTCGGTCTCCGGGT	0.537																																					p.R196X		Atlas-SNP	.											.	ABLIM1	131	.	0			c.C586T						PASS	.						121.0	118.0	119.0					10																	116331143		2203	4300	6503	SO:0001587	stop_gained	3983	exon4			TGACTCGGTCTCC	AF005654	CCDS7590.1, CCDS31289.1	10q25	2008-07-07		2002-09-13	ENSG00000099204	ENSG00000099204			78	protein-coding gene	gene with protein product		602330		LIMAB1, ABLIM		9245787	Standard	NM_002313		Approved	abLIM, limatin	uc021pyw.1	O14639	OTTHUMG00000019088	ENST00000277895.5:c.586C>T	10.37:g.116331143G>A	ENSP00000277895:p.Arg196*	85.0	0.0	0		106.0	52.0	0.490566	NM_002313	A6NI16|A6NJ06|A8MXA9|B3KVH2|Q15039|Q5JVV1|Q5JVV2|Q5T6N2|Q5T6N3|Q5T6N5|Q68CQ9|Q9BUP1	Nonsense_Mutation	SNP	ENST00000277895.5	37	CCDS7590.1	.	.	.	.	.	.	.	.	.	.	G	39	7.324017	0.98210	.	.	ENSG00000099204	ENST00000336585;ENST00000369252;ENST00000369267;ENST00000533213;ENST00000369262;ENST00000369263;ENST00000369256;ENST00000369260;ENST00000277895	.	.	.	5.97	5.02	0.67125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8323	0.63389	0.0:0.0:0.7325:0.2675	.	.	.	.	X	196;136;136;136;196;120;120;120;196	.	ENSP00000277895:R196X	R	-	1	2	ABLIM1	116321133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.205000	0.58466	2.836000	0.97738	0.655000	0.94253	CGA	.	.	none		0.537	ABLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050469.3		
WIPI1	55062	hgsc.bcm.edu	37	17	66449072	66449072	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:66449072G>A	ENST00000262139.5	-	2	141	c.142C>T	c.(142-144)Ctg>Ttg	p.L48L	WIPI1_ENST00000546360.1_Intron|WIPI1_ENST00000589459.1_Intron	NM_017983.5	NP_060453.3	Q5MNZ9	WIPI1_HUMAN	WD repeat domain, phosphoinositide interacting 1	48					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|autophagy (GO:0006914)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	autophagic vacuole membrane (GO:0000421)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|pre-autophagosomal structure (GO:0000407)|pre-autophagosomal structure membrane (GO:0034045)|trans-Golgi network (GO:0005802)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	18						ACTTGATCCAGCTGCTCCACA	0.502																																					p.L48L		Atlas-SNP	.											.	WIPI1	46	.	0			c.C142T						PASS	.						121.0	106.0	111.0					17																	66449072		2203	4300	6503	SO:0001819	synonymous_variant	55062	exon2			GATCCAGCTGCTC		CCDS11677.1	17q24.2	2014-02-12				ENSG00000070540		"""WD repeat domain containing"""	25471	protein-coding gene	gene with protein product		609224				15020712, 15602573	Standard	NM_017983		Approved	FLJ10055, WIPI49, Atg18, ATG18A	uc010dey.3	Q5MNZ9		ENST00000262139.5:c.142C>T	17.37:g.66449072G>A		66.0	0.0	0		68.0	4.0	0.0588235	NM_017983	Q8IXM5|Q9NWF8	Silent	SNP	ENST00000262139.5	37	CCDS11677.1																																																																																			.	.	none		0.502	WIPI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448739.1	NM_017983	
TM9SF2	9375	hgsc.bcm.edu	37	13	100204538	100204538	+	Silent	SNP	G	G	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr13:100204538G>C	ENST00000376387.4	+	13	1636	c.1446G>C	c.(1444-1446)gtG>gtC	p.V482V		NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	482					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					GCATATCTGTGCCTCTGACGT	0.388																																					p.V482V		Atlas-SNP	.											.	TM9SF2	52	.	0			c.G1446C						PASS	.						213.0	195.0	201.0					13																	100204538		2203	4300	6503	SO:0001819	synonymous_variant	9375	exon13			ATCTGTGCCTCTG	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.1446G>C	13.37:g.100204538G>C		177.0	0.0	0		234.0	25.0	0.106838	NM_004800	A8K399|Q2TAY5	Silent	SNP	ENST00000376387.4	37	CCDS9493.1																																																																																			.	.	none		0.388	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		
NEK1	4750	hgsc.bcm.edu	37	4	170400567	170400567	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr4:170400567T>A	ENST00000439128.2	-	22	2682	c.2042A>T	c.(2041-2043)aAa>aTa	p.K681I	NEK1_ENST00000507142.1_Missense_Mutation_p.K709I|NEK1_ENST00000512193.1_Missense_Mutation_p.K612I|NEK1_ENST00000510533.1_Missense_Mutation_p.K637I|NEK1_ENST00000511633.1_Missense_Mutation_p.K665I	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	681					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		GCCAACTTCTTTCAAAGCTGA	0.353																																					p.K709I		Atlas-SNP	.											.	NEK1	203	.	0			c.A2126T						PASS	.						75.0	73.0	74.0					4																	170400567		1843	4074	5917	SO:0001583	missense	4750	exon24			ACTTCTTTCAAAG	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.2042A>T	4.37:g.170400567T>A	ENSP00000408020:p.Lys681Ile	152.0	0.0	0		109.0	92.0	0.844037	NM_001199397	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	ENST00000439128.2	37	CCDS47162.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.970361	0.74246	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.74842	-0.88;-0.81;-0.81;-0.8;-0.83	4.74	4.74	0.60224	.	0.191168	0.36482	N	0.002565	D	0.82802	0.5116	M	0.64997	1.995	0.46078	D	0.998856	D;D;D;D;D	0.63880	0.993;0.993;0.993;0.993;0.987	D;P;D;P;P	0.68353	0.957;0.898;0.957;0.898;0.907	D	0.84491	0.0611	10	0.66056	D	0.02	.	12.9491	0.58389	0.0:0.0:0.0:1.0	.	612;665;709;637;681	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	I	681;665;637;709;612	ENSP00000408020:K681I;ENSP00000423332:K665I;ENSP00000427653:K637I;ENSP00000424757:K709I;ENSP00000424938:K612I	ENSP00000408020:K681I	K	-	2	0	NEK1	170637142	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.033000	0.49743	1.988000	0.58038	0.397000	0.26171	AAA	.	.	none		0.353	NEK1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363157.3		
