#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Confidence	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_NVarRat	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_TVarRat	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP_AF	i_dbSNP_PopFreq	i_dbSNP_Strength	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TET2	54790	hgsc.bcm.edu	37	4	106182925	106182925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:106182925delC	ENST00000540549.1	+	8	4824	c.3964delC	c.(3964-3966)ctgfs	p.L1322fs	TET2_ENST00000380013.4_Frame_Shift_Del_p.L1322fs|TET2_ENST00000513237.1_Frame_Shift_Del_p.L1343fs|TET2_ENST00000545826.1_3'UTR			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1322					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		GGAAGAGAAACTGGAGTCTCA	0.313			"""Mis N, F"""		MDS																																p.K1321fs		Pindel,Atlas-Indel	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	0			c.3963delA						PASS	.						87.0	74.0	78.0					4																	106182925		692	1588	2280	SO:0001589	frameshift_variant	54790	exon8			.	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3964delC	4.37:g.106182925delC	ENSP00000442788:p.Leu1322fs	229.0	0.0	.		251.0	39.0	0.155	NM_001127208	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	ENST00000540549.1	37	CCDS47120.1																																																																																			.	.	none		0.313	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
PRRC2C	23215	hgsc.bcm.edu	37	1	171557627	171557628	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:171557627_171557628delAC	ENST00000338920.4	+	33	8413_8414	c.8176_8177delAC	c.(8176-8178)acafs	p.T2726fs	PRRC2C_ENST00000426496.2_Frame_Shift_Del_p.T2661fs|PRRC2C_ENST00000392078.3_Frame_Shift_Del_p.T2728fs|PRRC2C_ENST00000367742.3_Frame_Shift_Del_p.T2728fs	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	2726					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										ACCATTTCCTACACAGTTTGCA	0.396																																					p.2725_2726del		Atlas-Indel	.											BAT2D1_ENST00000392078,NS,carcinoma,+2,2	.	.	2	0			c.8175_8176del						PASS	.																																			SO:0001589	frameshift_variant	23215	exon33			.	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.8176_8177delAC	1.37:g.171557629_171557630delAC	ENSP00000343629:p.Thr2726fs	104.0	0.0	0		118.0	20.0	0.169492	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Frame_Shift_Del	DEL	ENST00000338920.4	37	CCDS1296.2																																																																																			.	.	none		0.396	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
ARHGEF26	26084	hgsc.bcm.edu	37	3	153842198	153842199	+	Splice_Site	INS	-	-	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:153842198_153842199insA	ENST00000356448.4	+	3	1367_1368		c.e3-1		ARHGEF26_ENST00000465093.1_Splice_Site|ARHGEF26_ENST00000465817.1_Splice_Site	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26						endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						ttGTCTCTTAGAAAAAAATGCT	0.267																																					.	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	Atlas-Indel	.											.	ARHGEF26	158	.	0			c.1084-1->A						PASS	.																																			SO:0001630	splice_region_variant	26084	exon3			.	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.1084-1->A	3.37:g.153842205_153842205dupA		23.0	0.0	0		31.0	10.0	0.322581	NM_001251962	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Splice_Site	INS	ENST00000356448.4	37	CCDS46938.1																																																																																			.	.	none		0.267	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	Intron
EPB41L4A	64097	hgsc.bcm.edu	37	5	111500817	111500818	+	Splice_Site	INS	-	-	AAAAT	rs369027426		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:111500817_111500818insAAAAT	ENST00000261486.5	-	23	2209		c.e23-2		EPB41L4A-AS1_ENST00000413221.2_lincRNA|EPB41L4A_ENST00000507810.1_Intron	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		ATTTCTTCTCTAAAATATATTT	0.312																																					.		Atlas-Indel	.											.	EPB41L4A	130	.	0			c.1933-2->ATTTT						PASS	.																																			SO:0001630	splice_region_variant	64097	exon24			.	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1933-2->ATTTT	5.37:g.111500818_111500822dupAAAAT		83.0	0.0	0		130.0	11.0	0.0846154	NM_022140	A4FUI6	Splice_Site	INS	ENST00000261486.5	37	CCDS43350.1																																																																																			.	.	alt		0.312	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		Intron
MUSK	4593	hgsc.bcm.edu	37	9	113496632	113496632	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:113496632delA	ENST00000374448.4	+	6	864	c.730delA	c.(730-732)accfs	p.T244fs	MUSK_ENST00000416899.2_Frame_Shift_Del_p.T244fs|MUSK_ENST00000189978.5_Frame_Shift_Del_p.T244fs	NM_001166281.1|NM_005592.3	NP_001159753.1|NP_005583.1	O15146	MUSK_HUMAN	muscle, skeletal, receptor tyrosine kinase	244	Ig-like 3.				cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|neuromuscular junction development (GO:0007528)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein geranylgeranylation (GO:2000541)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(23)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	49						CCCCACCATCACCTGGATTGA	0.507																																					p.I253fs		Pindel,Atlas-Indel	.											.	MUSK	112	.	0			c.759delC						PASS	.						140.0	128.0	132.0					9																	113496632		2052	4215	6267	SO:0001589	frameshift_variant	4593	exon7			.	AF006464	CCDS48005.1, CCDS75874.1	9q31.3-q32	2013-01-29			ENSG00000030304	ENSG00000030304		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7525	protein-coding gene	gene with protein product		601296				7546737	Standard	NM_005592		Approved		uc022blv.1	O15146	OTTHUMG00000020485	ENST00000374448.4:c.730delA	9.37:g.113496632delA	ENSP00000363571:p.Thr244fs	98.0	0.0	.		105.0	17.0	0.162	NM_001166280	Q32MJ8|Q32MJ9|Q5VZW7|Q5VZW8	Frame_Shift_Del	DEL	ENST00000374448.4	37	CCDS48005.1																																																																																			.	.	none		0.507	MUSK-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
OR5AK2	390181	hgsc.bcm.edu	37	11	56756917	56756917	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:56756917delT	ENST00000326855.2	+	1	571	c.529delT	c.(529-531)tttfs	p.F178fs		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						CATCAATCACTTTTTCTGTGA	0.398																																					p.H176fs		Atlas-Indel	.											.	OR5AK2	45	.	0			c.528delC						PASS	.						346.0	311.0	323.0					11																	56756917		2201	4296	6497	SO:0001589	frameshift_variant	390181	exon1			.	AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.529delT	11.37:g.56756917delT	ENSP00000322784:p.Phe178fs	250.0	0.0	0		294.0	47.0	0.159864	NM_001005323	B2RNZ9	Frame_Shift_Del	DEL	ENST00000326855.2	37	CCDS31538.1																																																																																			.	.	none		0.398	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392446.1	NM_001005323	
RBM14	10432	hgsc.bcm.edu	37	11	66392639	66392640	+	In_Frame_Ins	INS	-	-	CTA			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:66392639_66392640insCTA	ENST00000310137.4	+	2	1431_1432	c.1292_1293insCTA	c.(1291-1296)gcctat>gcCTActat	p.432_433insY	RBM14-RBM4_ENST00000511114.1_Intron|RBM14_ENST00000409738.4_Intron|RBM4_ENST00000503028.2_Intron|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Intron|RBM14-RBM4_ENST00000412278.2_Intron|RBM14_ENST00000393979.3_Intron	NM_006328.3	NP_006319.1	Q96PK6	RBM14_HUMAN	RNA binding motif protein 14	432	Ala-rich.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|glucocorticoid receptor signaling pathway (GO:0042921)|histone deacetylation (GO:0016575)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to hormone (GO:0009725)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)		RBM14/PACS1(2)	breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17						CAACCTGCTGCCTATGTGGCAC	0.614																																					p.A431delinsAY		Pindel,Atlas-Indel	.											.	RBM14	59	.	0			c.1292_1293insCTA						PASS	.																																			SO:0001652	inframe_insertion	10432	exon2			.	AF080561	CCDS8147.1, CCDS55772.1, CCDS55773.1	11q13.2	2013-02-12			ENSG00000239306	ENSG00000239306		"""RNA binding motif (RRM) containing"""	14219	protein-coding gene	gene with protein product	"""coactivator activator"", ""SYT interacting protein"""	612409				9285794	Standard	NM_006328		Approved	SIP, SYTIP1, COAA, DKFZp779J0927	uc001oit.3	Q96PK6	OTTHUMG00000140380	ENST00000310137.4:c.1293_1295dupCTA	11.37:g.66392640_66392642dupCTA	ENSP00000311747:p.Tyr432_Tyr432dup	80.0	0.0	.		70.0	12.0	0.171	NM_006328	B0LM41|B3KMN4|D6RGD8|O75932|Q2PYN1|Q53GV1|Q68DQ9|Q96PK5	In_Frame_Ins	INS	ENST00000310137.4	37	CCDS8147.1																																																																																			.	.	none		0.614	RBM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277128.1	NM_006328	
TET2	54790	hgsc.bcm.edu	37	4	106158250	106158259	+	Frame_Shift_Del	DEL	CAGAAGCAAG	CAGAAGCAAG	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	CAGAAGCAAG	CAGAAGCAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:106158250_106158259delCAGAAGCAAG	ENST00000540549.1	+	3	4011_4020	c.3151_3160delCAGAAGCAAG	c.(3151-3162)cagaagcaagtafs	p.QKQV1051fs	TET2_ENST00000380013.4_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000513237.1_Frame_Shift_Del_p.QKQV1072fs|TET2_ENST00000413648.2_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000545826.1_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000394764.1_Frame_Shift_Del_p.QKQV1051fs|TET2_ENST00000305737.2_Frame_Shift_Del_p.QKQV1051fs			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	1051					5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)	p.Q1053*(2)|p.Q1051*(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCTCAAATCACAGAAGCAAGTAAAAGTTGA	0.443			"""Mis N, F"""		MDS																																p.1050_1053del		Pindel,Atlas-Indel	.		Rec	yes		4	4q24	54790	tet oncogene family member 2		L	.	TET2	1762	.	3	Substitution - Nonsense(3)	haematopoietic_and_lymphoid_tissue(3)	c.3150_3159del						PASS	.																																			SO:0001589	frameshift_variant	54790	exon3			.	AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.3151_3160delCAGAAGCAAG	4.37:g.106158250_106158259delCAGAAGCAAG	ENSP00000442788:p.Gln1051fs	86.0	0.0	.		133.0	23.0	0.173	NM_017628	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Frame_Shift_Del	DEL	ENST00000540549.1	37	CCDS47120.1																																																																																			.	.	none		0.443	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253952.2	NM_017628	
PCLO	27445	hgsc.bcm.edu	37	7	82595469	82595469	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:82595469delT	ENST00000333891.9	-	4	3972	c.3635delA	c.(3634-3636)aagfs	p.K1212fs	PCLO_ENST00000423517.2_Frame_Shift_Del_p.K1212fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGGGAGTGGCTTTTTTTCTTG	0.368																																					p.K1212fs		Pindel,Atlas-Indel	.											.	PCLO	1506	.	0			c.3636delG						PASS	.						164.0	155.0	158.0					7																	82595469		1796	4076	5872	SO:0001589	frameshift_variant	27445	exon4			.	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3635delA	7.37:g.82595469delT	ENSP00000334319:p.Lys1212fs	189.0	0.0	.		259.0	39.0	0.151	NM_014510		Frame_Shift_Del	DEL	ENST00000333891.9	37	CCDS47630.1																																																																																			.	.	none		0.368	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
BTBD7	55727	hgsc.bcm.edu	37	14	93709220	93709221	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:93709220_93709221insT	ENST00000334746.5	-	11	3104_3105	c.2797_2798insA	c.(2797-2799)acafs	p.T933fs	BTBD7_ENST00000554565.1_Frame_Shift_Ins_p.T582fs|BTBD7_ENST00000393170.2_Frame_Shift_Ins_p.T507fs	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	933					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		TCTGGTGTCTGTTTTTTGCTCT	0.485																																					p.T933fs		Pindel,Atlas-Indel	.											.	BTBD7	112	.	0			c.2798_2799insA						PASS	.																																			SO:0001589	frameshift_variant	55727	exon11			.	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.2798dupA	14.37:g.93709226_93709226dupT	ENSP00000335615:p.Thr933fs	279.0	0.0	.		367.0	68.0	0.185	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Frame_Shift_Ins	INS	ENST00000334746.5	37	CCDS32146.1																																																																																			.	.	none		0.485	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
SYTL2	54843	hgsc.bcm.edu	37	11	85447546	85447546	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:85447546T>C	ENST00000528231.1	-	5	858	c.581A>G	c.(580-582)gAg>gGg	p.E194G	SYTL2_ENST00000316356.4_Missense_Mutation_p.E195G|SYTL2_ENST00000389960.4_Missense_Mutation_p.E194G|SYTL2_ENST00000524452.1_Missense_Mutation_p.E194G|SYTL2_ENST00000527523.1_Missense_Mutation_p.E146G	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	194					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		ATATTTACCCTCTTTTGAAGT	0.328																																					p.E195G		Atlas-SNP	.											.	SYTL2	231	.	0			c.A584G						PASS	.						84.0	84.0	84.0					11																	85447546		2202	4297	6499	SO:0001583	missense	54843	exon5			TTACCCTCTTTTG	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.581A>G	11.37:g.85447546T>C	ENSP00000431701:p.Glu194Gly	73.0	0.0	0		88.0	4.0	0.0454545	NM_001162953	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	37	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	T	16.53	3.147895	0.57151	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.27720	1.73;1.75;1.75;1.65;1.73	5.93	5.93	0.95920	.	.	.	.	.	T	0.37489	0.1005	L	0.54323	1.7	0.80722	D	1	P;P;P;P;P	0.40834	0.73;0.546;0.611;0.546;0.554	P;B;B;B;B	0.45406	0.479;0.208;0.05;0.156;0.299	T	0.07290	-1.0780	8	.	.	.	.	14.6214	0.68588	0.0:0.0:0.0:1.0	.	146;194;194;195;52	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	G	194;195;194;146;194	ENSP00000374610:E194G;ENSP00000318803:E195G;ENSP00000431701:E194G;ENSP00000434010:E146G;ENSP00000435238:E194G	.	E	-	2	0	SYTL2	85125194	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.569000	0.60865	2.271000	0.75665	0.533000	0.62120	GAG	.	.	none		0.328	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
B4GALNT2	124872	hgsc.bcm.edu	37	17	47246178	47246178	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:47246178G>T	ENST00000300404.2	+	10	1470	c.1411G>T	c.(1411-1413)Ggc>Tgc	p.G471C	B4GALNT2_ENST00000393354.2_Missense_Mutation_p.G411C|B4GALNT2_ENST00000504681.1_Missense_Mutation_p.G385C	NM_153446.2	NP_703147.2	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	471					lipid glycosylation (GO:0030259)|negative regulation of cell-cell adhesion (GO:0022408)|protein glycosylation (GO:0006486)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)			endometrium(3)|large_intestine(6)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	24			all cancers(6;0.000316)			GGTGACCAGTGGCGTGGTCAA	0.567																																					p.G471C	GBM(124;244 1635 8663 18097 33175)	Atlas-SNP	.											B4GALNT2,colon,carcinoma,-2,1	B4GALNT2	67	1	0			c.G1411T						PASS	.						81.0	59.0	66.0					17																	47246178		2203	4300	6503	SO:0001583	missense	124872	exon10			ACCAGTGGCGTGG	AJ517770	CCDS11544.1, CCDS54139.1, CCDS54140.1	17q21.33	2013-02-22	2006-01-08	2006-01-08	ENSG00000167080	ENSG00000167080	2.4.1.-	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	24136	protein-coding gene	gene with protein product		111730	"""UDP-GalNAc:Neu5Acalpha2-3Galbeta-R beta1,4-N-acetylgalactosaminyltransferase"""	GALGT2		8782649, 12678917	Standard	NM_153446		Approved	Sda, Cad	uc002ion.2	Q8NHY0	OTTHUMG00000161307	ENST00000300404.2:c.1411G>T	17.37:g.47246178G>T	ENSP00000300404:p.Gly471Cys	99.0	0.0	0		95.0	4.0	0.0421053	NM_153446	B4DZE4|Q14CP1|Q86Y40	Missense_Mutation	SNP	ENST00000300404.2	37	CCDS11544.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716785	0.89205	.	.	ENSG00000167080	ENST00000504681;ENST00000393354;ENST00000300404	T;T;T	0.25749	1.78;1.78;1.78	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000001	T	0.53238	0.1784	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.51756	-0.8665	10	0.38643	T	0.18	-22.868	17.6682	0.88209	0.0:0.0:1.0:0.0	.	411;471	Q8NHY0-2;Q8NHY0	.;B4GN2_HUMAN	C	385;411;471	ENSP00000425510:G385C;ENSP00000377022:G411C;ENSP00000300404:G471C	ENSP00000300404:G471C	G	+	1	0	B4GALNT2	44601177	1.000000	0.71417	0.626000	0.29213	0.892000	0.51952	8.715000	0.91416	2.450000	0.82876	0.561000	0.74099	GGC	.	.	none		0.567	B4GALNT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364477.1	NM_153446	
LMO7	4008	hgsc.bcm.edu	37	13	76415865	76415865	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:76415865C>A	ENST00000321797.8	+	22	3799	c.3078C>A	c.(3076-3078)gaC>gaA	p.D1026E	LMO7_ENST00000357063.3_Missense_Mutation_p.D1311E|LMO7_ENST00000377534.3_Missense_Mutation_p.D1311E|LMO7_ENST00000526202.1_Missense_Mutation_p.D903E|LMO7_ENST00000341547.4_Missense_Mutation_p.D977E|LMO7_ENST00000465261.2_Missense_Mutation_p.D1026E			Q8WWI1	LMO7_HUMAN	LIM domain 7	1311					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGTCTTCAGACAGAGAAGGAA	0.527																																					p.D1026E		Atlas-SNP	.											.	LMO7	334	.	0			c.C3078A						PASS	.						96.0	97.0	96.0					13																	76415865		2203	4300	6503	SO:0001583	missense	4008	exon21			TTCAGACAGAGAA	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.3078C>A	13.37:g.76415865C>A	ENSP00000317802:p.Asp1026Glu	71.0	0.0	0		93.0	30.0	0.322581	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.74|14.74	2.624220|2.624220	0.46840|0.46840	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261|ENST00000447038;ENST00000525914	T;T;T;T;T;T;T|.	0.39997|.	1.65;1.63;1.64;1.06;1.06;1.07;1.05|.	5.95|5.95	4.09|4.09	0.47781|0.47781	.|.	0.607412|.	0.18332|.	N|.	0.144459|.	T|T	0.43389|0.43389	0.1245|0.1245	L|L	0.45581|0.45581	1.43|1.43	0.31577|0.31577	N|N	0.655654|0.655654	B;B;B;B;B|.	0.31318|.	0.06;0.319;0.012;0.06;0.119|.	B;B;B;B;B|.	0.26416|.	0.018;0.069;0.007;0.031;0.052|.	T|T	0.47837|0.47837	-0.9086|-0.9086	10|5	0.14656|.	T|.	0.56|.	-25.6026|-25.6026	4.7211|4.7211	0.12918|0.12918	0.1534:0.6166:0.1482:0.0818|0.1534:0.6166:0.1482:0.0818	.|.	903;977;1311;1026;1259|.	E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5|.	.;.;LMO7_HUMAN;.;.|.	E|K	977;1311;1311;925;1026;903;1026|935;195	ENSP00000342112:D977E;ENSP00000349571:D1311E;ENSP00000366757:D1311E;ENSP00000366719:D925E;ENSP00000317802:D1026E;ENSP00000431129:D903E;ENSP00000433352:D1026E|.	ENSP00000317802:D1026E|.	D|Q	+|+	3|1	2|0	LMO7|LMO7	75313866|75313866	0.914000|0.914000	0.31030|0.31030	0.999000|0.999000	0.59377|0.59377	0.914000|0.914000	0.54420|0.54420	0.510000|0.510000	0.22723|0.22723	2.825000|2.825000	0.97269|0.97269	0.655000|0.655000	0.94253|0.94253	GAC|CAG	.	.	none		0.527	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
ARHGAP22	58504	hgsc.bcm.edu	37	10	49654625	49654625	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr10:49654625A>G	ENST00000249601.4	-	10	2202	c.1906T>C	c.(1906-1908)Tcc>Ccc	p.S636P	ARHGAP22_ENST00000374170.1_Missense_Mutation_p.S477P|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.S652P|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.S642P|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.S527P|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.S546P|ARHGAP22_ENST00000477708.2_Missense_Mutation_p.S469P	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	636					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCTAACCGGGACATTCGTTTT	0.502																																					p.S652P		Atlas-SNP	.											.	ARHGAP22	94	.	0			c.T1954C						PASS	.						126.0	115.0	118.0					10																	49654625		2203	4300	6503	SO:0001583	missense	58504	exon10			ACCGGGACATTCG	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1906T>C	10.37:g.49654625A>G	ENSP00000249601:p.Ser636Pro	269.0	0.0	0		231.0	55.0	0.238095	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	A	10.90	1.482037	0.26598	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	4.42	0.456	0.16655	.	0.502966	0.20316	N	0.094726	T	0.49881	0.1583	L	0.51422	1.61	0.09310	N	0.999995	B;P;P;P;P;D	0.64830	0.337;0.475;0.744;0.475;0.744;0.994	B;B;B;B;B;P	0.59703	0.063;0.099;0.26;0.099;0.134;0.862	T	0.45877	-0.9231	10	0.44086	T	0.13	.	12.1264	0.53919	0.4414:0.5586:0.0:0.0	.	642;636;652;636;546;469	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	P	636;527;477;469;546;642;652	ENSP00000249601:S636P;ENSP00000363287:S527P;ENSP00000363285:S477P;ENSP00000422868:S469P;ENSP00000410054:S546P;ENSP00000416701:S642P;ENSP00000412461:S652P	ENSP00000249601:S636P	S	-	1	0	ARHGAP22	49324631	0.002000	0.14202	0.014000	0.15608	0.008000	0.06430	-0.001000	0.12947	0.080000	0.16959	0.459000	0.35465	TCC	.	.	none		0.502	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
TNF	7124	hgsc.bcm.edu	37	6	31543674	31543674	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31543674C>G	ENST00000449264.2	+	1	331	c.156C>G	c.(154-156)caC>caG	p.H52Q		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	52		Cleavage; by SPPL2A or SPPL2B.			activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	GCCTGCTGCACTTTGGAGTGA	0.627									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.H52Q		Atlas-SNP	.											.	TNF	15	.	0			c.C156G						PASS	.						45.0	45.0	45.0					6																	31543674		2203	4300	6503	SO:0001583	missense	7124	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	GCTGCACTTTGGA	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.156C>G	6.37:g.31543674C>G	ENSP00000398698:p.His52Gln	100.0	0.0	0		78.0	24.0	0.307692	NM_000594	O43647|Q9P1Q2|Q9UIV3	Missense_Mutation	SNP	ENST00000449264.2	37	CCDS4702.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.256573	0.39896	.	.	ENSG00000232810	ENST00000449264	T	0.74737	-0.87	5.77	3.99	0.46301	.	0.294531	0.38058	N	0.001824	T	0.50120	0.1597	L	0.58583	1.82	0.51767	D	0.999937	B	0.18166	0.026	B	0.18871	0.023	T	0.51004	-0.8760	10	0.23302	T	0.38	.	6.9811	0.24704	0.0:0.743:0.0:0.257	.	52	P01375	TNFA_HUMAN	Q	52	ENSP00000398698:H52Q	ENSP00000398698:H52Q	H	+	3	2	TNF	31651653	0.998000	0.40836	1.000000	0.80357	0.943000	0.58893	0.436000	0.21526	1.445000	0.47624	0.655000	0.94253	CAC	.	.	none		0.627	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
COL11A1	1301	hgsc.bcm.edu	37	1	103364535	103364535	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:103364535C>A	ENST00000370096.3	-	55	4414	c.4102G>T	c.(4102-4104)Gca>Tca	p.A1368S	COL11A1_ENST00000358392.2_Missense_Mutation_p.A1380S|COL11A1_ENST00000353414.4_Missense_Mutation_p.A1329S|COL11A1_ENST00000512756.1_Missense_Mutation_p.A1252S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1368	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCTGCACCTGCAGCTCCAGGA	0.274																																					p.A1380S		Atlas-SNP	.											.	COL11A1	972	.	0			c.G4138T						PASS	.						44.0	45.0	44.0					1																	103364535		2201	4298	6499	SO:0001583	missense	1301	exon55			CACCTGCAGCTCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4102G>T	1.37:g.103364535C>A	ENSP00000359114:p.Ala1368Ser	79.0	0.0	0		101.0	46.0	0.455446	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807087	0.31961	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4	6.06	1.46	0.22682	.	0.409732	0.27509	N	0.019059	D	0.84543	0.5495	L	0.43152	1.355	0.24453	N	0.994478	B;B;P;B;B	0.37708	0.043;0.073;0.606;0.0;0.03	B;B;P;B;B	0.49012	0.027;0.059;0.598;0.001;0.037	T	0.77130	-0.2701	10	0.20519	T	0.43	.	4.6044	0.12371	0.1589:0.3328:0.0:0.5083	.	1252;1329;1380;1368;588	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1368;1380;1329;588;1252	ENSP00000359114:A1368S;ENSP00000351163:A1380S;ENSP00000302551:A1329S;ENSP00000426533:A1252S	ENSP00000302551:A1329S	A	-	1	0	COL11A1	103137123	0.906000	0.30813	0.990000	0.47175	0.983000	0.72400	0.385000	0.20685	-0.012000	0.14223	0.650000	0.86243	GCA	.	.	none		0.274	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
ALAS2	212	hgsc.bcm.edu	37	X	55041425	55041425	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:55041425C>T	ENST00000330807.5	-	9	1329	c.1192G>A	c.(1192-1194)Ggc>Agc	p.G398S	ALAS2_ENST00000498636.1_5'UTR|ALAS2_ENST00000396198.3_Missense_Mutation_p.G385S|ALAS2_ENST00000335854.4_Missense_Mutation_p.G361S	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	398					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	GCAATGTAGCCGCCCACACAG	0.532																																					p.G398S		Atlas-SNP	.											.	ALAS2	163	.	0			c.G1192A						PASS	.						32.0	31.0	32.0					X																	55041425		2203	4300	6503	SO:0001583	missense	212	exon9			TGTAGCCGCCCAC		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1192G>A	X.37:g.55041425C>T	ENSP00000332369:p.Gly398Ser	88.0	0.0	0		109.0	17.0	0.155963	NM_000032	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	ENST00000330807.5	37	CCDS14366.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630705	0.87660	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.98684	-5.07;-5.07;-5.07	5.64	5.64	0.86602	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.093208	0.64402	D	0.000001	D	0.99501	0.9822	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.995;0.997	D	0.98150	1.0441	10	0.87932	D	0	-10.8077	17.643	0.88142	0.0:1.0:0.0:0.0	.	361;385;398	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	S	398;385;361	ENSP00000332369:G398S;ENSP00000379501:G385S;ENSP00000337131:G361S	ENSP00000332369:G398S	G	-	1	0	ALAS2	55058150	1.000000	0.71417	0.910000	0.35882	0.622000	0.37654	7.818000	0.86416	2.524000	0.85096	0.600000	0.82982	GGC	.	.	none		0.532	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056843.3	NM_000032	
SGK1	6446	hgsc.bcm.edu	37	6	134493825	134493825	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134493825G>A	ENST00000237305.7	-	7	725	c.637C>T	c.(637-639)Ctg>Ttg	p.L213L	SGK1_ENST00000367858.5_Silent_p.L308L|SGK1_ENST00000475719.2_Silent_p.L169L|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Silent_p.L241L|SGK1_ENST00000367857.5_Silent_p.L203L|SGK1_ENST00000413996.3_Silent_p.L227L	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	213	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		AGTGAATGCAGGTAGCCCAAG	0.502																																					p.L308L		Atlas-SNP	.											SGK1_ENST00000528577,NS,carcinoma,0,5	SGK1	387	5	0			c.C922T						PASS	.						71.0	63.0	66.0					6																	134493825		2203	4300	6503	SO:0001819	synonymous_variant	6446	exon9			AATGCAGGTAGCC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.637C>T	6.37:g.134493825G>A		96.0	0.0	0		108.0	15.0	0.138889	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Silent	SNP	ENST00000237305.7	37	CCDS5170.1																																																																																			.	.	none		0.502	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
TENM1	10178	hgsc.bcm.edu	37	X	123870854	123870854	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:123870854A>G	ENST00000371130.3	-	4	792	c.729T>C	c.(727-729)caT>caC	p.H243H	TENM1_ENST00000422452.2_Silent_p.H243H	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	243	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGTTATGCAGATGGACTGAAT	0.532																																					p.H243H		Atlas-SNP	.											.	.	.	.	0			c.T729C						PASS	.						178.0	161.0	166.0					X																	123870854		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon4			ATGCAGATGGACT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.729T>C	X.37:g.123870854A>G		80.0	0.0	0		86.0	14.0	0.162791	NM_001163278	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	37	CCDS14609.1																																																																																			.	.	none		0.532	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
MSMP	692094	hgsc.bcm.edu	37	9	35753722	35753722	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:35753722A>G	ENST00000436428.2	-	2	313	c.174T>C	c.(172-174)tcT>tcC	p.S58S	RGP1_ENST00000378078.4_3'UTR|MSMP_ENST00000414286.1_5'UTR|RP11-112J3.15_ENST00000425499.2_RNA	NM_001044264.2	NP_001037729.1	Q1L6U9	MSMP_HUMAN	microseminoprotein, prostate associated	58						cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(2)|kidney(1)|lung(3)|prostate(3)	9						TGCGGAGCCAAGACTCACCCA	0.527																																					p.S58S		Atlas-SNP	.											.	MSMP	15	.	0			c.T174C						PASS	.						44.0	46.0	45.0					9																	35753722		2045	4202	6247	SO:0001819	synonymous_variant	692094	exon2			GAGCCAAGACTCA	DQ012170	CCDS43797.1	9p13.3	2012-10-02			ENSG00000215183	ENSG00000215183			29663	protein-coding gene	gene with protein product		612191				17338636	Standard	NM_001044264		Approved	PC-3, PSMP	uc003zyb.2	Q1L6U9	OTTHUMG00000019882	ENST00000436428.2:c.174T>C	9.37:g.35753722A>G		146.0	0.0	0		133.0	34.0	0.255639	NM_001044264		Silent	SNP	ENST00000436428.2	37	CCDS43797.1																																																																																			.	.	none		0.527	MSMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052384.2	NM_001044264	
NLRC3	197358	hgsc.bcm.edu	37	16	3614077	3614077	+	RNA	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:3614077C>T	ENST00000301749.7	-	0	1266				NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CGTTAAAGCCCCGGATCTCCG	0.607																																					p.R287R		Atlas-SNP	.											NLRC3,NS,carcinoma,-2,1	NLRC3	103	1	0			c.G861A						PASS	.						47.0	53.0	51.0					16																	3614077		2025	4166	6191			197358	exon5			AAAGCCCCGGATC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614077C>T		43.0	0.0	0		28.0	11.0	0.392857	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	ENST00000301749.7	37																																																																																				.	.	none		0.607	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
NCOA3	8202	hgsc.bcm.edu	37	20	46279860	46279860	+	Silent	SNP	G	G	A	rs151060280	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:46279860G>A	ENST00000371998.3	+	20	3977	c.3786G>A	c.(3784-3786)caG>caA	p.Q1262Q	NCOA3_ENST00000372004.3_Silent_p.Q1258Q|NCOA3_ENST00000371997.3_Silent_p.Q1253Q|NCOA3_ENST00000341724.6_Silent_p.Q1188Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1262	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q1262Q(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcagcaacagc	0.567																																					p.Q1262Q		Atlas-SNP	.											NCOA3,bladder,carcinoma,0,6	NCOA3	156	6	1	Substitution - coding silent(1)	endometrium(1)	c.G3786A						PASS	.	G	,,,	10,4396	11.4+/-27.6	1,8,2194	53.0	58.0	56.0		3783,3759,3774,3786	-0.1	0.1	20	dbSNP_134	56	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NCOA3	NM_001174087.1,NM_001174088.1,NM_006534.3,NM_181659.2	,,,	1,20,6482	AA,AG,GG		0.1395,0.227,0.1692	,,,	1261/1424,1253/1416,1258/1421,1262/1425	46279860	22,12984	2203	4300	6503	SO:0001819	synonymous_variant	8202	exon20			GCAGCAGCAGCAA	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3786G>A	20.37:g.46279860G>A		77.0	0.0	0		82.0	5.0	0.0609756	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	ENST00000371998.3	37	CCDS13407.1																																																																																			G|0.997;A|0.003	0.003	strong		0.567	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