KMT2A	4297	hgsc.bcm.edu	37	11	118371761	118371761	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:118371761A>G	ENST00000389506.5	+	25	6209	c.6209A>G	c.(6208-6210)aAg>aGg	p.K2070R	KMT2A_ENST00000354520.4_Missense_Mutation_p.K2032R|KMT2A_ENST00000534358.1_Missense_Mutation_p.K2073R			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2070	FYR N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00875}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TATACATGCAAGATAGTGGAG	0.468																																					p.K2073R		Atlas-SNP	.											.	MLL	548	.	0			c.A6218G						PASS	.						150.0	118.0	129.0					11																	118371761		2200	4296	6496	SO:0001583	missense	4297	exon25			CATGCAAGATAGT	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6209A>G	11.37:g.118371761A>G	ENSP00000374157:p.Lys2070Arg	112.0	0.0	0		121.0	25.0	0.206612	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485424	0.63962	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	T;T;T	0.77358	-1.09;-1.09;-1.09	5.83	5.83	0.93111	FY-rich, N-terminal (1);FY-rich, N-terminal subgroup (1);	0.047613	0.85682	D	0.000000	T	0.56124	0.1964	N	0.02842	-0.48	0.53005	D	0.999968	B;B	0.30326	0.276;0.219	B;B	0.35278	0.199;0.138	T	0.60383	-0.7274	10	0.02654	T	1	.	16.2011	0.82078	1.0:0.0:0.0:0.0	.	2073;2070	E9PQG7;Q03164	.;MLL1_HUMAN	R	2073;2070;2032;980	ENSP00000436786:K2073R;ENSP00000374157:K2070R;ENSP00000346516:K2032R	ENSP00000346516:K2032R	K	+	2	0	MLL	117876971	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.135000	0.71696	2.219000	0.72066	0.482000	0.46254	AAG	.	.	none		0.468	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
CNNM3	26505	hgsc.bcm.edu	37	2	97483238	97483238	+	Splice_Site	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr2:97483238A>G	ENST00000305510.3	+	1	1252	c.1224A>G	c.(1222-1224)cgA>cgG	p.R408R	CNNM3_ENST00000377060.3_Splice_Site_p.R408R	NM_017623.4	NP_060093.3	Q8NE01	CNNM3_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 3	408	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)	p.R408R(1)		NS(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)|skin(1)|urinary_tract(2)	13						AATTCAAGCGAGGTAACGGCC	0.602																																					p.R408R		Atlas-SNP	.											CNNM3,NS,carcinoma,0,1	CNNM3	33	1	1	Substitution - coding silent(1)	kidney(1)	c.A1224G						scavenged	.						103.0	99.0	100.0					2																	97483238		2203	4300	6503	SO:0001630	splice_region_variant	26505	exon1			CAAGCGAGGTAAC	AF216965	CCDS2025.1, CCDS2026.1	2q11.2	2014-08-08	2014-08-07		ENSG00000168763	ENSG00000168763			104	protein-coding gene	gene with protein product		607804	"""cyclin M3"""	ACDP3		21393841, 24632616	Standard	XM_005263917		Approved		uc002swy.3	Q8NE01	OTTHUMG00000130531	ENST00000305510.3:c.1225+1A>G	2.37:g.97483238A>G		70.0	1.0	0.0142857		66.0	3.0	0.0454545	NM_199078	B3KX67|Q8TBV4|Q96IW4|Q9NRK4|Q9NXW6	Silent	SNP	ENST00000305510.3	37	CCDS2025.1																																																																																			.	.	none		0.602	CNNM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252952.2	NM_017623	Silent
C21orf2	755	hgsc.bcm.edu	37	21	45753051	45753051	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr21:45753051G>A	ENST00000339818.4	-	4	445	c.238C>T	c.(238-240)Ctc>Ttc	p.L80F	C21orf2_ENST00000325223.7_Missense_Mutation_p.L80F|C21orf2_ENST00000397956.3_Missense_Mutation_p.L80F|C21orf2_ENST00000496321.1_5'UTR|AP001062.7_ENST00000448927.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2	80					cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		AGGTAGAAGAGCTCAGCCAGG	0.677																																					p.L80F		Atlas-SNP	.											.	C21orf2	10	.	0			c.C238T						PASS	.						23.0	24.0	24.0					21																	45753051		2202	4300	6502	SO:0001583	missense	755	exon4			AGAAGAGCTCAGC	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.238C>T	21.37:g.45753051G>A	ENSP00000344566:p.Leu80Phe	100.0	0.0	0		129.0	56.0	0.434109	NM_004928	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Missense_Mutation	SNP	ENST00000339818.4	37	CCDS13709.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.041713	0.93685	.	.	ENSG00000160226	ENST00000339818;ENST00000380160;ENST00000397956;ENST00000325223	T;T;T	0.25085	1.82;1.82;1.82	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.60470	0.2271	M	0.92317	3.295	0.80722	D	1	D;D;D;D	0.89917	1.0;0.988;1.0;1.0	D;P;D;D	0.97110	0.999;0.908;1.0;0.999	T	0.69483	-0.5133	10	0.54805	T	0.06	-34.0877	15.5737	0.76359	0.0:0.0:1.0:0.0	.	80;80;80;39	G5E952;Q8N5X6;O43822;O43822-2	.;.;CU002_HUMAN;.	F	80;116;80;80	ENSP00000344566:L80F;ENSP00000381047:L80F;ENSP00000317302:L80F	ENSP00000317302:L80F	L	-	1	0	C21orf2	44577479	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.037000	0.93765	2.482000	0.83794	0.655000	0.94253	CTC	.	.	none		0.677	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230278	23230278	+	Silent	SNP	G	G	A	rs544778929	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr22:23230278G>A	ENST00000526893.1	+	1	319	c.45G>A	c.(43-45)gaG>gaA	p.E15E	IGLL5_ENST00000531372.1_Silent_p.E15E|IGLL5_ENST00000532223.2_Silent_p.E15E|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	15						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCCCTGAGGAGCTGGGCCCTG	0.672													G|||	6	0.00119808	0.0023	0.0029	5008	,	,		13267	0.0		0.0	False		,,,				2504	0.001				p.E15E		Atlas-SNP	.											IGLL5,NS,lymphoid_neoplasm,0,1	IGLL5	26	1	0			c.G45A						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			TGAGGAGCTGGGC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.45G>A	22.37:g.23230278G>A		159.0	0.0	0		75.0	65.0	0.866667	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.672	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
RAD51AP1	10635	hgsc.bcm.edu	37	12	4668142	4668142	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr12:4668142A>G	ENST00000352618.4	+	9	1041	c.991A>G	c.(991-993)Aat>Gat	p.N331D	RAD51AP1_ENST00000228843.9_Missense_Mutation_p.N348D|RAD51AP1_ENST00000543041.1_Missense_Mutation_p.N229D|RAD51AP1_ENST00000544931.1_3'UTR|RAD51AP1_ENST00000321524.7_Missense_Mutation_p.N298D	NM_006479.4	NP_006470.1			RAD51 associated protein 1											breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00306)|COAD - Colon adenocarcinoma(12;0.0389)			TTTGCATCCAAATGCCACTAG	0.458																																					p.N348D		Atlas-SNP	.											.	RAD51AP1	30	.	0			c.A1042G						PASS	.						128.0	118.0	121.0					12																	4668142		2203	4300	6503	SO:0001583	missense	10635	exon10			CATCCAAATGCCA	AF006259	CCDS8529.1, CCDS44805.1	12p13.2-p13.1	2004-09-16			ENSG00000111247	ENSG00000111247			16956	protein-coding gene	gene with protein product		603070				9396801	Standard	NM_001130862		Approved	PIR51	uc001qmw.3	Q96B01	OTTHUMG00000168125	ENST00000352618.4:c.991A>G	12.37:g.4668142A>G	ENSP00000309479:p.Asn331Asp	68.0	0.0	0		70.0	29.0	0.414286	NM_001130862		Missense_Mutation	SNP	ENST00000352618.4	37	CCDS8529.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.399685	0.42512	.	.	ENSG00000111247	ENST00000321524;ENST00000543041;ENST00000228843;ENST00000352618	T;T;T;T	0.48201	1.0;1.0;0.82;0.82	4.32	4.32	0.51571	.	0.680081	0.13888	N	0.355802	T	0.42449	0.1203	L	0.58101	1.795	0.30391	N	0.780976	P;B;B;P	0.41848	0.763;0.341;0.341;0.634	B;B;B;B	0.36608	0.229;0.08;0.08;0.178	T	0.52132	-0.8616	10	0.59425	D	0.04	-4.8877	9.7988	0.40751	1.0:0.0:0.0:0.0	.	229;348;348;331	B4DUS5;Q96B01;A8K313;Q96B01-2	.;R51A1_HUMAN;.;.	D	298;229;348;331	ENSP00000323750:N298D;ENSP00000439960:N229D;ENSP00000228843:N348D;ENSP00000309479:N331D	ENSP00000228843:N348D	N	+	1	0	RAD51AP1	4538403	0.581000	0.26741	0.803000	0.32268	0.451000	0.32288	1.716000	0.37981	1.809000	0.52856	0.533000	0.62120	AAT	.	.	none		0.458	RAD51AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398293.1	NM_006479	
FANCM	57697	hgsc.bcm.edu	37	14	45624650	45624650	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr14:45624650A>T	ENST00000267430.5	+	8	1469	c.1384A>T	c.(1384-1386)Aag>Tag	p.K462*	FANCM_ENST00000556036.1_Nonsense_Mutation_p.K462*|FANCM_ENST00000542564.2_Nonsense_Mutation_p.K436*	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	462	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						TGAACACTTCAAGTCATGGAA	0.313								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.K462X		Atlas-SNP	.											.	FANCM	225	.	0			c.A1384T						PASS	.						69.0	73.0	72.0					14																	45624650		2202	4300	6502	SO:0001587	stop_gained	57697	exon8	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CACTTCAAGTCAT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1384A>T	14.37:g.45624650A>T	ENSP00000267430:p.Lys462*	119.0	0.0	0		128.0	40.0	0.3125	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Nonsense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	A	38	6.864036	0.97893	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564;ENST00000556250	.	.	.	5.42	5.42	0.78866	.	0.409870	0.28834	N	0.013998	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7616	0.51908	0.853:0.147:0.0:0.0	.	.	.	.	X	462;462;436;47	.	ENSP00000267430:K462X	K	+	1	0	FANCM	44694400	0.968000	0.33430	0.984000	0.44739	0.854000	0.48673	2.342000	0.43992	2.040000	0.60383	0.460000	0.39030	AAG	.	.	none		0.313	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