HECW1	23072	hgsc.bcm.edu	37	7	43283515	43283515	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:43283515A>G	ENST00000395891.2	+	3	616	c.11A>G	c.(10-12)cAc>cGc	p.H4R	AC004692.4_ENST00000458680.1_RNA|AC004692.4_ENST00000458590.1_RNA|AC004692.4_ENST00000457315.1_RNA|HECW1_ENST00000453890.1_Missense_Mutation_p.H4R	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	4					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						ATGCTGCTGCACCTGTGTAGT	0.448																																					p.H4R		Atlas-SNP	.											.	HECW1	540	.	0			c.A11G						PASS	.						235.0	234.0	234.0					7																	43283515		2082	4218	6300	SO:0001583	missense	23072	exon3			TGCTGCACCTGTG	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.11A>G	7.37:g.43283515A>G	ENSP00000379228:p.His4Arg	249.0	0.0	0		222.0	52.0	0.234234	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	A	6.186	0.402502	0.11696	.	.	ENSG00000002746	ENST00000395891;ENST00000453890	T;T	0.34472	1.36;1.36	4.67	4.67	0.58626	.	2.499770	0.02291	U	0.070289	T	0.49983	0.1589	N	0.22421	0.69	0.31746	N	0.635233	D;D	0.57899	0.981;0.981	D;D	0.69824	0.966;0.966	T	0.46133	-0.9213	10	0.20519	T	0.43	.	14.1181	0.65167	1.0:0.0:0.0:0.0	.	4;4	B4DH42;Q76N89	.;HECW1_HUMAN	R	4	ENSP00000379228:H4R;ENSP00000407774:H4R	ENSP00000379228:H4R	H	+	2	0	HECW1	43250040	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.982000	0.76173	1.742000	0.51746	0.460000	0.39030	CAC	.	.	none		0.448	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
GAREM	64762	hgsc.bcm.edu	37	18	29850212	29850212	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:29850212G>A	ENST00000269209.6	-	5	1704	c.1701C>T	c.(1699-1701)acC>acT	p.T567T	GAREM_ENST00000399218.4_Silent_p.T567T			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	567					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										AGTAGGACAAGGTGGGGCTGG	0.557																																					p.T567T		Atlas-SNP	.											.	.	.	.	0			c.C1701T						PASS	.						154.0	129.0	137.0					18																	29850212		2203	4300	6503	SO:0001819	synonymous_variant	64762	exon5			GGACAAGGTGGGG	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1701C>T	18.37:g.29850212G>A		192.0	0.0	0		185.0	53.0	0.286486	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Silent	SNP	ENST00000269209.6	37	CCDS56057.1																																																																																			.	.	none		0.557	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
LACTB	114294	hgsc.bcm.edu	37	15	63433784	63433784	+	Missense_Mutation	SNP	C	C	T	rs556545187		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:63433784C>T	ENST00000261893.4	+	6	1496	c.1424C>T	c.(1423-1425)tCg>tTg	p.S475L	RPS27L_ENST00000559763.1_Intron	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	475						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						ACGTATGGTTCGTGTAGAAAG	0.483													C|||	1	0.000199681	0.0	0.0	5008	,	,		20385	0.0		0.0	False		,,,				2504	0.001				p.S475L	Melanoma(85;443 1381 6215 27308 35583)	Atlas-SNP	.											LACTB,NS,carcinoma,-1,1	LACTB	29	1	0			c.C1424T						PASS	.						77.0	66.0	70.0					15																	63433784		2203	4300	6503	SO:0001583	missense	114294	exon6			ATGGTTCGTGTAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.1424C>T	15.37:g.63433784C>T	ENSP00000261893:p.Ser475Leu	144.0	0.0	0		163.0	39.0	0.239264	NM_032857	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	.	.	.	.	.	.	.	.	.	.	C	2.400	-0.337917	0.05278	.	.	ENSG00000103642	ENST00000261893	T	0.40476	1.03	5.64	5.64	0.86602	Beta-lactamase/transpeptidase-like (2);Beta-lactamase-related (1);	0.334872	0.37178	N	0.002209	T	0.20373	0.0490	N	0.22421	0.69	0.23838	N	0.996708	P	0.37500	0.597	B	0.30782	0.12	T	0.17561	-1.0365	10	0.11485	T	0.65	-11.5505	5.3675	0.16121	0.1481:0.6328:0.1427:0.0764	.	475	P83111	LACTB_HUMAN	L	475	ENSP00000261893:S475L	ENSP00000261893:S475L	S	+	2	0	LACTB	61220837	0.996000	0.38824	0.874000	0.34290	0.217000	0.24651	2.416000	0.44644	2.817000	0.96982	0.563000	0.77884	TCG	.	.	none		0.483	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
ARHGAP8	23779	hgsc.bcm.edu	37	22	45221390	45221390	+	Silent	SNP	C	C	T	rs368897846		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:45221390C>T	ENST00000389774.2	+	8	747	c.606C>T	c.(604-606)caC>caT	p.H202H	PRR5-ARHGAP8_ENST00000361473.5_Silent_p.H302H|PRR5-ARHGAP8_ENST00000352766.7_Silent_p.H381H|ARHGAP8_ENST00000336963.4_Silent_p.H171H|ARHGAP8_ENST00000517296.3_Silent_p.H381H|ARHGAP8_ENST00000356099.6_Silent_p.H171H|ARHGAP8_ENST00000389773.5_Silent_p.H293H	NM_001017526.1	NP_001017526.1	P85298	RHG08_HUMAN	Rho GTPase activating protein 8	202					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)	p.H202Q(1)|p.H207Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(9)|prostate(1)|skin(7)	29		all_neural(38;0.00409)|Ovarian(80;0.00976)|Glioma(61;0.0649)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0204)		AGAGCCTGCACGAGGGCCGGA	0.662																																					p.H293H		Atlas-SNP	.											PRR5-ARHGAP8,NS,carcinoma,0,2	PRR5-ARHGAP8	53	2	2	Substitution - Missense(2)	lung(2)	c.C879T						PASS	.	C	,,,	0,4404		0,0,2202	35.0	37.0	36.0		606,513,879,513	1.0	0.0	22		36	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ARHGAP8,PRR5-ARHGAP8	NM_001017526.1,NM_001198726.1,NM_181334.4,NM_181335.2	,,,	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	,,,	202/465,171/306,293/556,171/434	45221390	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	553158	exon10			CCTGCACGAGGGC	AF177331	CCDS14060.2, CCDS33664.1, CCDS56233.1	22q13.3	2010-05-11			ENSG00000241484	ENSG00000241484		"""Rho GTPase activating proteins"""	677	protein-coding gene	gene with protein product		609405				10591208	Standard	NM_001198726		Approved	FLJ20185, BPGAP1		P85298	OTTHUMG00000030234	ENST00000389774.2:c.606C>T	22.37:g.45221390C>T		175.0	0.0	0		99.0	18.0	0.181818	NM_181334	A6ZJ79|A6ZJ80|O75983|O95695|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Silent	SNP	ENST00000389774.2	37	CCDS33664.1	.	.	.	.	.	.	.	.	.	.	c	4.721	0.134002	0.09032	0.0	1.16E-4	ENSG00000248405	ENST00000515632	.	.	.	4.46	1.03	0.20045	.	.	.	.	.	T	0.33498	0.0865	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26744	-1.0094	4	.	.	.	.	8.4748	0.33007	0.3768:0.4931:0.1301:0.0	.	.	.	.	M	225	.	.	T	+	2	0	PRR5-ARHGAP8	43600054	0.233000	0.23772	0.026000	0.17262	0.101000	0.19017	0.419000	0.21247	1.055000	0.40461	0.556000	0.70494	ACG	.	.	weak		0.662	ARHGAP8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000075088.4	NM_017701	
RAF1	5894	hgsc.bcm.edu	37	3	12645694	12645694	+	Missense_Mutation	SNP	A	A	G	rs3730271		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:12645694A>G	ENST00000251849.4	-	7	1214	c.775T>C	c.(775-777)Tcc>Ccc	p.S259P	RAF1_ENST00000442415.2_Missense_Mutation_p.S259P|RAF1_ENST00000542177.1_Missense_Mutation_p.S178P|RAF1_ENST00000534997.1_Missense_Mutation_p.S44P	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	259			S -> A (in an ovarian serous carcinoma sample; somatic mutation; increased ERK activation). {ECO:0000269|PubMed:17344846}.|S -> F (in NS5). {ECO:0000269|PubMed:17603483}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S259A(1)	ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTAGGTGTGGATGTCGACCTC	0.512			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.S259P		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	RAF1,caecum,carcinoma,0,3	RAF1	66	3	1	Substitution - Missense(1)	ovary(1)	c.T775C	GRCh37	CM086899	RAF1	M	rs3730271	PASS	.						155.0	138.0	144.0					3																	12645694		2203	4300	6503	SO:0001583	missense	5894	exon7	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GTGTGGATGTCGA	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.775T>C	3.37:g.12645694A>G	ENSP00000251849:p.Ser259Pro	126.0	0.0	0		165.0	37.0	0.224242	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.111444	0.56398	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	T;T;T;T;T	0.77877	-1.1;-1.13;-1.06;-0.98;-1.08	5.73	5.73	0.89815	.	0.094049	0.85682	D	0.000000	D	0.88288	0.6396	M	0.81802	2.56	0.80722	D	1	P;D;B	0.76494	0.633;0.999;0.205	B;D;B	0.70487	0.349;0.969;0.111	D	0.89783	0.3962	10	0.87932	D	0	.	16.3123	0.82883	1.0:0.0:0.0:0.0	rs3730271;rs3730271	178;44;259	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	P	259;259;138;44;178	ENSP00000251849:S259P;ENSP00000401888:S259P;ENSP00000398591:S138P;ENSP00000441186:S44P;ENSP00000443567:S178P	ENSP00000251849:S259P	S	-	1	0	RAF1	12620694	1.000000	0.71417	0.984000	0.44739	0.289000	0.27227	9.282000	0.95840	2.308000	0.77769	0.533000	0.62120	TCC	A|1.000;|0.000	.	weak		0.512	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
PIK3CA	5290	hgsc.bcm.edu	37	3	178916936	178916936	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:178916936G>T	ENST00000263967.3	+	2	480	c.323G>T	c.(322-324)cGt>cTt	p.R108L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	108					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.R108H(11)|p.R108L(2)|p.G106_R108delGNR(2)|p.G106_R108del(2)|p.R108P(1)|p.R108del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GTAGGCAACCGTGAAGAAAAG	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.R108L	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,colon,carcinoma,0,39	PIK3CA	8460	39	19	Substitution - Missense(14)|Deletion - In frame(5)	endometrium(7)|large_intestine(5)|lung(4)|breast(2)|central_nervous_system(1)	c.G323T						scavenged	.						87.0	82.0	84.0					3																	178916936		1822	4071	5893	SO:0001583	missense	5290	exon2			GCAACCGTGAAGA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.323G>T	3.37:g.178916936G>T	ENSP00000263967:p.Arg108Leu	67.0	0.0	0		59.0	3.0	0.0508475	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594124	0.86953	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.74002	0.83;-0.8	5.52	5.52	0.82312	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	M	0.64404	1.975	0.80722	D	1	D	0.56035	0.974	P	0.54460	0.753	T	0.80502	-0.1354	9	.	.	.	-11.9048	19.4271	0.94746	0.0:0.0:1.0:0.0	.	108	P42336	PK3CA_HUMAN	L	108	ENSP00000263967:R108L;ENSP00000417479:R108L	.	R	+	2	0	PIK3CA	180399630	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.630000	0.83225	2.584000	0.87258	0.555000	0.69702	CGT	.	.	none		0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ZFHX4	79776	hgsc.bcm.edu	37	8	77776035	77776035	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:77776035A>T	ENST00000521891.2	+	11	10533	c.10085A>T	c.(10084-10086)gAt>gTt	p.D3362V	ZFHX4_ENST00000455469.2_Missense_Mutation_p.D3317V|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D3313V|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D3336V	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACTCCAACGATGCTTCAGAA	0.433										HNSCC(33;0.089)																											p.D3362V		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A10085T						PASS	.						21.0	21.0	21.0					8																	77776035		1851	3991	5842	SO:0001583	missense	79776	exon11			CCAACGATGCTTC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.10085A>T	8.37:g.77776035A>T	ENSP00000430497:p.Asp3362Val	51.0	0.0	0		48.0	8.0	0.166667	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	2.721	-0.266537	0.05754	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.54479	0.57;0.62;0.61;0.58	4.5	4.5	0.54988	.	0.932477	0.08819	U	0.889077	T	0.39989	0.1099	N	0.11560	0.145	0.48762	D	0.999701	B	0.20459	0.045	B	0.25614	0.062	T	0.17745	-1.0359	10	0.72032	D	0.01	.	13.9762	0.64275	1.0:0.0:0.0:0.0	.	3317	Q86UP3-4	.	V	3362;3346;3317;3313;3336	ENSP00000430497:D3362V;ENSP00000399605:D3317V;ENSP00000050961:D3313V;ENSP00000430848:D3336V	ENSP00000050961:D3313V	D	+	2	0	ZFHX4	77938590	1.000000	0.71417	0.644000	0.29465	0.313000	0.28021	7.047000	0.76599	1.907000	0.55213	0.496000	0.49642	GAT	.	.	none		0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
FBXL7	23194	hgsc.bcm.edu	37	5	15928178	15928178	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:15928178C>A	ENST00000504595.1	+	3	788	c.307C>A	c.(307-309)Ctc>Atc	p.L103I	FBXL7_ENST00000510662.1_Missense_Mutation_p.L56I|FBXL7_ENST00000329673.7_Missense_Mutation_p.L91I	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	103					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GCTCATCCGGCTCGCCTCCAG	0.677																																					p.L103I		Atlas-SNP	.											FBXL7,NS,carcinoma,-2,1	FBXL7	138	1	0			c.C307A						PASS	.						19.0	25.0	23.0					5																	15928178		2032	4180	6212	SO:0001583	missense	23194	exon3			ATCCGGCTCGCCT	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.307C>A	5.37:g.15928178C>A	ENSP00000423630:p.Leu103Ile	47.0	0.0	0		54.0	15.0	0.277778	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	37	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	C	10.92	1.486928	0.26686	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.10573	2.89;2.86;2.89	5.52	4.65	0.58169	.	0.324591	0.29868	N	0.011000	T	0.06781	0.0173	N	0.19112	0.55	0.38780	D	0.954745	B	0.09022	0.002	B	0.04013	0.001	T	0.26467	-1.0102	10	0.37606	T	0.19	.	6.5028	0.22178	0.1505:0.7051:0.0:0.1444	.	103	Q9UJT9	FBXL7_HUMAN	I	103;56;91	ENSP00000423630:L103I;ENSP00000425184:L56I;ENSP00000329632:L91I	ENSP00000329632:L91I	L	+	1	0	FBXL7	15981178	0.998000	0.40836	0.893000	0.35052	0.928000	0.56348	1.263000	0.33004	1.324000	0.45282	-0.311000	0.09066	CTC	.	.	none		0.677	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
DOCK3	1795	hgsc.bcm.edu	37	3	51394558	51394558	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:51394558G>A	ENST00000266037.9	+	44	4692	c.4669G>A	c.(4669-4671)Gca>Aca	p.A1557T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1557	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TGGAGGCATTGCACGCTATCA	0.522																																					p.A1557T		Atlas-SNP	.											.	DOCK3	397	.	0			c.G4669A						PASS	.						100.0	94.0	96.0					3																	51394558		2067	4226	6293	SO:0001583	missense	1795	exon44			GGCATTGCACGCT	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4669G>A	3.37:g.51394558G>A	ENSP00000266037:p.Ala1557Thr	87.0	0.0	0		93.0	23.0	0.247312	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.135619	0.56828	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.17370	2.28	5.84	5.84	0.93424	.	0.052235	0.85682	D	0.000000	T	0.16599	0.0399	L	0.38838	1.175	0.58432	D	0.999998	B	0.26672	0.156	B	0.29267	0.1	T	0.03130	-1.1069	10	0.34782	T	0.22	.	14.9171	0.70807	0.0:0.0:0.8569:0.1431	.	1557	Q8IZD9	DOCK3_HUMAN	T	1557;353	ENSP00000266037:A1557T	ENSP00000266037:A1557T	A	+	1	0	DOCK3	51369598	1.000000	0.71417	0.861000	0.33841	0.989000	0.77384	7.871000	0.87180	2.765000	0.95021	0.655000	0.94253	GCA	.	.	none		0.522	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
SLC16A7	9194	hgsc.bcm.edu	37	12	60173423	60173423	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:60173423C>T	ENST00000261187.4	+	5	1564	c.1400C>T	c.(1399-1401)gCa>gTa	p.A467V	SLC16A7_ENST00000543448.1_Missense_Mutation_p.A368V|SLC16A7_ENST00000552024.1_Missense_Mutation_p.A467V|SLC16A7_ENST00000547379.1_Missense_Mutation_p.A467V|SLC16A7_ENST00000552432.1_Missense_Mutation_p.A467V	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	467					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	GTTTCAAATGCACAGAGTGTA	0.358																																					p.A467V		Atlas-SNP	.											.	SLC16A7	82	.	0			c.C1400T						PASS	.						75.0	72.0	73.0					12																	60173423		2203	4300	6503	SO:0001583	missense	9194	exon6			CAAATGCACAGAG	AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.1400C>T	12.37:g.60173423C>T	ENSP00000261187:p.Ala467Val	89.0	0.0	0		97.0	4.0	0.0412371	NM_001270622	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	ENST00000261187.4	37	CCDS8961.1	.	.	.	.	.	.	.	.	.	.	C	9.231	1.035740	0.19590	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000261187;ENST00000543448	T;T;T;T;T	0.17691	2.4;2.4;2.4;2.4;2.26	5.05	1.63	0.23807	.	4.485940	0.00687	N	0.000717	T	0.09774	0.0240	N	0.11560	0.145	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.23119	-1.0197	9	.	.	.	.	4.8693	0.13624	0.0:0.5139:0.1597:0.3264	.	467	O60669	MOT2_HUMAN	V	467;467;467;467;368	ENSP00000449547:A467V;ENSP00000448071:A467V;ENSP00000448742:A467V;ENSP00000261187:A467V;ENSP00000443731:A368V	.	A	+	2	0	SLC16A7	58459690	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	0.432000	0.21461	0.622000	0.30249	0.467000	0.42956	GCA	.	.	none		0.358	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406587.1	NM_004731	
CDH10	1008	hgsc.bcm.edu	37	5	24593514	24593514	+	Missense_Mutation	SNP	G	G	A	rs140810299		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:24593514G>A	ENST00000264463.4	-	2	593	c.86C>T	c.(85-87)aCg>aTg	p.T29M	RP11-116O11.1_ENST00000510391.1_RNA	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	29					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TGGCACAGGCGTCCTTCTGAA	0.403										HNSCC(23;0.051)			G|||	1	0.000199681	0.0	0.0	5008	,	,		16405	0.0		0.001	False		,,,				2504	0.0				p.T29M		Atlas-SNP	.											.	CDH10	391	.	0			c.C86T						PASS	.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	105.0	98.0	101.0		86	2.5	1.0	5	dbSNP_134	101	0,8598		0,0,4299	no	missense	CDH10	NM_006727.3	81	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign	29/789	24593514	1,13003	2203	4299	6502	SO:0001583	missense	1008	exon2			ACAGGCGTCCTTC	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.86C>T	5.37:g.24593514G>A	ENSP00000264463:p.Thr29Met	145.0	0.0	0		185.0	36.0	0.194595	NM_006727	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	CCDS3892.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	10.53	1.375184	0.24857	2.27E-4	0.0	ENSG00000040731	ENST00000264463	T	0.56103	0.48	4.36	2.53	0.30540	.	0.543154	0.19943	N	0.102617	T	0.43897	0.1268	L	0.50333	1.59	0.28771	N	0.900348	B	0.17852	0.024	B	0.14578	0.011	T	0.41787	-0.9489	10	0.45353	T	0.12	.	9.2453	0.37523	0.1795:0.0:0.8205:0.0	.	29	Q9Y6N8	CAD10_HUMAN	M	29	ENSP00000264463:T29M	ENSP00000264463:T29M	T	-	2	0	CDH10	24629271	1.000000	0.71417	0.993000	0.49108	0.503000	0.33858	6.687000	0.74552	0.962000	0.38057	-0.244000	0.11960	ACG	G|1.000;A|0.000	0.000	strong		0.403	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
RBMS3	27303	hgsc.bcm.edu	37	3	29938966	29938966	+	Splice_Site	SNP	G	G	T	rs13060292		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:29938966G>T	ENST00000383767.2	+	9	1224	c.888G>T	c.(886-888)caG>caT	p.Q296H	RBMS3_ENST00000434693.2_Splice_Site_p.Q295H|RBMS3_ENST00000383766.2_Splice_Site_p.Q295H|RBMS3_ENST00000452462.1_Splice_Site_p.Q296H|RBMS3_ENST00000456853.1_Splice_Site_p.Q309H|RBMS3_ENST00000273139.9_Splice_Site_p.Q296H|RBMS3_ENST00000396583.3_Splice_Site_p.Q309H			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	296					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CCACATACCAGGTATGTCCAA	0.403																																					p.Q309H		Atlas-SNP	.											.	RBMS3	62	.	0			c.G927T						PASS	.						204.0	184.0	191.0					3																	29938966		2203	4300	6503	SO:0001630	splice_region_variant	27303	exon10			ATACCAGGTATGT	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.888+1G>T	3.37:g.29938966G>T		146.0	0.0	0		175.0	39.0	0.222857	NM_001177712	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	G	31	5.100850	0.94245	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	T;T;T;T;T;T;T	0.30182	1.54;1.59;1.56;1.58;1.67;1.57;1.59	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.85373	2.75	0.80722	D	1	D;D;P;D	0.89917	1.0;0.999;0.756;0.999	D;D;P;D	0.76071	0.987;0.981;0.644;0.971	T	0.66524	-0.5902	9	.	.	.	.	18.754	0.91825	0.0:0.0:1.0:0.0	.	296;309;295;296	G5E9J9;Q6XE24-2;Q6XE24-3;Q6XE24	.;.;.;RBMS3_HUMAN	H	295;309;296;296;295;296;309	ENSP00000395592:Q295H;ENSP00000379828:Q309H;ENSP00000373277:Q296H;ENSP00000273139:Q296H;ENSP00000373276:Q295H;ENSP00000397926:Q296H;ENSP00000400519:Q309H	.	Q	+	3	2	RBMS3	29913970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.433000	0.82419	0.655000	0.94253	CAG	.	.	alt		0.403	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	Missense_Mutation
PRRC2B	84726	hgsc.bcm.edu	37	9	134322483	134322483	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr9:134322483G>A	ENST00000357304.4	+	7	922	c.867G>A	c.(865-867)ccG>ccA	p.P289P	PRRC2B_ENST00000372249.1_5'Flank|PRRC2B_ENST00000458550.1_Silent_p.P289P|PRRC2B_ENST00000405995.1_Silent_p.P289P	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	289							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TGTGTTCGCCGAAGTCATCAG	0.428																																					p.P289P		Atlas-SNP	.											.	PRRC2B	266	.	0			c.G867A						PASS	.						108.0	103.0	105.0					9																	134322483		1937	4141	6078	SO:0001819	synonymous_variant	84726	exon7			TTCGCCGAAGTCA	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.867G>A	9.37:g.134322483G>A		131.0	0.0	0		146.0	25.0	0.171233	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	37	CCDS48044.1																																																																																			.	.	none		0.428	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
DDX52	11056	hgsc.bcm.edu	37	17	35979827	35979827	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:35979827A>C	ENST00000349699.2	-	13	1678	c.1635T>G	c.(1633-1635)ttT>ttG	p.F545L	DDX52_ENST00000394367.3_Missense_Mutation_p.F437L	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	545	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Lys-rich.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				GTAGTTTCTGAAAACCTTTTA	0.338																																					p.F545L		Atlas-SNP	.											.	DDX52	40	.	0			c.T1635G						PASS	.						96.0	99.0	98.0					17																	35979827		2203	4300	6503	SO:0001583	missense	11056	exon13			TTTCTGAAAACCT	AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.1635T>G	17.37:g.35979827A>C	ENSP00000268854:p.Phe545Leu	159.0	0.0	0		179.0	40.0	0.223464	NM_007010	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	ENST00000349699.2	37	CCDS11323.1	.	.	.	.	.	.	.	.	.	.	A	4.181	0.032244	0.08101	.	.	ENSG00000141141	ENST00000349699;ENST00000394367	T;T	0.13307	2.6;2.63	5.87	0.492	0.16872	Helicase, C-terminal (1);	0.095278	0.64402	N	0.000001	T	0.02494	0.0076	N	0.01015	-1.05	0.38208	D	0.940389	B	0.02656	0.0	B	0.04013	0.001	T	0.37731	-0.9693	10	0.06365	T	0.9	.	1.6637	0.02797	0.3737:0.1278:0.3671:0.1314	.	545	Q9Y2R4	DDX52_HUMAN	L	545;437	ENSP00000268854:F545L;ENSP00000377893:F437L	ENSP00000268854:F545L	F	-	3	2	DDX52	33053940	0.998000	0.40836	0.991000	0.47740	0.741000	0.42261	0.324000	0.19610	-0.090000	0.12462	-0.242000	0.12053	TTT	.	.	none		0.338	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256795.1	NM_152300	
TMEM255B	348013	hgsc.bcm.edu	37	13	114514733	114514733	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:114514733C>G	ENST00000375353.3	+	9	865	c.838C>G	c.(838-840)Ccc>Gcc	p.P280A	TMEM255B_ENST00000467169.1_3'UTR	NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B	280	Pro-rich.					integral component of membrane (GO:0016021)											CCCAGTTGCGCCCTCCTCTGC	0.647																																					p.P280A		Atlas-SNP	.											.	.	.	.	0			c.C838G						PASS	.						47.0	53.0	51.0					13																	114514733		2203	4300	6503	SO:0001583	missense	348013	exon9			GTTGCGCCCTCCT	BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	ENST00000375353.3:c.838C>G	13.37:g.114514733C>G	ENSP00000364502:p.Pro280Ala	145.0	0.0	0		110.0	15.0	0.136364	NM_182614		Missense_Mutation	SNP	ENST00000375353.3	37	CCDS45071.1	.	.	.	.	.	.	.	.	.	.	C	4.207	0.037268	0.08148	.	.	ENSG00000184497	ENST00000375353	T	0.40225	1.04	4.35	-5.0	0.03001	.	.	.	.	.	T	0.28400	0.0702	L	0.50333	1.59	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.30268	-0.9984	9	0.46703	T	0.11	-1.715	1.5609	0.02594	0.1161:0.2033:0.1673:0.5134	.	280	Q8WV15	FA70B_HUMAN	A	280	ENSP00000364502:P280A	ENSP00000364502:P280A	P	+	1	0	FAM70B	113599210	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.015000	0.12634	-1.335000	0.02241	0.484000	0.47621	CCC	.	.	none		0.647	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045953.4	NM_182614	
AMER1	139285	hgsc.bcm.edu	37	X	63411917	63411917	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:63411917G>A	ENST00000330258.3	-	2	1522	c.1250C>T	c.(1249-1251)cCa>cTa	p.P417L	AMER1_ENST00000403336.1_Missense_Mutation_p.P417L|AMER1_ENST00000374869.3_Missense_Mutation_p.P417L	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	417					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									ATTGGGCCGTGGATACATTTG	0.517																																					p.P417L		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.C1250T						PASS	.						219.0	200.0	207.0					X																	63411917		2203	4300	6503	SO:0001583	missense	139285	exon2			GGCCGTGGATACA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1250C>T	X.37:g.63411917G>A	ENSP00000329117:p.Pro417Leu	198.0	0.0	0		190.0	35.0	0.184211	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	0.352	-0.944210	0.02322	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.29917	1.55;1.55;1.55	4.64	2.68	0.31781	.	0.510469	0.18585	N	0.136891	T	0.25306	0.0615	L	0.46157	1.445	0.27490	N	0.952304	B	0.10296	0.003	B	0.14578	0.011	T	0.16453	-1.0402	10	0.44086	T	0.13	-0.1509	8.3007	0.32012	0.2172:0.0:0.7828:0.0	.	417	Q5JTC6	F123B_HUMAN	L	417	ENSP00000364003:P417L;ENSP00000329117:P417L;ENSP00000384722:P417L	ENSP00000329117:P417L	P	-	2	0	FAM123B	63328642	0.138000	0.22547	0.195000	0.23364	0.065000	0.16274	1.140000	0.31516	0.559000	0.29153	0.600000	0.82982	CCA	.	.	none		0.517	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
TTC9	23508	hgsc.bcm.edu	37	14	71109098	71109098	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:71109098G>A	ENST00000256367.2	+	1	595	c.252G>A	c.(250-252)ttG>ttA	p.L84L	CTD-2540L5.6_ENST00000500016.1_lincRNA|CTD-2540L5.5_ENST00000553982.1_lincRNA	NM_015351.1	NP_056166.1	Q92623	TTC9A_HUMAN	tetratricopeptide repeat domain 9	84										skin(1)	1				all cancers(60;0.00545)|BRCA - Breast invasive adenocarcinoma(234;0.00747)|OV - Ovarian serous cystadenocarcinoma(108;0.0538)		ACCGGGCGTTGCTGGAGCTGA	0.682																																					p.L84L		Atlas-SNP	.											.	TTC9	11	.	0			c.G252A						PASS	.						10.0	12.0	11.0					14																	71109098		1871	4083	5954	SO:0001819	synonymous_variant	23508	exon1			GGCGTTGCTGGAG	D86980	CCDS45132.1	14q24.2	2014-08-12			ENSG00000133985			"""Tetratricopeptide (TTC) repeat domain containing"""	20267	protein-coding gene	gene with protein product		610488					Standard	NM_015351		Approved	KIAA0227, TTC9A	uc001xmi.2	Q92623	OTTHUMG00000172133	ENST00000256367.2:c.252G>A	14.37:g.71109098G>A		79.0	0.0	0		64.0	6.0	0.09375	NM_015351	Q86WT2	Silent	SNP	ENST00000256367.2	37	CCDS45132.1																																																																																			.	.	none		0.682	TTC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417024.1	XM_027236	
UXS1	80146	hgsc.bcm.edu	37	2	106729179	106729179	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:106729179C>T	ENST00000409501.3	-	10	844	c.787G>A	c.(787-789)Ggg>Agg	p.G263R	UXS1_ENST00000409032.1_Missense_Mutation_p.G95R|UXS1_ENST00000540130.1_Missense_Mutation_p.G206R|UXS1_ENST00000283148.7_Missense_Mutation_p.G268R|UXS1_ENST00000428048.2_Missense_Mutation_p.G107R			Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	263					protein tetramerization (GO:0051262)|UDP-D-xylose biosynthetic process (GO:0033320)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|UDP-glucuronate decarboxylase activity (GO:0048040)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	17						ATGCGTGGCCCAAAGGTGTTG	0.602																																					p.G268R		Atlas-SNP	.											.	UXS1	75	.	0			c.G802A						PASS	.						72.0	74.0	74.0					2																	106729179		2106	4232	6338	SO:0001583	missense	80146	exon10			GTGGCCCAAAGGT	AK027244	CCDS46378.1, CCDS58720.1, CCDS58721.1	2q12.2	2012-02-22			ENSG00000115652	ENSG00000115652	4.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	17729	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 6E, member 12"""	609749				19027726	Standard	NM_001253875		Approved	FLJ23591, UGD, SDR6E1	uc002tdn.3	Q8NBZ7	OTTHUMG00000153150	ENST00000409501.3:c.787G>A	2.37:g.106729179C>T	ENSP00000387019:p.Gly263Arg	92.0	0.0	0		65.0	10.0	0.153846	NM_001253875	Q8NBX3|Q9H5C2	Missense_Mutation	SNP	ENST00000409501.3	37	CCDS46378.1	.	.	.	.	.	.	.	.	.	.	C	31	5.081668	0.94050	.	.	ENSG00000115652	ENST00000283148;ENST00000540130;ENST00000409501;ENST00000409032;ENST00000428048;ENST00000441952;ENST00000416298;ENST00000444193	D;D;D;D;D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05;-5.05;-5.05;-5.05;-5.05	5.25	5.25	0.73442	NAD-dependent epimerase/dehydratase (1);	0.000000	0.85682	D	0.000000	D	0.99677	0.9879	H	0.99964	5.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.96850	0.9624	10	0.87932	D	0	.	18.4398	0.90662	0.0:1.0:0.0:0.0	.	107;268;263	B4E3U7;Q8NBZ7-2;Q8NBZ7	.;.;UXS1_HUMAN	R	268;206;263;95;107;107;95;95	ENSP00000283148:G268R;ENSP00000438265:G206R;ENSP00000387019:G263R;ENSP00000387096:G95R;ENSP00000394334:G107R;ENSP00000416656:G107R;ENSP00000403612:G95R;ENSP00000404468:G95R	ENSP00000283148:G268R	G	-	1	0	UXS1	106095611	1.000000	0.71417	0.986000	0.45419	0.950000	0.60333	6.730000	0.74780	2.452000	0.82932	0.561000	0.74099	GGG	.	.	none		0.602	UXS1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329778.1	NM_025076.3	
MUC5B	727897	hgsc.bcm.edu	37	11	1258274	1258274	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:1258274C>T	ENST00000529681.1	+	25	3235	c.3177C>T	c.(3175-3177)ccC>ccT	p.P1059P	MUC5B_ENST00000447027.1_Silent_p.P1062P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1059	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		AGCTCTCCCCCTCCTGCCCGG	0.657																																					p.P1059P		Atlas-SNP	.											.	MUC5B	473	.	0			c.C3177T						PASS	.						42.0	59.0	53.0					11																	1258274		2100	4204	6304	SO:0001819	synonymous_variant	727897	exon25			CTCCCCCTCCTGC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3177C>T	11.37:g.1258274C>T		62.0	0.0	0		59.0	4.0	0.0677966	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.	.	none		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
CPXM1	56265	hgsc.bcm.edu	37	20	2775239	2775239	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:2775239A>T	ENST00000380605.2	-	13	1971	c.1907T>A	c.(1906-1908)cTt>cAt	p.L636H		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	636					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						AGCAATCCCAAGCTCCGTGTC	0.587																																					p.L636H		Atlas-SNP	.											.	CPXM1	107	.	0			c.T1907A						PASS	.						183.0	117.0	140.0					20																	2775239		2203	4300	6503	SO:0001583	missense	56265	exon13			ATCCCAAGCTCCG	AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1907T>A	20.37:g.2775239A>T	ENSP00000369979:p.Leu636His	54.0	0.0	0		55.0	16.0	0.290909	NM_019609	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	ENST00000380605.2	37	CCDS13033.1	.	.	.	.	.	.	.	.	.	.	A	10.31	1.314694	0.23908	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.42131	0.98	5.53	1.79	0.24919	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);	0.516425	0.19628	N	0.109747	T	0.25005	0.0607	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.13202	-1.0518	10	0.44086	T	0.13	-3.0776	4.3529	0.11163	0.4832:0.0:0.0892:0.4276	.	636	Q96SM3	CPXM1_HUMAN	H	636;332	ENSP00000369979:L636H	ENSP00000369979:L636H	L	-	2	0	CPXM1	2723239	0.000000	0.05858	0.155000	0.22561	0.974000	0.67602	-0.008000	0.12788	0.507000	0.28148	0.533000	0.62120	CTT	.	.	none		0.587	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077643.2	NM_019609	
HECW2	57520	hgsc.bcm.edu	37	2	197092929	197092929	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:197092929C>A	ENST00000260983.3	-	22	3996	c.3814G>T	c.(3814-3816)Gaa>Taa	p.E1272*	HECW2_ENST00000409111.1_Nonsense_Mutation_p.E916*	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1272	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TTAAAGAGTTCTCTGGATACC	0.348																																					p.E1272X		Atlas-SNP	.											.	HECW2	239	.	0			c.G3814T						PASS	.						83.0	86.0	85.0					2																	197092929		2203	4300	6503	SO:0001587	stop_gained	57520	exon22			AGAGTTCTCTGGA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.3814G>T	2.37:g.197092929C>A	ENSP00000260983:p.Glu1272*	144.0	0.0	0		216.0	60.0	0.277778	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Nonsense_Mutation	SNP	ENST00000260983.3	37	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	C	45	11.371157	0.99552	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4587	0.94906	0.0:1.0:0.0:0.0	.	.	.	.	X	916;1272	.	ENSP00000260983:E1272X	E	-	1	0	HECW2	196801174	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.828000	0.97474	0.655000	0.94253	GAA	.	.	none		0.348	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
PIGQ	9091	hgsc.bcm.edu	37	16	632296	632296	+	Intron	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:632296G>A	ENST00000026218.5	+	10	1619				PIGQ_ENST00000409527.2_Missense_Mutation_p.R527H|PIGQ_ENST00000321878.5_Missense_Mutation_p.R527H	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q						C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				AGGCCCCTCCGCCTCCTGATG	0.692																																					p.R527H		Atlas-SNP	.											.	PIGQ	43	.	0			c.G1580A						PASS	.						23.0	23.0	23.0					16																	632296		2195	4293	6488	SO:0001627	intron_variant	9091	exon10			CCCTCCGCCTCCT	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1532-587G>A	16.37:g.632296G>A		145.0	0.0	0		107.0	44.0	0.411215	NM_004204	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.635080	0.29068	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000540241	T;T	0.44482	0.92;0.92	5.08	5.08	0.68730	.	.	.	.	.	T	0.32041	0.0816	L	0.28400	0.85	0.80722	D	1	B	0.23377	0.084	B	0.17098	0.017	T	0.09509	-1.0671	9	0.14656	T	0.56	.	17.4349	0.87548	0.0:0.0:1.0:0.0	.	527	Q9BRB3-2	.	H	527;527;85	ENSP00000386760:R527H;ENSP00000326674:R527H	ENSP00000326674:R527H	R	+	2	0	PIGQ	572297	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	4.179000	0.58290	2.361000	0.80049	0.561000	0.74099	CGC	.	.	none		0.692	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204	
SSX2IP	117178	hgsc.bcm.edu	37	1	85128001	85128001	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:85128001T>G	ENST00000342203.3	-	8	1070	c.807A>C	c.(805-807)caA>caC	p.Q269H	SSX2IP_ENST00000370612.4_Missense_Mutation_p.Q269H|SSX2IP_ENST00000437941.2_Missense_Mutation_p.Q242H|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000605755.1_Missense_Mutation_p.Q242H	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	269					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CCATTAGGATTTGTTTCTGAC	0.323																																					p.Q269H		Atlas-SNP	.											.	SSX2IP	53	.	0			c.A807C						PASS	.						113.0	124.0	120.0					1																	85128001		2203	4300	6503	SO:0001583	missense	117178	exon9			TAGGATTTGTTTC		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.807A>C	1.37:g.85128001T>G	ENSP00000340279:p.Gln269His	127.0	0.0	0		131.0	8.0	0.0610687	NM_001166417	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	37	CCDS699.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624299	0.66901	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612	T;T	0.47869	0.85;0.83	5.65	4.53	0.55603	.	0.219097	0.49305	D	0.000151	T	0.46405	0.1391	M	0.63428	1.95	0.41120	D	0.985803	D;D;D	0.64830	0.994;0.994;0.994	P;P;P	0.58820	0.846;0.783;0.783	T	0.53865	-0.8378	10	0.87932	D	0	-3.6859	7.8139	0.29247	0.0:0.2925:0.0:0.7075	.	265;269;242	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	H	269;242;265;269	ENSP00000340279:Q269H;ENSP00000412781:Q242H	ENSP00000340279:Q269H	Q	-	3	2	SSX2IP	84900589	0.991000	0.36638	1.000000	0.80357	0.996000	0.88848	0.235000	0.17948	0.994000	0.38892	0.482000	0.46254	CAA	.	.	none		0.323	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
ULK3	25989	hgsc.bcm.edu	37	15	75131687	75131687	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:75131687T>C	ENST00000440863.2	-	8	971	c.880A>G	c.(880-882)Aaa>Gaa	p.K294E	ULK3_ENST00000569437.1_Missense_Mutation_p.K294E|ULK3_ENST00000568667.1_Missense_Mutation_p.K305E	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	294	MIT 1.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						TCCTGGTCTTTCTTCACAGCC	0.592																																					p.K294E		Atlas-SNP	.											.	ULK3	30	.	0			c.A880G						PASS	.						38.0	42.0	41.0					15																	75131687		1947	4121	6068	SO:0001583	missense	25989	exon8			GGTCTTTCTTCAC	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.880A>G	15.37:g.75131687T>C	ENSP00000400312:p.Lys294Glu	155.0	0.0	0		118.0	10.0	0.0847458	NM_001099436	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Missense_Mutation	SNP	ENST00000440863.2	37	CCDS45305.1	.	.	.	.	.	.	.	.	.	.	T	14.52	2.560326	0.45590	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	T	0.68903	-0.36	5.05	5.05	0.67936	MIT (2);	.	.	.	.	T	0.50343	0.1610	N	0.17082	0.46	0.46061	D	0.998848	B;B;B;B	0.31680	0.335;0.335;0.199;0.11	B;B;B;B	0.31290	0.127;0.127;0.072;0.031	T	0.50250	-0.8850	9	0.30854	T	0.27	-15.4837	13.6385	0.62235	0.0:0.0:0.0:1.0	.	305;204;294;294	B4DFT0;B4DFS6;Q6PHR2;Q6PHR2-3	.;.;ULK3_HUMAN;.	E	294;305	ENSP00000400312:K294E	ENSP00000393658:K305E	K	-	1	0	ULK3	72918740	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.864000	0.69575	1.907000	0.55213	0.402000	0.26972	AAA	.	.	none		0.592	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518	
CAMK4	814	hgsc.bcm.edu	37	5	110560276	110560276	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:110560276A>T	ENST00000282356.4	+	1	493	c.95A>T	c.(94-96)tAc>tTc	p.Y32F	CAMK4_ENST00000512453.1_Missense_Mutation_p.Y32F	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	32					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		GTCCCGGATTACTGGATCGAC	0.682																																					p.Y32F		Atlas-SNP	.											.	CAMK4	77	.	0			c.A95T						PASS	.						27.0	30.0	29.0					5																	110560276		2202	4300	6502	SO:0001583	missense	814	exon1			CGGATTACTGGAT	D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.95A>T	5.37:g.110560276A>T	ENSP00000282356:p.Tyr32Phe	145.0	0.0	0		141.0	30.0	0.212766	NM_001744	D3DSZ7	Missense_Mutation	SNP	ENST00000282356.4	37	CCDS4103.1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.753876	0.49362	.	.	ENSG00000152495	ENST00000508074;ENST00000512453;ENST00000282356	T;T;T	0.66995	0.73;-0.24;-0.24	4.16	4.16	0.48862	Protein kinase-like domain (1);	0.074149	0.56097	D	0.000028	T	0.51126	0.1656	N	0.19112	0.55	0.41715	D	0.989476	B	0.18610	0.029	B	0.18871	0.023	T	0.51348	-0.8717	10	0.48119	T	0.1	.	12.4796	0.55833	1.0:0.0:0.0:0.0	.	32	Q16566	KCC4_HUMAN	F	32	ENSP00000426940:Y32F;ENSP00000422634:Y32F;ENSP00000282356:Y32F	ENSP00000282356:Y32F	Y	+	2	0	CAMK4	110588175	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.960000	0.56752	1.649000	0.50652	0.377000	0.23210	TAC	.	.	none		0.682	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250719.2	NM_001744	
SCAND1	51282	hgsc.bcm.edu	37	20	34542105	34542105	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:34542105G>C	ENST00000373991.3	-	3	1172	c.102C>G	c.(100-102)aaC>aaG	p.N34K	SCAND1_ENST00000305978.2_Missense_Mutation_p.N34K			P57086	SCND1_HUMAN	SCAN domain containing 1	34					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)					Breast(12;0.00631)|all_lung(11;0.0233)					AGCCCACACAGTTACGCTCAG	0.697																																					p.N97K		Atlas-SNP	.											.	SCAND1	2	.	0			c.C291G						PASS	.						11.0	12.0	12.0					20																	34542105		2173	4249	6422	SO:0001583	missense	51282	exon2			CACACAGTTACGC	AF204271	CCDS13269.1	20q11.1-q11.23	2013-01-08	2002-01-14		ENSG00000171222	ENSG00000171222		"""-"""	10566	protein-coding gene	gene with protein product		610416	"""SCAN domain-containing 1"""			10777584, 10747874, 12444922	Standard	NM_016558		Approved	SDP1, RAZ1	uc002xen.2	P57086	OTTHUMG00000032370	ENST00000373991.3:c.102C>G	20.37:g.34542105G>C	ENSP00000363103:p.Asn34Lys	93.0	0.0	0		69.0	5.0	0.0724638	NM_033630	Q6IAG7	Missense_Mutation	SNP	ENST00000373991.3	37	CCDS13269.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078518	0.36662	.	.	ENSG00000171222	ENST00000305978;ENST00000373991	T;T	0.08370	3.1;3.1	4.31	1.19	0.21007	.	0.828409	0.10092	N	0.717113	T	0.05823	0.0152	N	0.24115	0.695	0.09310	N	1	B	0.19583	0.037	B	0.21546	0.035	T	0.47169	-0.9138	10	0.17369	T	0.5	.	8.3967	0.32561	0.2657:0.0:0.7343:0.0	.	34	P57086	SCND1_HUMAN	K	34	ENSP00000301995:N34K;ENSP00000363103:N34K	ENSP00000301995:N34K	N	-	3	2	SCAND1	34005519	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.103000	0.10940	0.182000	0.20032	0.561000	0.74099	AAC	.	.	none		0.697	SCAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078958.2	NM_016558	
IRS4	8471	hgsc.bcm.edu	37	X	107976167	107976167	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:107976167C>T	ENST00000372129.2	-	1	3484	c.3408G>A	c.(3406-3408)gcG>gcA	p.A1136A	RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1136	Ala-rich.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GCGCGGAGGCCGCAGCTACAA	0.642																																					p.A1136A		Atlas-SNP	.											.	IRS4	253	.	0			c.G3408A						PASS	.						30.0	35.0	34.0					X																	107976167		2196	4283	6479	SO:0001819	synonymous_variant	8471	exon1			GGAGGCCGCAGCT	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3408G>A	X.37:g.107976167C>T		21.0	0.0	0		15.0	7.0	0.466667	NM_003604		Silent	SNP	ENST00000372129.2	37	CCDS14544.1																																																																																			.	.	none		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36654042	36654042	+	Missense_Mutation	SNP	A	A	G	rs552987504		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:36654042A>G	ENST00000431231.2	+	21	3360	c.3292A>G	c.(3292-3294)Agt>Ggt	p.S1098G	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.S1098G|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.S1004G	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1098					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CTGGTTCTTCAGTGACGAAGA	0.582																																					p.S1098G		Atlas-SNP	.											.	ARHGAP23	48	.	0			c.A3292G						PASS	.						35.0	31.0	32.0					17																	36654042		692	1591	2283	SO:0001583	missense	57636	exon21			TTCTTCAGTGACG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3292A>G	17.37:g.36654042A>G	ENSP00000393539:p.Ser1098Gly	418.0	0.0	0		366.0	66.0	0.180328	NM_001199417		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.38|16.38	3.105859|3.105859	0.56291|0.56291	.|.	.|.	ENSG00000225485|ENSG00000225485	ENST00000548703|ENST00000437668;ENST00000431231;ENST00000443378	.|T;T;T	.|0.15834	.|2.39;2.76;2.71	4.66|4.66	4.66|4.66	0.58398|0.58398	.|Rho GTPase-activating protein domain (1);	.|0.102279	.|0.64402	.|D	.|0.000006	T|T	0.19525|0.19525	0.0469|0.0469	L|L	0.52573|0.52573	1.65|1.65	0.38885|0.38885	D|D	0.956999|0.956999	.|B;P	.|0.50943	.|0.23;0.94	.|B;P	.|0.44946	.|0.082;0.465	T|T	0.05289|0.05289	-1.0894|-1.0894	5|10	.|0.25751	.|T	.|0.34	.|.	13.4901|13.4901	0.61390|0.61390	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1098;1098	.|Q9P227;Q9P227-2	.|RHG23_HUMAN;.	R|G	78|1098;1098;1004	.|ENSP00000394153:S1098G;ENSP00000393539:S1098G;ENSP00000407333:S1004G	.|ENSP00000393539:S1098G	Q|S	+|+	2|1	0|0	ARHGAP23|ARHGAP23	33907568|33907568	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	6.237000|6.237000	0.72345|0.72345	2.084000|2.084000	0.62774|0.62774	0.455000|0.455000	0.32223|0.32223	CAG|AGT	.	.	none		0.582	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
CKAP5	9793	hgsc.bcm.edu	37	11	46831321	46831321	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:46831321T>A	ENST00000529230.1	-	6	780	c.734A>T	c.(733-735)cAa>cTa	p.Q245L	CKAP5_ENST00000312055.5_Missense_Mutation_p.Q245L|CKAP5_ENST00000415402.1_Missense_Mutation_p.Q245L|CKAP5_ENST00000354558.3_Missense_Mutation_p.Q245L			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	245					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AGCAGACTGTTGTTGTTCCAA	0.428																																					p.Q245L	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.A734T						PASS	.						214.0	203.0	207.0					11																	46831321		2201	4299	6500	SO:0001583	missense	9793	exon6			GACTGTTGTTGTT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.734A>T	11.37:g.46831321T>A	ENSP00000432768:p.Gln245Leu	194.0	0.0	0		222.0	38.0	0.171171	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232689	0.79688	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000378629;ENST00000354558	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.78	3.39	0.38822	Armadillo-like helical (1);Armadillo-type fold (1);	0.052954	0.85682	D	0.000000	T	0.49830	0.1580	L	0.46157	1.445	0.58432	D	0.999998	P;B;D	0.54772	0.908;0.062;0.968	D;B;P	0.64144	0.922;0.055;0.449	T	0.33111	-0.9881	10	0.31617	T	0.26	-16.6184	8.6638	0.34108	0.0:0.0672:0.1296:0.8032	.	245;245;245	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	L	245	ENSP00000432768:Q245L;ENSP00000395302:Q245L;ENSP00000310227:Q245L;ENSP00000346566:Q245L	ENSP00000310227:Q245L	Q	-	2	0	CKAP5	46787897	1.000000	0.71417	0.958000	0.39756	0.988000	0.76386	7.607000	0.82883	0.418000	0.25898	-0.297000	0.09499	CAA	.	.	none		0.428	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
SGK1	6446	hgsc.bcm.edu	37	6	134494426	134494426	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134494426G>C	ENST00000237305.7	-	5	491	c.403C>G	c.(403-405)Ctg>Gtg	p.L135V	SGK1_ENST00000367858.5_Missense_Mutation_p.L230V|SGK1_ENST00000475719.2_Missense_Mutation_p.L135V|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Missense_Mutation_p.L163V|SGK1_ENST00000367857.5_Missense_Mutation_p.L125V|SGK1_ENST00000413996.3_Missense_Mutation_p.L149V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	135	Glu/Lys-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTCTTTTTCAGGATTGCTTTC	0.378																																					p.L230V		Atlas-SNP	.											.	SGK1	387	.	0			c.C688G						PASS	.						114.0	113.0	113.0					6																	134494426		2203	4300	6503	SO:0001583	missense	6446	exon7			TTTTCAGGATTGC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.403C>G	6.37:g.134494426G>C	ENSP00000237305:p.Leu135Val	153.0	0.0	0		149.0	27.0	0.181208	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450776	0.26074	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;1.88	6.17	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	L	0.33753	1.03	0.80722	D	1	B;B;B;B;B;B	0.27140	0.007;0.169;0.017;0.002;0.013;0.003	B;B;B;B;B;B	0.31442	0.01;0.13;0.1;0.006;0.035;0.01	T	0.31280	-0.9949	10	0.16896	T	0.51	.	15.9715	0.80025	0.0648:0.0:0.9352:0.0	.	163;149;135;125;230;135	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	230;149;135;125;163;135	ENSP00000356832:L230V;ENSP00000396242:L149V;ENSP00000237305:L135V;ENSP00000356831:L125V;ENSP00000434450:L163V;ENSP00000434302:L135V	ENSP00000237305:L135V	L	-	1	2	SGK1	134536119	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.089000	0.57685	1.599000	0.50093	0.655000	0.94253	CTG	.	.	none		0.378	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
PI15	51050	hgsc.bcm.edu	37	8	75737657	75737657	+	Missense_Mutation	SNP	G	G	A	rs141788887	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:75737657G>A	ENST00000260113.2	+	2	352	c.173G>A	c.(172-174)cGg>cAg	p.R58Q	RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000518128.1_RNA|PI15_ENST00000523773.1_Missense_Mutation_p.R58Q	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	58						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			AAAGCCAGGCGGAAGCGCTAC	0.448													G|||	10	0.00199681	0.0068	0.0014	5008	,	,		17888	0.0		0.0	False		,,,				2504	0.0				p.R58Q		Atlas-SNP	.											.	PI15	73	.	0			c.G173A						PASS	.	G	GLN/ARG	28,4378	35.2+/-66.4	0,28,2175	85.0	76.0	79.0		173	4.4	1.0	8	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PI15	NM_015886.3	43	0,29,6474	AA,AG,GG		0.0116,0.6355,0.223	probably-damaging	58/259	75737657	29,12977	2203	4300	6503	SO:0001583	missense	51050	exon2			CCAGGCGGAAGCG	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.173G>A	8.37:g.75737657G>A	ENSP00000260113:p.Arg58Gln	70.0	0.0	0		87.0	14.0	0.16092	NM_015886	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	37	CCDS6218.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	G	13.03	2.115943	0.37339	0.006355	1.16E-4	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.09630	2.96;2.96	5.35	4.45	0.53987	CAP domain (2);	0.169477	0.49916	D	0.000123	T	0.07773	0.0195	M	0.68593	2.085	0.48040	D	0.999577	P	0.49559	0.925	B	0.34301	0.179	T	0.28713	-1.0035	10	0.13108	T	0.6	.	16.2838	0.82709	0.0:0.1326:0.8674:0.0	.	58	O43692	PI15_HUMAN	Q	58	ENSP00000260113:R58Q;ENSP00000428567:R58Q	ENSP00000260113:R58Q	R	+	2	0	PI15	75900212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.032000	0.64140	1.585000	0.49928	0.655000	0.94253	CGG	G|0.997;A|0.003	0.003	strong		0.448	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
TMC5	79838	hgsc.bcm.edu	37	16	19498605	19498605	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:19498605T>C	ENST00000396229.2	+	17	3279	c.2530T>C	c.(2530-2532)Tcc>Ccc	p.S844P	TMC5_ENST00000381414.4_Missense_Mutation_p.S844P|TMC5_ENST00000561503.1_Missense_Mutation_p.S485P|TMC5_ENST00000219821.5_Missense_Mutation_p.S598P|TMC5_ENST00000542583.2_Missense_Mutation_p.S844P|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000541464.1_Missense_Mutation_p.S792P|TMC5_ENST00000564959.1_Missense_Mutation_p.S527P	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	844					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CTTTTTCCCATCCTTCACCGG	0.532																																					p.S844P		Atlas-SNP	.											.	TMC5	169	.	0			c.T2530C						PASS	.						75.0	65.0	69.0					16																	19498605		2197	4300	6497	SO:0001583	missense	79838	exon17			TTCCCATCCTTCA	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2530T>C	16.37:g.19498605T>C	ENSP00000379531:p.Ser844Pro	78.0	0.0	0		98.0	17.0	0.173469	NM_001105249	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499431	0.85069	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.71817	-0.34;-0.28;-0.48;-0.48;-0.6	5.72	5.72	0.89469	.	0.165964	0.56097	D	0.000036	D	0.84982	0.5593	M	0.84948	2.725	0.44862	D	0.997878	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.87578	0.998;0.979;0.994;0.992;0.991;0.996	D	0.85275	0.1058	10	0.37606	T	0.19	-27.6788	14.9732	0.71249	0.0:0.0:0.0:1.0	.	792;527;598;598;844;844	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	P	792;844;844;844;598;527	ENSP00000441227:S792P;ENSP00000370822:S844P;ENSP00000379531:S844P;ENSP00000446274:S844P;ENSP00000219821:S598P	ENSP00000219821:S598P	S	+	1	0	TMC5	19406106	1.000000	0.71417	0.957000	0.39632	0.995000	0.86356	5.372000	0.66156	2.176000	0.68965	0.533000	0.62120	TCC	.	.	none		0.532	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
TNFRSF14	8764	hgsc.bcm.edu	37	1	2491336	2491336	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:2491336T>C	ENST00000355716.4	+	4	678	c.379T>C	c.(379-381)Tgc>Cgc	p.C127R	RP3-395M20.8_ENST00000416860.2_RNA|RP3-395M20.8_ENST00000452793.1_RNA|TNFRSF14_ENST00000409119.1_Missense_Mutation_p.C127R	NM_003820.2	NP_003811.2	Q92956	TNR14_HUMAN	tumor necrosis factor receptor superfamily, member 14	127					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell migration (GO:2000406)|T cell costimulation (GO:0031295)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			kidney(1)	1	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;1.11e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000326)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.199)		AGGCCACTTCTGCATCGTCCA	0.692			"""Mis, N, F"""		follicular lymphoma																																p.C127R		Atlas-SNP	.		Rec	yes		1	1p36.32	8764	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""		L	.	TNFRSF14	89	.	0			c.T379C						PASS	.						35.0	36.0	35.0					1																	2491336		2193	4297	6490	SO:0001583	missense	8764	exon4			CACTTCTGCATCG	U70321	CCDS44046.1	1p36.32	2012-02-27	2011-08-11		ENSG00000157873	ENSG00000157873		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11912	protein-coding gene	gene with protein product	"""herpesvirus entry mediator"""	602746	"""tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)"""			8898196, 9162061	Standard	XM_006711018		Approved	HVEM, ATAR, TR2, LIGHTR, HVEA, CD270	uc001ajt.1	Q92956	OTTHUMG00000000792	ENST00000355716.4:c.379T>C	1.37:g.2491336T>C	ENSP00000347948:p.Cys127Arg	357.0	1.0	0.00280112		113.0	39.0	0.345133	NM_003820	B3KW30|B9DI89|Q6IB95|Q8N634|Q8WXR1|Q96J31|Q9UM65	Missense_Mutation	SNP	ENST00000355716.4	37	CCDS44046.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.325399	0.41197	.	.	ENSG00000157873	ENST00000426449;ENST00000434817;ENST00000435221;ENST00000451778;ENST00000409119;ENST00000355716	T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	3.57	3.57	0.40892	TNFR/CD27/30/40/95 cysteine-rich region (1);	.	.	.	.	T	0.79358	0.4432	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81549	-0.0882	9	0.87932	D	0	-11.917	8.7123	0.34391	0.0:0.0:0.0:1.0	.	127	Q92956	TNR14_HUMAN	R	127	ENSP00000411854:C127R;ENSP00000415254:C127R;ENSP00000399292:C127R;ENSP00000399533:C127R;ENSP00000386859:C127R;ENSP00000347948:C127R	ENSP00000347948:C127R	C	+	1	0	TNFRSF14	2483082	0.009000	0.17119	0.985000	0.45067	0.221000	0.24807	0.389000	0.20751	1.642000	0.50584	0.379000	0.24179	TGC	.	.	none		0.692	TNFRSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002088.1		
ZFX	7543	hgsc.bcm.edu	37	X	24229366	24229366	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:24229366G>A	ENST00000379177.1	+	11	2718	c.2291G>A	c.(2290-2292)cGg>cAg	p.R764Q	ZFX_ENST00000304543.5_Missense_Mutation_p.R764Q|ZFX_ENST00000540034.1_Missense_Mutation_p.R803Q|ZFX_ENST00000338565.3_Missense_Mutation_p.R714Q|ZFX_ENST00000379188.3_Missense_Mutation_p.R764Q|ZFX_ENST00000539115.1_Missense_Mutation_p.R535Q	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	764					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						GGCTTTAAACGGCACGTTATT	0.448																																					p.R764Q	Esophageal Squamous(20;306 562 7346 32868 37983)	Atlas-SNP	.											.	ZFX	61	.	0			c.G2291A						PASS	.						178.0	149.0	158.0					X																	24229366		2203	4300	6503	SO:0001583	missense	7543	exon10			TTAAACGGCACGT		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.2291G>A	X.37:g.24229366G>A	ENSP00000368475:p.Arg764Gln	205.0	0.0	0		240.0	53.0	0.220833	NM_003410	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	37	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961282	0.74016	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000014	T	0.36771	0.0979	L	0.48362	1.52	0.54753	D	0.999989	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.993	T	0.03433	-1.1037	10	0.42905	T	0.14	-6.7851	18.0792	0.89437	0.0:0.0:1.0:0.0	.	803;486;764	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	Q	535;764;486;764;764;803;714	ENSP00000438233:R535Q;ENSP00000368486:R764Q;ENSP00000368475:R764Q;ENSP00000304985:R764Q;ENSP00000441382:R803Q;ENSP00000343384:R714Q	ENSP00000304985:R764Q	R	+	2	0	ZFX	24139287	1.000000	0.71417	0.924000	0.36721	0.948000	0.59901	9.813000	0.99286	2.291000	0.77112	0.594000	0.82650	CGG	.	.	none		0.448	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
SGK1	6446	hgsc.bcm.edu	37	6	134494432	134494432	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134494432C>G	ENST00000237305.7	-	5	485	c.397G>C	c.(397-399)Gca>Cca	p.A133P	SGK1_ENST00000367858.5_Missense_Mutation_p.A228P|SGK1_ENST00000475719.2_Missense_Mutation_p.A133P|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Missense_Mutation_p.A161P|SGK1_ENST00000367857.5_Missense_Mutation_p.A123P|SGK1_ENST00000413996.3_Missense_Mutation_p.A147P	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	133	Glu/Lys-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTCAGGATTGCTTTCTTCTGT	0.383																																					p.A228P		Atlas-SNP	.											.	SGK1	387	.	0			c.G682C						PASS	.						114.0	114.0	114.0					6																	134494432		2203	4300	6503	SO:0001583	missense	6446	exon7			GGATTGCTTTCTT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.397G>C	6.37:g.134494432C>G	ENSP00000237305:p.Ala133Pro	148.0	0.0	0		157.0	21.0	0.133758	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565036	0.86439	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719	T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;1.81	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.096985	0.64402	D	0.000001	T	0.61702	0.2368	N	0.24115	0.695	0.80722	D	1	D;D;P;P;D;P	0.67145	0.977;0.979;0.907;0.936;0.996;0.948	P;P;P;P;P;P	0.60117	0.706;0.578;0.864;0.578;0.869;0.703	T	0.64326	-0.6434	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	161;147;133;123;228;133	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	P	228;147;133;123;161;133	ENSP00000356832:A228P;ENSP00000396242:A147P;ENSP00000237305:A133P;ENSP00000356831:A123P;ENSP00000434450:A161P;ENSP00000434302:A133P	ENSP00000237305:A133P	A	-	1	0	SGK1	134536125	1.000000	0.71417	0.994000	0.49952	0.999000	0.98932	5.920000	0.70017	2.941000	0.99782	0.655000	0.94253	GCA	.	.	none		0.383	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
SLC6A6	6533	hgsc.bcm.edu	37	3	14523273	14523273	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:14523273T>C	ENST00000454876.2	+	14	1975	c.1646T>C	c.(1645-1647)cTg>cCg	p.L549P	SLC6A6_ENST00000360861.3_Missense_Mutation_p.L549P			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	549					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						GGCTGGAGCCTGGCCCTTTCC	0.592																																					p.L549P		Atlas-SNP	.											.	SLC6A6	58	.	0			c.T1646C						PASS	.						136.0	119.0	125.0					3																	14523273		2203	4300	6503	SO:0001583	missense	6533	exon14			GGAGCCTGGCCCT		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.1646T>C	3.37:g.14523273T>C	ENSP00000398063:p.Leu549Pro	127.0	0.0	0		85.0	14.0	0.164706	NM_003043	B2RNU7|Q9BRI2|Q9BXB0	Missense_Mutation	SNP	ENST00000454876.2	37	CCDS33705.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.350042	0.82132	.	.	ENSG00000131389	ENST00000454876;ENST00000360861	T;T	0.80123	-1.34;-1.34	4.5	4.5	0.54988	.	0.074225	0.51477	D	0.000099	D	0.91713	0.7380	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.93800	0.7100	10	0.87932	D	0	.	14.1214	0.65189	0.0:0.0:0.0:1.0	.	549	P31641	SC6A6_HUMAN	P	549	ENSP00000398063:L549P;ENSP00000354107:L549P	ENSP00000354107:L549P	L	+	2	0	SLC6A6	14498277	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	7.988000	0.88194	1.789000	0.52484	0.377000	0.23210	CTG	.	.	none		0.592	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340507.1	NM_003043	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122289	38122289	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:38122289C>T	ENST00000406386.3	+	7	3981	c.3726C>T	c.(3724-3726)ccC>ccT	p.P1242P		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1242					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCCTGGCACCCTCACCTTCAC	0.701																																					p.P1242P		Atlas-SNP	.											.	TRIOBP	262	.	0			c.C3726T						PASS	.						27.0	35.0	32.0					22																	38122289		1912	4097	6009	SO:0001819	synonymous_variant	11078	exon7			GGCACCCTCACCT	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3726C>T	22.37:g.38122289C>T		112.0	0.0	0		82.0	4.0	0.0487805	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	37	CCDS43015.1																																																																																			.	.	none		0.701	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
NF1	4763	hgsc.bcm.edu	37	17	29667603	29667603	+	Silent	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:29667603T>G	ENST00000358273.4	+	47	7385	c.7002T>G	c.(7000-7002)ggT>ggG	p.G2334G	NF1_ENST00000356175.3_Silent_p.G2313G|NF1_ENST00000417592.2_Silent_p.G47G|NF1_ENST00000444181.2_Silent_p.G127G	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2334					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ATTCAGCAGGTACCGCACTTC	0.438			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.G2334G		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	1586	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.T7002G						PASS	.						122.0	108.0	113.0					17																	29667603		2203	4300	6503	SO:0001819	synonymous_variant	4763	exon47	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	AGCAGGTACCGCA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7002T>G	17.37:g.29667603T>G		151.0	0.0	0		155.0	22.0	0.141935	NM_001042492	O00662|Q14284|Q14930|Q14931|Q9UMK3	Silent	SNP	ENST00000358273.4	37	CCDS42292.1																																																																																			.	.	none		0.438	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
STK17A	9263	hgsc.bcm.edu	37	7	43664438	43664438	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:43664438C>G	ENST00000319357.5	+	7	1421	c.1242C>G	c.(1240-1242)taC>taG	p.Y414*		NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	414					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						AATTTATCTACTGAGCAATAT	0.348																																					p.Y414X		Atlas-SNP	.											.	STK17A	31	.	0			c.C1242G						PASS	.						37.0	39.0	38.0					7																	43664438		2200	4298	6498	SO:0001587	stop_gained	9263	exon7			TATCTACTGAGCA	AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.1242C>G	7.37:g.43664438C>G	ENSP00000319192:p.Tyr414*	26.0	0.0	0		23.0	9.0	0.391304	NM_004760	A4D1V6|Q8IVC8	Nonsense_Mutation	SNP	ENST00000319357.5	37	CCDS5470.1	.	.	.	.	.	.	.	.	.	.	C	38	6.861793	0.97893	.	.	ENSG00000164543	ENST00000319357	.	.	.	4.94	4.94	0.65067	.	0.000000	0.43260	D	0.000582	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.1523	0.89678	0.0:1.0:0.0:0.0	.	.	.	.	X	414	.	ENSP00000319192:Y414X	Y	+	3	2	STK17A	43630963	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.531000	0.53546	2.259000	0.74868	0.557000	0.71058	TAC	.	.	none		0.348	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250902.1	NM_004760	