CBWD3	445571	hgsc.bcm.edu	37	9	70871857	70871857	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr9:70871857T>A	ENST00000360171.6	+	5	1002	c.451T>A	c.(451-453)Tgg>Agg	p.W151R	CBWD3_ENST00000377342.5_Intron	NM_201453.2	NP_958861.2	Q5JTY5	CBWD3_HUMAN	COBW domain containing 3	151							ATP binding (GO:0005524)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		TTCTATGTTTTGGGTTGATGC	0.269																																					p.W151R		Atlas-SNP	.											.	CBWD3	10	.	0			c.T451A						PASS	.						25.0	31.0	29.0					9																	70871857		2189	4258	6447	SO:0001583	missense	445571	exon5			ATGTTTTGGGTTG	BC069006	CCDS35038.1, CCDS35038.2	9q13	2014-05-06			ENSG00000196873	ENSG00000196873			18519	protein-coding gene	gene with protein product		611080				15233989, 12421752	Standard	XM_005277637		Approved	bA561O23.1	uc004aga.4	Q5JTY5	OTTHUMG00000184383	ENST00000360171.6:c.451T>A	9.37:g.70871857T>A	ENSP00000353295:p.Trp151Arg	399.0	0.0	0		484.0	112.0	0.231405	NM_201453	B4DNG9|Q6VB91	Missense_Mutation	SNP	ENST00000360171.6	37	CCDS35038.1	.	.	.	.	.	.	.	.	.	.	.	17.24	3.338396	0.60963	.	.	ENSG00000196873	ENST00000360171;ENST00000447896;ENST00000455061;ENST00000455820;ENST00000377344	T	0.41065	1.01	3.38	3.38	0.38709	Cobalamin (vitamin B12) biosynthesis CobW-like (1);	0.000000	0.85682	D	0.000000	T	0.61578	0.2358	M	0.75264	2.295	0.80722	D	1	D;P	0.89917	1.0;0.815	D;P	0.87578	0.998;0.733	T	0.65685	-0.6108	10	0.87932	D	0	-30.7068	11.0695	0.47995	0.0:0.0:0.0:1.0	.	151;151	E7ETY5;Q5JTY5	.;CBWD3_HUMAN	R	151;151;151;151;115	ENSP00000353295:W151R	ENSP00000353295:W151R	W	+	1	0	CBWD3	70061677	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.201000	0.77847	1.311000	0.45024	0.254000	0.18369	TGG	.	.	none		0.269	CBWD3-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052526.1	NM_201453	
COL6A1	1291	hgsc.bcm.edu	37	21	47423737	47423737	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr21:47423737G>A	ENST00000361866.3	+	35	3011	c.2897G>A	c.(2896-2898)gGc>gAc	p.G966D	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	966	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CAGCGGGCAGGCATCGAGATC	0.672																																					p.G966D		Atlas-SNP	.											.	COL6A1	101	.	0			c.G2897A						PASS	.						39.0	40.0	39.0					21																	47423737		2200	4298	6498	SO:0001583	missense	1291	exon35			GGGCAGGCATCGA	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2897G>A	21.37:g.47423737G>A	ENSP00000355180:p.Gly966Asp	95.0	0.0	0		88.0	39.0	0.443182	NM_001848	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544844	0.45280	.	.	ENSG00000142156	ENST00000361866	D	0.82803	-1.65	4.83	2.7	0.31948	von Willebrand factor, type A (3);	0.364959	0.27280	N	0.020091	T	0.81351	0.4804	M	0.78049	2.395	0.54753	D	0.999987	B	0.15473	0.013	B	0.20184	0.028	T	0.77035	-0.2737	10	0.44086	T	0.13	-12.9407	10.1343	0.42697	0.1868:0.0:0.8132:0.0	.	966	P12109	CO6A1_HUMAN	D	966	ENSP00000355180:G966D	ENSP00000355180:G966D	G	+	2	0	COL6A1	46248165	0.968000	0.33430	0.912000	0.35992	0.308000	0.27856	1.709000	0.37909	0.771000	0.33359	0.596000	0.82720	GGC	.	.	none		0.672	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
ZFHX4	79776	hgsc.bcm.edu	37	8	77766731	77766731	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr8:77766731A>T	ENST00000521891.2	+	10	8022	c.7574A>T	c.(7573-7575)cAc>cTc	p.H2525L	ZFHX4_ENST00000518282.1_Missense_Mutation_p.H2499L|ZFHX4_ENST00000455469.2_Missense_Mutation_p.H2480L|ZFHX4_ENST00000050961.6_Missense_Mutation_p.H2480L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAATTCCTTCACTCTCCGTTC	0.498										HNSCC(33;0.089)																											p.H2525L		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A7574T						PASS	.						167.0	167.0	167.0					8																	77766731		2038	4213	6251	SO:0001583	missense	79776	exon10			TCCTTCACTCTCC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7574A>T	8.37:g.77766731A>T	ENSP00000430497:p.His2525Leu	81.0	0.0	0		105.0	12.0	0.114286	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	16.66	3.184571	0.57909	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.53857	0.6;0.66;0.63;0.62	4.94	4.94	0.65067	.	0.000000	0.46758	U	0.000276	T	0.65554	0.2702	M	0.71581	2.175	0.80722	D	1	P;P;P	0.52316	0.92;0.896;0.952	P;P;P	0.55999	0.727;0.789;0.789	T	0.66444	-0.5922	10	0.39692	T	0.17	.	14.7648	0.69632	1.0:0.0:0.0:0.0	.	2480;2480;2525	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	L	2525;2509;2480;2480;2499	ENSP00000430497:H2525L;ENSP00000399605:H2480L;ENSP00000050961:H2480L;ENSP00000430848:H2499L	ENSP00000050961:H2480L	H	+	2	0	ZFHX4	77929286	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	9.131000	0.94446	2.077000	0.62373	0.528000	0.53228	CAC	.	.	none		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
CTNND2	1501	hgsc.bcm.edu	37	5	11732341	11732341	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr5:11732341C>A	ENST00000304623.8	-	2	270	c.81G>T	c.(79-81)aaG>aaT	p.K27N	CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.K27N	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	27					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGGAACTCGTCTTCTCTGAGG	0.502																																					p.K27N		Atlas-SNP	.											.	CTNND2	289	.	0			c.G81T						PASS	.						126.0	127.0	126.0					5																	11732341		2203	4300	6503	SO:0001583	missense	1501	exon2			ACTCGTCTTCTCT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.81G>T	5.37:g.11732341C>A	ENSP00000307134:p.Lys27Asn	45.0	0.0	0		58.0	25.0	0.431034	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	7.609	0.674382	0.14841	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000502551;ENST00000508761	T;T	0.76060	-0.94;-0.99	5.8	3.08	0.35506	.	0.000000	0.46758	D	0.000274	T	0.50034	0.1592	N	0.08118	0	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.20874	-1.0262	10	0.12430	T	0.62	-20.7622	10.2002	0.43077	0.0:0.7052:0.0:0.2948	.	27	Q9UQB3	CTND2_HUMAN	N	27;27;13;13	ENSP00000307134:K27N;ENSP00000352661:K27N	ENSP00000307134:K27N	K	-	3	2	CTNND2	11785341	1.000000	0.71417	0.999000	0.59377	0.902000	0.53008	0.865000	0.27940	0.109000	0.17891	-0.829000	0.03081	AAG	.	.	none		0.502	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