TTLL4	9654	hgsc.bcm.edu	37	2	219602439	219602439	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:219602439C>T	ENST00000392102.1	+	3	380	c.40C>T	c.(40-42)Cgc>Tgc	p.R14C	TTLL4_ENST00000258398.4_Missense_Mutation_p.R14C|TTLL4_ENST00000457313.1_Intron|TTLL4_ENST00000442769.1_Missense_Mutation_p.R14C	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	14					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TATTGGCCTCCGCCAGAAAAA	0.592																																					p.R14C	GBM(172;1818 2053 15407 20943 49753)	Atlas-SNP	.											.	TTLL4	96	.	0			c.C40T						PASS	.						57.0	57.0	57.0					2																	219602439		2203	4300	6503	SO:0001583	missense	9654	exon3			GGCCTCCGCCAGA		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.40C>T	2.37:g.219602439C>T	ENSP00000375951:p.Arg14Cys	119.0	0.0	0		120.0	17.0	0.141667	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	37	CCDS2422.1	.	.	.	.	.	.	.	.	.	.	c	7.873	0.728577	0.15507	.	.	ENSG00000135912	ENST00000415717;ENST00000392102;ENST00000437755;ENST00000442769;ENST00000424644;ENST00000258398	T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83	5.32	0.493	0.16878	.	0.620848	0.15371	N	0.265860	T	0.14141	0.0342	N	0.20986	0.625	0.28758	N	0.901088	B;B	0.13145	0.004;0.007	B;B	0.04013	0.001;0.001	T	0.14476	-1.0471	10	0.87932	D	0	.	4.2465	0.10674	0.1639:0.4106:0.0:0.4255	.	14;14	E7EX20;Q14679	.;TTLL4_HUMAN	C	14	ENSP00000411228:R14C;ENSP00000375951:R14C;ENSP00000391342:R14C;ENSP00000396555:R14C;ENSP00000405485:R14C;ENSP00000258398:R14C	ENSP00000258398:R14C	R	+	1	0	TTLL4	219310683	0.139000	0.22563	0.923000	0.36655	0.461000	0.32589	-0.000000	0.12993	0.011000	0.14865	-0.970000	0.02610	CGC	.	.	none		0.592	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
PARP1	142	hgsc.bcm.edu	37	1	226573325	226573325	+	Silent	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:226573325T>C	ENST00000366794.5	-	7	1034	c.891A>G	c.(889-891)gaA>gaG	p.E297E		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	297					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		GACCCGAGCATTCCTCGCAGG	0.562								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.E297E		Atlas-SNP	.											.	PARP1	100	.	0			c.A891G						PASS	.						115.0	98.0	103.0					1																	226573325		2203	4300	6503	SO:0001819	synonymous_variant	142	exon7			CGAGCATTCCTCG	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.891A>G	1.37:g.226573325T>C		98.0	0.0	0		108.0	5.0	0.0462963	NM_001618	B1ANJ4|Q8IUZ9	Silent	SNP	ENST00000366794.5	37	CCDS1554.1																																																																																			.	.	none		0.562	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
CDH16	1014	hgsc.bcm.edu	37	16	66944286	66944286	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:66944286G>A	ENST00000299752.4	-	15	2237	c.2044C>T	c.(2044-2046)Cat>Tat	p.H682Y	CDH16_ENST00000568632.1_Missense_Mutation_p.H585Y|CDH16_ENST00000565796.1_Missense_Mutation_p.H643Y|CDH16_ENST00000570262.1_Missense_Mutation_p.H602Y|CDH16_ENST00000394055.3_Missense_Mutation_p.H660Y	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	682	Ectodomain G.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		ATCAAGCCATGGTCTTGGCGG	0.632																																					p.H682Y		Atlas-SNP	.											.	CDH16	91	.	0			c.C2044T						PASS	.						111.0	113.0	112.0					16																	66944286		2200	4300	6500	SO:0001583	missense	1014	exon15			AGCCATGGTCTTG	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.2044C>T	16.37:g.66944286G>A	ENSP00000299752:p.His682Tyr	143.0	0.0	0		135.0	25.0	0.185185	NM_004062	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	G	0.692	-0.794195	0.02862	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.55234	0.53;0.53	4.61	2.56	0.30785	.	0.293204	0.32884	N	0.005525	T	0.29491	0.0735	L	0.31294	0.92	0.25809	N	0.984415	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.26538	-1.0100	10	0.02654	T	1	-0.7022	4.7712	0.13157	0.3365:0.0:0.6635:0.0	.	660;682;682	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	Y	660;682;646	ENSP00000377619:H660Y;ENSP00000299752:H682Y	ENSP00000299752:H682Y	H	-	1	0	CDH16	65501787	0.596000	0.26866	0.456000	0.27044	0.193000	0.23685	1.826000	0.39092	0.477000	0.27464	0.455000	0.32223	CAT	.	.	none		0.632	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	
PRDM9	56979	hgsc.bcm.edu	37	5	23526430	23526430	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:23526430C>T	ENST00000296682.3	+	11	1415	c.1233C>T	c.(1231-1233)caC>caT	p.H411H		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	411					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						AACGCAATCACTCCTCTCAGA	0.483										HNSCC(3;0.000094)																											p.H411H		Atlas-SNP	.											.	PRDM9	344	.	0			c.C1233T						PASS	.						131.0	123.0	126.0					5																	23526430		2203	4300	6503	SO:0001819	synonymous_variant	56979	exon11			CAATCACTCCTCT	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1233C>T	5.37:g.23526430C>T		240.0	0.0	0		231.0	38.0	0.164502	NM_020227	B4DX22|Q27Q50	Silent	SNP	ENST00000296682.3	37	CCDS43307.1																																																																																			.	.	none		0.483	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
MAPK7	5598	hgsc.bcm.edu	37	17	19285517	19285517	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:19285517C>T	ENST00000308406.5	+	5	2287	c.1901C>T	c.(1900-1902)cCa>cTa	p.P634L	MAPK7_ENST00000395604.3_Missense_Mutation_p.P634L|MAPK7_ENST00000299612.7_Missense_Mutation_p.P495L|MAPK7_ENST00000571657.1_Intron|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000395602.4_Missense_Mutation_p.P634L	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	634	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)			autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCTGCCTGCCCACCCCCTGGC	0.706																																					p.P634L		Atlas-SNP	.											.	MAPK7	72	.	0			c.C1901T						PASS	.						17.0	18.0	18.0					17																	19285517		2190	4285	6475	SO:0001583	missense	5598	exon5			CCTGCCCACCCCC	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1901C>T	17.37:g.19285517C>T	ENSP00000311005:p.Pro634Leu	128.0	0.0	0		59.0	13.0	0.220339	NM_002749	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	9.264	1.043860	0.19748	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.77489	-0.78;-1.1;-0.78;-0.78	4.87	2.72	0.32119	.	0.502080	0.21467	N	0.074080	T	0.55130	0.1901	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49952	-0.8884	10	0.59425	D	0.04	-0.6152	6.3873	0.21568	0.1809:0.7178:0.0:0.1013	.	634	Q13164	MK07_HUMAN	L	634;495;634;634	ENSP00000311005:P634L;ENSP00000299612:P495L;ENSP00000378968:P634L;ENSP00000378966:P634L	ENSP00000299612:P495L	P	+	2	0	MAPK7	19226110	0.001000	0.12720	0.025000	0.17156	0.710000	0.40934	0.264000	0.18497	1.174000	0.42811	0.313000	0.20887	CCA	.	.	none		0.706	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
DSCR4	10281	hgsc.bcm.edu	37	21	39493346	39493346	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr21:39493346A>G	ENST00000328264.3	-	1	108	c.4T>C	c.(4-6)Tcg>Ccg	p.S2P	DSCR4_ENST00000398948.1_Missense_Mutation_p.S2P|DSCR8_ENST00000357704.4_5'Flank|DSCR8_ENST00000400477.3_5'Flank	NM_005867.2	NP_005858.1	P56555	DSCR4_HUMAN	Down syndrome critical region gene 4	2										large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	6						atgattaacgacatggacaca	0.498																																					p.S2P		Atlas-SNP	.											.	DSCR4	20	.	0			c.T4C						PASS	.						95.0	84.0	88.0					21																	39493346		2203	4300	6503	SO:0001583	missense	10281	exon1			TTAACGACATGGA	AB000099	CCDS33554.1	21q22.2	2012-04-19			ENSG00000184029	ENSG00000184029			3045	protein-coding gene	gene with protein product		604829				9455479	Standard	NM_005867		Approved	DCRB	uc002ywp.3	P56555	OTTHUMG00000086673	ENST00000328264.3:c.4T>C	21.37:g.39493346A>G	ENSP00000328676:p.Ser2Pro	48.0	0.0	0		58.0	15.0	0.258621	NM_005867	Q4VB31	Missense_Mutation	SNP	ENST00000328264.3	37	CCDS33554.1	.	.	.	.	.	.	.	.	.	.	A	6.972	0.549360	0.13374	.	.	ENSG00000184029	ENST00000398948;ENST00000328264	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	T	0.51210	0.1661	.	.	.	0.09310	N	1	P	0.51449	0.945	P	0.57425	0.82	T	0.40156	-0.9578	6	0.87932	D	0	.	.	.	.	.	2	P56555	DSCR4_HUMAN	P	2	.	ENSP00000328676:S2P	S	-	1	0	DSCR4	38415216	0.003000	0.15002	0.015000	0.15790	0.015000	0.08874	-0.597000	0.05713	0.263000	0.21812	0.260000	0.18958	TCG	.	.	none		0.498	DSCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000194834.1	NM_005867	
LAMA4	3910	hgsc.bcm.edu	37	6	112537639	112537639	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:112537639G>A	ENST00000230538.7	-	3	624	c.227C>T	c.(226-228)tCg>tTg	p.S76L	RP1-142L7.9_ENST00000603682.1_lincRNA|LAMA4_ENST00000522006.1_Missense_Mutation_p.S76L|LAMA4_ENST00000524032.1_5'UTR|LAMA4_ENST00000389463.4_Missense_Mutation_p.S76L|LAMA4_ENST00000431543.2_Missense_Mutation_p.S76L|LAMA4_ENST00000424408.2_Missense_Mutation_p.S76L	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	76					blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		ACATTCTCCCGACAGGGTGTG	0.433																																					p.S76L		Atlas-SNP	.											.	LAMA4	227	.	0			c.C227T						PASS	.						111.0	93.0	99.0					6																	112537639		2203	4300	6503	SO:0001583	missense	3910	exon3			TCTCCCGACAGGG		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.227C>T	6.37:g.112537639G>A	ENSP00000230538:p.Ser76Leu	78.0	0.0	0		100.0	25.0	0.25	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	37	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819282	0.50633	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588;ENST00000368639;ENST00000519932;ENST00000431543;ENST00000243219;ENST00000521690	T;T;T;T;T;D;D	0.97731	2.5;2.49;2.49;2.49;1.6;-4.51;-4.51	5.84	5.84	0.93424	.	0.216402	0.41001	D	0.000980	D	0.96917	0.8993	N	0.24115	0.695	0.80722	D	1	D;P;D	0.89917	1.0;0.916;0.998	D;P;D	0.74023	0.964;0.541;0.982	D	0.96804	0.9591	10	0.38643	T	0.18	.	17.6392	0.88130	0.0:0.0:1.0:0.0	.	76;76;76	Q6LET9;Q16363;Q16363-2	.;LAMA4_HUMAN;.	L	76	ENSP00000230538:S76L;ENSP00000429488:S76L;ENSP00000374114:S76L;ENSP00000416470:S76L;ENSP00000430336:S76L;ENSP00000428583:S76L;ENSP00000412136:S76L	ENSP00000230538:S76L	S	-	2	0	LAMA4	112644332	0.998000	0.40836	0.238000	0.24106	0.008000	0.06430	6.253000	0.72453	2.748000	0.94277	0.650000	0.86243	TCG	.	.	none		0.433	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
RNF166	115992	hgsc.bcm.edu	37	16	88766062	88766062	+	Missense_Mutation	SNP	C	C	T	rs144508728		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:88766062C>T	ENST00000312838.4	-	3	486	c.391G>A	c.(391-393)Gtc>Atc	p.V131I	RNF166_ENST00000541206.2_Missense_Mutation_p.V22I|RNF166_ENST00000537718.2_Missense_Mutation_p.V22I|RNF166_ENST00000568683.1_Missense_Mutation_p.V22I|RNF166_ENST00000562499.1_5'Flank|RP5-1142A6.5_ENST00000561699.1_RNA|RNF166_ENST00000567844.1_Missense_Mutation_p.V50I	NM_178841.3	NP_849163.1	Q96A37	RN166_HUMAN	ring finger protein 166	131							zinc ion binding (GO:0008270)			endometrium(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0476)		ACCACGGGGACGAACTTGGGG	0.622																																					p.V131I		Atlas-SNP	.											.	RNF166	3	.	0			c.G391A						PASS	.	C	ILE/VAL,ILE/VAL,ILE/VAL	1,4393	2.1+/-5.4	0,1,2196	135.0	105.0	115.0		148,64,391	4.6	1.0	16	dbSNP_134	115	1,8597	1.2+/-3.3	0,1,4298	no	missense,missense,missense	RNF166	NM_001171815.1,NM_001171816.1,NM_178841.3	29,29,29	0,2,6494	TT,TC,CC		0.0116,0.0228,0.0154	benign,benign,benign	50/157,22/129,131/238	88766062	2,12990	2197	4299	6496	SO:0001583	missense	115992	exon3			CGGGGACGAACTT	AK057106	CCDS10969.1, CCDS54056.1, CCDS54057.1	16q24.3	2013-01-09			ENSG00000158717	ENSG00000158717		"""RING-type (C3HC4) zinc fingers"""	28856	protein-coding gene	gene with protein product						12477932	Standard	NM_178841		Approved	MGC2647, MGC14381	uc002flk.3	Q96A37	OTTHUMG00000137863	ENST00000312838.4:c.391G>A	16.37:g.88766062C>T	ENSP00000326095:p.Val131Ile	145.0	0.0	0		99.0	4.0	0.040404	NM_178841	B3KQ03|D3DX75|H3BTU8|Q96DM0	Missense_Mutation	SNP	ENST00000312838.4	37	CCDS10969.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.905259	0.52333	2.28E-4	1.16E-4	ENSG00000158717	ENST00000312838;ENST00000537718;ENST00000541206	T	0.15718	2.4	4.57	4.57	0.56435	.	0.136393	0.49305	D	0.000153	T	0.07954	0.0199	N	0.14661	0.345	0.44309	D	0.997187	P	0.44659	0.84	B	0.25405	0.06	T	0.35500	-0.9786	10	0.18710	T	0.47	-28.0268	16.9747	0.86310	0.0:1.0:0.0:0.0	.	131	Q96A37	RN166_HUMAN	I	131;50;22	ENSP00000326095:V131I	ENSP00000326095:V131I	V	-	1	0	RNF166	87293563	0.998000	0.40836	0.987000	0.45799	0.967000	0.64934	3.918000	0.56432	2.115000	0.64714	0.313000	0.20887	GTC	C|1.000;T|0.000	0.000	weak		0.622	RNF166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269544.1	NM_178841	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230365	23230365	+	Silent	SNP	A	A	T	rs559053132	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:23230365A>T	ENST00000526893.1	+	1	406	c.132A>T	c.(130-132)gcA>gcT	p.A44A	IGLL5_ENST00000532223.2_Silent_p.A44A|IGLL5_ENST00000531372.1_Silent_p.A44A|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	44						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CAATGGTTGCACCGCAAAGCG	0.677																																					p.H9L		Atlas-SNP	.											.	IGLL5	26	.	0			c.A26T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGTTGCACCGCAA	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.132A>T	22.37:g.23230365A>T		157.0	0.0	0		114.0	28.0	0.245614	NM_001256296		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.677	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
OR5H6	79295	hgsc.bcm.edu	37	3	97983269	97983269	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:97983269C>A	ENST00000383696.2	+	1	182	c.141C>A	c.(139-141)ttC>ttA	p.F47L	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCCTGGCATTCTTGGTAATAT	0.413																																					p.F47L		Atlas-SNP	.											OR5H6,bladder,carcinoma,0,1	OR5H6	89	1	0			c.C141A						PASS	.						207.0	217.0	213.0					3																	97983269		2203	4299	6502	SO:0001583	missense	79295	exon1			GGCATTCTTGGTA	BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.141C>A	3.37:g.97983269C>A	ENSP00000373196:p.Phe47Leu	261.0	0.0	0		296.0	74.0	0.25	NM_001005479	Q6IF88	Missense_Mutation	SNP	ENST00000383696.2	37	CCDS33800.1	.	.	.	.	.	.	.	.	.	.	-	13.32	2.202696	0.38905	.	.	ENSG00000230301	ENST00000383696	T	0.04454	3.62	2.19	0.231	0.15377	.	0.000000	0.44902	D	0.000416	T	0.13756	0.0333	M	0.66297	2.02	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.02533	-1.1145	10	0.72032	D	0.01	.	6.0007	0.19519	0.0:0.6814:0.0:0.3186	.	47	Q8NGV6	OR5H6_HUMAN	L	47	ENSP00000373196:F47L	ENSP00000373196:F47L	F	+	3	2	OR5H6	99465959	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	-0.601000	0.05687	0.251000	0.21505	0.194000	0.17425	TTC	.	.	none		0.413	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359111.2		
KLK6	5653	hgsc.bcm.edu	37	19	51466703	51466703	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:51466703G>A	ENST00000376851.3	-	4	739	c.300C>T	c.(298-300)gcC>gcT	p.A100A	KLK6_ENST00000456750.2_5'Flank|KLK6_ENST00000376853.4_Intron|KLK6_ENST00000391808.1_5'UTR|KLK6_ENST00000310157.2_Silent_p.A100A|CTB-147C22.8_ENST00000601506.1_RNA|KLK6_ENST00000594641.1_Silent_p.A100A	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	100	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CATGGCTGGCGGCATCATAGT	0.582																																					p.A100A		Atlas-SNP	.											.	KLK6	35	.	0			c.C300T						PASS	.						81.0	63.0	69.0					19																	51466703		2203	4300	6503	SO:0001819	synonymous_variant	5653	exon4			GCTGGCGGCATCA	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.300C>T	19.37:g.51466703G>A		147.0	0.0	0		133.0	28.0	0.210526	NM_001012964	A6NJA1|A8MW09|Q6H301	Silent	SNP	ENST00000376851.3	37	CCDS12811.1																																																																																			.	.	none		0.582	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
KRTCAP3	200634	hgsc.bcm.edu	37	2	27666008	27666008	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:27666008T>C	ENST00000543753.1	+	4	388	c.341T>C	c.(340-342)cTt>cCt	p.L114P	KRTCAP3_ENST00000288873.3_Missense_Mutation_p.L114P|KRTCAP3_ENST00000407293.1_Missense_Mutation_p.L96P	NM_001168364.1	NP_001161836.1	Q53RY4	KCP3_HUMAN	keratinocyte associated protein 3	114						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)	3	Acute lymphoblastic leukemia(172;0.155)					CTGGGCCTCCTTCTTGCTGTG	0.627																																					p.L114P		Atlas-SNP	.											.	KRTCAP3	12	.	0			c.T341C						PASS	.						138.0	144.0	142.0					2																	27666008		2203	4300	6503	SO:0001583	missense	200634	exon4			GCCTCCTTCTTGC	AY157576	CCDS1754.1	2p23.3	2008-02-05			ENSG00000157992	ENSG00000157992			28943	protein-coding gene	gene with protein product							Standard	NM_173853		Approved	KCP3	uc002rks.3	Q53RY4	OTTHUMG00000097782	ENST00000543753.1:c.341T>C	2.37:g.27666008T>C	ENSP00000442400:p.Leu114Pro	127.0	0.0	0		100.0	4.0	0.04	NM_173853	B7ZL49|Q6UW42|Q8IWS5	Missense_Mutation	SNP	ENST00000543753.1	37	CCDS1754.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.014958	0.75161	.	.	ENSG00000157992	ENST00000543753;ENST00000288873;ENST00000407293	T;T;T	0.51071	0.72;0.72;0.72	5.77	5.77	0.91146	.	0.187045	0.47093	D	0.000255	T	0.64461	0.2600	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67925	-0.5544	10	0.87932	D	0	-14.8246	10.1184	0.42605	0.0:0.0789:0.0:0.9211	.	114	Q53RY4	KCP3_HUMAN	P	114;114;96	ENSP00000442400:L114P;ENSP00000288873:L114P;ENSP00000384689:L96P	ENSP00000288873:L114P	L	+	2	0	KRTCAP3	27519512	0.998000	0.40836	0.993000	0.49108	0.893000	0.52053	3.967000	0.56802	2.201000	0.70794	0.459000	0.35465	CTT	.	.	none		0.627	KRTCAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215025.1	NM_173853	
LIMS1	3987	hgsc.bcm.edu	37	2	109300340	109300340	+	Splice_Site	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:109300340G>A	ENST00000393310.1	+	10	1030		c.e10-1		LIMS1_ENST00000410093.1_Splice_Site|LIMS1_ENST00000544547.1_Splice_Site|LIMS1_ENST00000409441.1_Splice_Site|LIMS1_ENST00000332345.6_Splice_Site|LIMS1_ENST00000338045.3_Splice_Site|LIMS1_ENST00000542845.1_Splice_Site	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						TTTGTCTTTAGGAATAAGTTT	0.323																																					.		Atlas-SNP	.											.	LIMS1	38	.	0			c.900-1G>A						PASS	.						52.0	55.0	54.0					2																	109300340		2200	4299	6499	SO:0001630	splice_region_variant	3987	exon10			TCTTTAGGAATAA		CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.864-1G>A	2.37:g.109300340G>A		154.0	0.0	0		202.0	46.0	0.227723	NM_001193483	B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Splice_Site	SNP	ENST00000393310.1	37	CCDS2078.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573303	0.86542	.	.	ENSG00000169756	ENST00000544547;ENST00000332345;ENST00000393310;ENST00000410093;ENST00000409441;ENST00000338045;ENST00000542845	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LIMS1	108666772	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.827000	0.99397	2.873000	0.98535	0.563000	0.77884	.	.	.	none		0.323	LIMS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253596.1	NM_004987	Intron
PDE5A	8654	hgsc.bcm.edu	37	4	120460116	120460116	+	Splice_Site	SNP	G	G	A	rs142017762		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:120460116G>A	ENST00000354960.3	-	11	1950	c.1631C>T	c.(1630-1632)gCg>gTg	p.A544V	PDE5A_ENST00000512739.1_5'UTR|PDE5A_ENST00000394439.1_Splice_Site_p.A492V|PDE5A_ENST00000264805.5_Splice_Site_p.A502V|RP11-33B1.1_ENST00000498873.1_RNA	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	544					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	GATAATTACCGCTAACGACTG	0.343																																					p.A544V		Atlas-SNP	.											.	PDE5A	83	.	0			c.C1631T						PASS	.	G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	137.0	152.0	147.0		1631,1505,1475	4.9	1.0	4	dbSNP_134	147	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice,missense-near-splice	PDE5A	NM_001083.3,NM_033430.2,NM_033437.3	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	544/876,502/834,492/824	120460116	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	8654	exon11			ATTACCGCTAACG	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1632+1C>T	4.37:g.120460116G>A		86.0	0.0	0		127.0	16.0	0.125984	NM_001083	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	37	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.832877	0.50951	0.0	1.16E-4	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.62941	-0.01;0.04;0.04	5.8	4.94	0.65067	.	0.317482	0.32655	N	0.005809	T	0.46483	0.1395	N	0.16478	0.41	0.47737	D	0.999504	B;B	0.13145	0.007;0.002	B;B	0.04013	0.0;0.001	T	0.30794	-0.9966	10	0.23302	T	0.38	.	15.7381	0.77863	0.0:0.0:0.8623:0.1377	.	544;502	O76074;O76074-2	PDE5A_HUMAN;.	V	544;492;502	ENSP00000347046:A544V;ENSP00000377957:A492V;ENSP00000264805:A502V	ENSP00000264805:A502V	A	-	2	0	PDE5A	120679564	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	4.056000	0.57448	1.411000	0.46957	0.650000	0.86243	GCG	G|1.000;A|0.000	0.000	weak		0.343	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	Missense_Mutation
SCN11A	11280	hgsc.bcm.edu	37	3	38924723	38924723	+	Splice_Site	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:38924723C>T	ENST00000302328.3	-	18	3418		c.e18+1		SCN11A_ENST00000450244.1_Splice_Site|SCN11A_ENST00000456224.3_Splice_Site|SCN11A_ENST00000444237.2_Splice_Site	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGATGATTTACCAGTGCCCCA	0.488																																					.		Atlas-SNP	.											.	SCN11A	296	.	0			c.3219+1G>A						PASS	.						93.0	83.0	87.0					3																	38924723		2203	4300	6503	SO:0001630	splice_region_variant	11280	exon19			GATTTACCAGTGC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3219+1G>A	3.37:g.38924723C>T		72.0	0.0	0		82.0	4.0	0.0487805	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Splice_Site	SNP	ENST00000302328.3	37	CCDS33737.1	.	.	.	.	.	.	.	.	.	.	C	31	5.080272	0.94050	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.776	0.96393	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCN11A	38899727	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.453000	0.80700	2.840000	0.97914	0.655000	0.94253	.	.	.	none		0.488	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	Intron
PLXNB2	23654	hgsc.bcm.edu	37	22	50728063	50728063	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:50728063G>A	ENST00000449103.1	-	3	1091	c.951C>T	c.(949-951)gaC>gaT	p.D317D	PLXNB2_ENST00000359337.4_Silent_p.D317D			O15031	PLXB2_HUMAN	plexin B2	317	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGTGCACCTTGTCCAGCGGGA	0.642																																					p.D317D		Atlas-SNP	.											.	PLXNB2	172	.	0			c.C951T						PASS	.						42.0	51.0	48.0					22																	50728063		1949	4160	6109	SO:0001819	synonymous_variant	23654	exon3			CACCTTGTCCAGC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.951C>T	22.37:g.50728063G>A		65.0	0.0	0		42.0	10.0	0.238095	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	ENST00000449103.1	37	CCDS43035.1																																																																																			.	.	none		0.642	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
CYYR1	116159	hgsc.bcm.edu	37	21	27945186	27945186	+	Splice_Site	SNP	C	C	T	rs576125420		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr21:27945186C>T	ENST00000299340.4	-	1	417		c.e1+1		CYYR1_ENST00000400043.3_Splice_Site|CYYR1_ENST00000435845.2_Splice_Site	NM_052954.2	NP_443186.1	Q96J86	CYYR1_HUMAN	cysteine/tyrosine-rich 1							integral component of membrane (GO:0016021)				large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	15						CCGTCACTGACCTGCGTAGAC	0.662																																					.		Atlas-SNP	.											.	CYYR1	38	.	0			c.73+1G>A						PASS	.						58.0	58.0	58.0					21																	27945186		2203	4299	6502	SO:0001630	splice_region_variant	116159	exon2			CACTGACCTGCGT	AY061853	CCDS13578.1	21q21.2	2014-07-04	2005-07-24		ENSG00000166265	ENSG00000166265			16274	protein-coding gene	gene with protein product			"""cysteine and tyrosine-rich 1"""	C21orf95		12036297, 12062809, 24981926	Standard	NM_052954		Approved		uc002ymd.3	Q96J86	OTTHUMG00000078689	ENST00000299340.4:c.73+1G>A	21.37:g.27945186C>T		69.0	0.0	0		104.0	20.0	0.192308	NM_052954	A0A059TD09|A8MTU9|B2R845|Q53ER3|Q5JPD0|Q96NV7|R9QAJ4|W8CQB3	Splice_Site	SNP	ENST00000299340.4	37	CCDS13578.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919627	0.73098	.	.	ENSG00000166265	ENST00000299340;ENST00000435845;ENST00000400043	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.227	0.59921	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYYR1	26867057	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.229000	0.51278	2.835000	0.97688	0.650000	0.86243	.	.	.	none		0.662	CYYR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171654.2	NM_052954	Intron
SEMA3A	10371	hgsc.bcm.edu	37	7	83610791	83610791	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:83610791G>A	ENST00000265362.4	-	14	1812	c.1498C>T	c.(1498-1500)Caa>Taa	p.Q500*	SEMA3A_ENST00000436949.1_Nonsense_Mutation_p.Q500*	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	500	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ATATATAGTTGTTGCTGTGGA	0.418																																					p.Q500X		Atlas-SNP	.											.	SEMA3A	121	.	0			c.C1498T						PASS	.						55.0	56.0	56.0					7																	83610791		2203	4300	6503	SO:0001587	stop_gained	10371	exon14			ATAGTTGTTGCTG	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1498C>T	7.37:g.83610791G>A	ENSP00000265362:p.Gln500*	77.0	0.0	0		90.0	14.0	0.155556	NM_006080		Nonsense_Mutation	SNP	ENST00000265362.4	37	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	G	40	8.476428	0.98827	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	19.8579	0.96771	0.0:0.0:1.0:0.0	.	.	.	.	X	500	.	ENSP00000265362:Q500X	Q	-	1	0	SEMA3A	83448727	1.000000	0.71417	0.996000	0.52242	0.707000	0.40811	9.807000	0.99171	2.687000	0.91594	0.655000	0.94253	CAA	.	.	none		0.418	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
THRB	7068	hgsc.bcm.edu	37	3	24231681	24231681	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:24231681G>A	ENST00000356447.4	-	4	451	c.167C>T	c.(166-168)cCa>cTa	p.P56L	THRB_ENST00000396671.2_Missense_Mutation_p.P56L|THRB_ENST00000416420.1_Missense_Mutation_p.P56L	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	56	Modulating.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GATGAGATGTGGCGACGACTG	0.502																																					p.P56L	Melanoma(21;896 1043 15021 37958)	Atlas-SNP	.											.	THRB	52	.	0			c.C167T						PASS	.						247.0	234.0	239.0					3																	24231681		2203	4300	6503	SO:0001583	missense	7068	exon4			AGATGTGGCGACG		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.167C>T	3.37:g.24231681G>A	ENSP00000348827:p.Pro56Leu	204.0	0.0	0		246.0	48.0	0.195122	NM_000461	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Missense_Mutation	SNP	ENST00000356447.4	37	CCDS2641.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433453	0.25813	.	.	ENSG00000151090	ENST00000396671;ENST00000356447;ENST00000416420;ENST00000413780;ENST00000415021;ENST00000447875;ENST00000453729;ENST00000431815;ENST00000447414;ENST00000428492;ENST00000418247	D;D;D;D	0.96427	-3.13;-3.13;-3.13;-4.01	5.81	4.0	0.46444	.	.	.	.	.	D	0.91372	0.7278	N	0.24115	0.695	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	D	0.84018	0.0352	9	0.59425	D	0.04	.	6.734	0.23399	0.0673:0.1301:0.667:0.1356	.	56	P10828	THB_HUMAN	L	56;56;56;25;56;56;56;56;56;56;56	ENSP00000379904:P56L;ENSP00000348827:P56L;ENSP00000414444:P56L;ENSP00000414100:P25L	ENSP00000348827:P56L	P	-	2	0	THRB	24206685	0.034000	0.19679	0.421000	0.26609	0.342000	0.28953	1.173000	0.31920	0.781000	0.33589	0.655000	0.94253	CCA	.	.	none		0.502	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252877.3	NM_000461	
IGLL5	100423062	hgsc.bcm.edu	37	22	23230348	23230348	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:23230348C>T	ENST00000526893.1	+	1	389	c.115C>T	c.(115-117)Ctg>Ttg	p.L39L	IGLL5_ENST00000532223.2_Silent_p.L39L|IGLL5_ENST00000531372.1_Silent_p.L39L|hsa-mir-5571_ENST00000577998.1_RNA	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	39						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						CCATGGCCTGCTGCGCCCAAT	0.687																																					p.L39L		Atlas-SNP	.											.	IGLL5	26	.	0			c.C115T						PASS	.																																			SO:0001819	synonymous_variant	100423062	exon1			GGCCTGCTGCGCC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.115C>T	22.37:g.23230348C>T		151.0	0.0	0		118.0	5.0	0.0423729	NM_001178126		Silent	SNP	ENST00000526893.1	37	CCDS54506.1																																																																																			.	.	none		0.687	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
ABCA3	21	hgsc.bcm.edu	37	16	2339491	2339491	+	Missense_Mutation	SNP	C	C	T	rs145565697	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:2339491C>T	ENST00000301732.5	-	20	3344	c.2644G>A	c.(2644-2646)Gac>Aac	p.D882N	ABCA3_ENST00000382381.3_Missense_Mutation_p.D824N	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	882					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CCAATGCCGTCGGAGGGGTCC	0.687													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17193	0.0		0.0	False		,,,				2504	0.0				p.D882N		Atlas-SNP	.											.	ABCA3	176	.	0			c.G2644A						PASS	.	C	ASN/ASP	10,4380		0,10,2185	32.0	29.0	30.0		2644	0.5	0.0	16	dbSNP_134	30	0,8598		0,0,4299	yes	missense	ABCA3	NM_001089.2	23	0,10,6484	TT,TC,CC		0.0,0.2278,0.077	benign	882/1705	2339491	10,12978	2195	4299	6494	SO:0001583	missense	21	exon20			TGCCGTCGGAGGG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2644G>A	16.37:g.2339491C>T	ENSP00000301732:p.Asp882Asn	98.0	0.0	0		90.0	4.0	0.0444444	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	ENST00000301732.5	37	CCDS10466.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.348915	0.24426	0.002278	0.0	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.91740	-2.9	4.68	0.543	0.17179	.	0.223978	0.44688	N	0.000432	D	0.84813	0.5555	L	0.36672	1.1	0.52099	D	0.999942	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.72360	-0.4317	10	0.30854	T	0.27	.	8.3806	0.32468	0.0:0.673:0.0:0.327	.	882;886;882	A7MBM9;Q4LE27;Q99758	.;.;ABCA3_HUMAN	N	882;886	ENSP00000301732:D882N	ENSP00000301732:D882N	D	-	1	0	ABCA3	2279492	0.951000	0.32395	0.000000	0.03702	0.215000	0.24574	2.187000	0.42602	-0.026000	0.13895	0.561000	0.74099	GAC	C|0.998;T|0.002	0.002	strong		0.687	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
TNF	7124	hgsc.bcm.edu	37	6	31543635	31543635	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31543635G>A	ENST00000449264.2	+	1	292	c.117G>A	c.(115-117)ctG>ctA	p.L39L		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	39		Cleavage; by SPPL2A or SPPL2B.			activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	TCTCCTTCCTGATCGTGGCAG	0.652									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.L39L		Atlas-SNP	.											.	TNF	15	.	0			c.G117A						PASS	.						66.0	67.0	67.0					6																	31543635		2203	4300	6503	SO:0001819	synonymous_variant	7124	exon1	Familial Cancer Database	incl.: Familial Head and Neck Cancer	CTTCCTGATCGTG	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.117G>A	6.37:g.31543635G>A		75.0	0.0	0		69.0	25.0	0.362319	NM_000594	O43647|Q9P1Q2|Q9UIV3	Silent	SNP	ENST00000449264.2	37	CCDS4702.1																																																																																			.	.	none		0.652	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