DIAPH1	1729	hgsc.bcm.edu	37	5	140953563	140953563	+	Silent	SNP	T	T	A	rs374236039|rs3075570		TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr5:140953563T>A	ENST00000398557.4	-	16	1994	c.1854A>T	c.(1852-1854)ccA>ccT	p.P618P	DIAPH1_ENST00000253811.6_Silent_p.P618P|DIAPH1_ENST00000518047.1_Silent_p.P609P|DIAPH1_ENST00000398566.3_Silent_p.P609P|DIAPH1_ENST00000389054.3_Silent_p.P618P|DIAPH1_ENST00000398562.2_Silent_p.P609P|DIAPH1_ENST00000520569.1_Silent_p.P564P|DIAPH1_ENST00000389057.5_Silent_p.P609P	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	618	FH1.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAAaggaggtggaggaggag	0.577																																					p.P618P		Atlas-SNP	.											DIAPH1,NS,carcinoma,0,1	DIAPH1	64	1	0			c.A1854T						scavenged	.						21.0	21.0	21.0					5																	140953563		1987	4116	6103	SO:0001819	synonymous_variant	1729	exon16			AGGAGGTGGAGGA	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1854A>T	5.37:g.140953563T>A		16.0	1.0	0.0625		35.0	8.0	0.228571	NM_005219	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Silent	SNP	ENST00000398557.4	37	CCDS43374.1																																																																																			.	.	weak		0.577	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_005219	
SLC27A5	10998	hgsc.bcm.edu	37	19	59010920	59010920	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr19:59010920C>T	ENST00000263093.2	-	7	1715	c.1606G>A	c.(1606-1608)Gta>Ata	p.V536I	SLC27A5_ENST00000599700.1_5'Flank|SLC27A5_ENST00000594786.1_5'Flank|SLC27A5_ENST00000601355.1_Missense_Mutation_p.V452I	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	536					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		ATGGCCAGTACGTCCCCGGTG	0.687																																					p.V536I		Atlas-SNP	.											.	SLC27A5	58	.	0			c.G1606A						PASS	.						85.0	78.0	81.0					19																	59010920		2203	4300	6503	SO:0001583	missense	10998	exon7			CCAGTACGTCCCC	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.1606G>A	19.37:g.59010920C>T	ENSP00000263093:p.Val536Ile	64.0	0.0	0		76.0	28.0	0.368421	NM_012254	B3KVP6|B4DPQ1	Missense_Mutation	SNP	ENST00000263093.2	37	CCDS12983.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470540	0.63625	.	.	ENSG00000083807	ENST00000263093	T	0.37915	1.17	5.26	-0.904	0.10530	AMP-dependent synthetase/ligase (1);	0.216318	0.39985	N	0.001207	T	0.19886	0.0478	L	0.35414	1.06	0.26467	N	0.975346	B	0.20780	0.048	B	0.20767	0.031	T	0.10154	-1.0642	10	0.56958	D	0.05	-17.5506	1.7058	0.02881	0.1539:0.3661:0.2999:0.1802	.	536	Q9Y2P5	S27A5_HUMAN	I	536	ENSP00000263093:V536I	ENSP00000263093:V536I	V	-	1	0	SLC27A5	63702732	0.996000	0.38824	0.016000	0.15963	0.983000	0.72400	0.379000	0.20585	0.312000	0.23038	0.462000	0.41574	GTA	.	.	none		0.687	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467060.1	NM_012254	
MTMR1	8776	hgsc.bcm.edu	37	X	149896207	149896207	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chrX:149896207A>C	ENST00000370390.3	+	5	632	c.475A>C	c.(475-477)Aag>Cag	p.K159Q	MTMR1_ENST00000538506.1_Missense_Mutation_p.K46Q|MTMR1_ENST00000445323.2_Missense_Mutation_p.K167Q|MTMR1_ENST00000544228.1_Missense_Mutation_p.K159Q|MTMR1_ENST00000542156.1_Missense_Mutation_p.K159Q|MTMR1_ENST00000451863.2_Missense_Mutation_p.K159Q|MTMR1_ENST00000541925.1_Missense_Mutation_p.K65Q	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	159	GRAM.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CAGAGTGGAGAAGATTGGAGC	0.423																																					p.K159Q		Atlas-SNP	.											.	MTMR1	82	.	0			c.A475C						PASS	.						125.0	108.0	114.0					X																	149896207		2203	4300	6503	SO:0001583	missense	8776	exon5			GTGGAGAAGATTG	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.475A>C	X.37:g.149896207A>C	ENSP00000359417:p.Lys159Gln	196.0	0.0	0		122.0	92.0	0.754098	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	37	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	a	20.2	3.953853	0.73902	.	.	ENSG00000063601	ENST00000541925;ENST00000493995;ENST00000439546;ENST00000429965;ENST00000434699;ENST00000542156;ENST00000370390;ENST00000490316;ENST00000445323;ENST00000544228;ENST00000451863;ENST00000438018;ENST00000436701;ENST00000538506	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72	5.08	5.08	0.68730	GRAM (2);	0.154112	0.56097	D	0.000028	D	0.94275	0.8161	M	0.80847	2.515	0.58432	D	0.999997	P;P;D	0.57899	0.921;0.904;0.981	P;P;P	0.58970	0.849;0.704;0.804	D	0.94951	0.8100	10	0.87932	D	0	.	14.1476	0.65360	1.0:0.0:0.0:0.0	.	159;167;159	Q13613;F8WA39;Q8NEC6	MTMR1_HUMAN;.;.	Q	65;65;65;65;65;159;159;176;167;159;159;123;140;46	ENSP00000441879:K65Q;ENSP00000431992:K65Q;ENSP00000404599:K65Q;ENSP00000390736:K65Q;ENSP00000405946:K65Q;ENSP00000445281:K159Q;ENSP00000359417:K159Q;ENSP00000436957:K176Q;ENSP00000414178:K167Q;ENSP00000440534:K159Q;ENSP00000387446:K159Q;ENSP00000389884:K123Q;ENSP00000414925:K140Q;ENSP00000443444:K46Q	ENSP00000359417:K159Q	K	+	1	0	MTMR1	149646865	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.001000	0.63946	1.787000	0.52448	0.441000	0.28932	AAG	.	.	none		0.423	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	