ZNF181	339318	hgsc.bcm.edu	37	19	35232117	35232117	+	Silent	SNP	C	C	T	rs200927726		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:35232117C>T	ENST00000492450.1	+	4	920	c.831C>T	c.(829-831)ggC>ggT	p.G277G	ZNF181_ENST00000459757.2_Silent_p.G276G|ZNF181_ENST00000392232.3_Silent_p.G321G			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	277					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G213G(1)		endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TTAGCCATGGCTCATCCCTTA	0.443																																					p.G277G		Atlas-SNP	.											ZNF181,NS,carcinoma,+2,2	ZNF181	65	2	1	Substitution - coding silent(1)	kidney(1)	c.C831T						scavenged	.						90.0	95.0	93.0					19																	35232117		2203	4300	6503	SO:0001819	synonymous_variant	339318	exon4			CCATGGCTCATCC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.831C>T	19.37:g.35232117C>T		92.0	2.0	0.0217391		73.0	4.0	0.0547945	NM_001029997	B7ZKX3|Q49A75	Silent	SNP	ENST00000492450.1	37	CCDS32990.2																																																																																			C|0.999;T|0.001	0.001	weak		0.443	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
PRKD2	25865	hgsc.bcm.edu	37	19	47204071	47204071	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr19:47204071C>T	ENST00000291281.4	-	7	1331	c.1106G>A	c.(1105-1107)gGa>gAa	p.G369E	PRKD2_ENST00000600194.1_Missense_Mutation_p.G212E|PRKD2_ENST00000433867.1_Missense_Mutation_p.G369E|PRKD2_ENST00000601806.1_Missense_Mutation_p.G212E|PRKD2_ENST00000595515.1_Missense_Mutation_p.G369E			Q9BZL6	KPCD2_HUMAN	protein kinase D2	369					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GGCCTTGCCTCCCTCGCCTTC	0.572																																					p.G369E		Atlas-SNP	.											.	PRKD2	94	.	0			c.G1106A						PASS	.						62.0	50.0	54.0					19																	47204071		2203	4300	6503	SO:0001583	missense	25865	exon7			TTGCCTCCCTCGC	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1106G>A	19.37:g.47204071C>T	ENSP00000291281:p.Gly369Glu	86.0	0.0	0		69.0	4.0	0.057971	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	5.174	0.217694	0.09810	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.63744	-0.06;-0.06	4.28	-0.572	0.11745	.	1.007170	0.07985	N	0.986164	T	0.44767	0.1309	L	0.47716	1.5	0.24460	N	0.99445	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33007	-0.9885	10	0.05436	T	0.98	-3.4373	4.0249	0.09683	0.0:0.415:0.1761:0.4089	.	369;369	E7ER94;Q9BZL6	.;KPCD2_HUMAN	E	369	ENSP00000291281:G369E;ENSP00000393978:G369E	ENSP00000291281:G369E	G	-	2	0	PRKD2	51895911	0.359000	0.24955	0.792000	0.32020	0.882000	0.50991	0.493000	0.22451	0.198000	0.20407	0.555000	0.69702	GGA	.	.	none		0.572	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
FLNC	2318	hgsc.bcm.edu	37	7	128483878	128483878	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr7:128483878G>A	ENST00000325888.8	+	19	3101	c.2840G>A	c.(2839-2841)gGc>gAc	p.G947D	FLNC_ENST00000346177.6_Missense_Mutation_p.G947D	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	947					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GTGACTTATGGCGGGGACCCT	0.532																																					p.G947D		Atlas-SNP	.											.	FLNC	339	.	0			c.G2840A						PASS	.						85.0	87.0	86.0					7																	128483878		1932	4140	6072	SO:0001583	missense	2318	exon19			CTTATGGCGGGGA	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2840G>A	7.37:g.128483878G>A	ENSP00000327145:p.Gly947Asp	154.0	0.0	0		114.0	37.0	0.324561	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746324	0.69418	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.91521	-2.86;-2.86	5.32	5.32	0.75619	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.95108	0.8415	M	0.71920	2.185	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95440	0.8524	10	0.87932	D	0	.	18.9962	0.92813	0.0:0.0:1.0:0.0	.	947;947	Q14315-2;Q14315	.;FLNC_HUMAN	D	947	ENSP00000327145:G947D;ENSP00000344002:G947D	ENSP00000327145:G947D	G	+	2	0	FLNC	128271114	1.000000	0.71417	1.000000	0.80357	0.453000	0.32348	9.783000	0.99037	2.481000	0.83766	0.561000	0.74099	GGC	.	.	none		0.532	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
SLCO1B7	338821	hgsc.bcm.edu	37	12	21201693	21201693	+	Missense_Mutation	SNP	T	T	A	rs370821380		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:21201693T>A	ENST00000421593.2	+	8	1042	c.1042T>A	c.(1042-1044)Tat>Aat	p.Y348N	SLCO1B7_ENST00000554957.1_Missense_Mutation_p.Y395N|LST3_ENST00000540229.1_Intron|SLCO1B3_ENST00000553473.1_Intron|LST3_ENST00000381541.3_Missense_Mutation_p.Y395N	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	348						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TTCAGGAGGATATATCATTAA	0.353																																					p.Y348N		Atlas-SNP	.											.	SLCO1B7	85	.	0			c.T1042A						PASS	.						48.0	48.0	48.0					12																	21201693		2014	4205	6219	SO:0001583	missense	338821	exon8			GGAGGATATATCA	AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.1042T>A	12.37:g.21201693T>A	ENSP00000394168:p.Tyr348Asn	103.0	0.0	0		176.0	46.0	0.261364	NM_001009562	Q71QF0	Missense_Mutation	SNP	ENST00000421593.2	37	CCDS44843.1	.	.	.	.	.	.	.	.	.	.	.	13.38	2.220808	0.39201	.	.	ENSG00000257046;ENSG00000205754;ENSG00000205754	ENST00000381541;ENST00000554957;ENST00000421593	T;T;T	0.81415	-1.41;-1.41;-1.49	3.45	3.45	0.39498	.	0.479354	0.21186	N	0.078723	D	0.85898	0.5804	M	0.83012	2.62	0.25795	N	0.984577	D;P	0.54397	0.966;0.942	P;P	0.58873	0.847;0.847	T	0.77723	-0.2481	10	0.72032	D	0.01	.	5.4437	0.16523	0.0:0.1313:0.0:0.8687	.	348;395	G3V0H7;F5H094	.;.	N	395;395;348	ENSP00000370952:Y395N;ENSP00000452013:Y395N;ENSP00000394168:Y348N	ENSP00000370952:Y395N	Y	+	1	0	SLCO1B7;RP11-545J16.1	21092960	0.369000	0.25039	0.990000	0.47175	0.727000	0.41649	0.316000	0.19469	1.554000	0.49487	0.416000	0.27883	TAT	.	.	alt		0.353	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402066.1	NM_001009562	
CTBS	1486	hgsc.bcm.edu	37	1	85040024	85040024	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:85040024C>T	ENST00000370630.5	-	1	123	c.75G>A	c.(73-75)ctG>ctA	p.L25L	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	25					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		ccagcagcgccagcagcgcTA	0.726																																					p.L25L		Atlas-SNP	.											CTBS,NS,carcinoma,0,1	CTBS	24	1	0			c.G75A						scavenged	.						3.0	4.0	4.0					1																	85040024		1689	3502	5191	SO:0001819	synonymous_variant	1486	exon1			CAGCGCCAGCAGC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.75G>A	1.37:g.85040024C>T		6.0	0.0	0		3.0	2.0	0.666667	NM_004388	Q5VX50	Silent	SNP	ENST00000370630.5	37	CCDS698.1																																																																																			.	.	none		0.726	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
DDX39B	7919	hgsc.bcm.edu	37	6	31500627	31500627	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31500627T>C	ENST00000396172.1	-	7	1427	c.797A>G	c.(796-798)tAc>tGc	p.Y266C	DDX39B_ENST00000376177.2_Missense_Mutation_p.Y266C|DDX39B_ENST00000417556.2_Missense_Mutation_p.Y281C|DDX39B_ENST00000462421.1_5'Flank|DDX39B_ENST00000415382.2_Missense_Mutation_p.Y188C|DDX39B_ENST00000458640.1_Missense_Mutation_p.Y266C|ATP6V1G2-DDX39B_ENST00000376185.1_3'UTR	NM_004640.6	NP_004631.1	Q13838	DX39B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B	266	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|RNA secondary structure unwinding (GO:0010501)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|transcription export complex (GO:0000346)	ATP binding (GO:0005524)|ATP-dependent protein binding (GO:0043008)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)|RNA-dependent ATPase activity (GO:0008186)|U4 snRNA binding (GO:0030621)|U6 snRNA binding (GO:0017070)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						CAGTTTCACGTAGTACTGCTG	0.552																																					p.Y266C		Atlas-SNP	.											.	DDX39B	38	.	0			c.A797G						PASS	.						125.0	100.0	109.0					6																	31500627		1511	2709	4220	SO:0001583	missense	7919	exon7			TTCACGTAGTACT	Z37166	CCDS4697.1	6p21.33	2011-02-09	2011-02-08	2011-02-08	ENSG00000198563	ENSG00000198563		"""DEAD-boxes"""	13917	protein-coding gene	gene with protein product	"""U2AF65-associated protein 56"""	142560	"""HLA-B associated transcript 1"""	BAT1		7601445, 2813433	Standard	NM_004640		Approved	D6S81E, UAP56	uc003ntu.3	Q13838	OTTHUMG00000031165	ENST00000396172.1:c.797A>G	6.37:g.31500627T>C	ENSP00000379475:p.Tyr266Cys	189.0	0.0	0		208.0	93.0	0.447115	NM_004640	B0S8C0|O43496|Q0EFA1|Q2L6F9|Q53GL9|Q5RJ64|Q5RJ66|Q5ST94|Q5STB4|Q5STB5|Q5STB7|Q5STB8|Q5STU4|Q5STU5|Q5STU6|Q5STU8|Q71V76	Missense_Mutation	SNP	ENST00000396172.1	37	CCDS4697.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.74|19.74	3.883915|3.883915	0.72410|0.72410	.|.	.|.	ENSG00000198563|ENSG00000198563	ENST00000417023|ENST00000376177;ENST00000458640;ENST00000396172;ENST00000417556;ENST00000415382;ENST00000431908;ENST00000427214	.|D;T;T;T;T;T;T	.|0.92752	.|-3.1;3.44;3.44;3.44;3.44;3.44;3.33	5.46|5.46	4.28|4.28	0.50868|0.50868	.|Helicase, C-terminal (1);	.|0.079694	.|0.51477	.|D	.|0.000087	D|D	0.95053|0.95053	0.8398|0.8398	M|M	0.86740|0.86740	2.835|2.835	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;0.988	.|D;D;D;P	.|0.91635	.|0.999;0.999;0.994;0.693	D|D	0.95212|0.95212	0.8326|0.8326	5|10	.|0.87932	.|D	.|0	-12.1399|-12.1399	10.7351|10.7351	0.46120|0.46120	0.0:0.0:0.1602:0.8398|0.0:0.0:0.1602:0.8398	.|.	.|188;266;266;281	.|B4DP52;Q13838;Q5STU3;F8VQ10	.|.;DX39B_HUMAN;.;.	A|C	30|266;266;266;281;188;188;266	.|ENSP00000365347:Y266C;ENSP00000416269:Y266C;ENSP00000379475:Y266C;ENSP00000412582:Y281C;ENSP00000392669:Y188C;ENSP00000408000:Y188C;ENSP00000399371:Y266C	.|ENSP00000365347:Y266C	T|Y	-|-	1|2	0|0	DDX39B|DDX39B	31608606|31608606	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.673000|7.673000	0.83973|0.83973	0.886000|0.886000	0.36113|0.36113	0.533000|0.533000	0.62120|0.62120	ACG|TAC	.	.	none		0.552	DDX39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259083.1	NM_004640	
TENM4	26011	hgsc.bcm.edu	37	11	78380664	78380664	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:78380664G>A	ENST00000278550.7	-	32	7188	c.6726C>T	c.(6724-6726)cgC>cgT	p.R2242R		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2242					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGATGCGGTCGCGGATGTCAT	0.572																																					p.R2242R		Atlas-SNP	.											ODZ4_ENST00000278550,colon,carcinoma,-1,2	.	.	2	0			c.C6726T						PASS	.						170.0	174.0	173.0					11																	78380664		2171	4252	6423	SO:0001819	synonymous_variant	26011	exon32			GCGGTCGCGGATG	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.6726C>T	11.37:g.78380664G>A		141.0	0.0	0		143.0	37.0	0.258741	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	37	CCDS44688.1																																																																																			.	.	none		0.572	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
RBM27	54439	hgsc.bcm.edu	37	5	145613242	145613242	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr5:145613242T>G	ENST00000265271.5	+	7	1246	c.1080T>G	c.(1078-1080)agT>agG	p.S360R	RBM27_ENST00000506502.1_Missense_Mutation_p.S360R	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	360	Pro-rich.				mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGGCCATAGTATGAGACTTC	0.562																																					p.S360R		Atlas-SNP	.											.	RBM27	119	.	0			c.T1080G						PASS	.						41.0	42.0	42.0					5																	145613242		1568	3582	5150	SO:0001583	missense	54439	exon7			CCATAGTATGAGA	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.1080T>G	5.37:g.145613242T>G	ENSP00000265271:p.Ser360Arg	100.0	0.0	0		106.0	31.0	0.292453	NM_018989	Q8IYW9	Missense_Mutation	SNP	ENST00000265271.5	37	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	T	14.01	2.406658	0.42715	.	.	ENSG00000091009	ENST00000265271	T	0.46451	0.87	5.52	1.85	0.25348	.	0.476754	0.24611	N	0.037051	T	0.20414	0.0491	N	0.08118	0	0.27233	N	0.959348	B;B	0.23058	0.001;0.079	B;B	0.21546	0.001;0.035	T	0.19257	-1.0311	10	0.20519	T	0.43	-1.2398	10.0623	0.42282	0.0:0.3859:0.0:0.6141	.	360;360	Q9P2N5;B3KY61	RBM27_HUMAN;.	R	360	ENSP00000265271:S360R	ENSP00000265271:S360R	S	+	3	2	RBM27	145593435	0.269000	0.24143	0.979000	0.43373	0.998000	0.95712	-0.066000	0.11598	0.139000	0.18822	0.533000	0.62120	AGT	.	.	none		0.562	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
VWA7	80737	hgsc.bcm.edu	37	6	31744405	31744405	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31744405T>C	ENST00000375688.4	-	2	352	c.152A>G	c.(151-153)gAg>gGg	p.E51G	VWA7_ENST00000375686.3_Missense_Mutation_p.E51G|VWA7_ENST00000447450.1_Missense_Mutation_p.E51G|Y_RNA_ENST00000364685.1_RNA|VWA7_ENST00000467576.1_5'UTR			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	51						extracellular region (GO:0005576)											GAGCGCTGCCTCCTCAGTTAG	0.642																																					p.E51G		Atlas-SNP	.											.	.	.	.	0			c.A152G						PASS	.						19.0	9.0	13.0					6																	31744405		1410	2507	3917	SO:0001583	missense	80737	exon2			GCTGCCTCCTCAG		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.152A>G	6.37:g.31744405T>C	ENSP00000364840:p.Glu51Gly	177.0	0.0	0		158.0	67.0	0.424051	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	37	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	17.59	3.427819	0.62733	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.13778	2.56;2.56;2.56	4.92	3.74	0.42951	.	0.199559	0.41823	D	0.000801	T	0.05914	0.0154	L	0.50333	1.59	0.31474	N	0.667961	B	0.29646	0.253	B	0.31337	0.128	T	0.13737	-1.0498	10	0.51188	T	0.08	-10.4076	10.0134	0.42001	0.0:0.0:0.1703:0.8297	.	51	Q9Y334	G7C_HUMAN	G	51	ENSP00000364840:E51G;ENSP00000364838:E51G;ENSP00000390554:E51G	ENSP00000364838:E51G	E	-	2	0	C6orf27	31852384	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.464000	0.53057	0.881000	0.35993	0.455000	0.32223	GAG	.	.	none		0.642	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
PCDH9	5101	hgsc.bcm.edu	37	13	66879059	66879059	+	Missense_Mutation	SNP	A	A	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:66879059A>C	ENST00000377865.2	-	4	3576	c.3442T>G	c.(3442-3444)Ttg>Gtg	p.L1148V	PCDH9_ENST00000328454.5_Missense_Mutation_p.L1114V|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000456367.1_Missense_Mutation_p.L1114V|PCDH9_ENST00000544246.1_Missense_Mutation_p.L1148V			Q9HC56	PCDH9_HUMAN	protocadherin 9	1148					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		TATGGACCCAAGCCAGGAGGC	0.517																																					p.L1148V		Atlas-SNP	.											.	PCDH9	252	.	0			c.T3442G						PASS	.						121.0	105.0	111.0					13																	66879059		2203	4300	6503	SO:0001583	missense	5101	exon5			GACCCAAGCCAGG	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3442T>G	13.37:g.66879059A>C	ENSP00000367096:p.Leu1148Val	94.0	0.0	0		112.0	20.0	0.178571	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	A	15.23	2.771484	0.49680	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.54675	0.64;0.64;0.56;0.56	6.16	5.03	0.67393	.	0.000000	0.38217	N	0.001780	T	0.43122	0.1233	L	0.39898	1.24	0.30218	N	0.797123	P;P;P	0.46859	0.85;0.885;0.85	B;B;B	0.43301	0.301;0.415;0.301	T	0.51100	-0.8748	10	0.45353	T	0.12	.	7.8316	0.29347	0.7928:0.0:0.2072:0.0	.	1106;1114;1148	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	V	1148;1148;1114;1114	ENSP00000442186:L1148V;ENSP00000367096:L1148V;ENSP00000401699:L1114V;ENSP00000332060:L1114V	ENSP00000332060:L1114V	L	-	1	2	PCDH9	65777060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.940000	0.40223	2.367000	0.80283	0.528000	0.53228	TTG	.	.	none		0.517	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
FHOD3	80206	hgsc.bcm.edu	37	18	34340708	34340708	+	Silent	SNP	C	C	T	rs200423151		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:34340708C>T	ENST00000359247.4	+	22	3987	c.3987C>T	c.(3985-3987)ccC>ccT	p.P1329P	FHOD3_ENST00000445677.1_Silent_p.P1308P|FHOD3_ENST00000257209.4_Silent_p.P1346P|FHOD3_ENST00000591635.1_Silent_p.P542P|FHOD3_ENST00000592128.1_Silent_p.P325P|FHOD3_ENST00000590592.1_Silent_p.P1529P	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1329					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				ACGCCACCCCCGCGCTGGGCG	0.687													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13615	0.0		0.0	False		,,,				2504	0.0				p.P1346P		Atlas-SNP	.											.	FHOD3	210	.	0			c.C4038T						PASS	.						23.0	22.0	22.0					18																	34340708		2193	4295	6488	SO:0001819	synonymous_variant	80206	exon23			CACCCCCGCGCTG	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3987C>T	18.37:g.34340708C>T		24.0	0.0	0		22.0	5.0	0.227273	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	37																																																																																				C|1.000;T|0.000	0.000	strong		0.687	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
ZNF423	23090	hgsc.bcm.edu	37	16	49670344	49670344	+	Missense_Mutation	SNP	G	G	A	rs544721667		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:49670344G>A	ENST00000561648.1	-	4	2772	c.2719C>T	c.(2719-2721)Cgg>Tgg	p.R907W	ZNF423_ENST00000567169.1_Missense_Mutation_p.R790W|ZNF423_ENST00000562520.1_Missense_Mutation_p.R847W|ZNF423_ENST00000563137.2_Missense_Mutation_p.R847W|ZNF423_ENST00000535559.1_Missense_Mutation_p.R790W|ZNF423_ENST00000262383.2_Missense_Mutation_p.R907W|ZNF423_ENST00000562871.1_Missense_Mutation_p.R847W	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	907					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				TTGTGGTCCCGCAGCCGGTGA	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		20967	0.0		0.0	False		,,,				2504	0.001				p.R907W		Atlas-SNP	.											ZNF423_ENST00000262383,NS,carcinoma,+2,2	ZNF423	463	2	0			c.C2719T						PASS	.						61.0	59.0	60.0					16																	49670344		2198	4300	6498	SO:0001583	missense	23090	exon4			GGTCCCGCAGCCG	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.2719C>T	16.37:g.49670344G>A	ENSP00000455426:p.Arg907Trp	124.0	0.0	0		119.0	23.0	0.193277	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	37	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204654	0.58234	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.10382	2.88;2.93	4.81	2.74	0.32292	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.27063	0.0663	M	0.62723	1.935	0.43540	D	0.995834	D	0.89917	1.0	D	0.72625	0.978	T	0.01574	-1.1321	9	.	.	.	-25.0868	13.064	0.59022	0.0:0.0:0.463:0.537	.	907	Q2M1K9	ZN423_HUMAN	W	907;790	ENSP00000262383:R907W;ENSP00000442321:R790W	.	R	-	1	2	ZNF423	48227845	0.829000	0.29322	0.997000	0.53966	0.985000	0.73830	0.897000	0.28390	1.028000	0.39785	-0.268000	0.10319	CGG	.	.	none		0.592	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
KCNK10	54207	hgsc.bcm.edu	37	14	88652049	88652049	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:88652049C>T	ENST00000340700.5	-	7	1898	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K	KCNK10_ENST00000319231.5_Missense_Mutation_p.E488K|KCNK10_ENST00000312350.5_Missense_Mutation_p.E488K	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	483					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TTCTTCTCCTCGTCCAGGGAG	0.502																																					p.E488K		Atlas-SNP	.											.	KCNK10	273	.	0			c.G1462A						PASS	.						149.0	148.0	148.0					14																	88652049		2203	4300	6503	SO:0001583	missense	54207	exon7			TCTCCTCGTCCAG	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1447G>A	14.37:g.88652049C>T	ENSP00000343104:p.Glu483Lys	252.0	0.0	0		275.0	68.0	0.247273	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	37	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944729	0.73672	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.94232	-3.36;-3.37;-3.38	5.5	5.5	0.81552	.	0.667612	0.15589	N	0.254476	D	0.90930	0.7149	L	0.46157	1.445	0.51767	D	0.999937	B;B;B	0.29612	0.251;0.251;0.251	B;B;B	0.15052	0.012;0.008;0.012	D	0.88801	0.3285	10	0.72032	D	0.01	.	18.3984	0.90507	0.0:1.0:0.0:0.0	.	483;488;488	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	K	483;488;488	ENSP00000343104:E483K;ENSP00000310568:E488K;ENSP00000312811:E488K	ENSP00000310568:E488K	E	-	1	0	KCNK10	87721802	1.000000	0.71417	0.929000	0.37066	0.786000	0.44442	7.294000	0.78760	2.599000	0.87857	0.655000	0.94253	GAG	.	.	none		0.502	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
TIAM2	26230	hgsc.bcm.edu	37	6	155458711	155458711	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:155458711G>A	ENST00000461783.3	+	7	2868	c.1595G>A	c.(1594-1596)cGa>cAa	p.R532Q	TIAM2_ENST00000318981.5_Missense_Mutation_p.R532Q|TIAM2_ENST00000456144.1_Missense_Mutation_p.R532Q|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000360366.4_Missense_Mutation_p.R532Q|TIAM2_ENST00000529824.2_Missense_Mutation_p.R532Q			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	532	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CTGGTGGCACGAAGGAAATGG	0.572																																					p.R532Q		Atlas-SNP	.											TIAM2,NS,malignant_melanoma,0,1	TIAM2	161	1	0			c.G1595A						scavenged	.						71.0	74.0	73.0					6																	155458711		2203	4300	6503	SO:0001583	missense	26230	exon4			TGGCACGAAGGAA		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1595G>A	6.37:g.155458711G>A	ENSP00000437188:p.Arg532Gln	20.0	0.0	0		25.0	6.0	0.24	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	37	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	G	36	5.662895	0.96734	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	6.08	6.08	0.98989	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.82176	0.4980	L	0.51422	1.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.989;0.993	T	0.82076	-0.0636	10	0.87932	D	0	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	532;532	Q8IVF5-2;Q8IVF5	.;TIAM2_HUMAN	Q	532;778;532;532;532;532;532	ENSP00000437188:R532Q;ENSP00000434901:R532Q;ENSP00000407746:R532Q;ENSP00000327315:R532Q;ENSP00000353528:R532Q;ENSP00000433348:R532Q	ENSP00000327315:R532Q	R	+	2	0	TIAM2	155500403	1.000000	0.71417	0.992000	0.48379	0.967000	0.64934	9.476000	0.97823	2.894000	0.99253	0.655000	0.94253	CGA	.	.	none		0.572	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
RHBDF1	64285	hgsc.bcm.edu	37	16	112797	112797	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:112797C>A	ENST00000262316.6	-	6	913	c.771G>T	c.(769-771)gaG>gaT	p.E257D	RHBDF1_ENST00000454039.2_Missense_Mutation_p.E257D	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	257					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				ATGTGTCCAGCTCATCGGGGA	0.602																																					p.E257D		Atlas-SNP	.											.	RHBDF1	54	.	0			c.G771T						PASS	.						112.0	118.0	116.0					16																	112797		2203	4300	6503	SO:0001583	missense	64285	exon6			GTCCAGCTCATCG	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.771G>T	16.37:g.112797C>A	ENSP00000262316:p.Glu257Asp	102.0	0.0	0		95.0	18.0	0.189474	NM_022450	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	37	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.397914	0.25205	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	T;T	0.64260	-0.09;-0.09	4.56	3.57	0.40892	.	0.102644	0.64402	D	0.000003	T	0.44074	0.1276	N	0.20401	0.57	0.47621	D	0.999476	B;B;B	0.29481	0.085;0.245;0.002	B;B;B	0.36608	0.074;0.229;0.02	T	0.22591	-1.0212	10	0.09590	T	0.72	-35.6303	8.8488	0.35188	0.0:0.8267:0.0:0.1733	.	257;280;257	F5GWL4;B4E3Q0;Q96CC6	.;.;RHDF1_HUMAN	D	257	ENSP00000262316:E257D;ENSP00000392133:E257D	ENSP00000262316:E257D	E	-	3	2	RHBDF1	52797	0.997000	0.39634	0.999000	0.59377	0.981000	0.71138	0.894000	0.28350	2.359000	0.80004	0.462000	0.41574	GAG	.	.	none		0.602	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	NM_022450	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72017233	72017233	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:72017233A>G	ENST00000378743.3	-	24	5009	c.4651T>C	c.(4651-4653)Tca>Cca	p.S1551P		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1551					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACAATTCTTGAAGGATTATCA	0.343																																					p.S1551P		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.T4651C						PASS	.						103.0	93.0	96.0					12																	72017233		1834	4087	5921	SO:0001583	missense	196441	exon24			TTCTTGAAGGATT	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4651T>C	12.37:g.72017233A>G	ENSP00000368017:p.Ser1551Pro	74.0	0.0	0		90.0	4.0	0.0444444	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.623719	0.66901	.	.	ENSG00000133858	ENST00000378743	T	0.34072	1.38	4.98	4.98	0.66077	.	0.170588	0.39985	N	0.001204	T	0.48409	0.1498	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.45116	-0.9283	10	0.44086	T	0.13	.	14.6713	0.68945	1.0:0.0:0.0:0.0	.	1551	O60293	ZC3H1_HUMAN	P	1551	ENSP00000368017:S1551P	ENSP00000368017:S1551P	S	-	1	0	ZFC3H1	70303500	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	4.627000	0.61276	1.868000	0.54150	0.460000	0.39030	TCA	.	.	none		0.343	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
SGK1	6446	hgsc.bcm.edu	37	6	134495706	134495706	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495706C>T	ENST00000237305.7	-	2	183	c.95G>A	c.(94-96)aGg>aAg	p.R32K	SGK1_ENST00000367858.5_Missense_Mutation_p.R127K|SGK1_ENST00000475719.2_Missense_Mutation_p.R32K|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000528577.1_Missense_Mutation_p.R60K|SGK1_ENST00000367857.5_Missense_Mutation_p.R22K|SGK1_ENST00000413996.3_Missense_Mutation_p.R46K	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	32	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)	p.R32M(1)|p.R127M(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CAGACCCATCCTCCTCTGCTT	0.428											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R127K		Atlas-SNP	.											SGK1_ENST00000367858,NS,lymphoid_neoplasm,0,2	SGK1	387	2	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)	c.G380A						PASS	.						79.0	79.0	79.0					6																	134495706		2203	4300	6503	SO:0001583	missense	6446	exon4			CCCATCCTCCTCT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.95G>A	6.37:g.134495706C>T	ENSP00000237305:p.Arg32Lys	76.0	0.0	0	1611	48.0	12.0	0.25	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823755	0.71143	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.43688	1.39;1.39;1.39;1.39;1.39;1.39;0.94	5.89	5.89	0.94794	.	0.083857	0.85682	D	0.000000	T	0.27559	0.0677	L	0.37630	1.12	0.80722	D	1	B;B;B;B;B;B	0.15719	0.014;0.001;0.011;0.004;0.014;0.003	B;B;B;B;B;B	0.25405	0.03;0.002;0.02;0.03;0.06;0.007	T	0.03545	-1.1026	10	0.40728	T	0.16	.	20.2576	0.98430	0.0:1.0:0.0:0.0	.	60;46;32;22;127;32	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	K	127;46;32;22;60;32;96	ENSP00000356832:R127K;ENSP00000396242:R46K;ENSP00000237305:R32K;ENSP00000356831:R22K;ENSP00000434450:R60K;ENSP00000434302:R32K;ENSP00000435577:R96K	ENSP00000237305:R32K	R	-	2	0	SGK1	134537399	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.276000	0.51646	2.783000	0.95769	0.655000	0.94253	AGG	.	.	none		0.428	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
SGK1	6446	hgsc.bcm.edu	37	6	134495711	134495711	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495711C>T	ENST00000237305.7	-	2	178	c.90G>A	c.(88-90)caG>caA	p.Q30Q	SGK1_ENST00000367858.5_Silent_p.Q125Q|SGK1_ENST00000475719.2_Silent_p.Q30Q|SGK1_ENST00000489458.2_5'Flank|SGK1_ENST00000528577.1_Silent_p.Q58Q|SGK1_ENST00000367857.5_Silent_p.Q20Q|SGK1_ENST00000413996.3_Silent_p.Q44Q	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	30	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CCATCCTCCTCTGCTTCATGA	0.433											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q125Q		Atlas-SNP	.											.	SGK1	387	.	0			c.G375A						PASS	.						76.0	76.0	76.0					6																	134495711		2203	4300	6503	SO:0001819	synonymous_variant	6446	exon4			CCTCCTCTGCTTC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.90G>A	6.37:g.134495711C>T		78.0	0.0	0	1611	47.0	13.0	0.276596	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Silent	SNP	ENST00000237305.7	37	CCDS5170.1																																																																																			.	.	none		0.433	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
DDX3X	1654	hgsc.bcm.edu	37	X	41206198	41206198	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:41206198C>T	ENST00000399959.2	+	15	2557	c.1702C>T	c.(1702-1704)Ccg>Tcg	p.P568S	DDX3X_ENST00000457138.2_Missense_Mutation_p.P552S|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000441189.2_Intron|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	568	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						ACAAGAAGTGCCGTCTTGGTT	0.403										HNSCC(61;0.18)																											p.P568S		Atlas-SNP	.											.	DDX3X	138	.	0			c.C1702T						PASS	.						93.0	90.0	91.0					X																	41206198		2172	4275	6447	SO:0001583	missense	1654	exon15			GAAGTGCCGTCTT	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1702C>T	X.37:g.41206198C>T	ENSP00000382840:p.Pro568Ser	248.0	0.0	0		241.0	15.0	0.0622407	NM_001193416	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	ENST00000399959.2	37	CCDS43931.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.782891	0.90282	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.27402	1.67;1.69	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58221	0.2107	M	0.76002	2.32	0.80722	D	1	B;D;D;D	0.89917	0.002;1.0;1.0;1.0	B;D;D;D	0.97110	0.0;0.936;1.0;1.0	T	0.63404	-0.6645	10	0.87932	D	0	-8.1884	18.0954	0.89488	0.0:1.0:0.0:0.0	.	438;552;580;568	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	S	568;552	ENSP00000382840:P568S;ENSP00000392494:P552S	ENSP00000382840:P568S	P	+	1	0	DDX3X	41091142	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.773000	0.85462	2.209000	0.71365	0.529000	0.55759	CCG	.	.	none		0.403	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056253.1	NM_024005	
LOXHD1	125336	hgsc.bcm.edu	37	18	44126858	44126858	+	Splice_Site	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:44126858C>A	ENST00000398722.4	-	15	2679	c.2680G>T	c.(2680-2682)Gat>Tat	p.D894Y	LOXHD1_ENST00000441893.2_Splice_Site_p.D105Y|LOXHD1_ENST00000441551.2_Splice_Site_p.D966Y|LOXHD1_ENST00000536736.1_Splice_Site_p.D1172Y|LOXHD1_ENST00000582408.1_Splice_Site_p.D61Y|LOXHD1_ENST00000300591.6_Splice_Site_p.D61Y|LOXHD1_ENST00000579038.1_5'UTR			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	894					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TTTAGAAAACCTTTCTGCTCC	0.577																																					p.D1172Y		Atlas-SNP	.											.	LOXHD1	367	.	0			c.G3514T						PASS	.						79.0	92.0	88.0					18																	44126858		692	1591	2283	SO:0001630	splice_region_variant	125336	exon22			GAAAACCTTTCTG	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2680+1G>T	18.37:g.44126858C>A		66.0	0.0	0		82.0	5.0	0.0609756	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.51|12.51	1.959039|1.959039	0.34565|0.34565	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111;ENST00000420097|ENST00000441551	T;T;T;T;T|.	0.28255|.	1.62;1.62;1.62;1.62;1.62|.	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	0.231618|.	0.44285|.	D|.	0.000464|.	T|T	0.67059|0.67059	0.2853|0.2853	L|L	0.44542|0.44542	1.39|1.39	0.47276|0.47276	D|D	0.999371|0.999371	D;D;D|.	0.89917|.	0.998;0.999;1.0|.	D;D;D|.	0.91635|.	0.996;0.997;0.999|.	T|T	0.64402|0.64402	-0.6416|-0.6416	9|5	.|.	.|.	.|.	.|.	18.0981|18.0981	0.89497|0.89497	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1172;105;894|.	F5GZB4;F8WA52;Q8IVV2-2|.	.;.;.|.	Y|I	61;894;1172;105;894;74;74|1152	ENSP00000300591:D61Y;ENSP00000381707:D894Y;ENSP00000444586:D1172Y;ENSP00000409062:D105Y;ENSP00000440060:D74Y|.	.|.	D|R	-|-	1|2	0|0	LOXHD1|LOXHD1	42380856|42380856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.721000|0.721000	0.41392|0.41392	4.899000|4.899000	0.63245|0.63245	2.265000|2.265000	0.75225|0.75225	0.557000|0.557000	0.71058|0.71058	GAT|AGA	.	.	none		0.577	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	Missense_Mutation