TDRD6	221400	hgsc.bcm.edu	37	6	46656149	46656149	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:46656149G>A	ENST00000316081.6	+	1	284	c.284G>A	c.(283-285)cGt>cAt	p.R95H	TDRD6_ENST00000544460.1_Missense_Mutation_p.R95H|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	95	Tudor 1. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CAGGAGAGCCGTGTCTTCCTG	0.701																																					p.R95H		Atlas-SNP	.											.	TDRD6	205	.	0			c.G284A						PASS	.						6.0	8.0	7.0					6																	46656149		2017	3951	5968	SO:0001583	missense	221400	exon1			AGAGCCGTGTCTT	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.284G>A	6.37:g.46656149G>A	ENSP00000346065:p.Arg95His	18.0	0.0	0		23.0	12.0	0.521739	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289084	0.59976	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.09723	2.95;2.95	5.31	5.31	0.75309	Maternal tudor protein (1);Tudor domain (1);	0.869952	0.10294	N	0.692000	T	0.19366	0.0465	L	0.56769	1.78	0.29552	N	0.851296	D;D	0.89917	1.0;1.0	D;D	0.76071	0.977;0.987	T	0.02411	-1.1163	10	0.51188	T	0.08	-5.4554	13.8844	0.63699	0.0:0.0:0.8474:0.1525	.	95;95	F5H5M3;O60522	.;TDRD6_HUMAN	H	95	ENSP00000443299:R95H;ENSP00000346065:R95H	ENSP00000346065:R95H	R	+	2	0	TDRD6	46764108	0.940000	0.31905	1.000000	0.80357	0.978000	0.69477	1.391000	0.34475	2.482000	0.83794	0.563000	0.77884	CGT	.	.	none		0.701	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
KIAA1244	57221	hgsc.bcm.edu	37	6	138583857	138583857	+	Missense_Mutation	SNP	G	G	A	rs149573553	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr6:138583857G>A	ENST00000251691.4	+	12	1403	c.1237G>A	c.(1237-1239)Gaa>Aaa	p.E413K		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGGCATGACCGAAGCATGCAT	0.473													G|||	2	0.000399361	0.0	0.0	5008	,	,		23811	0.002		0.0	False		,,,				2504	0.0				p.E413K		Atlas-SNP	.											.	KIAA1244	236	.	0			c.G1237A						PASS	.						110.0	104.0	106.0					6																	138583857		2203	4300	6503	SO:0001583	missense	57221	exon12			ATGACCGAAGCAT	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1237G>A	6.37:g.138583857G>A	ENSP00000251691:p.Glu413Lys	116.0	0.0	0		127.0	49.0	0.385827	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	22.9	4.348964	0.82132	.	.	ENSG00000112379	ENST00000251691	T	0.04275	3.66	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.09468	0.0233	M	0.73962	2.25	0.58432	D	0.999992	D	0.67145	0.996	P	0.50570	0.644	T	0.01178	-1.1427	10	0.72032	D	0.01	-13.0813	18.2897	0.90126	0.0:0.0:1.0:0.0	.	413	Q5TH69	BIG3_HUMAN	K	413	ENSP00000251691:E413K	ENSP00000251691:E413K	E	+	1	0	KIAA1244	138625550	1.000000	0.71417	0.709000	0.30452	0.865000	0.49528	7.342000	0.79310	2.745000	0.94114	0.655000	0.94253	GAA	G|0.999;A|0.001	0.001	strong		0.473	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
MAP2K3	5606	hgsc.bcm.edu	37	17	21208440	21208440	+	Splice_Site	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:21208440G>A	ENST00000342679.4	+	9	1023	c.774G>A	c.(772-774)atG>atA	p.M258I	MAP2K3_ENST00000316920.6_Splice_Site_p.M229I|MAP2K3_ENST00000361818.5_Splice_Site_p.M229I	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	258	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GCATCACCATGGTACTGTGGG	0.612																																					p.M258I		Atlas-SNP	.											.	MAP2K3	135	.	0			c.G774A						PASS	.						113.0	99.0	104.0					17																	21208440		2203	4300	6503	SO:0001630	splice_region_variant	5606	exon9			CACCATGGTACTG	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.774+1G>A	17.37:g.21208440G>A		101.0	0.0	0		124.0	17.0	0.137097	NM_145109	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	CCDS11217.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705218	0.68615	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.62941	-0.01;-0.01	4.97	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37785	0.1016	N	0.01134	-0.995	0.80722	D	1	B	0.32160	0.358	B	0.34242	0.178	T	0.52185	-0.8609	10	0.51188	T	0.08	-50.5579	18.2339	0.89944	0.0:0.0:1.0:0.0	.	258	P46734	MP2K3_HUMAN	I	258;229;229;262	ENSP00000345083:M258I;ENSP00000355081:M229I	ENSP00000319139:M262I	M	+	3	0	MAP2K3	21149033	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	9.690000	0.98676	2.309000	0.77851	0.462000	0.41574	ATG	.	.	none		0.612	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259374.2	NM_145109	Missense_Mutation
UPF3A	65110	hgsc.bcm.edu	37	13	115057219	115057219	+	Silent	SNP	A	A	G			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr13:115057219A>G	ENST00000375299.3	+	7	854	c.798A>G	c.(796-798)aaA>aaG	p.K266K	UPF3A_ENST00000475218.2_3'UTR|UPF3A_ENST00000351487.5_Silent_p.K233K	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	266					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		gcaaaaaaaaagagacagata	0.353																																					p.K266K		Atlas-SNP	.											.	UPF3A	47	.	0			c.A798G						PASS	.						39.0	40.0	40.0					13																	115057219		2201	4289	6490	SO:0001819	synonymous_variant	65110	exon7			AAAAAAAGAGACA	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.798A>G	13.37:g.115057219A>G		67.0	0.0	0		103.0	5.0	0.0485437	NM_023011	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.	.	none		0.353	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