PIK3CD	5293	hgsc.bcm.edu	37	1	9787030	9787030	+	Missense_Mutation	SNP	G	G	A	rs397518423		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:9787030G>A	ENST00000377346.4	+	24	3256	c.3061G>A	c.(3061-3063)Gaa>Aaa	p.E1021K	PIK3CD_ENST00000361110.2_Missense_Mutation_p.E1045K|CLSTN1_ENST00000477264.1_5'Flank|PIK3CD_ENST00000536656.1_Missense_Mutation_p.E1045K	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	1021	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		E -> K (in APDS; results in gain of function causing enhanced membrane association and kinase activity). {ECO:0000269|PubMed:24136356}.		adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	GAAGTTTAACGAAGCCCTCCG	0.567																																					p.E1021K		Atlas-SNP	.											PIK3CD,NS,lymphoid_neoplasm,0,2	PIK3CD	86	2	0			c.G3061A	GRCh37	CM067447	PIK3CD	M		PASS	.						79.0	71.0	74.0					1																	9787030		2203	4300	6503	SO:0001583	missense	5293	exon24			TTTAACGAAGCCC		CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.3061G>A	1.37:g.9787030G>A	ENSP00000366563:p.Glu1021Lys	109.0	0.0	0		117.0	59.0	0.504274	NM_005026	A6NCG0|G1FFP1|O15445|Q5SR49	Missense_Mutation	SNP	ENST00000377346.4	37	CCDS104.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810780	0.50421	.	.	ENSG00000171608	ENST00000536656;ENST00000377346;ENST00000361110;ENST00000360563	T;T;T	0.81415	-1.49;-1.49;-1.49	4.65	3.72	0.42706	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.86431	0.5931	L	0.53729	1.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;P;D	0.74674	0.984;0.876;0.941	D	0.87336	0.2328	10	0.87932	D	0	-17.4746	14.041	0.64674	0.0:0.0:0.8477:0.1523	.	1020;1045;1021	B7ZM44;Q5SR50;O00329	.;.;PK3CD_HUMAN	K	1045;1021;1045;1045	ENSP00000446444:E1045K;ENSP00000366563:E1021K;ENSP00000354410:E1045K	ENSP00000353766:E1045K	E	+	1	0	PIK3CD	9709617	1.000000	0.71417	0.115000	0.21578	0.699000	0.40488	9.865000	0.99609	0.945000	0.37605	-0.187000	0.12897	GAA	.	.	none		0.567	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004235.1	NM_005026	
MAPK10	5602	hgsc.bcm.edu	37	4	87022299	87022299	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:87022299C>T	ENST00000359221.3	-	8	1162	c.636G>A	c.(634-636)agG>agA	p.R212R	MAPK10_ENST00000395166.1_Silent_p.R174R|MAPK10_ENST00000361569.2_Silent_p.R212R|MAPK10_ENST00000449047.2_Silent_p.R67R|MAPK10_ENST00000395161.2_Silent_p.R212R|MAPK10_ENST00000513839.1_5'Flank|MAPK10_ENST00000395160.3_Silent_p.R67R|MAPK10_ENST00000395157.3_Silent_p.R67R|MAPK10_ENST00000395169.3_Silent_p.R174R			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	212	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)	p.R212S(1)|p.R67S(1)		breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TGCCTGCTGTCCTGGCCAGTC	0.448																																					p.R212R		Atlas-SNP	.											MAPK10_ENST00000449047,NS,carcinoma,0,1	MAPK10	106	1	2	Substitution - Missense(2)	lung(2)	c.G636A						PASS	.						119.0	100.0	107.0					4																	87022299		2203	4300	6503	SO:0001819	synonymous_variant	5602	exon8			TGCTGTCCTGGCC	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.636G>A	4.37:g.87022299C>T		124.0	0.0	0		174.0	45.0	0.258621	NM_002753	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Silent	SNP	ENST00000359221.3	37	CCDS34026.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.409014	0.25378	.	.	ENSG00000109339	ENST00000515400	.	.	.	5.84	3.2	0.36748	.	.	.	.	.	T	0.59487	0.2197	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55153	-0.8185	4	.	.	.	-18.4515	9.8477	0.41037	0.0:0.7294:0.0:0.2706	.	.	.	.	N	125	.	.	D	-	1	0	MAPK10	87241323	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	0.528000	0.23002	0.822000	0.34565	0.557000	0.71058	GAC	.	.	none		0.448	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
PLXNA1	5361	hgsc.bcm.edu	37	3	126733600	126733600	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:126733600G>A	ENST00000393409.2	+	13	2803	c.2803G>A	c.(2803-2805)Gcc>Acc	p.A935T	PLXNA1_ENST00000251772.4_Missense_Mutation_p.A912T	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	935	IPT/TIG 1.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TGCCCATGACGCCCTGGTGGA	0.697																																					p.A935T		Atlas-SNP	.											.	PLXNA1	185	.	0			c.G2803A						PASS	.						62.0	46.0	52.0					3																	126733600		2202	4299	6501	SO:0001583	missense	5361	exon13			CATGACGCCCTGG	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2803G>A	3.37:g.126733600G>A	ENSP00000377061:p.Ala935Thr	99.0	0.0	0		67.0	13.0	0.19403	NM_032242		Missense_Mutation	SNP	ENST00000393409.2	37	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402308	0.83230	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.77098	-1.07;-1.07	4.21	4.21	0.49690	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	D	0.84088	0.5395	L	0.55743	1.74	0.58432	D	0.999999	D	0.60575	0.988	D	0.63488	0.915	D	0.84986	0.0891	10	0.48119	T	0.1	.	16.7531	0.85492	0.0:0.0:1.0:0.0	.	935	Q9UIW2	PLXA1_HUMAN	T	935;912	ENSP00000377061:A935T;ENSP00000251772:A912T	ENSP00000251772:A912T	A	+	1	0	PLXNA1	128216290	1.000000	0.71417	0.927000	0.36925	0.341000	0.28922	7.032000	0.76498	2.184000	0.69523	0.484000	0.47621	GCC	.	.	none		0.697	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
MRPL49	740	hgsc.bcm.edu	37	11	64889279	64889279	+	5'Flank	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:64889279G>C	ENST00000279242.2	+	0	0				MRPL49_ENST00000526171.1_5'Flank|FAU_ENST00000434372.2_Missense_Mutation_p.L3V|FAU_ENST00000525297.1_Missense_Mutation_p.L3V|FAU_ENST00000529639.1_Missense_Mutation_p.L3V|MRPL49_ENST00000534078.1_5'Flank|FAU_ENST00000527548.1_Missense_Mutation_p.L3V|FAU_ENST00000279259.3_Missense_Mutation_p.L3V|FAU_ENST00000529259.1_Missense_Mutation_p.L3V|MRPL49_ENST00000531705.1_5'Flank|FAU_ENST00000531743.1_Missense_Mutation_p.L3V	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						CGGACAAAGAGCTGCATATTG	0.537																																					p.L3V		Atlas-SNP	.											FAU,NS,carcinoma,+2,1	FAU	17	1	0			c.C7G						PASS	.						67.0	61.0	63.0					11																	64889279		2201	4297	6498	SO:0001631	upstream_gene_variant	2197	exon2			CAAAGAGCTGCAT		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		11.37:g.64889279G>C	Exception_encountered	89.0	0.0	0		87.0	22.0	0.252874	NM_001997	B2R4G6	Missense_Mutation	SNP	ENST00000279242.2	37	CCDS8096.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409753	0.83340	.	.	ENSG00000149806	ENST00000529639;ENST00000531743;ENST00000525297;ENST00000527548;ENST00000279259;ENST00000529259;ENST00000526555;ENST00000434372	T;T;T;T;T;T;T;T	0.60548	1.11;1.11;0.18;1.11;1.11;1.11;1.11;1.11	5.92	4.99	0.66335	Ubiquitin supergroup (1);Ubiquitin (1);	0.058047	0.64402	N	0.000001	T	0.57607	0.2065	M	0.71920	2.185	0.80722	D	1	P;P	0.41393	0.461;0.748	B;B	0.37480	0.181;0.251	T	0.64647	-0.6358	10	0.72032	D	0.01	-4.6526	14.7826	0.69776	0.0:0.145:0.8549:0.0	.	3;3	E9PMS9;P35544	.;UBIM_HUMAN	V	3	ENSP00000435370:L3V;ENSP00000431822:L3V;ENSP00000436110:L3V;ENSP00000434440:L3V;ENSP00000279259:L3V;ENSP00000434680:L3V;ENSP00000433139:L3V;ENSP00000413848:L3V	ENSP00000279259:L3V	L	-	1	0	FAU	64645855	1.000000	0.71417	0.994000	0.49952	0.853000	0.48598	4.503000	0.60407	1.476000	0.48215	0.650000	0.86243	CTC	.	.	none		0.537	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
DSEL	92126	hgsc.bcm.edu	37	18	65180867	65180867	+	Missense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr18:65180867C>A	ENST00000310045.7	-	2	2482	c.1009G>T	c.(1009-1011)Gtg>Ttg	p.V337L	CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	327					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GCTATACCCACAGTTCTTTGG	0.383																																					p.V337L		Atlas-SNP	.											.	DSEL	196	.	0			c.G1009T						PASS	.						69.0	74.0	72.0					18																	65180867		2203	4300	6503	SO:0001583	missense	92126	exon2			TACCCACAGTTCT	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1009G>T	18.37:g.65180867C>A	ENSP00000310565:p.Val337Leu	78.0	0.0	0		72.0	13.0	0.180556	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.743918	0.49151	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.27402	1.67	4.9	4.9	0.64082	.	0.000000	0.64402	U	0.000002	T	0.31231	0.0790	M	0.71581	2.175	0.44694	D	0.997686	P	0.37955	0.612	B	0.33960	0.173	T	0.11665	-1.0578	10	0.39692	T	0.17	-13.9785	11.9105	0.52737	0.0:0.9195:0.0:0.0805	.	327	Q8IZU8	DSEL_HUMAN	L	337;327	ENSP00000310565:V337L	ENSP00000310565:V337L	V	-	1	0	DSEL	63331847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.819000	0.62664	2.460000	0.83146	0.563000	0.77884	GTG	.	.	none		0.383	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
FAM83D	81610	hgsc.bcm.edu	37	20	37555095	37555095	+	Missense_Mutation	SNP	C	C	G	rs542789388		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:37555095C>G	ENST00000217429.4	+	1	141	c.100C>G	c.(100-102)Ctg>Gtg	p.L34V		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	4					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				CATGGCTCTGCTGTCCGAGGG	0.672																																					p.L34V		Atlas-SNP	.											.	FAM83D	60	.	0			c.C100G						PASS	.						13.0	17.0	15.0					20																	37555095		1906	4100	6006	SO:0001583	missense	81610	exon1			GCTCTGCTGTCCG	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.100C>G	20.37:g.37555095C>G	ENSP00000217429:p.Leu34Val	34.0	0.0	0		29.0	6.0	0.206897	NM_030919	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Missense_Mutation	SNP	ENST00000217429.4	37	CCDS42872.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471206	0.43942	.	.	ENSG00000101447	ENST00000217429;ENST00000424027	T	0.12255	2.7	5.48	-0.0886	0.13672	.	6.575320	0.00481	N	0.000125	T	0.08268	0.0206	N	0.14661	0.345	0.09310	N	1	B;B	0.31548	0.22;0.328	B;B	0.31101	0.058;0.124	T	0.22836	-1.0205	10	0.19590	T	0.45	.	5.1809	0.15160	0.2481:0.5461:0.0:0.2058	.	4;4	Q9H4H8;Q9H4H8-2	FA83D_HUMAN;.	V	34;4	ENSP00000217429:L34V	ENSP00000217429:L34V	L	+	1	2	FAM83D	36988509	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.197000	0.17197	0.029000	0.15352	0.655000	0.94253	CTG	.	.	none		0.672	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
SGK1	6446	hgsc.bcm.edu	37	6	134495211	134495211	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495211C>G	ENST00000237305.7	-	3	248	c.160G>C	c.(160-162)Gtt>Ctt	p.V54L	SGK1_ENST00000367858.5_Missense_Mutation_p.V149L|SGK1_ENST00000475719.2_Missense_Mutation_p.V54L|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Missense_Mutation_p.V82L|SGK1_ENST00000367857.5_Missense_Mutation_p.V44L|SGK1_ENST00000413996.3_Missense_Mutation_p.V68L	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	54	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		ATGGACTGAACTTCAGGGCTG	0.498																																					p.V149L		Atlas-SNP	.											SGK1_ENST00000528577,NS,lymphoid_neoplasm,0,5	SGK1	387	5	0			c.G445C						PASS	.						122.0	115.0	117.0					6																	134495211		2203	4300	6503	SO:0001583	missense	6446	exon5			ACTGAACTTCAGG	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.160G>C	6.37:g.134495211C>G	ENSP00000237305:p.Val54Leu	85.0	0.0	0		73.0	6.0	0.0821918	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.408672	0.83340	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.38077	1.71;1.71;1.71;1.71;1.71;1.71;1.16	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.57636	0.2067	M	0.76574	2.34	0.80722	D	1	P;D;B;B;B;B	0.67145	0.529;0.996;0.117;0.289;0.262;0.19	B;D;B;B;B;B	0.76071	0.17;0.987;0.056;0.105;0.276;0.056	T	0.56890	-0.7904	10	0.59425	D	0.04	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	82;68;54;44;149;54	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	L	149;68;54;44;82;54;118	ENSP00000356832:V149L;ENSP00000396242:V68L;ENSP00000237305:V54L;ENSP00000356831:V44L;ENSP00000434450:V82L;ENSP00000434302:V54L;ENSP00000435577:V118L	ENSP00000237305:V54L	V	-	1	0	SGK1	134536904	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.487000	0.81328	2.840000	0.97914	0.655000	0.94253	GTT	.	.	none		0.498	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
INHBB	3625	hgsc.bcm.edu	37	2	121107185	121107185	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:121107185G>A	ENST00000295228.3	+	2	1005	c.959G>A	c.(958-960)tGg>tAg	p.W320*		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	320					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				TGGAACGACTGGATCATAGCA	0.622																																					p.W320X		Atlas-SNP	.											INHBB,NS,malignant_melanoma,-1,1	INHBB	29	1	0			c.G959A						PASS	.						78.0	75.0	76.0					2																	121107185		2203	4300	6503	SO:0001587	stop_gained	3625	exon2			ACGACTGGATCAT		CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.959G>A	2.37:g.121107185G>A	ENSP00000295228:p.Trp320*	142.0	0.0	0		100.0	4.0	0.04	NM_002193	Q53T31|Q8N1D3	Nonsense_Mutation	SNP	ENST00000295228.3	37	CCDS2132.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144622	0.57044	.	.	ENSG00000163083	ENST00000295228	.	.	.	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.61	16.4938	0.84209	0.0:0.0:1.0:0.0	.	.	.	.	X	320	.	ENSP00000295228:W320X	W	+	2	0	INHBB	120823655	1.000000	0.71417	1.000000	0.80357	0.066000	0.16364	9.507000	0.97996	2.495000	0.84180	0.563000	0.77884	TGG	.	.	none		0.622	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
MCMDC2	157777	hgsc.bcm.edu	37	8	67796149	67796149	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:67796149A>G	ENST00000422365.2	+	9	1164	c.993A>G	c.(991-993)gtA>gtG	p.V331V	MCMDC2_ENST00000313616.5_Silent_p.V331V|MCMDC2_ENST00000492775.1_Silent_p.V331V|MCMDC2_ENST00000541540.1_Silent_p.V268V|MCMDC2_ENST00000396592.3_Silent_p.V331V	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	331					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						TGAGTCTAGTACAGACAACTG	0.378																																					p.V331V		Atlas-SNP	.											.	MCMDC2	84	.	0			c.A993G						PASS	.						75.0	71.0	72.0					8																	67796149		2203	4300	6503	SO:0001819	synonymous_variant	157777	exon9			TCTAGTACAGACA	BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.993A>G	8.37:g.67796149A>G		92.0	0.0	0		103.0	5.0	0.0485437	NM_173518	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Silent	SNP	ENST00000422365.2	37	CCDS6197.2																																																																																			.	.	none		0.378	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518	
SMG1	23049	hgsc.bcm.edu	37	16	18847712	18847712	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:18847712G>A	ENST00000446231.2	-	47	8159	c.7747C>T	c.(7747-7749)Ctt>Ttt	p.L2583F	SMG1_ENST00000389467.3_Missense_Mutation_p.L2583F			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2583					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATCTCTTGAAGCAAGCTTGCA	0.383																																					p.L2583F		Atlas-SNP	.											.	SMG1	401	.	0			c.C7747T						PASS	.						125.0	115.0	118.0					16																	18847712		1903	4133	6036	SO:0001583	missense	23049	exon47			CTTGAAGCAAGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.7747C>T	16.37:g.18847712G>A	ENSP00000402515:p.Leu2583Phe	98.0	0.0	0		125.0	22.0	0.176	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688557	0.68271	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01215	5.16;5.16	6.17	6.17	0.99709	Armadillo-type fold (1);	0.000000	0.64402	D	0.000010	T	0.02888	0.0086	N	0.19112	0.55	0.45427	D	0.998404	D	0.58620	0.983	P	0.56474	0.799	T	0.63782	-0.6559	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2583	Q96Q15	SMG1_HUMAN	F	2583	ENSP00000402515:L2583F;ENSP00000374118:L2583F	ENSP00000374118:L2583F	L	-	1	0	SMG1	18755213	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.862000	0.87013	2.941000	0.99782	0.655000	0.94253	CTT	.	.	none		0.383	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
TACR3	6870	hgsc.bcm.edu	37	4	104511045	104511045	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:104511045T>C	ENST00000304883.2	-	5	1332	c.1192A>G	c.(1192-1194)Agc>Ggc	p.S398G	RP11-297P16.3_ENST00000502936.1_RNA|RP11-297P16.3_ENST00000512401.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	398					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TACATACTGCTTTGCCGGTTT	0.507																																					p.S398G		Atlas-SNP	.											.	TACR3	102	.	0			c.A1192G						PASS	.						207.0	193.0	198.0					4																	104511045		2203	4300	6503	SO:0001583	missense	6870	exon5			TACTGCTTTGCCG	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1192A>G	4.37:g.104511045T>C	ENSP00000303325:p.Ser398Gly	195.0	0.0	0		252.0	58.0	0.230159	NM_001059	Q0P510	Missense_Mutation	SNP	ENST00000304883.2	37	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	T	14.99	2.701190	0.48307	.	.	ENSG00000169836	ENST00000304883	T	0.66460	-0.21	5.81	4.64	0.57946	.	0.043074	0.85682	N	0.000000	T	0.57110	0.2031	L	0.45422	1.42	0.47476	D	0.999437	B	0.11235	0.004	B	0.10450	0.005	T	0.51068	-0.8752	10	0.33141	T	0.24	.	11.0731	0.48014	0.0:0.072:0.0:0.928	.	398	P29371	NK3R_HUMAN	G	398	ENSP00000303325:S398G	ENSP00000303325:S398G	S	-	1	0	TACR3	104730494	1.000000	0.71417	0.974000	0.42286	0.982000	0.71751	5.850000	0.69473	1.034000	0.39945	0.482000	0.46254	AGC	.	.	none		0.507	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
NTPCR	84284	hgsc.bcm.edu	37	1	233113956	233113956	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:233113956C>T	ENST00000366628.5	+	5	639	c.552C>T	c.(550-552)tgC>tgT	p.C184C	NTPCR_ENST00000490098.1_3'UTR	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related	184						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(1)|ovary(1)	4						TCGTGACGTGCGTGCAGAGCA	0.537																																					p.C184C		Atlas-SNP	.											.	NTPCR	15	.	0			c.C552T						PASS	.						111.0	88.0	96.0					1																	233113956		2203	4300	6503	SO:0001819	synonymous_variant	84284	exon5			GACGTGCGTGCAG	BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.552C>T	1.37:g.233113956C>T		110.0	0.0	0		89.0	4.0	0.0449438	NM_032324		Silent	SNP	ENST00000366628.5	37	CCDS1597.1																																																																																			.	.	none		0.537	NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092324.2	NM_032324	
RBMS3	27303	hgsc.bcm.edu	37	3	29938967	29938967	+	Splice_Site	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:29938967G>T	ENST00000383767.2	+	9	1224		c.e9+1		RBMS3_ENST00000434693.2_Splice_Site|RBMS3_ENST00000383766.2_Splice_Site|RBMS3_ENST00000452462.1_Splice_Site|RBMS3_ENST00000456853.1_Splice_Site|RBMS3_ENST00000273139.9_Splice_Site|RBMS3_ENST00000396583.3_Splice_Site			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3						positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CACATACCAGGTATGTCCAAT	0.398																																					.		Atlas-SNP	.											.	RBMS3	62	.	0			c.927+1G>T						PASS	.						204.0	183.0	190.0					3																	29938967		2203	4300	6503	SO:0001630	splice_region_variant	27303	exon10			TACCAGGTATGTC	AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.888+1G>T	3.37:g.29938967G>T		143.0	0.0	0		177.0	41.0	0.231638	NM_001177712	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Splice_Site	SNP	ENST00000383767.2	37	CCDS33724.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872761	0.91587	.	.	ENSG00000144642	ENST00000434693;ENST00000396583;ENST00000383767;ENST00000273139;ENST00000383766;ENST00000452462;ENST00000456853	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.754	0.91825	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBMS3	29913971	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.433000	0.82419	0.655000	0.94253	.	.	.	none		0.398	RBMS3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000341306.1	NM_001003792	Intron
SP140	11262	hgsc.bcm.edu	37	2	231102990	231102990	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:231102990T>G	ENST00000392045.3	+	3	414	c.300T>G	c.(298-300)agT>agG	p.S100R	SP140_ENST00000343805.6_Missense_Mutation_p.S100R|SP140_ENST00000350136.5_Missense_Mutation_p.S80R|SP140_ENST00000544128.1_3'UTR|SP140_ENST00000420434.3_Missense_Mutation_p.S100R|SP140_ENST00000417495.3_Missense_Mutation_p.S100R|SP140_ENST00000486687.2_Missense_Mutation_p.S100R|SP140_ENST00000373645.3_Missense_Mutation_p.S100R	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	100	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GTGTACTCAGTGAACTGGAGA	0.388																																					p.S100R		Atlas-SNP	.											.	SP140	121	.	0			c.T300G						PASS	.						127.0	117.0	120.0					2																	231102990		2203	4300	6503	SO:0001583	missense	11262	exon3			ACTCAGTGAACTG	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.300T>G	2.37:g.231102990T>G	ENSP00000375899:p.Ser100Arg	181.0	0.0	0		230.0	51.0	0.221739	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	37	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	T	12.17	1.856712	0.32791	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	D;D;D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56;-3.56;-3.56	3.7	-4.24	0.03777	Sp100 (2);	.	.	.	.	D	0.92792	0.7708	M	0.68317	2.08	0.09310	N	1	B;B;B;P;B;B	0.41232	0.288;0.288;0.244;0.743;0.45;0.122	B;B;B;P;B;B	0.50192	0.148;0.148;0.092;0.634;0.243;0.063	D	0.85321	0.1084	9	0.87932	D	0	-2.9298	0.0805	0.00031	0.3142:0.2021:0.1609:0.3228	.	100;100;100;100;100;100	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75;Q6NSG4	.;.;.;LY10_HUMAN;.;.	R	100;100;100;80;100;100;100;100;100	ENSP00000440107:S100R;ENSP00000345846:S80R;ENSP00000375899:S100R;ENSP00000342096:S100R;ENSP00000398210:S100R;ENSP00000362749:S100R	ENSP00000342096:S100R	S	+	3	2	SP140	230811234	0.000000	0.05858	0.001000	0.08648	0.793000	0.44817	-0.731000	0.04909	-0.792000	0.04480	0.533000	0.62120	AGT	.	.	none		0.388	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
RALYL	138046	hgsc.bcm.edu	37	8	85774611	85774611	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:85774611C>T	ENST00000521268.1	+	6	1599	c.494C>T	c.(493-495)aCg>aTg	p.T165M	RALYL_ENST00000521376.1_Missense_Mutation_p.T76M|RALYL_ENST00000522455.1_Missense_Mutation_p.T165M|RALYL_ENST00000523850.1_Missense_Mutation_p.T92M|RALYL_ENST00000517638.1_Missense_Mutation_p.T178M|RALYL_ENST00000518566.1_Missense_Mutation_p.T154M|RALYL_ENST00000521695.1_Missense_Mutation_p.T165M	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	165							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GCAGTCACAACGACTCGCAGG	0.483																																					p.T178M		Atlas-SNP	.											.	RALYL	123	.	0			c.C533T						PASS	.						56.0	61.0	59.0					8																	85774611		1929	4136	6065	SO:0001583	missense	138046	exon6			TCACAACGACTCG		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.494C>T	8.37:g.85774611C>T	ENSP00000430367:p.Thr165Met	57.0	0.0	0		53.0	13.0	0.245283	NM_001100391	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	37	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526572	0.64860	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.18657	2.83;2.83;2.83;2.85;2.83;2.42;2.2	5.1	5.1	0.69264	.	0.214143	0.49305	D	0.000143	T	0.35941	0.0949	M	0.61703	1.905	0.09310	N	1	P;D;P;P;D	0.60160	0.791;0.987;0.939;0.93;0.987	B;P;B;P;P	0.51016	0.336;0.588;0.337;0.656;0.588	T	0.19192	-1.0313	10	0.62326	D	0.03	-3.4988	18.8851	0.92375	0.0:1.0:0.0:0.0	.	154;165;92;178;165	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	M	165;165;165;154;178;92;76	ENSP00000430394:T165M;ENSP00000428667:T165M;ENSP00000430367:T165M;ENSP00000430065:T154M;ENSP00000430128:T178M;ENSP00000428807:T92M;ENSP00000428310:T76M	ENSP00000430128:T178M	T	+	2	0	RALYL	85937166	0.679000	0.27596	0.011000	0.14972	0.798000	0.45092	5.613000	0.67688	2.511000	0.84671	0.551000	0.68910	ACG	.	.	none		0.483	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
SOX15	6665	hgsc.bcm.edu	37	17	7492686	7492686	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:7492686C>T	ENST00000250055.2	-	1	802	c.309G>A	c.(307-309)aaG>aaA	p.K103K	SOX15_ENST00000570788.1_Silent_p.K103K|MPDU1_ENST00000423172.2_Intron|FXR2_ENST00000573057.1_5'Flank|SOX15_ENST00000538513.2_Silent_p.K103K	NM_006942.1	NP_008873.1	O60248	SOX15_HUMAN	SRY (sex determining region Y)-box 15	103					cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|male gonad development (GO:0008584)|myoblast development (GO:0048627)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue regeneration (GO:0043403)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)	2						CGCGGAGCCGCTTGGCCTCCT	0.682											OREG0024139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K103K		Atlas-SNP	.											.	SOX15	10	.	0			c.G309A						PASS	.						24.0	27.0	26.0					17																	7492686		2202	4299	6501	SO:0001819	synonymous_variant	6665	exon1			GAGCCGCTTGGCC	AJ006222	CCDS32549.1	17p13.1	2014-08-12	2002-07-22	2002-07-26	ENSG00000129194	ENSG00000129194		"""SRY (sex determining region Y)-boxes"""	11196	protein-coding gene	gene with protein product		601297	"""SRY (sex determining region Y)-box 20"""	SOX20		8978787, 9730625	Standard	NM_006942		Approved	SOX27, SOX26	uc002ghz.1	O60248	OTTHUMG00000178146	ENST00000250055.2:c.309G>A	17.37:g.7492686C>T		155.0	0.0	0	642	79.0	11.0	0.139241	NM_006942	B4DWU7|D3DTQ0|P35717|Q9Y6W7	Silent	SNP	ENST00000250055.2	37	CCDS32549.1																																																																																			.	.	none		0.682	SOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440757.1	NM_006942	
OR5W2	390148	hgsc.bcm.edu	37	11	55681542	55681542	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:55681542C>A	ENST00000344514.1	-	1	516	c.517G>T	c.(517-519)Gag>Tag	p.E173*		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TGATTAATCTCATTAGACCCA	0.418																																					p.E173X	Melanoma(48;171 1190 15239 43886 49348)	Atlas-SNP	.											OR5W2,colon,carcinoma,+2,1	OR5W2	112	1	0			c.G517T						PASS	.						84.0	77.0	79.0					11																	55681542		2201	4296	6497	SO:0001587	stop_gained	390148	exon1			TAATCTCATTAGA	BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.517G>T	11.37:g.55681542C>A	ENSP00000342448:p.Glu173*	52.0	0.0	0		69.0	15.0	0.217391	NM_001001960		Nonsense_Mutation	SNP	ENST00000344514.1	37	CCDS31513.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861330	0.71949	.	.	ENSG00000187612	ENST00000344514	.	.	.	5.0	4.09	0.47781	.	0.000000	0.40818	N	0.001006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	11.1192	0.48279	0.0:0.9092:0.0:0.0908	.	.	.	.	X	173	.	ENSP00000342448:E173X	E	-	1	0	OR5W2	55438118	0.000000	0.05858	0.625000	0.29200	0.981000	0.71138	-0.662000	0.05305	1.097000	0.41459	0.542000	0.68232	GAG	.	.	none		0.418	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391523.1	NM_001001960	
SGK1	6446	hgsc.bcm.edu	37	6	134495170	134495170	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495170C>G	ENST00000237305.7	-	3	289	c.201G>C	c.(199-201)gaG>gaC	p.E67D	SGK1_ENST00000367858.5_Missense_Mutation_p.E162D|SGK1_ENST00000475719.2_Missense_Mutation_p.E67D|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Missense_Mutation_p.E95D|SGK1_ENST00000367857.5_Missense_Mutation_p.E57D|SGK1_ENST00000413996.3_Missense_Mutation_p.E81D	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	67					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CATTCATAAGCTCAGGCTCCT	0.483																																					p.E162D		Atlas-SNP	.											.	SGK1	387	.	0			c.G486C						PASS	.						150.0	144.0	146.0					6																	134495170		2203	4300	6503	SO:0001583	missense	6446	exon5			CATAAGCTCAGGC	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.201G>C	6.37:g.134495170C>G	ENSP00000237305:p.Glu67Asp	94.0	0.0	0		71.0	5.0	0.0704225	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893621	0.52121	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.66;-0.66;-0.64;-0.64	5.99	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	L	0.45137	1.4	0.80722	D	1	B;B;B;B;B;B	0.18461	0.005;0.028;0.001;0.013;0.017;0.001	B;B;B;B;B;B	0.21917	0.012;0.011;0.001;0.007;0.037;0.003	T	0.36383	-0.9750	10	0.30854	T	0.27	.	7.4903	0.27458	0.0:0.6523:0.0:0.3477	.	95;81;67;57;162;67	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	D	162;81;67;57;95;67;131	ENSP00000356832:E162D;ENSP00000396242:E81D;ENSP00000237305:E67D;ENSP00000356831:E57D;ENSP00000434450:E95D;ENSP00000434302:E67D	ENSP00000237305:E67D	E	-	3	2	SGK1	134536863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.890000	0.39728	0.848000	0.35191	0.655000	0.94253	GAG	.	.	none		0.483	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
HECTD4	283450	hgsc.bcm.edu	37	12	112622063	112622063	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr12:112622063G>A	ENST00000430131.2	-	60	10586	c.9441C>T	c.(9439-9441)tcC>tcT	p.S3147S	HECTD4_ENST00000550722.1_Silent_p.S3423S|HECTD4_ENST00000377560.5_Silent_p.S3397S			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3147					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CTGTGTACATGGAGCCCATGT	0.637																																					p.S3435S		Atlas-SNP	.											.	.	.	.	0			c.C10305T						PASS	.						74.0	85.0	82.0					12																	112622063		1990	4157	6147	SO:0001819	synonymous_variant	283450	exon61			GTACATGGAGCCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.9441C>T	12.37:g.112622063G>A		130.0	0.0	0		82.0	18.0	0.219512	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	37																																																																																				.	.	none		0.637	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
ALKBH8	91801	hgsc.bcm.edu	37	11	107423860	107423860	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:107423860A>T	ENST00000428149.2	-	5	720	c.569T>A	c.(568-570)gTa>gAa	p.V190E	ALKBH8_ENST00000389568.3_Missense_Mutation_p.V190E|ALKBH8_ENST00000530933.1_5'Flank|ALKBH8_ENST00000417449.2_Missense_Mutation_p.V193E|ALKBH8_ENST00000429370.1_Missense_Mutation_p.V190E	NM_138775.2	NP_620130.2	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8 (E. coli)	190					cellular response to DNA damage stimulus (GO:0006974)|tRNA methylation (GO:0030488)	cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|RNA binding (GO:0003723)|tRNA (uracil) methyltransferase activity (GO:0016300)	p.V190A(2)		breast(2)|large_intestine(2)|lung(5)	9		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		ATCTTTATCTACATTGTTGTT	0.308																																					p.V190E		Atlas-SNP	.											ALKBH8_ENST00000428149,colon,carcinoma,0,2	ALKBH8	88	2	2	Substitution - Missense(2)	large_intestine(2)	c.T569A						scavenged	.						139.0	128.0	132.0					11																	107423860		2200	4294	6494	SO:0001583	missense	91801	exon5			TTATCTACATTGT	AF086489	CCDS8337.2, CCDS73376.1	11q22.3	2013-10-04			ENSG00000137760	ENSG00000137760	2.1.1.229	"""Alkylation repair homologs"", ""RNA binding motif (RRM) containing"""	25189	protein-coding gene	gene with protein product		613306				20123966	Standard	NM_138775		Approved	MGC10235	uc009yxp.3	Q96BT7	OTTHUMG00000157008	ENST00000428149.2:c.569T>A	11.37:g.107423860A>T	ENSP00000415885:p.Val190Glu	99.0	0.0	0		74.0	3.0	0.0405405	NM_138775	B1Q2M0|B4DEF6|Q8N989	Missense_Mutation	SNP	ENST00000428149.2	37	CCDS8337.2	.	.	.	.	.	.	.	.	.	.	A	25.1	4.602662	0.87157	.	.	ENSG00000137760	ENST00000428149;ENST00000429370;ENST00000389568;ENST00000417449	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.52	5.52	0.82312	.	0.062750	0.64402	D	0.000007	T	0.56411	0.1983	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.61182	-0.7114	10	0.87932	D	0	-25.9757	14.8123	0.70006	1.0:0.0:0.0:0.0	.	190	Q96BT7	ALKB8_HUMAN	E	190;190;190;193	ENSP00000415885:V190E;ENSP00000391225:V190E;ENSP00000374219:V190E;ENSP00000397673:V193E	ENSP00000260318:V190E	V	-	2	0	ALKBH8	106929070	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.572000	0.90756	2.095000	0.63458	0.482000	0.46254	GTA	.	.	none		0.308	ALKBH8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347071.2	NM_138775	