SPTBN2	6712	hgsc.bcm.edu	37	11	66472275	66472275	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:66472275C>T	ENST00000533211.1	-	15	2803	c.2472G>A	c.(2470-2472)caG>caA	p.Q824Q	SPTBN2_ENST00000529997.1_Silent_p.Q824Q|SPTBN2_ENST00000309996.2_Silent_p.Q824Q			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	824					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GCACCCGGCTCTGCACCTCGG	0.716																																					p.Q824Q		Atlas-SNP	.											SPTBN2,right_lower_lobe,carcinoma,0,1	SPTBN2	188	1	0			c.G2472A						scavenged	.						13.0	14.0	14.0					11																	66472275		2184	4272	6456	SO:0001819	synonymous_variant	6712	exon14			CCGGCTCTGCACC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.2472G>A	11.37:g.66472275C>T		11.0	0.0	0		20.0	2.0	0.1	NM_006946	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																			.	.	none		0.716	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
AP5Z1	9907	hgsc.bcm.edu	37	7	4823361	4823361	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr7:4823361C>T	ENST00000348624.4	+	5	647	c.553C>T	c.(553-555)Cgc>Tgc	p.R185C	AP5Z1_ENST00000401897.1_Missense_Mutation_p.R185C	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	185					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CGACTGGCTGCGCTACGCCAG	0.657																																					p.R185C		Atlas-SNP	.											.	.	.	.	0			c.C553T						PASS	.						5.0	8.0	7.0					7																	4823361		1760	3730	5490	SO:0001583	missense	9907	exon5			TGGCTGCGCTACG	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.553C>T	7.37:g.4823361C>T	ENSP00000297562:p.Arg185Cys	101.0	0.0	0		83.0	39.0	0.46988	NM_014855	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029717	0.54790	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.50277	0.76;0.75	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.66973	0.2844	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.71119	-0.4685	10	0.66056	D	0.02	.	11.8038	0.52143	0.1882:0.8118:0.0:0.0	.	185	O43299	K0415_HUMAN	C	185	ENSP00000297562:R185C;ENSP00000384980:R185C	ENSP00000297562:R185C	R	+	1	0	KIAA0415	4789887	0.929000	0.31497	0.969000	0.41365	0.255000	0.26057	1.781000	0.38644	1.983000	0.57843	0.462000	0.41574	CGC	.	.	none		0.657	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
OR4C6	219432	hgsc.bcm.edu	37	11	55433333	55433333	+	Missense_Mutation	SNP	C	C	T	rs140747151	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr11:55433333C>T	ENST00000314259.3	+	1	720	c.691C>T	c.(691-693)Cgg>Tgg	p.R231W		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R231W(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						CTCTAAAGGGCGGCACAAAGC	0.502													c|||	2	0.000399361	0.0	0.0	5008	,	,		18006	0.0		0.002	False		,,,				2504	0.0				p.R231W		Atlas-SNP	.											OR4C6,middle_lobe,carcinoma,0,4	OR4C6	114	4	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C691T						PASS	.	C	TRP/ARG	0,4400		0,0,2200	132.0	126.0	128.0		691	-8.1	0.0	11	dbSNP_134	128	3,8589	3.0+/-9.4	0,3,4293	yes	missense	OR4C6	NM_001004704.1	101	0,3,6493	TT,TC,CC		0.0349,0.0,0.0231	benign	231/310	55433333	3,12989	2200	4296	6496	SO:0001583	missense	219432	exon1			AAAGGGCGGCACA	CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.691C>T	11.37:g.55433333C>T	ENSP00000324769:p.Arg231Trp	109.0	0.0	0		172.0	68.0	0.395349	NM_001004704	B2RP11|Q6IFD2	Missense_Mutation	SNP	ENST00000314259.3	37	CCDS31506.1	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	5.384	0.256036	0.10185	0.0	3.49E-4	ENSG00000181903	ENST00000314259	T	0.00335	8.06	4.07	-8.14	0.01069	GPCR, rhodopsin-like superfamily (1);	0.754623	0.10587	N	0.657205	T	0.00328	0.0010	M	0.87971	2.92	0.09310	N	1	B	0.22146	0.065	B	0.26693	0.072	T	0.27773	-1.0064	10	0.72032	D	0.01	.	6.9124	0.24342	0.6124:0.1383:0.0:0.2493	.	231	Q8NH72	OR4C6_HUMAN	W	231	ENSP00000324769:R231W	ENSP00000324769:R231W	R	+	1	2	OR4C6	55189909	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-4.913000	0.00170	-1.249000	0.02500	0.543000	0.68304	CGG	C|0.999;T|0.001	0.001	strong		0.502	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391504.1	NM_001004704	
HSPA12A	259217	hgsc.bcm.edu	37	10	118464772	118464772	+	Silent	SNP	G	G	A			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr10:118464772G>A	ENST00000369209.3	-	3	248	c.144C>T	c.(142-144)aaC>aaT	p.N48N		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	48						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		GTTCTGAGACGTTGGAGTCAG	0.582																																					p.N48N		Atlas-SNP	.											.	HSPA12A	81	.	0			c.C144T						PASS	.						177.0	188.0	185.0					10																	118464772		2150	4269	6419	SO:0001819	synonymous_variant	259217	exon3			TGAGACGTTGGAG	AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.144C>T	10.37:g.118464772G>A		103.0	0.0	0		119.0	45.0	0.378151	NM_025015		Silent	SNP	ENST00000369209.3	37	CCDS41569.1																																																																																			.	.	none		0.582	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050530.1	NM_025015	
LIMD2	80774	hgsc.bcm.edu	37	17	61776164	61776164	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr17:61776164C>T	ENST00000259006.3	-	4	377	c.219G>A	c.(217-219)aaG>aaA	p.K73K	LIMD2_ENST00000578061.1_Silent_p.K73K|LIMD2_ENST00000578402.1_Silent_p.K73K|LIMD2_ENST00000578993.1_Silent_p.K33K|LIMD2_ENST00000582055.1_Silent_p.K24K|LIMD2_ENST00000583211.1_Silent_p.K24K	NM_030576.3	NP_085053.1	Q9BT23	LIMD2_HUMAN	LIM domain containing 2	73	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			kidney(1)|lung(2)	3						CGCACCTGAGCTTGGTGTGAC	0.657																																					p.K73K		Atlas-SNP	.											.	LIMD2	6	.	0			c.G219A						PASS	.						44.0	44.0	44.0					17																	61776164		2203	4300	6503	SO:0001819	synonymous_variant	80774	exon4			CCTGAGCTTGGTG	AK092301	CCDS11641.1	17q23.3	2006-02-03				ENSG00000136490			28142	protein-coding gene	gene with protein product						12477932	Standard	NM_030576		Approved	MGC10986	uc002jbj.4	Q9BT23		ENST00000259006.3:c.219G>A	17.37:g.61776164C>T		93.0	0.0	0		91.0	39.0	0.428571	NM_030576	D3DU16|Q96S91	Silent	SNP	ENST00000259006.3	37	CCDS11641.1																																																																																			.	.	none		0.657	LIMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443877.1	NM_030576	
TAS1R2	80834	hgsc.bcm.edu	37	1	19175988	19175988	+	Silent	SNP	G	G	A	rs146531311	byFrequency	TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr1:19175988G>A	ENST00000375371.3	-	4	1335	c.1314C>T	c.(1312-1314)ttC>ttT	p.F438F	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	438					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CTTGCGGGTCGAAGAAGATTT	0.582																																					p.F438F		Atlas-SNP	.											TAS1R2,NS,carcinoma,0,1	TAS1R2	134	1	0			c.C1314T						PASS	.	A		0,4406		0,0,2203	75.0	68.0	70.0		1314	-5.2	0.0	1	dbSNP_134	70	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	TAS1R2	NM_152232.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		438/840	19175988	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	80834	exon4			CGGGTCGAAGAAG		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1314C>T	1.37:g.19175988G>A		113.0	0.0	0		125.0	54.0	0.432	NM_152232	Q5TZ19	Silent	SNP	ENST00000375371.3	37	CCDS187.1																																																																																			G|1.000;A|0.000	0.000	strong		0.582	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000006953.1		
UFSP2	55325	hgsc.bcm.edu	37	4	186329507	186329507	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr4:186329507C>T	ENST00000264689.6	-	8	1030	c.914G>A	c.(913-915)cGa>cAa	p.R305Q		NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	305						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		CTGCAGAGATCGATAAGCACA	0.428																																					p.R305Q		Atlas-SNP	.											.	UFSP2	33	.	0			c.G914A						PASS	.						132.0	117.0	122.0					4																	186329507		2203	4300	6503	SO:0001583	missense	55325	exon8			AGAGATCGATAAG	AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.914G>A	4.37:g.186329507C>T	ENSP00000264689:p.Arg305Gln	127.0	0.0	0		73.0	4.0	0.0547945	NM_018359	Q6IA77|Q96FS3	Missense_Mutation	SNP	ENST00000264689.6	37	CCDS3842.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.235189|5.235189	0.95207|0.95207	.|.	.|.	ENSG00000109775|ENSG00000109775	ENST00000509180|ENST00000264689	.|T	.|0.41400	.|1.0	6.03|6.03	6.03|6.03	0.97812|0.97812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79287|0.79287	0.4420|0.4420	H|H	0.97611|0.97611	4.04|4.04	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.85593|0.85593	0.1247|0.1247	5|10	.|0.87932	.|D	.|0	-8.9285|-8.9285	20.5568|20.5568	0.99304|0.99304	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|305;205	.|Q9NUQ7;B3KRI4	.|UFSP2_HUMAN;.	N|Q	34|305	.|ENSP00000264689:R305Q	.|ENSP00000264689:R305Q	D|R	-|-	1|2	0|0	UFSP2|UFSP2	186566501|186566501	1.000000|1.000000	0.71417|0.71417	0.041000|0.041000	0.18516|0.18516	0.712000|0.712000	0.41017|0.41017	7.478000|7.478000	0.81082|0.81082	2.861000|2.861000	0.98227|0.98227	0.655000|0.655000	0.94253|0.94253	GAT|CGA	.	.	none		0.428	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360589.2	NM_018359	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230380	23230380	+	Silent	SNP	C	C	T			TCGA-FF-8047-01A-11D-2210-10	TCGA-FF-8047-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	1b1780d5-06da-40ee-9e15-02631a68027b	07c3103c-94ed-4fee-968d-318721aa84a9	g.chr22:23230380C>T	ENST00000526893.1	+	1	421	c.147C>T	c.(145-147)gaC>gaT	p.D49D	IGLL5_ENST00000531372.1_Silent_p.D49D|IGLL5_ENST00000532223.2_Silent_p.D49D|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	49						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						AAAGCGGGGACCCAGACCCTG	0.682																																					p.T14I		Atlas-SNP	.											.	IGLL5	26	.	0			c.C41T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			CGGGGACCCAGAC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.147C>T	22.37:g.23230380C>T		123.0	0.0	0		63.0	50.0	0.793651	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.682	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