GRIK4	2900	hgsc.bcm.edu	37	11	120831697	120831697	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr11:120831697C>T	ENST00000527524.2	+	17	2241	c.1954C>T	c.(1954-1956)Ccc>Tcc	p.P652S	GRIK4_ENST00000438375.2_Missense_Mutation_p.P652S	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	652					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		CATGGATGTGCCCATTGAGTC	0.532																																					p.P652S		Atlas-SNP	.											GRIK4,NS,carcinoma,-1,1	GRIK4	149	1	0			c.C1954T						PASS	.						140.0	111.0	121.0					11																	120831697		2203	4299	6502	SO:0001583	missense	2900	exon15			GATGTGCCCATTG	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1954C>T	11.37:g.120831697C>T	ENSP00000435648:p.Pro652Ser	130.0	0.0	0		130.0	31.0	0.238462	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	C	34	5.386043	0.95967	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.11495	2.77;2.77	5.51	5.51	0.81932	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.35278	0.0926	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.03240	-1.1057	10	0.66056	D	0.02	.	19.0461	0.93020	0.0:1.0:0.0:0.0	.	652;652	A6H8K8;Q16099	.;GRIK4_HUMAN	S	652	ENSP00000435648:P652S;ENSP00000404063:P652S	ENSP00000404063:P652S	P	+	1	0	GRIK4	120336907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.593000	0.87608	0.655000	0.94253	CCC	.	.	none		0.532	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
KLHL6	89857	hgsc.bcm.edu	37	3	183209942	183209942	+	Missense_Mutation	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:183209942C>G	ENST00000341319.3	-	7	1674	c.1639G>C	c.(1639-1641)Gag>Cag	p.E547Q		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	547					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CTGGCCCGCTCGTGGCTGAGC	0.657																																					p.E547Q		Atlas-SNP	.											.	KLHL6	100	.	0			c.G1639C						PASS	.						39.0	39.0	39.0					3																	183209942		2202	4299	6501	SO:0001583	missense	89857	exon7			CCCGCTCGTGGCT	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1639G>C	3.37:g.183209942C>G	ENSP00000341342:p.Glu547Gln	174.0	0.0	0		152.0	27.0	0.177632	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940006	0.73557	.	.	ENSG00000172578	ENST00000341319	T	0.66815	-0.23	5.8	5.8	0.92144	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.73489	0.3593	L	0.33668	1.02	0.50467	D	0.999877	D	0.60575	0.988	D	0.66497	0.944	T	0.67245	-0.5719	10	0.22706	T	0.39	.	20.029	0.97531	0.0:1.0:0.0:0.0	.	547	Q8WZ60	KLHL6_HUMAN	Q	547	ENSP00000341342:E547Q	ENSP00000341342:E547Q	E	-	1	0	KLHL6	184692636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.907000	0.69908	2.742000	0.94016	0.591000	0.81541	GAG	.	.	none		0.657	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
CHD8	57680	hgsc.bcm.edu	37	14	21870201	21870201	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:21870201C>T	ENST00000557364.1	-	20	4240	c.3977G>A	c.(3976-3978)tGt>tAt	p.C1326Y	CHD8_ENST00000430710.3_Missense_Mutation_p.C1047Y|CHD8_ENST00000399982.2_Missense_Mutation_p.C1326Y|CHD8_ENST00000555962.1_5'UTR			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1326					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GTCCTCTTCACAAAACTTGGA	0.403																																					p.C1326Y		Atlas-SNP	.											.	CHD8	339	.	0			c.G3977A						PASS	.						163.0	157.0	159.0					14																	21870201		2037	4224	6261	SO:0001583	missense	57680	exon19			TCTTCACAAAACT	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3977G>A	14.37:g.21870201C>T	ENSP00000451601:p.Cys1326Tyr	142.0	0.0	0		197.0	31.0	0.15736	NM_001170629	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	ENST00000557364.1	37	CCDS53885.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.109408	0.77096	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.85702	-2.02;-2.02;-2.02	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.91835	0.7416	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89666	0.3880	10	0.38643	T	0.18	-18.0066	19.6509	0.95805	0.0:1.0:0.0:0.0	.	1326;1047	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	Y	1047;1326;1046;1326	ENSP00000406288:C1047Y;ENSP00000382863:C1326Y;ENSP00000451601:C1326Y	ENSP00000262707:C1046Y	C	-	2	0	CHD8	20940041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	TGT	.	.	none		0.403	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410436.1	NM_020920	
SULF1	23213	hgsc.bcm.edu	37	8	70512971	70512971	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:70512971G>A	ENST00000260128.4	+	9	1585	c.868G>A	c.(868-870)Gat>Aat	p.D290N	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Missense_Mutation_p.D290N|SULF1_ENST00000402687.4_Missense_Mutation_p.D290N|SULF1_ENST00000419716.3_Missense_Mutation_p.D290N	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	290					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GATGTCAGTGGATGATTCTGT	0.438																																					p.D290N		Atlas-SNP	.											.	SULF1	153	.	0			c.G868A						PASS	.						163.0	155.0	158.0					8																	70512971		2203	4300	6503	SO:0001583	missense	23213	exon9			TCAGTGGATGATT	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.868G>A	8.37:g.70512971G>A	ENSP00000260128:p.Asp290Asn	89.0	0.0	0		106.0	22.0	0.207547	NM_001128205	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	ENST00000260128.4	37	CCDS6204.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.929844	0.92389	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	D;D;D;D	0.99842	-7.1;-7.1;-7.1;-7.1	6.16	6.16	0.99307	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.042703	0.85682	D	0.000000	D	0.99869	0.9938	M	0.90082	3.085	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.97261	0.9904	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	290	Q8IWU6	SULF1_HUMAN	N	290	ENSP00000403040:D290N;ENSP00000260128:D290N;ENSP00000385704:D290N;ENSP00000390315:D290N	ENSP00000260128:D290N	D	+	1	0	SULF1	70675525	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.905000	0.87416	2.937000	0.99478	0.650000	0.86243	GAT	.	.	none		0.438	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
ZNF572	137209	hgsc.bcm.edu	37	8	125989722	125989722	+	Silent	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:125989722A>G	ENST00000319286.5	+	3	1366	c.1212A>G	c.(1210-1212)agA>agG	p.R404R		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GACATCAGAGAACACATACAG	0.423										HNSCC(60;0.17)																											p.R404R		Atlas-SNP	.											ZNF572,colon,carcinoma,+1,1	ZNF572	82	1	0			c.A1212G						PASS	.						83.0	80.0	81.0					8																	125989722		2203	4300	6503	SO:0001819	synonymous_variant	137209	exon3			TCAGAGAACACAT	BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1212A>G	8.37:g.125989722A>G		57.0	0.0	0		65.0	4.0	0.0615385	NM_152412	A1L4F1|Q8N1Q0	Silent	SNP	ENST00000319286.5	37	CCDS6354.1																																																																																			.	.	none		0.423	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381359.1	NM_152412	
COASY	80347	hgsc.bcm.edu	37	17	40716156	40716156	+	Missense_Mutation	SNP	G	G	A	rs367865615		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:40716156G>A	ENST00000393818.2	+	2	1334	c.878G>A	c.(877-879)cGt>cAt	p.R293H	MLX_ENST00000346833.4_5'Flank|RP11-400F19.8_ENST00000585572.1_RNA|MLX_ENST00000246912.4_5'Flank|COASY_ENST00000420359.1_Missense_Mutation_p.R293H|COASY_ENST00000590958.1_Missense_Mutation_p.R322H|MLX_ENST00000435881.2_5'Flank|COASY_ENST00000421097.2_Missense_Mutation_p.R293H|COASY_ENST00000449624.1_5'UTR	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	293	Phosphopantetheine adenylyltransferase.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GAGACCTATCGTGGGGGGATG	0.622																																					p.R322H		Atlas-SNP	.											.	COASY	45	.	0			c.G965A						PASS	.						39.0	41.0	40.0					17																	40716156		2203	4300	6503	SO:0001583	missense	80347	exon4			CCTATCGTGGGGG	AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.878G>A	17.37:g.40716156G>A	ENSP00000377406:p.Arg293His	187.0	0.0	0		153.0	41.0	0.267974	NM_001042532	B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	ENST00000393818.2	37	CCDS11429.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500814	0.85176	.	.	ENSG00000068120	ENST00000421097;ENST00000420359;ENST00000393818	D;D;D	0.96459	-4.01;-4.02;-4.02	5.23	5.23	0.72850	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.106801	0.64402	D	0.000014	D	0.97498	0.9181	M	0.62266	1.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.973	D	0.97758	1.0219	10	0.87932	D	0	-11.0142	16.6827	0.85297	0.0:0.0:1.0:0.0	.	322;293	Q13057-2;Q13057	.;COASY_HUMAN	H	322;293;293	ENSP00000393564:R322H;ENSP00000413338:R293H;ENSP00000377406:R293H	ENSP00000377406:R293H	R	+	2	0	COASY	37969682	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.983000	0.40648	2.882000	0.98803	0.655000	0.94253	CGT	.	.	alt		0.622	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450409.1	NM_025233	
BRIP1	83990	hgsc.bcm.edu	37	17	59760682	59760682	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:59760682T>G	ENST00000259008.2	-	20	3992	c.3725A>C	c.(3724-3726)aAa>aCa	p.K1242T		NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1242					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						AAACATGCCTTTATTTTTGGA	0.284			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																													p.K1242T		Atlas-SNP	.	yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	.	BRIP1	237	.	0			c.A3725C						PASS	.						63.0	66.0	65.0					17																	59760682		2202	4292	6494	SO:0001583	missense	83990	exon20			ATGCCTTTATTTT	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.3725A>C	17.37:g.59760682T>G	ENSP00000259008:p.Lys1242Thr	73.0	0.0	0		102.0	20.0	0.196078	NM_032043	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	ENST00000259008.2	37	CCDS11631.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883513	0.33255	.	.	ENSG00000136492	ENST00000259008	T	0.77620	-1.11	4.35	4.35	0.52113	.	.	.	.	.	T	0.63010	0.2475	N	0.19112	0.55	0.80722	D	1	P	0.40970	0.734	B	0.39617	0.305	T	0.61153	-0.7120	8	.	.	.	.	11.1816	0.48631	0.0:0.0:0.0:1.0	.	1242	Q9BX63	FANCJ_HUMAN	T	1242	ENSP00000259008:K1242T	.	K	-	2	0	BRIP1	57115464	1.000000	0.71417	0.914000	0.36105	0.079000	0.17450	2.496000	0.45346	1.710000	0.51325	0.383000	0.25322	AAA	.	.	none		0.284	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445362.1	NM_032043	
GH2	2689	hgsc.bcm.edu	37	17	61957782	61957782	+	Missense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr17:61957782T>A	ENST00000423893.2	-	5	614	c.553A>T	c.(553-555)Aac>Tac	p.N185Y	GH2_ENST00000456543.2_Missense_Mutation_p.R183S|GH2_ENST00000332800.7_3'UTR|GH2_ENST00000449787.2_Missense_Mutation_p.N170Y			P01242	SOM2_HUMAN	growth hormone 2	185					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						AGCCCGTAGTTCTTGAGCAGT	0.557																																					p.N185Y		Atlas-SNP	.											.	GH2	73	.	0			c.A553T						PASS	.						201.0	164.0	177.0					17																	61957782		2203	4300	6503	SO:0001583	missense	2689	exon5			CGTAGTTCTTGAG	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.553A>T	17.37:g.61957782T>A	ENSP00000409294:p.Asn185Tyr	460.0	0.0	0		412.0	95.0	0.230583	NM_002059	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	37	CCDS11647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	12.27|12.27	1.886442|1.886442	0.33348|0.33348	.|.	.|.	ENSG00000136487|ENSG00000136487	ENST00000423893;ENST00000449787|ENST00000456543	D;D|D	0.88664|0.88896	-2.41;-2.41|-2.44	2.74|2.74	2.74|2.74	0.32292|0.32292	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);|.	.|.	.|.	.|.	.|.	D|D	0.93115|0.93115	0.7808|0.7808	M|M	0.93939|0.93939	3.475|3.475	0.80722|0.80722	D|D	1|1	D;D|P	0.89917|0.52170	1.0;1.0|0.951	D;D|P	0.97110|0.56088	1.0;0.998|0.791	D|D	0.91600|0.91600	0.5294|0.5294	9|9	0.87932|0.48119	D|T	0|0.1	.|.	5.5287|5.5287	0.16972|0.16972	0.0:0.1365:0.0:0.8635|0.0:0.1365:0.0:0.8635	.|.	185;170|183	P01242;O14643|O14644	SOM2_HUMAN;.|.	Y|S	185;170|183	ENSP00000409294:N185Y;ENSP00000410618:N170Y|ENSP00000394122:R183S	ENSP00000409294:N185Y|ENSP00000394122:R183S	N|R	-|-	1|3	0|2	GH2|GH2	59311514|59311514	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.020000|0.020000	0.10135|0.10135	3.546000|3.546000	0.53656|0.53656	1.255000|1.255000	0.44051|0.44051	0.254000|0.254000	0.18369|0.18369	AAC|AGA	.	.	none		0.557	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
TOR1AIP1	26092	hgsc.bcm.edu	37	1	179852022	179852022	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:179852022C>T	ENST00000606911.2	+	1	576	c.385C>T	c.(385-387)Cgc>Tgc	p.R129C	TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.R129C|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.R129C|RP11-533E19.7_ENST00000610272.1_lincRNA|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.R8C			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	129					positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						AAGGACTACCCGCCTTCAGCA	0.597																																					p.R129C		Atlas-SNP	.											.	TOR1AIP1	58	.	0			c.C385T						PASS	.						36.0	42.0	40.0					1																	179852022		2203	4300	6503	SO:0001583	missense	26092	exon1			ACTACCCGCCTTC		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.385C>T	1.37:g.179852022C>T	ENSP00000476687:p.Arg129Cys	101.0	0.0	0		92.0	4.0	0.0434783	NM_001267578	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703232	0.48412	.	.	ENSG00000143337	ENST00000528443;ENST00000325993;ENST00000271583;ENST00000435319	T;T;T	0.26810	1.71;1.71;1.71	3.48	1.49	0.22878	.	0.353873	0.20615	N	0.088900	T	0.38506	0.1043	M	0.61703	1.905	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.65773	0.91;0.938	T	0.12426	-1.0548	10	0.72032	D	0.01	-0.3755	4.6478	0.12580	0.0:0.6448:0.2268:0.1284	.	129;129	Q5JTV8;E9PKD1	TOIP1_HUMAN;.	C	129	ENSP00000435365:R129C;ENSP00000271583:R129C;ENSP00000393292:R129C	ENSP00000271583:R129C	R	+	1	0	TOR1AIP1	178118645	0.004000	0.15560	0.005000	0.12908	0.019000	0.09904	1.565000	0.36386	0.267000	0.21916	0.563000	0.77884	CGC	.	.	none		0.597	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602	
NBEA	26960	hgsc.bcm.edu	37	13	35632915	35632915	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:35632915G>A	ENST00000400445.3	+	8	1688	c.1154G>A	c.(1153-1155)gGt>gAt	p.G385D	NBEA_ENST00000540320.1_Missense_Mutation_p.G385D|NBEA_ENST00000379939.2_Missense_Mutation_p.G385D|NBEA_ENST00000310336.4_Missense_Mutation_p.G385D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	385					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GTATTCTGTGGTCAACTTGGT	0.358																																					p.G385D		Atlas-SNP	.											.	NBEA	340	.	0			c.G1154A						PASS	.						34.0	31.0	32.0					13																	35632915		1799	4063	5862	SO:0001583	missense	26960	exon8			TCTGTGGTCAACT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1154G>A	13.37:g.35632915G>A	ENSP00000383295:p.Gly385Asp	344.0	0.0	0		395.0	68.0	0.172152	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	29.4	5.004746	0.93287	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.94608	0.8262	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94886	0.8043	10	0.72032	D	0.01	.	19.6016	0.95566	0.0:0.0:1.0:0.0	.	385	Q5T321	.	D	385	ENSP00000440951:G385D;ENSP00000383295:G385D;ENSP00000369271:G385D;ENSP00000308534:G385D	ENSP00000308534:G385D	G	+	2	0	NBEA	34530915	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.718000	0.92993	0.650000	0.86243	GGT	.	.	none		0.358	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
CCR6	1235	hgsc.bcm.edu	37	6	167550741	167550741	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:167550741C>A	ENST00000341935.5	+	3	1575	c.1023C>A	c.(1021-1023)taC>taA	p.Y341*	CCR6_ENST00000349984.4_Nonsense_Mutation_p.Y341*|CCR6_ENST00000400926.2_Nonsense_Mutation_p.Y341*|RP11-517H2.6_ENST00000609590.1_RNA	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	341					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		GAAGGAAGTACAAGTCCTCAG	0.493																																					p.Y341X		Atlas-SNP	.											.	CCR6	36	.	0			c.C1023A						PASS	.						75.0	73.0	74.0					6																	167550741		2203	4300	6503	SO:0001587	stop_gained	1235	exon3			GAAGTACAAGTCC	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.1023C>A	6.37:g.167550741C>A	ENSP00000343952:p.Tyr341*	115.0	0.0	0		137.0	27.0	0.19708	NM_004367	E1P5C6|P78553|Q92846	Nonsense_Mutation	SNP	ENST00000341935.5	37	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	C	34	5.358683	0.95854	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	.	.	.	4.64	0.654	0.17833	.	6.339280	0.01476	U	0.016474	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9574	0.19281	0.0:0.5143:0.1513:0.3344	.	.	.	.	X	341	.	ENSP00000343952:Y341X	Y	+	3	2	CCR6	167470731	0.636000	0.27207	0.000000	0.03702	0.011000	0.07611	0.126000	0.15769	0.122000	0.18314	0.655000	0.94253	TAC	.	.	none		0.493	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1		
TMEM184C	55751	hgsc.bcm.edu	37	4	148539118	148539118	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:148539118C>T	ENST00000296582.3	+	1	585	c.11C>T	c.(10-12)aCt>aTt	p.T4I	RP11-425A23.1_ENST00000508072.1_RNA|TMEM184C_ENST00000508208.1_Missense_Mutation_p.T4I	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	4						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						ATGCCTTGCACTTGTACCTGG	0.478											OREG0016353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T4I		Atlas-SNP	.											.	TMEM184C	25	.	0			c.C11T						PASS	.						264.0	246.0	252.0					4																	148539118		2203	4300	6503	SO:0001583	missense	55751	exon1			CTTGCACTTGTAC	AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.11C>T	4.37:g.148539118C>T	ENSP00000296582:p.Thr4Ile	205.0	0.0	0	1718	220.0	51.0	0.231818	NM_018241	D3DP04|Q86X84|Q969I7|Q9NXM2	Missense_Mutation	SNP	ENST00000296582.3	37	CCDS3770.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374141	0.82573	.	.	ENSG00000164168	ENST00000296582;ENST00000508208	.	.	.	5.45	5.45	0.79879	.	0.138744	0.48767	D	0.000162	T	0.57621	0.2066	L	0.43152	1.355	0.51233	D	0.999917	B	0.31680	0.335	B	0.28139	0.086	T	0.58951	-0.7545	9	0.56958	D	0.05	-10.0523	19.6609	0.95871	0.0:1.0:0.0:0.0	.	4	Q9NVA4	T184C_HUMAN	I	4	.	ENSP00000296582:T4I	T	+	2	0	TMEM184C	148758568	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.185000	0.77714	2.720000	0.93068	0.557000	0.71058	ACT	.	.	none		0.478	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364644.1	NM_018241	
RFTN1	23180	hgsc.bcm.edu	37	3	16419279	16419279	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:16419279G>A	ENST00000334133.4	-	5	1044	c.772C>T	c.(772-774)Ctg>Ttg	p.L258L	RFTN1_ENST00000432519.1_Silent_p.L222L	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	258					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						GGTCCATCCAGTGTCTTGCTC	0.587																																					p.L258L		Atlas-SNP	.											.	RFTN1	79	.	0			c.C772T						PASS	.						70.0	74.0	73.0					3																	16419279		2203	4300	6503	SO:0001819	synonymous_variant	23180	exon5			CATCCAGTGTCTT	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.772C>T	3.37:g.16419279G>A		113.0	0.0	0		82.0	28.0	0.341463	NM_015150	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Silent	SNP	ENST00000334133.4	37	CCDS33712.1																																																																																			.	.	none		0.587	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
EPHA6	285220	hgsc.bcm.edu	37	3	97251298	97251298	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:97251298G>A	ENST00000514100.1	+	8	715	c.473G>A	c.(472-474)cGg>cAg	p.R158Q	EPHA6_ENST00000442602.2_Missense_Mutation_p.R132Q|EPHA6_ENST00000502694.1_Missense_Mutation_p.R158Q|EPHA6_ENST00000389672.5_Missense_Mutation_p.R766Q	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	672	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CACATGGATCGGCAAAGAAGA	0.438																																					p.R766Q		Atlas-SNP	.											EPHA6,NS,carcinoma,+1,1	EPHA6	439	1	0			c.G2297A						scavenged	.						93.0	90.0	91.0					3																	97251298		1862	4119	5981	SO:0001583	missense	285220	exon11			TGGATCGGCAAAG	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.473G>A	3.37:g.97251298G>A	ENSP00000421711:p.Arg158Gln	96.0	1.0	0.0104167		122.0	27.0	0.221311	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000514100.1	37		.	.	.	.	.	.	.	.	.	.	G	20.5	3.999696	0.74818	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.81889	0.4918	N	0.20304	0.555	0.51767	D	0.999937	P;B;D;P	0.62365	0.508;0.04;0.991;0.568	B;B;P;B	0.52109	0.073;0.019;0.69;0.039	D	0.83686	0.0174	9	0.59425	D	0.04	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	132;671;158;158	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	Q	766;158;158;132	ENSP00000374323:R766Q;ENSP00000421711:R158Q;ENSP00000423950:R158Q;ENSP00000403100:R132Q	ENSP00000374323:R766Q	R	+	2	0	EPHA6	98733988	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.613000	0.54152	2.767000	0.95098	0.563000	0.77884	CGG	.	.	none		0.438	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000359997.1	NM_001080448	
LTBP1	4052	hgsc.bcm.edu	37	2	33614282	33614282	+	Silent	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr2:33614282G>C	ENST00000404816.2	+	32	5096	c.4743G>C	c.(4741-4743)gtG>gtC	p.V1581V	LTBP1_ENST00000407925.1_Silent_p.V1255V|LTBP1_ENST00000418533.2_Silent_p.V1213V|LTBP1_ENST00000272273.5_Silent_p.V479V|LTBP1_ENST00000402934.1_Silent_p.V1200V|LTBP1_ENST00000404525.1_Silent_p.V1202V|LTBP1_ENST00000390003.4_Silent_p.V1256V|LTBP1_ENST00000354476.3_Silent_p.V1582V			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1581					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACATCCCCGTGACGGGACGCC	0.562																																					p.V1581V		Atlas-SNP	.											.	LTBP1	317	.	0			c.G4743C						PASS	.						115.0	103.0	107.0					2																	33614282		2203	4300	6503	SO:0001819	synonymous_variant	4052	exon32			CCCCGTGACGGGA		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4743G>C	2.37:g.33614282G>C		136.0	0.0	0		148.0	48.0	0.324324	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	37	CCDS33177.2																																																																																			.	.	none		0.562	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
SGK1	6446	hgsc.bcm.edu	37	6	134495159	134495159	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:134495159G>A	ENST00000237305.7	-	3	300	c.212C>T	c.(211-213)gCc>gTc	p.A71V	SGK1_ENST00000367858.5_Missense_Mutation_p.A166V|SGK1_ENST00000475719.2_Missense_Mutation_p.A71V|SGK1_ENST00000489458.2_5'UTR|SGK1_ENST00000528577.1_Missense_Mutation_p.A99V|SGK1_ENST00000367857.5_Missense_Mutation_p.A61V|SGK1_ENST00000413996.3_Missense_Mutation_p.A85V	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	71					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		AGAAGGGTTGGCATTCATAAG	0.453																																					p.A166V		Atlas-SNP	.											SGK1_ENST00000528577,NS,lymphoid_neoplasm,0,5	SGK1	387	5	0			c.C497T						PASS	.						152.0	146.0	148.0					6																	134495159		2203	4300	6503	SO:0001583	missense	6446	exon5			GGGTTGGCATTCA	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.212C>T	6.37:g.134495159G>A	ENSP00000237305:p.Ala71Val	92.0	0.0	0		64.0	11.0	0.171875	NM_001143676	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658406	0.47467	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T	0.72835	-0.68;-0.68;-0.68;-0.66;-0.66;-0.69	5.99	5.12	0.69794	.	0.399737	0.30076	N	0.010479	T	0.37293	0.0998	N	0.14661	0.345	0.80722	D	1	B;B;B;B;B;B	0.12630	0.001;0.001;0.001;0.001;0.006;0.0	B;B;B;B;B;B	0.14578	0.004;0.003;0.002;0.005;0.011;0.001	T	0.26950	-1.0088	10	0.25106	T	0.35	.	14.2908	0.66275	0.0:0.0:0.7295:0.2705	.	99;85;71;61;166;71	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	166;85;71;61;99;71;135	ENSP00000356832:A166V;ENSP00000396242:A85V;ENSP00000237305:A71V;ENSP00000356831:A61V;ENSP00000434450:A99V;ENSP00000434302:A71V	ENSP00000237305:A71V	A	-	2	0	SGK1	134536852	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.654000	0.54453	1.523000	0.49018	0.655000	0.94253	GCC	.	.	none		0.453	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
B2M	567	hgsc.bcm.edu	37	15	45003764	45003764	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:45003764T>C	ENST00000558401.1	+	1	90	c.20T>C	c.(19-21)tTa>tCa	p.L7S	PATL2_ENST00000558573.1_5'Flank|B2M_ENST00000559916.1_Missense_Mutation_p.L7S|B2M_ENST00000544417.1_Missense_Mutation_p.L7S	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	7					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)	p.L7S(1)		breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		TCCGTGGCCTTAGCTGTGCTC	0.607																																					p.L7S		Atlas-SNP	.											B2M,NS,lymphoid_neoplasm,0,1	B2M	99	1	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.T20C						scavenged	.						131.0	95.0	107.0					15																	45003764		2198	4298	6496	SO:0001583	missense	567	exon1			TGGCCTTAGCTGT	AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.20T>C	15.37:g.45003764T>C	ENSP00000452780:p.Leu7Ser	118.0	1.0	0.00847458		104.0	24.0	0.230769	NM_004048	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Missense_Mutation	SNP	ENST00000558401.1	37	CCDS10113.1	.	.	.	.	.	.	.	.	.	.	T	11.97	1.798275	0.31777	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	T	0.01422	4.91	5.35	4.22	0.49857	.	2.541080	0.03331	U	0.193423	T	0.04227	0.0117	M	0.73598	2.24	0.09310	N	1	P;P;P	0.46512	0.879;0.808;0.808	P;B;B	0.44394	0.448;0.368;0.368	T	0.44097	-0.9350	10	0.40728	T	0.16	.	8.1935	0.31383	0.0:0.0892:0.0:0.9108	.	7;7;7	F5H6I0;A6XMH4;P61769	.;.;B2MG_HUMAN	S	7	ENSP00000437604:L7S	ENSP00000340858:L7S	L	+	2	0	B2M	42791056	0.006000	0.16342	0.001000	0.08648	0.002000	0.02628	0.889000	0.28282	1.144000	0.42321	0.533000	0.62120	TTA	.	.	none		0.607	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254007.2	NM_004048	
ZBTB2	57621	hgsc.bcm.edu	37	6	151687092	151687092	+	Missense_Mutation	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:151687092C>T	ENST00000325144.4	-	3	1249	c.1109G>A	c.(1108-1110)cGc>cAc	p.R370H		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		GATAAATTTGCGTCCACATAT	0.527																																					p.R370H		Atlas-SNP	.											.	ZBTB2	30	.	0			c.G1109A						PASS	.						114.0	111.0	112.0					6																	151687092		2203	4300	6503	SO:0001583	missense	57621	exon3			AATTTGCGTCCAC	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.1109G>A	6.37:g.151687092C>T	ENSP00000323183:p.Arg370His	354.0	0.0	0		333.0	14.0	0.042042	NM_020861	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	ENST00000325144.4	37	CCDS5231.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155967	0.57259	.	.	ENSG00000181472	ENST00000325144	T	0.61510	0.1	5.76	5.76	0.90799	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.61565	0.2357	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.66268	-0.5966	10	0.87932	D	0	-41.439	19.976	0.97309	0.0:1.0:0.0:0.0	.	370	Q8N680	ZBTB2_HUMAN	H	370	ENSP00000323183:R370H	ENSP00000323183:R370H	R	-	2	0	ZBTB2	151728785	1.000000	0.71417	0.998000	0.56505	0.912000	0.54170	7.704000	0.84595	2.713000	0.92767	0.655000	0.94253	CGC	.	.	none		0.527	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
CD93	22918	hgsc.bcm.edu	37	20	23065878	23065878	+	Missense_Mutation	SNP	C	C	T	rs140540216		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr20:23065878C>T	ENST00000246006.4	-	1	1099	c.952G>A	c.(952-954)Gtc>Atc	p.V318I		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	318	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.		V -> A. {ECO:0000269|PubMed:11781389}.		macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GGTCCCAGGACGCACGTGGCC	0.637																																					p.V318I		Atlas-SNP	.											CD93,colon,carcinoma,0,1	CD93	84	1	0			c.G952A						PASS	.						39.0	43.0	42.0					20																	23065878		2203	4300	6503	SO:0001583	missense	22918	exon1			CCAGGACGCACGT	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.952G>A	20.37:g.23065878C>T	ENSP00000246006:p.Val318Ile	167.0	0.0	0		150.0	27.0	0.18	NM_012072	O00274	Missense_Mutation	SNP	ENST00000246006.4	37	CCDS13149.1	.	.	.	.	.	.	.	.	.	.	T	1.767	-0.485219	0.04352	.	.	ENSG00000125810	ENST00000246006	D	0.87412	-2.25	5.42	-2.28	0.06826	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.855870	0.02965	N	0.143707	T	0.75591	0.3870	N	0.25647	0.755	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.59215	-0.7496	10	0.12103	T	0.63	-4.8249	3.9396	0.09321	0.0988:0.4634:0.0974:0.3404	.	318	Q9NPY3	C1QR1_HUMAN	I	318	ENSP00000246006:V318I	ENSP00000246006:V318I	V	-	1	0	CD93	23013878	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.089000	0.01357	-0.557000	0.06126	-1.014000	0.02459	GTC	C|1.000;A|0.000	.	alt		0.637	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
TMEM200A	114801	hgsc.bcm.edu	37	6	130761752	130761752	+	Missense_Mutation	SNP	G	G	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:130761752G>T	ENST00000296978.3	+	3	1056	c.185G>T	c.(184-186)gGt>gTt	p.G62V	TMEM200A_ENST00000545622.1_Missense_Mutation_p.G62V|TMEM200A_ENST00000392429.1_Missense_Mutation_p.G62V	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	62						integral component of membrane (GO:0016021)		p.G62A(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		TCCCCATCTGGTTTTTTTCTT	0.473																																					p.G62V		Atlas-SNP	.											TMEM200A,NS,carcinoma,0,2	TMEM200A	108	2	2	Substitution - Missense(2)	kidney(2)	c.G185T						PASS	.						113.0	115.0	114.0					6																	130761752		2203	4300	6503	SO:0001583	missense	114801	exon3			CATCTGGTTTTTT	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.185G>T	6.37:g.130761752G>T	ENSP00000296978:p.Gly62Val	162.0	0.0	0		207.0	37.0	0.178744	NM_001258277	Q96PX5	Missense_Mutation	SNP	ENST00000296978.3	37	CCDS5140.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787946	0.70337	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.76147	0.3947	M	0.73217	2.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78499	-0.2180	9	0.87932	D	0	.	19.305	0.94157	0.0:0.0:1.0:0.0	.	62	Q86VY9	T200A_HUMAN	V	62	.	ENSP00000296978:G62V	G	+	2	0	TMEM200A	130803445	1.000000	0.71417	0.950000	0.38849	0.599000	0.36880	9.809000	0.99208	2.547000	0.85894	0.655000	0.94253	GGT	.	.	none		0.473	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042201.1	NM_052913	
ANK2	287	hgsc.bcm.edu	37	4	114294465	114294465	+	Missense_Mutation	SNP	T	T	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:114294465T>G	ENST00000357077.4	+	45	11772	c.11719T>G	c.(11719-11721)Tat>Gat	p.Y3907D	ANK2_ENST00000509550.1_Missense_Mutation_p.Y998D|ANK2_ENST00000394537.3_Missense_Mutation_p.Y1822D|ANK2_ENST00000264366.6_Missense_Mutation_p.Y3874D|ANK2_ENST00000506722.1_Missense_Mutation_p.Y1813D|ANK2_ENST00000510275.2_Missense_Mutation_p.Y505D	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	3907					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CATTAGGCGGTATGTATCCTC	0.383																																					p.Y3907D		Atlas-SNP	.											.	ANK2	576	.	0			c.T11719G						PASS	.						84.0	84.0	84.0					4																	114294465		2203	4300	6503	SO:0001583	missense	287	exon45			AGGCGGTATGTAT	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.11719T>G	4.37:g.114294465T>G	ENSP00000349588:p.Tyr3907Asp	85.0	0.0	0		148.0	25.0	0.168919	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	37	CCDS3702.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.5|24.5	4.542868|4.542868	0.86022|0.86022	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000514960|ENST00000506722;ENST00000431447;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275;ENST00000505342	.|T;T;T;T;T;D;D	.|0.96491	.|-0.33;-0.31;-0.37;-0.38;-1.08;-2.04;-4.03	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.135690	.|0.33553	.|N	.|0.004794	D|D	0.97626|0.97626	0.9222|0.9222	M|M	0.70595|0.70595	2.14|2.14	0.46317|0.46317	D|D	0.998987|0.998987	.|D;D;D;P;D;D	.|0.71674	.|0.963;0.996;0.979;0.892;0.998;0.984	.|P;D;P;P;D;D	.|0.64506	.|0.642;0.919;0.642;0.643;0.917;0.926	D|D	0.97950|0.97950	1.0331|1.0331	5|10	.|0.56958	.|D	.|0.05	.|.	16.6093|16.6093	0.84858|0.84858	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|998;888;854;1822;3907;1813	.|E9PCH6;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5	.|.;.;.;.;.;.	G|D	854|1813;888;1822;3907;3874;1813;998;505;917	.|ENSP00000421067:Y1813D;ENSP00000378044:Y1822D;ENSP00000349588:Y3907D;ENSP00000264366:Y3874D;ENSP00000426944:Y998D;ENSP00000421023:Y505D;ENSP00000422498:Y917D	.|ENSP00000264366:Y3874D	V|Y	+|+	2|1	0|0	ANK2|ANK2	114513914|114513914	0.979000|0.979000	0.34478|0.34478	0.749000|0.749000	0.31150|0.31150	0.846000|0.846000	0.48090|0.48090	4.663000|4.663000	0.61532|0.61532	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	GTA|TAT	.	.	none		0.383	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ADM2	79924	hgsc.bcm.edu	37	22	50921164	50921164	+	Silent	SNP	A	A	C	rs72438078|rs3840963	byFrequency	TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr22:50921164A>C	ENST00000395738.2	+	2	571	c.279A>C	c.(277-279)cgA>cgC	p.R93R	ADM2_ENST00000362068.2_Missense_Mutation_p.E10A|ADM2_ENST00000395737.1_Silent_p.R93R	NM_001253845.1|NM_024866.5	NP_001240774.1|NP_079142.2	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2	93					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|digestion (GO:0007586)|feeding behavior (GO:0007631)|negative regulation of blood pressure (GO:0045776)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)	extracellular region (GO:0005576)	protein complex binding (GO:0032403)	p.H95_R100delHSGPRR(1)		breast(1)|kidney(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGGGCCCCCGAAGACACTCGG	0.697																																					p.R93R		Atlas-SNP	.											ADM2,rectum,carcinoma,0,2	ADM2	15	2	1	Deletion - In frame(1)	breast(1)	c.A279C						PASS	.																																			SO:0001819	synonymous_variant	79924	exon2			CCCCCGAAGACAC	AF529213	CCDS33682.1	22q13.33	2013-02-25			ENSG00000128165	ENSG00000128165		"""Endogenous ligands"""	28898	protein-coding gene	gene with protein product		608682				14706825	Standard	NM_024866		Approved	AM2, FLJ21135	uc003blj.3	Q7Z4H4	OTTHUMG00000150202	ENST00000395738.2:c.279A>C	22.37:g.50921164A>C		47.0	0.0	0		36.0	10.0	0.277778	NM_024866	Q3LFQ0	Silent	SNP	ENST00000395738.2	37	CCDS33682.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.058801	0.55325	.	.	ENSG00000128165	ENST00000362068	.	.	.	4.21	-5.89	0.02282	.	.	.	.	.	T	0.08670	0.0215	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35151	-0.9800	5	0.08381	T	0.77	.	0.8616	0.01194	0.2188:0.3176:0.2553:0.2083	.	.	.	.	A	10	.	ENSP00000354955:E10A	E	+	2	0	ADM2	49268030	0.000000	0.05858	0.002000	0.10522	0.479000	0.33129	-1.143000	0.03200	-0.430000	0.07318	0.368000	0.22195	GAA	.	.	none		0.697	ADM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316816.1	NM_024866	
ZFAT	57623	hgsc.bcm.edu	37	8	135613905	135613905	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr8:135613905G>A	ENST00000377838.3	-	6	2231	c.2057C>T	c.(2056-2058)cCt>cTt	p.P686L	ZFAT_ENST00000520727.1_Missense_Mutation_p.P674L|ZFAT_ENST00000523399.1_Missense_Mutation_p.P624L|ZFAT_ENST00000520356.1_Missense_Mutation_p.P674L|ZFAT_ENST00000520214.1_Missense_Mutation_p.P674L|ZFAT_ENST00000429442.2_Missense_Mutation_p.P674L|ZFAT-AS1_ENST00000505776.1_RNA	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	686					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AGCTACTGGAGGGAGGAGGTC	0.597																																					p.P686L		Atlas-SNP	.											.	ZFAT	265	.	0			c.C2057T						PASS	.						68.0	73.0	72.0					8																	135613905		2041	4199	6240	SO:0001583	missense	57623	exon6			ACTGGAGGGAGGA	BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.2057C>T	8.37:g.135613905G>A	ENSP00000367069:p.Pro686Leu	131.0	0.0	0		111.0	5.0	0.045045	NM_020863	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	ENST00000377838.3	37	CCDS47924.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235411	0.22626	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399;ENST00000398946	T;T;T;T;T;T	0.09911	3.0;2.93;2.93;2.93;2.93;2.96	5.0	4.12	0.48240	.	0.066393	0.64402	D	0.000013	T	0.07683	0.0193	L	0.27053	0.805	0.09310	N	0.999997	B;B;B;B	0.25272	0.016;0.004;0.122;0.001	B;B;B;B	0.28305	0.009;0.004;0.088;0.002	T	0.33445	-0.9868	10	0.24483	T	0.36	-8.8579	8.1168	0.30948	0.2492:0.0:0.7508:0.0	.	624;674;674;686	E9PER3;E9PBN4;Q9P243-3;Q9P243	.;.;.;ZFAT_HUMAN	L	674;674;674;686;674;573;624;674	ENSP00000427879:P674L;ENSP00000427831:P674L;ENSP00000394501:P674L;ENSP00000367069:P686L;ENSP00000428483:P674L;ENSP00000429091:P624L	ENSP00000326997:P573L	P	-	2	0	ZFAT	135683087	0.003000	0.15002	0.039000	0.18376	0.809000	0.45718	1.438000	0.35002	1.327000	0.45338	0.561000	0.74099	CCT	.	.	none		0.597	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378272.1	NM_001029939	
MYH11	4629	hgsc.bcm.edu	37	16	15880586	15880586	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:15880586G>A	ENST00000300036.5	-	5	643	c.534C>T	c.(532-534)ggC>ggT	p.G178G	MYH11_ENST00000576790.2_Silent_p.G178G|MYH11_ENST00000396324.3_Silent_p.G178G|MYH11_ENST00000452625.2_Silent_p.G178G	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	178	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTCCAGACTCGCCTCTGAAAG	0.522			T	CBFB	AML																																p.G178G		Atlas-SNP	.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	520	.	0			c.C534T						PASS	.						107.0	86.0	93.0					16																	15880586		2197	4300	6497	SO:0001819	synonymous_variant	4629	exon5			AGACTCGCCTCTG	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.534C>T	16.37:g.15880586G>A		160.0	0.0	0		178.0	47.0	0.264045	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																			.	.	none		0.522	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
BCL11B	64919	hgsc.bcm.edu	37	14	99641016	99641016	+	Silent	SNP	C	C	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr14:99641016C>G	ENST00000357195.3	-	4	2166	c.2157G>C	c.(2155-2157)cgG>cgC	p.R719R	BCL11B_ENST00000345514.2_Silent_p.R648R|BCL11B_ENST00000443726.2_Silent_p.R525R	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	719					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		TCATGAAGTGCCGCGACGCCG	0.667			T	TLX3	T-ALL																																p.R719R		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,NS,carcinoma,-2,1	BCL11B	108	1	0			c.G2157C						PASS	.						23.0	20.0	21.0					14																	99641016		2198	4295	6493	SO:0001819	synonymous_variant	64919	exon4			GAAGTGCCGCGAC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.2157G>C	14.37:g.99641016C>G		61.0	0.0	0		28.0	7.0	0.25	NM_138576	Q9H162	Silent	SNP	ENST00000357195.3	37	CCDS9950.1																																																																																			.	.	none		0.667	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
MAP2K1	5604	hgsc.bcm.edu	37	15	66727441	66727441	+	Missense_Mutation	SNP	T	T	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr15:66727441T>C	ENST00000307102.5	+	2	688	c.157T>C	c.(157-159)Ttt>Ctt	p.F53L		NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	53			F -> S (in CFC3). {ECO:0000269|PubMed:16439621}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)	p.F53L(2)|p.F53S(1)		endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	CCTTGAGGCCTTTCTTACCCA	0.547																																					p.F53L		Atlas-SNP	.											MAP2K1,rectum,carcinoma,0,3	MAP2K1	115	3	3	Substitution - Missense(3)	lung(2)|large_intestine(1)	c.T157C						scavenged	.						155.0	146.0	149.0					15																	66727441		2201	4299	6500	SO:0001583	missense	5604	exon2			GAGGCCTTTCTTA	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.157T>C	15.37:g.66727441T>C	ENSP00000302486:p.Phe53Leu	88.0	1.0	0.0113636		94.0	26.0	0.276596	NM_002755		Missense_Mutation	SNP	ENST00000307102.5	37	CCDS10216.1	.	.	.	.	.	.	.	.	.	.	T	35	5.500444	0.96355	.	.	ENSG00000169032	ENST00000307102	D	0.93019	-3.15	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	M	0.76170	2.325	0.80722	D	1	D;D	0.61080	0.989;0.98	P;P	0.59115	0.852;0.805	D	0.93980	0.7257	10	0.26408	T	0.33	-14.6287	14.0473	0.64712	0.0:0.0:0.0:1.0	.	31;53	B4DFY5;Q02750	.;MP2K1_HUMAN	L	53	ENSP00000302486:F53L	ENSP00000302486:F53L	F	+	1	0	MAP2K1	64514495	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.924000	0.87555	1.911000	0.55334	0.383000	0.25322	TTT	.	.	none		0.547	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
ZBTB12	221527	hgsc.bcm.edu	37	6	31868698	31868698	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:31868698G>A	ENST00000375527.2	-	2	560	c.385C>T	c.(385-387)Ccc>Tcc	p.P129S	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	129					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						CCTATTTTGGGCTCAATGAAC	0.582																																					p.P129S		Atlas-SNP	.											.	ZBTB12	25	.	0			c.C385T						PASS	.						74.0	73.0	74.0					6																	31868698		2203	4300	6503	SO:0001583	missense	221527	exon2			TTTTGGGCTCAAT	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.385C>T	6.37:g.31868698G>A	ENSP00000364677:p.Pro129Ser	127.0	0.0	0		101.0	51.0	0.504951	NM_181842	B0UY00|Q5JQ98	Missense_Mutation	SNP	ENST00000375527.2	37	CCDS4727.1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266422	0.59540	.	.	ENSG00000204366	ENST00000375527	T	0.14766	2.48	4.38	3.51	0.40186	.	0.071421	0.56097	U	0.000028	T	0.09335	0.0230	N	0.19112	0.55	0.45066	D	0.998089	D	0.69078	0.997	D	0.68765	0.96	T	0.19289	-1.0310	10	0.19590	T	0.45	.	11.2674	0.49118	0.0928:0.0:0.9072:0.0	.	129	Q9Y330	ZBT12_HUMAN	S	129	ENSP00000364677:P129S	ENSP00000364677:P129S	P	-	1	0	ZBTB12	31976677	1.000000	0.71417	0.991000	0.47740	0.967000	0.64934	6.542000	0.73869	0.823000	0.34589	0.423000	0.28283	CCC	.	.	none		0.582	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842	
MTUS2	23281	hgsc.bcm.edu	37	13	30054459	30054459	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:30054459C>T	ENST00000380808.2	+	3	510	c.294C>T	c.(292-294)caC>caT	p.H98H	MTUS2_ENST00000431530.3_Silent_p.H1129H|MTUS2-AS1_ENST00000587588.1_RNA|MTUS2_ENST00000542829.1_Silent_p.H8H|MTUS2-AS1_ENST00000323380.5_RNA	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1119						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGGAGGAGCACGGTGACCAGC	0.667																																					p.H1129H		Atlas-SNP	.											.	MTUS2	279	.	0			c.C3387T						PASS	.						11.0	15.0	14.0					13																	30054459		2064	4188	6252	SO:0001819	synonymous_variant	23281	exon8			GGAGCACGGTGAC	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.294C>T	13.37:g.30054459C>T		169.0	0.0	0		168.0	26.0	0.154762	NM_001033602	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	ENST00000380808.2	37	CCDS41874.1																																																																																			.	.	none		0.667	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044335.2	XM_166270	
TRIM38	10475	hgsc.bcm.edu	37	6	25983696	25983696	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:25983696T>A	ENST00000357085.3	+	8	1655	c.1179T>A	c.(1177-1179)taT>taA	p.Y393*	TRIM38_ENST00000349458.3_Nonsense_Mutation_p.Y393*|U91328.21_ENST00000608931.1_RNA	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	393	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						AGAAAGGCTATGTAGCACTTA	0.478																																					p.Y393X		Atlas-SNP	.											.	TRIM38	50	.	0			c.T1179A						PASS	.						124.0	122.0	123.0					6																	25983696		2203	4300	6503	SO:0001587	stop_gained	10475	exon8			AGGCTATGTAGCA	U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.1179T>A	6.37:g.25983696T>A	ENSP00000349596:p.Tyr393*	138.0	0.0	0		170.0	61.0	0.358824	NM_006355	B2R862	Nonsense_Mutation	SNP	ENST00000357085.3	37	CCDS4568.1	.	.	.	.	.	.	.	.	.	.	t	27.6	4.847153	0.91277	.	.	ENSG00000112343	ENST00000540262;ENST00000349458;ENST00000357085	.	.	.	4.25	0.426	0.16479	.	0.336568	0.21891	N	0.067596	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4119	0.27021	0.0:0.455:0.0:0.545	.	.	.	.	X	393	.	ENSP00000230099:Y393X	Y	+	3	2	TRIM38	26091675	0.000000	0.05858	0.001000	0.08648	0.227000	0.25037	-0.723000	0.04952	0.067000	0.16545	0.533000	0.62120	TAT	.	.	none		0.478	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040076.2		
HIST1H1A	3024	hgsc.bcm.edu	37	6	26017331	26017331	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:26017331C>T	ENST00000244573.3	-	1	709	c.630G>A	c.(628-630)gcG>gcA	p.A210A		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	210					nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						TCTTGGGTGCCGCTTTCTTGG	0.463																																					p.A210A		Atlas-SNP	.											.	HIST1H1A	25	.	0			c.G630A						PASS	.						106.0	109.0	108.0					6																	26017331		2203	4300	6503	SO:0001819	synonymous_variant	3024	exon1			GGGTGCCGCTTTC	AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.630G>A	6.37:g.26017331C>T		252.0	0.0	0		245.0	104.0	0.42449	NM_005325	Q3MJ34	Silent	SNP	ENST00000244573.3	37	CCDS4569.1																																																																																			.	.	none		0.463	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
RAF1	5894	hgsc.bcm.edu	37	3	12627290	12627290	+	Missense_Mutation	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:12627290G>A	ENST00000251849.4	-	14	1865	c.1426C>T	c.(1426-1428)Ctc>Ttc	p.L476F	RAF1_ENST00000442415.2_Missense_Mutation_p.L496F|RAF1_ENST00000542177.1_Missense_Mutation_p.L395F|RAF1_ENST00000534997.1_Missense_Mutation_p.L261F	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	476	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCTTCATGGAGAAATATATCT	0.388			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.L476F		Atlas-SNP	.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	66	.	0			c.C1426T						PASS	.						96.0	95.0	95.0					3																	12627290		2203	4300	6503	SO:0001583	missense	5894	exon14	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CATGGAGAAATAT	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1426C>T	3.37:g.12627290G>A	ENSP00000251849:p.Leu476Phe	58.0	0.0	0		61.0	15.0	0.245902	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160558	0.78226	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.26	5.26	0.73747	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93106	0.7805	M	0.82923	2.615	0.80722	D	1	D;D;D	0.89917	0.985;0.985;1.0	D;D;D	0.87578	0.983;0.946;0.998	D	0.93639	0.6963	10	0.87932	D	0	.	19.0661	0.93110	0.0:0.0:1.0:0.0	.	395;261;476	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	F	476;496;355;261;395	ENSP00000251849:L476F;ENSP00000401888:L496F;ENSP00000398591:L355F;ENSP00000441186:L261F;ENSP00000443567:L395F	ENSP00000251849:L476F	L	-	1	0	RAF1	12602290	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.135000	0.71696	2.746000	0.94184	0.655000	0.94253	CTC	.	.	none		0.388	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
ARL8A	127829	hgsc.bcm.edu	37	1	202113679	202113679	+	Silent	SNP	G	G	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:202113679G>A	ENST00000272217.2	-	1	190	c.22C>T	c.(22-24)Ctg>Ttg	p.L8L		NM_001256129.1|NM_138795.3	NP_001243058.1|NP_620150.1	Q96BM9	ARL8A_HUMAN	ADP-ribosylation factor-like 8A	8					chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|mitotic nuclear division (GO:0007067)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						CAGTCCAGCAGCTTGTTGAAC	0.677																																					p.L8L		Atlas-SNP	.											.	ARL8A	14	.	0			c.C22T						PASS	.						79.0	63.0	69.0					1																	202113679		2203	4300	6503	SO:0001819	synonymous_variant	127829	exon1			CCAGCAGCTTGTT	BC015408	CCDS1421.1, CCDS73004.1	1q32.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000143862	ENSG00000143862		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25192	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10B"""	ARL10B		8889548	Standard	NM_001256129		Approved	FLJ45195, Gie2	uc001gxk.2	Q96BM9	OTTHUMG00000035923	ENST00000272217.2:c.22C>T	1.37:g.202113679G>A		25.0	0.0	0		29.0	7.0	0.241379	NM_138795	B3KXD0	Silent	SNP	ENST00000272217.2	37	CCDS1421.1																																																																																			.	.	none		0.677	ARL8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087493.1	NM_138795	
SYT14	255928	hgsc.bcm.edu	37	1	210334267	210334267	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr1:210334267G>C	ENST00000472886.1	+	8	1562	c.1548G>C	c.(1546-1548)atG>atC	p.M516I	SYT14_ENST00000367015.1_Missense_Mutation_p.M478I|SYT14_ENST00000422431.1_Missense_Mutation_p.M580I|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000399639.2_3'UTR|SYT14_ENST00000534859.1_Missense_Mutation_p.M542I|SYT14_ENST00000537238.1_Missense_Mutation_p.M478I|SYT14_ENST00000367019.1_Missense_Mutation_p.M535I			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	516	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		GAAAAGAGATGATAGGCTGGA	0.398																																					p.M580I		Atlas-SNP	.											.	SYT14	89	.	0			c.G1740C						PASS	.						139.0	134.0	135.0					1																	210334267		2203	4300	6503	SO:0001583	missense	255928	exon10			AGAGATGATAGGC	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1548G>C	1.37:g.210334267G>C	ENSP00000418901:p.Met516Ile	121.0	0.0	0		151.0	26.0	0.172185	NM_001146261	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	37	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747320	0.49257	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.54	5.54	0.83059	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.039837	0.85682	D	0.000000	T	0.61999	0.2392	L	0.39397	1.21	0.80722	D	1	B;B;B;B	0.24426	0.1;0.057;0.103;0.082	B;B;B;B	0.29077	0.098;0.042;0.059;0.087	T	0.55250	-0.8170	10	0.21014	T	0.42	-22.5444	19.8284	0.96626	0.0:0.0:1.0:0.0	.	563;516;535;580	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	I	580;542;478;535;516;478	ENSP00000389039:M580I;ENSP00000442891:M542I;ENSP00000437423:M478I;ENSP00000355986:M535I;ENSP00000418901:M516I;ENSP00000355982:M478I	ENSP00000355982:M478I	M	+	3	0	SYT14	208400890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.338000	0.96553	2.751000	0.94390	0.585000	0.79938	ATG	.	.	none		0.398	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
RNGTT	8732	hgsc.bcm.edu	37	6	89554108	89554108	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr6:89554108T>A	ENST00000369485.4	-	11	1423	c.1237A>T	c.(1237-1239)Aag>Tag	p.K413*	RNGTT_ENST00000538899.1_Nonsense_Mutation_p.K353*|RNGTT_ENST00000369475.3_Nonsense_Mutation_p.K413*|RNGTT_ENST00000265607.6_Nonsense_Mutation_p.K413*	NM_003800.3	NP_003791.3	O60942	MCE1_HUMAN	RNA guanylyltransferase and 5'-phosphatase	413	GTase.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|RNA processing (GO:0006396)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|mRNA guanylyltransferase activity (GO:0004484)|polynucleotide 5'-phosphatase activity (GO:0004651)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA guanylyltransferase activity (GO:0008192)|triphosphatase activity (GO:0050355)			endometrium(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	21		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)		AAAAACGGCTTATTTCTGACG	0.333																																					p.K413X		Atlas-SNP	.											.	RNGTT	52	.	0			c.A1237T						PASS	.						137.0	136.0	137.0					6																	89554108		2203	4300	6503	SO:0001587	stop_gained	8732	exon11			ACGGCTTATTTCT	AF025654	CCDS5017.1	6q16	2011-06-09			ENSG00000111880	ENSG00000111880	2.7.7.50	"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	10073	protein-coding gene	gene with protein product		603512				9828141, 9512541	Standard	NM_001286428		Approved	HCE, HCE1, hCAP	uc003pmr.2	O60942	OTTHUMG00000015190	ENST00000369485.4:c.1237A>T	6.37:g.89554108T>A	ENSP00000358497:p.Lys413*	61.0	0.0	0		67.0	16.0	0.238806	NM_003800	E1P513|E1P514|O43483|O60257|O60351|Q5TCW8|Q8WUM8	Nonsense_Mutation	SNP	ENST00000369485.4	37	CCDS5017.1	.	.	.	.	.	.	.	.	.	.	T	40	7.950168	0.98577	.	.	ENSG00000111880	ENST00000369485;ENST00000265607;ENST00000538899;ENST00000536746;ENST00000369475	.	.	.	5.7	5.7	0.88788	.	0.119116	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5296	15.9509	0.79835	0.0:0.0:0.0:1.0	.	.	.	.	X	413;413;353;384;413	.	ENSP00000265607:K413X	K	-	1	0	RNGTT	89610827	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.953000	0.87836	2.175000	0.68902	0.460000	0.39030	AAG	.	.	none		0.333	RNGTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041469.1		
SOWAHB	345079	hgsc.bcm.edu	37	4	77818940	77818940	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr4:77818940C>T	ENST00000334306.2	-	1	62	c.63G>A	c.(61-63)gtG>gtA	p.V21V		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	21																	CAGCGTTGGTCACGCGGCCCC	0.657																																					p.V21V		Atlas-SNP	.											.	.	.	.	0			c.G63A						PASS	.						24.0	26.0	25.0					4																	77818940		2201	4300	6501	SO:0001819	synonymous_variant	345079	exon1			GTTGGTCACGCGG		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.63G>A	4.37:g.77818940C>T		31.0	0.0	0		41.0	10.0	0.243902	NM_001029870	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			.	.	none		0.657	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
ATP2C2	9914	hgsc.bcm.edu	37	16	84473085	84473085	+	Missense_Mutation	SNP	A	A	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr16:84473085A>T	ENST00000262429.4	+	13	1253	c.1164A>T	c.(1162-1164)gaA>gaT	p.E388D	ATP2C2_ENST00000416219.2_Missense_Mutation_p.E388D|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	388					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CTGCCAATGAAATGACAGTGA	0.512																																					p.E388D		Atlas-SNP	.											.	ATP2C2	75	.	0			c.A1164T						PASS	.						234.0	245.0	242.0					16																	84473085		2145	4254	6399	SO:0001583	missense	9914	exon13			CAATGAAATGACA	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1164A>T	16.37:g.84473085A>T	ENSP00000262429:p.Glu388Asp	144.0	0.0	0		161.0	35.0	0.217391	NM_014861	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.441104	0.63067	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	D;D	0.96619	-4.07;-4.07	4.91	-5.36	0.02689	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.64402	D	0.000003	D	0.97620	0.9220	M	0.90198	3.095	0.40064	D	0.975936	D;D;D;P	0.58970	0.984;0.975;0.963;0.946	P;D;P;D	0.64237	0.898;0.923;0.883;0.923	D	0.97061	0.9771	10	0.87932	D	0	.	15.4601	0.75349	0.2567:0.0:0.7433:0.0	.	388;237;405;388	E7ES94;F8WAA5;O75185-2;O75185	.;.;.;AT2C2_HUMAN	D	388;388;237	ENSP00000397925:E388D;ENSP00000262429:E388D	ENSP00000262429:E388D	E	+	3	2	ATP2C2	83030586	1.000000	0.71417	0.830000	0.32933	0.244000	0.25665	0.514000	0.22786	-0.979000	0.03529	-0.441000	0.05720	GAA	.	.	none		0.512	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
MAGEC1	9947	hgsc.bcm.edu	37	X	140995472	140995472	+	Missense_Mutation	SNP	A	A	G			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:140995472A>G	ENST00000285879.4	+	4	2568	c.2282A>G	c.(2281-2283)gAg>gGg	p.E761G	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	761										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGTTTCCCTGAGAGTCCTCAG	0.542										HNSCC(15;0.026)																											p.E761G		Atlas-SNP	.											.	MAGEC1	317	.	0			c.A2282G						PASS	.						129.0	141.0	137.0					X																	140995472		2203	4300	6503	SO:0001583	missense	9947	exon4			TCCCTGAGAGTCC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2282A>G	X.37:g.140995472A>G	ENSP00000285879:p.Glu761Gly	101.0	0.0	0		82.0	12.0	0.146341	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	-	8.918	0.960479	0.18583	.	.	ENSG00000155495	ENST00000285879	T	0.02552	4.25	1.2	-2.4	0.06583	.	.	.	.	.	T	0.02380	0.0073	N	0.24115	0.695	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.39375	-0.9617	9	0.72032	D	0.01	.	1.9049	0.03275	0.2872:0.2437:0.0:0.4691	.	761	O60732	MAGC1_HUMAN	G	761	ENSP00000285879:E761G	ENSP00000285879:E761G	E	+	2	0	MAGEC1	140823138	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.560000	0.05964	-0.662000	0.05338	0.235000	0.17854	GAG	.	.	none		0.542	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
EPHA3	2042	hgsc.bcm.edu	37	3	89390951	89390951	+	Silent	SNP	C	C	T			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr3:89390951C>T	ENST00000336596.2	+	5	1242	c.1017C>T	c.(1015-1017)acC>acT	p.T339T	EPHA3_ENST00000494014.1_Silent_p.T339T|EPHA3_ENST00000452448.2_Silent_p.T339T	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	339	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TAAACGAGACCTCAGTTATCC	0.403										TSP Lung(6;0.00050)																											p.T339T		Atlas-SNP	.											.	EPHA3	501	.	0			c.C1017T						PASS	.						76.0	79.0	78.0					3																	89390951		2203	4300	6503	SO:0001819	synonymous_variant	2042	exon5			CGAGACCTCAGTT	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1017C>T	3.37:g.89390951C>T		83.0	0.0	0		93.0	4.0	0.0430108	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	37	CCDS2922.1																																																																																			.	.	none		0.403	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
LMO7	4008	hgsc.bcm.edu	37	13	76381767	76381767	+	Missense_Mutation	SNP	G	G	A	rs534047308		TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chr13:76381767G>A	ENST00000321797.8	+	8	1370	c.649G>A	c.(649-651)Gag>Aag	p.E217K	RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Missense_Mutation_p.E502K|LMO7_ENST00000377534.3_Missense_Mutation_p.E502K|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000465261.2_Missense_Mutation_p.E217K			Q8WWI1	LMO7_HUMAN	LIM domain 7	502					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AGATGACCTCGAGATGGCAGC	0.453													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18167	0.0		0.0	False		,,,				2504	0.0				p.E217K		Atlas-SNP	.											.	LMO7	334	.	0			c.G649A						PASS	.						93.0	86.0	88.0					13																	76381767		1568	3582	5150	SO:0001583	missense	4008	exon7			GACCTCGAGATGG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.649G>A	13.37:g.76381767G>A	ENSP00000317802:p.Glu217Lys	67.0	0.0	0		92.0	4.0	0.0434783	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.44|13.44	2.238724|2.238724	0.39598|0.39598	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526528|ENST00000447038	T;T;T;T|.	0.54279|.	0.58;0.58;0.58;0.58|.	5.83|5.83	4.11|4.11	0.48088|0.48088	.|.	0.288711|.	0.37304|.	N|.	0.002146|.	T|T	0.54515|0.54515	0.1863|0.1863	M|M	0.64997|0.64997	1.995|1.995	0.19300|0.19300	N|N	0.999977|0.999977	B;B|.	0.23735|.	0.09;0.022|.	B;B|.	0.11329|.	0.006;0.006|.	T|T	0.45041|0.45041	-0.9288|-0.9288	10|5	0.66056|.	D|.	0.02|.	-4.5653|-4.5653	12.5045|12.5045	0.55973|0.55973	0.1331:0.0:0.8669:0.0|0.1331:0.0:0.8669:0.0	.|.	502;217|.	Q8WWI1;E9PLH4|.	LMO7_HUMAN;.|.	K|Q	502;502;217;217;123|125	ENSP00000349571:E502K;ENSP00000366757:E502K;ENSP00000317802:E217K;ENSP00000433352:E217K|.	ENSP00000317802:E217K|.	E|R	+|+	1|2	0|0	LMO7|LMO7	75279768|75279768	1.000000|1.000000	0.71417|0.71417	0.004000|0.004000	0.12327|0.12327	0.032000|0.032000	0.12392|0.12392	4.278000|4.278000	0.58946|0.58946	0.814000|0.814000	0.34374|0.34374	0.655000|0.655000	0.94253|0.94253	GAG|CGA	.	.	none		0.453	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
TMSB4X	7114	hgsc.bcm.edu	37	X	12994912	12994912	+	Missense_Mutation	SNP	G	G	C			TCGA-FF-8062-01A-11D-2210-10	TCGA-FF-8062-10A-01D-2210-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	bd403458-5154-488b-931a-a7e737a6bf8c	1edee53e-5b0f-44c1-93e4-ad0778e1e147	g.chrX:12994912G>C	ENST00000380635.1	+	3	333	c.117G>C	c.(115-117)aaG>aaC	p.K39N	TMSB4X_ENST00000380633.1_Missense_Mutation_p.K39N|TMSB4X_ENST00000451311.2_Missense_Mutation_p.K39N|TMSB4X_ENST00000380636.1_Missense_Mutation_p.K39N			P62328	TYB4_HUMAN	thymosin beta 4, X-linked	39					actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sequestering of actin monomers (GO:0042989)	cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	poly(A) RNA binding (GO:0044822)			upper_aerodigestive_tract(1)	1						AACAGGAGAAGCAAGCAGGCG	0.393																																					p.K39N		Atlas-SNP	.											.	TMSB4X	3	.	0			c.G117C						PASS	.						56.0	60.0	59.0					X																	12994912		2187	4236	6423	SO:0001583	missense	7114	exon3			GGAGAAGCAAGCA		CCDS35202.1	Xp22.2	2013-05-14	2008-02-25		ENSG00000205542	ENSG00000205542			11881	protein-coding gene	gene with protein product		300159	"""thymosin, beta 4, X chromosome"""	TMSB4		2677145, 9381176	Standard	NM_021109		Approved	TB4X	uc004cvf.3	P62328	OTTHUMG00000021144	ENST00000380635.1:c.117G>C	X.37:g.12994912G>C	ENSP00000370009:p.Lys39Asn	71.0	0.0	0		81.0	15.0	0.185185	NM_021109	P01253|P01254|Q546P5|Q63576|Q9UE55	Missense_Mutation	SNP	ENST00000380635.1	37	CCDS35202.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598583	0.46318	.	.	ENSG00000205542	ENST00000451311;ENST00000380636;ENST00000380635;ENST00000380633	T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22	4.8	4.8	0.61643	.	0.082982	0.46145	U	0.000307	T	0.72590	0.3479	.	.	.	0.39812	D	0.972719	P	0.44260	0.83	P	0.53062	0.717	T	0.76729	-0.2852	9	0.87932	D	0	-4.3082	8.5344	0.33355	0.1781:0.0:0.8219:0.0	.	39	P62328	TYB4_HUMAN	N	39	ENSP00000414376:K39N;ENSP00000370010:K39N;ENSP00000370009:K39N;ENSP00000370007:K39N	ENSP00000370007:K39N	K	+	3	2	TMSB4X	12904833	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.475000	0.66787	2.129000	0.65627	0.600000	0.82982	AAG	.	.	none		0.393	TMSB4X-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000055779.1	NM_021109	
